# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_1 cds 283 477 - GCA001639275_00001 hypothetical protein contig_1 cds 1003 1299 - GCA001639275_00002 hypothetical protein contig_2 cds 16 603 - GCA001639275_00003 hypothetical protein PFAM:PF01609.27, PFAM:PF13359.12 contig_2 cds 576 989 - GCA001639275_00004 hypothetical protein contig_3 cds 311 625 - GCA001639275_00005 hypothetical protein contig_3 cds 691 927 - GCA001639275_00006 hypothetical protein contig_4 cds 14 802 - GCA001639275_00007 hypothetical protein PFAM:PF13358.12 contig_7 cds 508 711 - GCA001639275_00008 hypothetical protein contig_8 cds 206 451 + GCA001639275_00009 hypothetical protein contig_8 cds 460 582 + GCA001639275_00010 hypothetical protein contig_10 cds 671 940 + GCA001639275_00011 hypothetical protein PFAM:PF13358.12 contig_11 cds 705 1724 + GCA001639275_00012 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_11 cds 1735 2877 + GCA001639275_00013 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_11 cds 2870 3985 + GCA001639275_00014 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_11 cds 3989 5245 + GCA001639275_00015 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_11 cds 5256 6578 + GCA001639275_00016 UDP-glucose 6-dehydrogenase SO:0001217, UniRef:UniRef50_A0A4U8UEP1 contig_11 cds 6582 7943 + GCA001639275_00017 hypothetical protein contig_11 cds 7952 9058 + GCA001639275_00018 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_11 cds 9351 9464 + GCA001639275_00019 hypothetical protein contig_11 cds 9595 10272 + GCA001639275_00020 hypothetical protein contig_11 cds 10382 11212 + GCA001639275_00021 ABC transporter, substrate-binding protein, family 3 SO:0001217, UniRef:UniRef50_B1C6W5 contig_11 cds 11240 11890 + GCA001639275_00022 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_F7KSM3 contig_11 cds 11903 12586 + GCA001639275_00023 ABC-type polar amino acid transport system, ATPase component SO:0001217, UniRef:UniRef50_A0A0M6WZM0 contig_11 cds 12798 13784 + GCA001639275_00024 hypothetical protein PFAM:PF13240.11 contig_11 cds 13843 14898 + GCA001639275_00025 hypothetical protein PFAM:PF13240.11 contig_11 cds 14926 15585 + GCA001639275_00026 Uracil-DNA glycosylase SO:0001217, UniRef:UniRef50_P39615 contig_11 cds 15803 16354 - GCA001639275_00027 mntP Putative manganese efflux pump MntP SO:0001217, UniRef:UniRef50_A8MEV0 contig_11 cds 16411 17304 + GCA001639275_00028 hypothetical protein contig_11 cds 17266 17682 - GCA001639275_00029 hypothetical protein PFAM:PF00293.34 contig_11 cds 17730 18050 - GCA001639275_00030 Guanidinium exporter SO:0001217, UniRef:UniRef50_A0A0W0VPM2 contig_11 cds 18183 19151 + GCA001639275_00031 hypothetical protein PFAM:PF01118.30, PFAM:PF02558.23, PFAM:PF02737.24, PFAM:PF03446.21, PFAM:PF07479.19, PFAM:PF20618.3 contig_11 cds 19161 19856 + GCA001639275_00032 hypothetical protein PFAM:PF12804.13 contig_11 cds 19875 20708 + GCA001639275_00033 hypothetical protein PFAM:PF04991.19 contig_11 cds 20722 21552 + GCA001639275_00034 hypothetical protein PFAM:PF04991.19 contig_11 cds 21710 23017 + GCA001639275_00035 hypothetical protein PFAM:PF01467.32, PFAM:PF13714.12 contig_11 cds 23027 23758 + GCA001639275_00036 Phosphodiesterase family protein SO:0001217, UniRef:UniRef50_C8PP49 contig_11 cds 23779 24777 + GCA001639275_00037 hypothetical protein PFAM:PF16363.11 contig_11 cds 24787 25557 + GCA001639275_00038 hypothetical protein PFAM:PF20202.4 contig_11 cds 25559 26740 + GCA001639275_00039 Saccharopine dehydrogenase NADP binding domain-containing protein SO:0001217, UniRef:UniRef50_C9RPC9 contig_11 cds 26756 27880 + GCA001639275_00040 hypothetical protein PFAM:PF02775.26, PFAM:PF02776.23 contig_11 cds 28022 29449 + GCA001639275_00041 hypothetical protein contig_11 cds 29624 29815 + GCA001639275_00042 hypothetical protein contig_11 cds 29818 29970 + GCA001639275_00043 hypothetical protein contig_11 cds 30430 31629 - GCA001639275_00044 hypothetical protein PFAM:PF13635.12 contig_11 cds 31861 32400 + GCA001639275_00045 Glutathione peroxidase SO:0001217, UniRef:UniRef50_C9LIC7 contig_11 cds 32717 32935 + GCA001639275_00046 hypothetical protein PFAM:PF18127.6 contig_11 cds 33007 34131 + GCA001639275_00047 hypothetical protein contig_11 cds 34137 36212 - GCA001639275_00048 hypothetical protein PFAM:PF00037.32, PFAM:PF03460.22, PFAM:PF04432.18, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_11 cds 36771 36995 + GCA001639275_00049 hypothetical protein contig_11 cds 37275 37664 - GCA001639275_00050 hypothetical protein PFAM:PF01850.27 contig_11 cds 37664 37894 - GCA001639275_00051 hypothetical protein PFAM:PF04014.23 contig_11 crispr 38910 41132 ? CRISPR array with 34 repeats of length 28, consensus sequence ATGTTAATCAGACCAATTTGGGATTGAA and spacer length 38 SO:0001459 contig_11 crispr-repeat 38910 38937 ? CRISPR repeat contig_11 crispr-spacer 38938 38973 ? CRISPR spacer, sequence ATGTGTAATGCATCACATATTCACTATCCATGTCAA contig_11 crispr-repeat 38974 39001 ? CRISPR repeat contig_11 crispr-spacer 39002 39039 ? CRISPR spacer, sequence ATATACTAAATCCAGCAGTATCGAGTTTAAATATAGCA contig_11 crispr-repeat 39040 39067 ? CRISPR repeat contig_11 crispr-spacer 39068 39105 ? CRISPR spacer, sequence ATTAAGATAATTAAAATTAAATTAACGAATAACAATAC contig_11 crispr-repeat 39106 39133 ? CRISPR repeat contig_11 crispr-spacer 39134 39171 ? CRISPR spacer, sequence ATGATTATTATAGAGCATCAATGAAAAAATATGCTACA contig_11 crispr-repeat 39172 39199 ? CRISPR repeat contig_11 crispr-spacer 39200 39238 ? CRISPR spacer, sequence ATAATAATGTTATTAAGATTGTAACTAACCATTTTAAGA contig_11 crispr-repeat 39239 39266 ? CRISPR repeat contig_11 crispr-spacer 39267 39304 ? CRISPR spacer, sequence ATTTCCTTTGTAAGTTCATGTTCAACTTTATTTTCATC contig_11 crispr-repeat 39305 39332 ? CRISPR repeat contig_11 crispr-spacer 39333 39370 ? CRISPR spacer, sequence ATTTATTGACCATCTCTTACATATTTTAATTTTCTTAA contig_11 crispr-repeat 39371 39398 ? CRISPR repeat contig_11 crispr-spacer 39399 39436 ? CRISPR spacer, sequence ATATGTATATCAAGAGGCAACTATTGGACAATTCACAT contig_11 crispr-repeat 39437 39464 ? CRISPR repeat contig_11 crispr-spacer 39465 39502 ? CRISPR spacer, sequence ATTTGCTTAAACATGCAAATAAATAATCAAACAATTGA contig_11 crispr-repeat 39503 39530 ? CRISPR repeat contig_11 crispr-spacer 39531 39569 ? CRISPR spacer, sequence ATTAAACCAAGAAAAAAACAAACACCCCCAAAAAACACT contig_11 crispr-repeat 39570 39597 ? CRISPR repeat contig_11 crispr-spacer 39598 39635 ? CRISPR spacer, sequence ATCAACATAGTATAGATGATAAATATACTTATAATCAA contig_11 crispr-repeat 39636 39663 ? CRISPR repeat contig_11 crispr-spacer 39664 39702 ? CRISPR spacer, sequence ATAATTTAGATGGGACACATGGAGCAAGGTATAAATATT contig_11 crispr-repeat 39703 39730 ? CRISPR repeat contig_11 crispr-spacer 39731 39767 ? CRISPR spacer, sequence ATGATTGCTCAACACAAGACCCAGCGACAGCAAAAAA contig_11 crispr-repeat 39768 39795 ? CRISPR repeat contig_11 crispr-spacer 39796 39834 ? CRISPR spacer, sequence ATGGGCGTATCCTAGGATTTTTATCCCCCGGTAATAATA contig_11 crispr-repeat 39835 39862 ? CRISPR repeat contig_11 crispr-spacer 39863 39899 ? CRISPR spacer, sequence ATCAAAAAAAGGAAAGTAGGTATGTTAAGACCTTCAA contig_11 crispr-repeat 39900 39927 ? CRISPR repeat contig_11 crispr-spacer 39928 39967 ? CRISPR spacer, sequence ATTAAAACTCATGAGTATTAATTTTGCCGGAACCTTTAAT contig_11 crispr-repeat 39968 39995 ? CRISPR repeat contig_11 crispr-spacer 39996 40033 ? CRISPR spacer, sequence ATTTATTGACCATCTCTTACATATTTTAATTTTCTTAA contig_11 crispr-repeat 40034 40061 ? CRISPR repeat contig_11 crispr-spacer 40062 40099 ? CRISPR spacer, sequence ATATGTATATCAAGAGGCAACTATTGGACAATTCACAT contig_11 crispr-repeat 40100 40127 ? CRISPR repeat contig_11 crispr-spacer 40128 40165 ? CRISPR spacer, sequence ATTTGCTTAAACATGCAAATAAATAATCAAACAATTGA contig_11 crispr-repeat 40166 40193 ? CRISPR repeat contig_11 crispr-spacer 40194 40227 ? CRISPR spacer, sequence GACTGGTTATTAAGTTGGGCGTCATCTGAAACAT contig_11 crispr-repeat 40228 40255 ? CRISPR repeat contig_11 crispr-spacer 40256 40292 ? CRISPR spacer, sequence ATCTACACATTTCAAAAACAAAAAGCCACATAAGGGG contig_11 crispr-repeat 40293 40320 ? CRISPR repeat contig_11 crispr-spacer 40321 40359 ? CRISPR spacer, sequence ATCCCAATACTCGAAAAGATATCGATATACAAATAGAAA contig_11 crispr-repeat 40360 40387 ? CRISPR repeat contig_11 crispr-spacer 40388 40426 ? CRISPR spacer, sequence ATTAACTATAACCAGGTGGTGACGATGAAATCACAAGTA contig_11 crispr-repeat 40427 40454 ? CRISPR repeat contig_11 crispr-spacer 40455 40492 ? CRISPR spacer, sequence ATATTGATTATAGCCTAGACACAAAACAAAGTAGAACA contig_11 crispr-repeat 40493 40520 ? CRISPR repeat contig_11 crispr-spacer 40521 40561 ? CRISPR spacer, sequence ATGATAAATCCTATCAATATTCTCTGATTTAAGAAAGTGCA contig_11 crispr-repeat 40562 40589 ? CRISPR repeat contig_11 crispr-spacer 40590 40629 ? CRISPR spacer, sequence ATCAGTGGAATAGGTGTAGTCTATTCCATCCTCACTCCCT contig_11 crispr-repeat 40630 40657 ? CRISPR repeat contig_11 crispr-spacer 40658 40695 ? CRISPR spacer, sequence ATTGCTGTACTTGTTGCAAGACAAATACGAGGTGTGAT contig_11 crispr-repeat 40696 40723 ? CRISPR repeat contig_11 crispr-spacer 40724 40762 ? CRISPR spacer, sequence ATAGCCTTGGTAAGCCTAGTAAGAAGAAGAGTGAGGATG contig_11 crispr-repeat 40763 40790 ? CRISPR repeat contig_11 crispr-spacer 40791 40829 ? CRISPR spacer, sequence ATGGATTATATTTAAAAAAAGAAATATTCTAACCTAATA contig_11 crispr-repeat 40830 40857 ? CRISPR repeat contig_11 crispr-spacer 40858 40896 ? CRISPR spacer, sequence ATCCTCAAGAGTGTTATTCACATTCTTCACCTTCTATAA contig_11 crispr-repeat 40897 40924 ? CRISPR repeat contig_11 crispr-spacer 40925 40961 ? CRISPR spacer, sequence ATCAATTCATCATCAGTAATAATCACATCATTACCAG contig_11 crispr-repeat 40962 40989 ? CRISPR repeat contig_11 crispr-spacer 40990 41028 ? CRISPR spacer, sequence ATACACTCAACAAACCTTGCAACTGTACAGCTGTAACCT contig_11 crispr-repeat 41029 41056 ? CRISPR repeat contig_11 crispr-spacer 41057 41094 ? CRISPR spacer, sequence ATTAAATTTTCCCATCAATTTCAAGAAAAACATTGCTT contig_11 crispr-repeat 41095 41122 ? CRISPR repeat contig_11 crispr-spacer 41123 41132 ? CRISPR spacer, sequence ATCATGGATG contig_11 cds 41184 43481 - GCA001639275_00052 hypothetical protein PFAM:PF02687.27 contig_11 cds 43465 44169 - GCA001639275_00053 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_R2RX92 contig_11 cds 44638 45426 + GCA001639275_00054 hypothetical protein contig_11 cds 45445 46236 + GCA001639275_00055 ModB2: putative molybdenum transport system permease protein SO:0001217, UniRef:UniRef50_K0NI36 contig_11 cds 46236 46889 + GCA001639275_00056 hypothetical protein PFAM:PF00005.33 contig_11 cds 47038 47343 + GCA001639275_00057 hypothetical protein PFAM:PF03459.23 contig_11 cds 47358 47834 + GCA001639275_00058 Methylated-DNA--protein-cysteine methyltransferase SO:0001217, UniRef:UniRef50_A0A1M5FE19 contig_11 cds 47954 48511 + GCA001639275_00059 Rubrerythrin family protein SO:0001217, UniRef:UniRef50_A0A9D2IN08 contig_11 cds 49583 50143 + GCA001639275_00060 hypothetical protein contig_11 cds 50255 52783 + GCA001639275_00061 hypothetical protein PFAM:PF13307.12 contig_11 cds 52786 54222 - GCA001639275_00062 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_R8W1Y7 contig_11 cds 54215 54958 - GCA001639275_00063 hypothetical protein contig_11 cds 54967 55548 - GCA001639275_00064 TIGR02185 protein SO:0001217, UniRef:UniRef50_Q24MQ7 contig_20 cds 108 716 - GCA001639275_00065 hypothetical protein PFAM:PF05598.16 contig_21 cds 88 681 - GCA001639275_00066 hypothetical protein PFAM:PF02415.23 contig_22 cds 193 438 + GCA001639275_00067 hypothetical protein contig_22 cds 1894 4407 + GCA001639275_00068 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23 contig_22 cds 4622 5665 + GCA001639275_00069 hypothetical protein PFAM:PF00465.25 contig_22 cds 5666 6103 + GCA001639275_00070 hypothetical protein contig_22 cds 6112 6798 + GCA001639275_00071 hypothetical protein contig_22 cds 6807 7031 + GCA001639275_00072 hypothetical protein contig_22 cds 7061 10039 - GCA001639275_00073 hypothetical protein PFAM:PF02369.22, PFAM:PF05048.19, PFAM:PF13229.12, PFAM:PF13620.12, PFAM:PF17789.7 contig_22 cds 10287 11939 + GCA001639275_00074 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_22 cds 11979 12398 + GCA001639275_00075 hypothetical protein contig_22 cds 12512 14167 - GCA001639275_00076 hypothetical protein PFAM:PF01409.25, PFAM:PF03483.22, PFAM:PF03484.21, PFAM:PF17759.6 contig_22 cds 14183 14539 - GCA001639275_00077 hypothetical protein contig_22 cds 16553 16810 - GCA001639275_00078 hypothetical protein contig_22 cds 17067 17549 - GCA001639275_00079 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_22 cds 17734 19812 - GCA001639275_00080 hypothetical protein PFAM:PF02369.22, PFAM:PF02415.23, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_22 cds 20975 21259 - GCA001639275_00081 hypothetical protein contig_22 cds 21228 21341 - GCA001639275_00082 hypothetical protein contig_22 cds 21376 21597 - GCA001639275_00083 hypothetical protein contig_22 cds 22508 25222 + GCA001639275_00084 hypothetical protein PFAM:PF00133.28, PFAM:PF08264.19 contig_22 cds 25533 26315 + GCA001639275_00085 Rebeccamycin O-methyltransferase SO:0001217, UniRef:UniRef50_A0AAQ1UH95 contig_22 cds 26865 28181 + GCA001639275_00086 hypothetical protein contig_22 cds 28181 28804 + GCA001639275_00087 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_22 cds 28895 29842 + GCA001639275_00088 Cysteine synthase SO:0001217, UniRef:UniRef50_A0A653I4D0 contig_22 cds 29916 30614 + GCA001639275_00089 Serine acetyltransferase SO:0001217, UniRef:UniRef50_A0A3M1HI88 contig_22 cds 30626 31000 + GCA001639275_00090 hypothetical protein PFAM:PF01381.28 contig_22 tRNA 31069 31140 + GCA001639275_00091 trnC tRNA-Cys(gca) SO:0000258 contig_22 cds 31172 32512 + GCA001639275_00092 Cysteine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A1G2FB13 contig_22 cds 32794 34092 + GCA001639275_00093 O-acetyl-L-homoserine sulfhydrylase 1 SO:0001217, UniRef:UniRef50_Q5SK88 contig_22 cds 34132 35316 + GCA001639275_00094 iscS Cysteine desulfurase IscS SO:0001217, UniRef:UniRef50_A0A3B8NMT2 contig_22 cds 35329 35700 + GCA001639275_00095 nifU NIF system FeS cluster assembly NifU N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A0K8JIH9 contig_22 cds 35757 36131 + GCA001639275_00096 hypothetical protein PFAM:PF01880.24 contig_22 cds 36210 36710 + GCA001639275_00097 hypothetical protein contig_22 cds 36727 38985 + GCA001639275_00098 hypothetical protein PFAM:PF00575.29, PFAM:PF01336.31, PFAM:PF01368.27 contig_22 cds 38998 39885 + GCA001639275_00099 hypothetical protein PFAM:PF13240.11, PFAM:PF13248.11 contig_22 cds 39894 40868 + GCA001639275_00100 hypothetical protein contig_22 cds 40870 41151 - GCA001639275_00101 hypothetical protein PFAM:PF14947.12 contig_22 cds 41582 42286 + GCA001639275_00102 hypothetical protein PFAM:PF01876.22 contig_22 cds 42276 42632 + GCA001639275_00103 hypothetical protein contig_22 cds 42840 43604 + GCA001639275_00104 hypothetical protein PFAM:PF00227.31 contig_22 cds 43634 44332 + GCA001639275_00105 hypothetical protein PFAM:PF01172.24, PFAM:PF09377.16, PFAM:PF20268.4 contig_22 cds 44360 45286 + GCA001639275_00106 hypothetical protein PFAM:PF00013.35, PFAM:PF00575.29, PFAM:PF14382.12, PFAM:PF15985.11, PFAM:PF21266.3, PFAM:PF22625.2 contig_22 cds 45312 46010 + GCA001639275_00107 hypothetical protein PFAM:PF01138.27, PFAM:PF03725.20 contig_22 cds 46020 46805 + GCA001639275_00108 hypothetical protein PFAM:PF01138.27, PFAM:PF03725.20 contig_22 cds 46802 47407 - GCA001639275_00109 hypothetical protein PFAM:PF12804.13 contig_22 cds 47404 48162 - GCA001639275_00110 hypothetical protein contig_22 cds 48163 48732 - GCA001639275_00111 hypothetical protein PFAM:PF00398.26, PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF12847.13, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_22 cds 48733 49281 - GCA001639275_00112 ubiX Flavin prenyltransferase UbiX SO:0001217, UniRef:UniRef50_A0A140L3I3 contig_22 cds 49290 50516 - GCA001639275_00113 hypothetical protein contig_22 cds 50523 50831 - GCA001639275_00114 hypothetical protein contig_22 cds 51039 52142 + GCA001639275_00115 Ammonium transporter SO:0001217, UniRef:UniRef50_O66515 contig_23 cds 89 412 + GCA001639275_00116 hypothetical protein contig_25 cds 163 402 + GCA001639275_00117 hypothetical protein contig_27 cds 34 231 - GCA001639275_00118 hypothetical protein contig_28 cds 103 258 - GCA001639275_00119 hypothetical protein contig_28 cds 447 602 - GCA001639275_00120 hypothetical protein contig_33 cds 210 1565 + GCA001639275_00121 hypothetical protein contig_33 cds 1577 1915 - GCA001639275_00122 hypothetical protein contig_33 cds 1920 2567 - GCA001639275_00123 hypothetical protein contig_33 cds 2583 3293 - GCA001639275_00124 hypothetical protein contig_33 cds 3902 5203 + GCA001639275_00125 Phenylacetate-coenzyme A ligase SO:0001217, UniRef:UniRef50_A0A1S7LEF0 contig_33 cds 5212 5643 + GCA001639275_00126 ACT domain-containing protein SO:0001217, UniRef:UniRef50_A0A0U9HLK7 contig_33 cds 8273 9256 - GCA001639275_00127 hypothetical protein PFAM:PF00288.32 contig_33 cds 9423 9923 - GCA001639275_00128 Ferritin SO:0001217, UniRef:UniRef50_A0A238XUQ0 contig_33 cds 10159 10962 + GCA001639275_00129 hypothetical protein PFAM:PF00293.34, PFAM:PF09297.16 contig_33 cds 10946 11713 - GCA001639275_00130 hypothetical protein PFAM:PF00155.27 contig_33 cds 11767 12096 - GCA001639275_00131 Cystathionine beta-lyase SO:0001217, UniRef:UniRef50_A0A3C0VS42 contig_33 cds 12097 12612 - GCA001639275_00132 Albonoursin synthase SO:0001217, UniRef:UniRef50_A0A136WGY7 contig_33 cds 12675 13157 + GCA001639275_00133 hypothetical protein PFAM:PF03729.18 contig_33 cds 13175 14629 - GCA001639275_00134 hypothetical protein PFAM:PF00070.33, PFAM:PF02852.28, PFAM:PF07992.20 contig_33 cds 14642 15919 - GCA001639275_00135 hypothetical protein PFAM:PF00587.30, PFAM:PF02403.27 contig_33 cds 16359 16529 - GCA001639275_00136 hypothetical protein contig_33 cds 16681 17208 - GCA001639275_00137 N-acetyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Y4ENS0 contig_33 cds 17264 17614 - GCA001639275_00138 Arsenate reductase SO:0001217, UniRef:UniRef50_D5DVB1 contig_33 cds 17677 17961 + GCA001639275_00139 hypothetical protein contig_33 cds 17988 18782 - GCA001639275_00140 hypothetical protein PFAM:PF00142.24, PFAM:PF01656.29, PFAM:PF13614.12 contig_33 cds 18775 20022 - GCA001639275_00141 hypothetical protein contig_33 cds 20028 21449 - GCA001639275_00142 Amidophosphoribosyltransferase SO:0001217, UniRef:UniRef50_M1LPX2 contig_33 cds 21564 22373 - GCA001639275_00143 hypothetical protein contig_33 cds 22349 23314 - GCA001639275_00144 UDP-glucose 4-epimerase SO:0001217, UniRef:UniRef50_P26503 contig_33 cds 23324 24502 - GCA001639275_00145 hypothetical protein PFAM:PF01266.30, PFAM:PF07992.20, PFAM:PF13450.12, PFAM:PF22578.2 contig_33 cds 24507 24674 - GCA001639275_00146 hypothetical protein PFAM:PF00037.32, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11 contig_33 cds 24827 25252 - GCA001639275_00147 hypothetical protein PFAM:PF00582.32 contig_33 cds 25253 26959 - GCA001639275_00148 hypothetical protein PFAM:PF00005.33, PFAM:PF00931.28, PFAM:PF02463.25, PFAM:PF03215.21, PFAM:PF05621.17, PFAM:PF09818.15, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13555.12, PFAM:PF20720.3 contig_33 cds 27160 29829 - GCA001639275_00149 hypothetical protein PFAM:PF02663.19 contig_33 cds 29845 29979 - GCA001639275_00150 hypothetical protein contig_33 cds 29936 30103 - GCA001639275_00151 hypothetical protein contig_33 cds 30093 30734 - GCA001639275_00152 hypothetical protein PFAM:PF01613.24 contig_33 cds 30739 31524 - GCA001639275_00153 cooC CO dehydrogenase/acetyl-CoA synthase complex, accessory protein CooC SO:0001217, UniRef:UniRef50_K4LC99 contig_33 cds 32046 32156 - GCA001639275_00154 hypothetical protein contig_33 cds 32574 32870 + GCA001639275_00155 hypothetical protein PFAM:PF01909.29, PFAM:PF18765.7 contig_33 cds 32857 32979 + GCA001639275_00156 hypothetical protein contig_33 cds 33123 33419 + GCA001639275_00157 hypothetical protein contig_33 cds 33416 33958 - GCA001639275_00158 hypothetical protein contig_33 cds 34049 35821 - GCA001639275_00159 hypothetical protein PFAM:PF01541.30, PFAM:PF08459.17, PFAM:PF12826.13, PFAM:PF14520.12, PFAM:PF22920.2 contig_33 cds 35808 42389 - GCA001639275_00160 hypothetical protein PFAM:PF13086.12, PFAM:PF13087.12, PFAM:PF13245.12, PFAM:PF13604.12, PFAM:PF18741.7 contig_33 cds 42647 43027 - GCA001639275_00161 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12 contig_33 cds 43055 43960 - GCA001639275_00162 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13181.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF14559.12 contig_33 cds 43987 44217 - GCA001639275_00163 hypothetical protein contig_33 cds 44290 44880 - GCA001639275_00164 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14853.12, PFAM:PF25062.1 contig_33 cds 45228 46001 - GCA001639275_00165 hypothetical protein contig_33 cds 46159 46977 - GCA001639275_00166 hypothetical protein PFAM:PF00294.29 contig_33 cds 47000 47881 - GCA001639275_00167 pdxS Pyridoxal 5'-phosphate synthase subunit PdxS SO:0001217, UniRef:UniRef50_P37527 contig_33 cds 47970 48179 - GCA001639275_00168 hypothetical protein contig_33 cds 48206 48892 - GCA001639275_00169 hypothetical protein contig_33 cds 49276 49506 + GCA001639275_00170 hypothetical protein contig_33 cds 49863 50225 - GCA001639275_00171 hypothetical protein contig_33 cds 50283 50459 + GCA001639275_00172 hypothetical protein contig_37 cds 7 531 - GCA001639275_00173 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11 contig_39 cds 51 533 + GCA001639275_00174 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_41 cds 175 849 - GCA001639275_00175 hypothetical protein contig_41 cds 1155 1604 - GCA001639275_00176 hypothetical protein contig_41 cds 1892 2377 - GCA001639275_00177 trmO tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO SO:0001217, UniRef:UniRef50_A0A6P1ZCM4 contig_41 cds 2584 2790 + GCA001639275_00178 Molybdenum-pterin-binding protein 2 SO:0001217, UniRef:UniRef50_P08854 contig_41 cds 2956 3393 - GCA001639275_00179 hypothetical protein contig_41 cds 3403 3942 - GCA001639275_00180 hypothetical protein PFAM:PF01467.32 contig_41 cds 3959 4663 - GCA001639275_00181 hypothetical protein contig_41 cds 4795 5454 + GCA001639275_00182 hypothetical protein contig_41 cds 5456 5971 + GCA001639275_00183 hypothetical protein PFAM:PF04034.18 contig_41 cds 6131 6277 + GCA001639275_00184 hypothetical protein contig_41 cds 6386 7138 + GCA001639275_00185 hypothetical protein PFAM:PF01884.23 contig_41 cds 7202 8269 + GCA001639275_00186 hypothetical protein PFAM:PF09376.16 contig_41 cds 8275 9780 + GCA001639275_00187 hypothetical protein PFAM:PF01935.23, PFAM:PF05872.18, PFAM:PF09378.16 contig_41 cds 9925 10650 + GCA001639275_00188 hypothetical protein contig_41 cds 10879 12093 + GCA001639275_00189 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_41 cds 12090 14840 + GCA001639275_00190 hypothetical protein PFAM:PF02463.25, PFAM:PF04423.19, PFAM:PF13304.12, PFAM:PF13476.12, PFAM:PF13514.12, PFAM:PF13555.12 contig_41 cds 15112 15507 - GCA001639275_00191 hypothetical protein contig_41 cds 15606 16886 + GCA001639275_00192 hypothetical protein PFAM:PF08245.18 contig_41 cds 16965 18152 + GCA001639275_00193 hypothetical protein contig_41 cds 18176 18829 + GCA001639275_00194 hypothetical protein PFAM:PF12804.13 contig_41 cds 18832 19506 - GCA001639275_00195 hypothetical protein contig_41 cds 19534 20769 - GCA001639275_00196 hypothetical protein PFAM:PF12705.13 contig_41 cds 20782 23232 - GCA001639275_00197 hypothetical protein PFAM:PF00270.35, PFAM:PF00580.27, PFAM:PF13086.12, PFAM:PF13245.12, PFAM:PF13361.12 contig_41 cds 23406 23729 + GCA001639275_00198 hypothetical protein contig_41 cds 23956 26826 + GCA001639275_00199 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF07719.23, PFAM:PF09369.15, PFAM:PF14559.12, PFAM:PF22982.3 contig_41 cds 27056 28192 - GCA001639275_00200 hypothetical protein PFAM:PF00248.27, PFAM:PF13237.11 contig_41 cds 28420 28797 + GCA001639275_00201 hypothetical protein PFAM:PF01155.25 contig_41 cds 28811 29467 + GCA001639275_00202 hypothetical protein PFAM:PF02492.25, PFAM:PF03308.22 contig_41 cds 29485 30516 + GCA001639275_00203 hypothetical protein contig_41 tRNA 30567 30639 + GCA001639275_00204 trnA tRNA-Ala(ggc) SO:0000254 contig_41 cds 30682 31764 + GCA001639275_00205 hypothetical protein contig_41 cds 31777 32229 + GCA001639275_00206 hypothetical protein PFAM:PF09001.16 contig_41 cds 32234 32539 + GCA001639275_00207 hypothetical protein PFAM:PF08979.16 contig_41 cds 32546 33487 + GCA001639275_00208 hypothetical protein PFAM:PF01717.24 contig_41 cds 33614 34366 - GCA001639275_00209 cbiF Cobalt-precorrin 4 C11-methyltransferase CbiF SO:0001217, UniRef:UniRef50_W8T9L4 contig_41 cds 34465 34854 + GCA001639275_00210 hypothetical protein contig_41 cds 34851 35351 + GCA001639275_00211 hypothetical protein contig_41 cds 35398 35766 + GCA001639275_00212 hypothetical protein contig_41 cds 35756 36517 - GCA001639275_00213 hypothetical protein PFAM:PF01026.27 contig_41 cds 36523 37287 - GCA001639275_00214 hypothetical protein contig_41 cds 37339 38055 - GCA001639275_00215 hypothetical protein contig_41 cds 38250 38771 + GCA001639275_00216 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_41 cds 39823 40062 + GCA001639275_00217 hypothetical protein contig_41 cds 40055 40465 + GCA001639275_00218 hypothetical protein PFAM:PF01850.27 contig_41 cds 40891 41208 + GCA001639275_00219 hypothetical protein PFAM:PF01096.23 contig_41 cds 41244 42806 + GCA001639275_00220 hypothetical protein PFAM:PF02080.26 contig_41 cds 43405 44376 + GCA001639275_00221 hypothetical protein PFAM:PF02289.21 contig_41 cds 44477 44713 + GCA001639275_00222 hypothetical protein contig_41 cds 44902 45027 + GCA001639275_00223 hypothetical protein contig_42 cds 255 1394 + GCA001639275_00224 hypothetical protein contig_42 cds 1400 1870 + GCA001639275_00225 tRNA(adenine(34)) deaminase SO:0001217, UniRef:UniRef50_A0A6N8J6I0 contig_42 cds 1940 3523 - GCA001639275_00226 hypothetical protein PFAM:PF19269.4 contig_42 cds 3638 4936 - GCA001639275_00227 Phosphomethylpyrimidine synthase SO:0001217, UniRef:UniRef50_Q39RJ6 contig_42 cds 5181 6095 - GCA001639275_00228 hypothetical protein PFAM:PF00294.29 contig_42 cds 6259 7128 - GCA001639275_00229 hypothetical protein PFAM:PF00126.33 contig_42 cds 7205 7795 + GCA001639275_00230 hypothetical protein PFAM:PF01380.27, PFAM:PF13580.11 contig_42 cds 8227 9015 + GCA001639275_00231 Formate/nitrite transporter family protein SO:0001217, UniRef:UniRef50_A0A7V9KEM3 contig_42 cds 9076 11220 + GCA001639275_00232 fdhF Hydrogen dependent carbon dioxide reductase subunit FdhF SO:0001217, UniRef:UniRef50_A0A097ATK5 contig_42 cds 11237 12436 + GCA001639275_00233 hypothetical protein PFAM:PF04432.18 contig_42 cds 12511 13437 - GCA001639275_00234 hypothetical protein PFAM:PF04055.27, PFAM:PF06463.18, PFAM:PF13353.11 contig_42 cds 13438 14475 - GCA001639275_00235 hypothetical protein PFAM:PF03205.20 contig_42 cds 14890 15348 + GCA001639275_00236 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF14697.11 contig_42 cds 15341 16438 + GCA001639275_00237 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_42 cds 16447 16677 + GCA001639275_00238 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF14697.11 contig_42 cds 16689 17258 + GCA001639275_00239 hypothetical protein PFAM:PF01568.27 contig_42 cds 17248 18624 + GCA001639275_00240 hypothetical protein PFAM:PF00384.28 contig_42 cds 18636 20345 + GCA001639275_00241 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_42 cds 20358 21224 + GCA001639275_00242 hypothetical protein contig_42 cds 21295 21567 + GCA001639275_00243 hypothetical protein contig_42 cds 21666 21956 + GCA001639275_00244 hypothetical protein contig_42 cds 21957 23636 - GCA001639275_00245 hypothetical protein PFAM:PF01995.21, PFAM:PF08461.16 contig_42 cds 23677 25032 - GCA001639275_00246 hypothetical protein PFAM:PF00120.29, PFAM:PF03951.24 contig_42 cds 25287 26042 - GCA001639275_00247 hypothetical protein PFAM:PF00899.27 contig_42 cds 26043 27113 - GCA001639275_00248 hypothetical protein PFAM:PF00248.27 contig_42 tRNA 27231 27340 - GCA001639275_00249 tRNA-Xxx contig_42 cds 27501 28751 + GCA001639275_00250 hypothetical protein PFAM:PF00670.27, PFAM:PF02826.25, PFAM:PF05221.23 contig_42 cds 28774 29424 + GCA001639275_00251 hypothetical protein PFAM:PF09892.16 contig_42 cds 29421 30404 - GCA001639275_00252 hypothetical protein contig_42 cds 30416 30979 - GCA001639275_00253 hypothetical protein PFAM:PF01947.21 contig_42 cds 30990 32243 - GCA001639275_00254 hypothetical protein contig_42 cds 32256 33425 - GCA001639275_00255 hypothetical protein PFAM:PF00682.25, PFAM:PF22617.1 contig_42 cds 33474 34013 - GCA001639275_00256 hypothetical protein PFAM:PF01928.26 contig_42 cds 34236 34781 + GCA001639275_00257 hypothetical protein PFAM:PF00352.27 contig_42 cds 34795 36345 + GCA001639275_00258 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_42 cds 36570 37256 + GCA001639275_00259 DUF2249 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1E8VWK5 contig_42 cds 37270 37500 + GCA001639275_00260 hypothetical protein PFAM:PF08984.16 contig_42 cds 38209 40356 + GCA001639275_00261 hypothetical protein PFAM:PF01396.24 contig_42 cds 40700 43393 + GCA001639275_00262 hypothetical protein PFAM:PF02516.20, PFAM:PF21436.2 contig_42 cds 43454 44548 + GCA001639275_00263 hypothetical protein PFAM:PF00025.27, PFAM:PF02421.24, PFAM:PF02824.27 contig_42 cds 44568 45107 + GCA001639275_00264 hypothetical protein PFAM:PF00004.35, PFAM:PF00910.28, PFAM:PF01202.28, PFAM:PF03266.21, PFAM:PF13207.12, PFAM:PF13238.12 contig_43 cds 131 1387 - GCA001639275_00265 hypothetical protein PFAM:PF01977.22, PFAM:PF20695.2, PFAM:PF20696.2 contig_43 cds 1396 2412 - GCA001639275_00266 hypothetical protein PFAM:PF00731.26 contig_43 cds 2468 4621 - GCA001639275_00267 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H2RL22 contig_43 cds 4747 6450 + GCA001639275_00268 hypothetical protein PFAM:PF00535.33 contig_43 cds 6464 7399 - GCA001639275_00269 hypothetical protein PFAM:PF08489.16, PFAM:PF22641.2 contig_43 cds 7408 7824 - GCA001639275_00270 hypothetical protein PFAM:PF00885.24 contig_43 cds 7844 7942 - GCA001639275_00271 hypothetical protein contig_43 cds 7953 8960 - GCA001639275_00272 hypothetical protein PFAM:PF00180.25 contig_43 cds 8935 9414 - GCA001639275_00273 hypothetical protein PFAM:PF00694.25 contig_43 cds 9411 10664 - GCA001639275_00274 hypothetical protein contig_43 cds 10860 11009 + GCA001639275_00275 hypothetical protein contig_43 cds 11756 12964 + GCA001639275_00276 DUF2264 domain-containing protein SO:0001217, UniRef:UniRef50_K5ZEP7 contig_43 cds 12967 14208 - GCA001639275_00277 hypothetical protein PFAM:PF00984.24, PFAM:PF03446.21, PFAM:PF03720.21, PFAM:PF03721.20 contig_43 cds 14280 15122 + GCA001639275_00278 dTDP-4-dehydrorhamnose reductase SO:0001217, UniRef:UniRef50_A0A140L6V4 contig_43 cds 15123 15572 + GCA001639275_00279 hypothetical protein PFAM:PF00545.25 contig_43 cds 15577 15822 + GCA001639275_00280 Barstar (barnase inhibitor) domain-containing protein SO:0001217, UniRef:UniRef50_F3B3T5 contig_43 cds 15902 16768 + GCA001639275_00281 Glucose-1-phosphate thymidylyltransferase SO:0001217, UniRef:UniRef50_P55257 contig_43 cds 16765 17331 + GCA001639275_00282 dTDP-4-dehydrorhamnose 3,5-epimerase SO:0001217, UniRef:UniRef50_H6T5Z5 contig_43 cds 17341 18348 + GCA001639275_00283 dTDP-glucose 4,6-dehydratase SO:0001217, UniRef:UniRef50_A0A948UX06 contig_43 cds 18577 18861 + GCA001639275_00284 hypothetical protein contig_43 cds 18870 19151 + GCA001639275_00285 hypothetical protein contig_43 cds 19203 20291 + GCA001639275_00286 hypothetical protein contig_43 cds 20293 21249 + GCA001639275_00287 hypothetical protein PFAM:PF00535.33 contig_43 cds 21255 22214 + GCA001639275_00288 Family 2 glycosyl transferase SO:0001217, UniRef:UniRef50_J7SBV9 contig_43 cds 22227 23084 + GCA001639275_00289 Glycosyltransferase family 2 protein SO:0001217, UniRef:UniRef50_A0AA95KTA8 contig_43 cds 23138 24541 + GCA001639275_00290 Bacterial sugar transferase domain-containing protein SO:0001217, UniRef:UniRef50_Q24S81 contig_43 cds 24702 27317 + GCA001639275_00291 hypothetical protein PFAM:PF01336.31, PFAM:PF16686.11, PFAM:PF16900.11, PFAM:PF17244.8, PFAM:PF21473.3, PFAM:PF24903.1 contig_43 cds 27346 28281 + GCA001639275_00292 hypothetical protein PFAM:PF06745.19, PFAM:PF08423.17, PFAM:PF12826.13, PFAM:PF13481.12, PFAM:PF14520.12 contig_43 cds 28844 32341 + GCA001639275_00293 hypothetical protein PFAM:PF13229.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_43 cds 33056 33196 + GCA001639275_00294 hypothetical protein contig_43 cds 35112 37691 + GCA001639275_00295 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_43 cds 37851 38141 + GCA001639275_00296 hypothetical protein contig_43 cds 38690 38902 + GCA001639275_00297 hypothetical protein contig_43 cds 39654 39899 - GCA001639275_00298 hypothetical protein contig_43 cds 40123 40632 - GCA001639275_00299 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_43 cds 41033 44512 - GCA001639275_00300 hypothetical protein PFAM:PF13229.12 contig_44 cds 123 2075 - GCA001639275_00301 hypothetical protein contig_44 cds 2298 2450 - GCA001639275_00302 hypothetical protein contig_44 cds 2642 3322 - GCA001639275_00303 hypothetical protein contig_44 cds 3333 3884 - GCA001639275_00304 hypothetical protein contig_44 cds 4260 5630 - GCA001639275_00305 hypothetical protein PFAM:PF01909.29, PFAM:PF09249.16, PFAM:PF18144.7, PFAM:PF21133.2 contig_44 cds 5635 6192 - GCA001639275_00306 hypothetical protein PFAM:PF10469.15 contig_44 cds 6201 7328 - GCA001639275_00307 hypothetical protein contig_44 cds 7338 8129 - GCA001639275_00308 hypothetical protein PFAM:PF01791.15 contig_44 cds 8289 8930 - GCA001639275_00309 hypothetical protein contig_44 cds 8939 9646 - GCA001639275_00310 hypothetical protein contig_44 cds 9746 14824 - GCA001639275_00311 hypothetical protein contig_44 cds 14993 17863 - GCA001639275_00312 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_44 cds 18037 18558 - GCA001639275_00313 hypothetical protein contig_44 cds 18551 19408 - GCA001639275_00314 hypothetical protein PFAM:PF00288.32 contig_44 cds 19401 20045 - GCA001639275_00315 hypothetical protein contig_44 cds 20493 21002 - GCA001639275_00316 Flavodoxin-like domain-containing protein SO:0001217, UniRef:UniRef50_G7M4W7 contig_44 cds 21096 22319 - GCA001639275_00317 hypothetical protein PFAM:PF00258.30, PFAM:PF00753.33, PFAM:PF19583.5 contig_44 cds 22619 23281 + GCA001639275_00318 Polymerase/histidinol phosphatase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A075WQ85 contig_44 cds 23278 23742 + GCA001639275_00319 hypothetical protein contig_44 cds 23747 24418 - GCA001639275_00320 hypothetical protein PFAM:PF01872.23 contig_44 cds 24428 25441 - GCA001639275_00321 hypothetical protein contig_44 cds 25485 25955 - GCA001639275_00322 hypothetical protein PFAM:PF01978.25, PFAM:PF02796.21, PFAM:PF12840.13, PFAM:PF13384.12, PFAM:PF13412.12 contig_44 cds 25963 27540 - GCA001639275_00323 hypothetical protein contig_44 cds 27552 29525 - GCA001639275_00324 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF01588.26, PFAM:PF19303.5 contig_44 cds 29694 31022 + GCA001639275_00325 hypothetical protein contig_44 cds 31019 31579 - GCA001639275_00326 hypothetical protein contig_44 cds 31652 32626 + GCA001639275_00327 hypothetical protein contig_44 cds 32632 32889 + GCA001639275_00328 hypothetical protein contig_44 cds 32884 33450 - GCA001639275_00329 hypothetical protein PFAM:PF02223.23 contig_44 cds 33469 34611 - GCA001639275_00330 hypothetical protein PFAM:PF04055.27 contig_44 cds 34715 35206 + GCA001639275_00331 hypothetical protein PFAM:PF02776.23 contig_44 cds 35211 35747 + GCA001639275_00332 hypothetical protein PFAM:PF02775.26 contig_44 cds 35744 38053 - GCA001639275_00333 hypothetical protein PFAM:PF00037.32, PFAM:PF00070.33, PFAM:PF01266.30, PFAM:PF01593.30, PFAM:PF07992.20, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13450.12, PFAM:PF13484.11, PFAM:PF14697.11 contig_44 cds 38053 38991 - GCA001639275_00334 hypothetical protein PFAM:PF02754.22 contig_44 cds 38993 39592 - GCA001639275_00335 hypothetical protein PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13534.11 contig_44 cds 39606 40871 - GCA001639275_00336 hypothetical protein PFAM:PF01837.21 contig_44 cds 40876 41646 - GCA001639275_00337 Phosphosulfolactate synthase SO:0001217, UniRef:UniRef50_A0A6N4A8N1 contig_44 cds 41750 42466 + GCA001639275_00338 hypothetical protein contig_44 cds 42493 42780 - GCA001639275_00339 hypothetical protein PFAM:PF01893.21 contig_45 cds 184 1833 + GCA001639275_00340 hypothetical protein PFAM:PF00920.27, PFAM:PF24877.1 contig_45 cds 1841 3115 + GCA001639275_00341 Histidinol dehydrogenase SO:0001217, UniRef:UniRef50_Q3AD53 contig_45 cds 3252 4571 + GCA001639275_00342 hypothetical protein PFAM:PF00152.25, PFAM:PF01336.31, PFAM:PF01409.25 contig_45 cds 4579 5781 + GCA001639275_00343 hypothetical protein PFAM:PF03486.20, PFAM:PF07992.20 contig_45 cds 6140 9064 + GCA001639275_00344 hypothetical protein PFAM:PF02663.19 contig_45 cds 9021 9584 + GCA001639275_00345 hypothetical protein contig_45 cds 9666 10295 + GCA001639275_00346 hypothetical protein contig_45 cds 10305 11576 + GCA001639275_00347 Glutamate-1-semialdehyde 2,1-aminomutase SO:0001217, UniRef:UniRef50_Q55665 contig_45 cds 11586 12005 + GCA001639275_00348 hypothetical protein PFAM:PF10502.14 contig_45 cds 12024 13721 + GCA001639275_00349 hypothetical protein PFAM:PF03485.21, PFAM:PF05746.21 contig_45 cds 13761 14288 - GCA001639275_00350 FMN reductase [NAD(P)H] SO:0001217, UniRef:UniRef50_A0A380LQ39 contig_45 cds 14382 15692 + GCA001639275_00351 hypothetical protein PFAM:PF01071.24, PFAM:PF02843.22, PFAM:PF02844.21 contig_45 cds 15716 15949 + GCA001639275_00352 hypothetical protein contig_45 cds 15991 16563 + GCA001639275_00353 hypothetical protein contig_45 cds 16620 17525 + GCA001639275_00354 Ornithine carbamoyltransferase SO:0001217, UniRef:UniRef50_Q9ZB62 contig_45 cds 17794 19488 + GCA001639275_00355 Acetolactate synthase SO:0001217, UniRef:UniRef50_A0A2V7PZS0 contig_45 cds 19498 19983 + GCA001639275_00356 Acetolactate synthase small subunit SO:0001217, UniRef:UniRef50_A0A174E9E8 contig_45 cds 19984 20511 + GCA001639275_00357 hypothetical protein PFAM:PF00484.24 contig_45 cds 20677 21669 + GCA001639275_00358 hypothetical protein PFAM:PF01450.25, PFAM:PF02826.25, PFAM:PF03446.21 contig_45 cds 21715 22722 + GCA001639275_00359 hypothetical protein contig_45 cds 22736 22936 - GCA001639275_00360 hypothetical protein PFAM:PF01423.28, PFAM:PF02237.23 contig_45 cds 23023 23166 + GCA001639275_00361 hypothetical protein contig_45 cds 23170 23946 - GCA001639275_00362 hypothetical protein PFAM:PF01975.23 contig_45 cds 24091 24999 + GCA001639275_00363 hypothetical protein contig_45 cds 24985 26046 - GCA001639275_00364 hypothetical protein contig_45 cds 26048 27403 - GCA001639275_00365 hypothetical protein PFAM:PF01656.29, PFAM:PF07685.20, PFAM:PF13500.12 contig_45 cds 27505 29331 + GCA001639275_00366 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25, PFAM:PF08915.16 contig_45 cds 29389 30624 + GCA001639275_00367 hypothetical protein PFAM:PF00215.30 contig_45 cds 30671 30955 + GCA001639275_00368 Putative zinc ribbon domain-containing protein SO:0001217, UniRef:UniRef50_A0A7C6FQJ7 contig_45 cds 30952 31848 - GCA001639275_00369 hypothetical protein contig_45 cds 31952 32536 + GCA001639275_00370 hypothetical protein PFAM:PF03358.20 contig_45 cds 32588 34144 + GCA001639275_00371 hypothetical protein contig_45 cds 34154 34693 - GCA001639275_00372 hypothetical protein contig_45 cds 35022 35357 - GCA001639275_00373 hypothetical protein contig_46 cds 1174 1416 - GCA001639275_00374 hypothetical protein contig_46 cds 2300 2527 - GCA001639275_00375 hypothetical protein contig_46 cds 3448 4353 + GCA001639275_00376 hypothetical protein contig_46 cds 4654 6645 + GCA001639275_00377 hypothetical protein PFAM:PF00037.32, PFAM:PF07992.20, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF14697.11 contig_46 cds 7065 8333 + GCA001639275_00378 hypothetical protein PFAM:PF00155.27, PFAM:PF00464.25 contig_46 cds 8340 9032 + GCA001639275_00379 hypothetical protein PFAM:PF00037.32, PFAM:PF02441.25, PFAM:PF12837.12, PFAM:PF13183.11, PFAM:PF13237.11 contig_46 cds 9018 9344 - GCA001639275_00380 hypothetical protein contig_46 cds 9625 10830 + GCA001639275_00381 hypothetical protein contig_46 cds 10978 14211 + GCA001639275_00382 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF08264.19, PFAM:PF19302.4 contig_46 cds 14213 16351 + GCA001639275_00383 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27, PFAM:PF18072.6 contig_46 cds 16368 17585 + GCA001639275_00384 hypothetical protein PFAM:PF00994.29, PFAM:PF03454.20 contig_46 cds 17602 18732 + GCA001639275_00385 hypothetical protein contig_46 cds 18775 19191 - GCA001639275_00386 hypothetical protein PFAM:PF00210.30, PFAM:PF02915.23 contig_46 cds 19229 20473 - GCA001639275_00387 hypothetical protein PFAM:PF00258.30, PFAM:PF19583.5 contig_46 cds 20699 21466 + GCA001639275_00388 hypothetical protein PFAM:PF01022.26, PFAM:PF13412.12 contig_46 cds 21467 22171 - GCA001639275_00389 hypothetical protein PFAM:PF00590.25 contig_46 tRNA 24088 24161 - GCA001639275_00390 trnR tRNA-Arg(tcg) SO:0001036 contig_46 cds 24181 25191 - GCA001639275_00391 hypothetical protein contig_46 cds 25204 25518 - GCA001639275_00392 hypothetical protein PFAM:PF01096.23, PFAM:PF02150.21 contig_46 cds 25606 26028 - GCA001639275_00393 hypothetical protein PFAM:PF00293.34 contig_46 cds 26061 26339 - GCA001639275_00394 hypothetical protein PFAM:PF01193.29, PFAM:PF13656.11 contig_46 cds 26351 26923 - GCA001639275_00395 hypothetical protein PFAM:PF10447.15, PFAM:PF14382.12 contig_46 cds 26984 27988 - GCA001639275_00396 hypothetical protein contig_46 cds 27990 28559 - GCA001639275_00397 hypothetical protein PFAM:PF00156.33 contig_46 cds 28653 29993 + GCA001639275_00398 hypothetical protein PFAM:PF00448.28, PFAM:PF02881.24, PFAM:PF02978.25 contig_46 cds 29998 31206 + GCA001639275_00399 hypothetical protein PFAM:PF21238.2, PFAM:PF22023.1 contig_46 cds 31211 31678 + GCA001639275_00400 hypothetical protein contig_46 cds 31744 31905 + GCA001639275_00401 hypothetical protein contig_46 cds 31953 32777 + GCA001639275_00402 hypothetical protein PFAM:PF01207.24, PFAM:PF03060.21, PFAM:PF05690.20 contig_46 cds 32774 33706 + GCA001639275_00403 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_47 cds 189 521 - GCA001639275_00404 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12 contig_47 cds 787 1191 + GCA001639275_00405 hypothetical protein PFAM:PF03061.28 contig_47 cds 1427 3091 - GCA001639275_00406 3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase SO:0001217, UniRef:UniRef50_A0A0P0L9Z5 contig_47 cds 3102 3671 - GCA001639275_00407 (S)-2-hydroxypropylphosphonic acid epoxidase SO:0001217, UniRef:UniRef50_A0A174ISJ1 contig_47 cds 3830 4408 + GCA001639275_00408 hypothetical protein PFAM:PF00132.30, PFAM:PF14602.12 contig_47 cds 4405 5130 - GCA001639275_00409 hypothetical protein PFAM:PF12705.13 contig_47 cds 5561 6106 - GCA001639275_00410 hypothetical protein contig_47 cds 6386 6697 - GCA001639275_00411 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF13534.11 contig_47 cds 6909 7811 - GCA001639275_00412 hypothetical protein PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_47 cds 8126 9925 + GCA001639275_00413 irtA Iron import ATP-binding/permease protein IrtA SO:0001217, UniRef:UniRef50_A0A174NUF5 contig_47 cds 9918 11675 + GCA001639275_00414 hypothetical protein PFAM:PF00005.33 contig_47 cds 11770 11949 - GCA001639275_00415 hypothetical protein contig_47 cds 12315 13082 + GCA001639275_00416 hypothetical protein contig_47 cds 13239 13841 - GCA001639275_00417 hypothetical protein PFAM:PF13240.11 contig_47 cds 13935 14273 - GCA001639275_00418 UPF0145 protein SCO3412 SO:0001217, UniRef:UniRef50_Q9X8J2 contig_47 cds 14610 15593 - GCA001639275_00419 hypothetical protein PFAM:PF00165.29, PFAM:PF12833.13 contig_47 cds 15658 16512 + GCA001639275_00420 hypothetical protein contig_47 cds 16567 16722 + GCA001639275_00421 hypothetical protein contig_47 cds 16775 16894 - GCA001639275_00422 hypothetical protein contig_47 cds 17069 17926 - GCA001639275_00423 hypothetical protein contig_47 cds 18171 18734 - GCA001639275_00424 hypothetical protein contig_47 cds 18774 19160 - GCA001639275_00425 hypothetical protein PFAM:PF01638.23 contig_47 cds 19650 20429 - GCA001639275_00426 Polyketide biosynthesis methyltransferase SO:0001217, UniRef:UniRef50_G5F3T7 contig_47 cds 21401 22771 - GCA001639275_00427 hypothetical protein contig_47 cds 22812 23255 - GCA001639275_00428 hypothetical protein PFAM:PF01047.28, PFAM:PF01638.23, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13601.12, PFAM:PF22381.2 contig_47 cds 23297 24235 - GCA001639275_00429 hypothetical protein PFAM:PF00725.27, PFAM:PF02737.24 contig_47 cds 24430 24891 - GCA001639275_00430 hypothetical protein PFAM:PF01047.28, PFAM:PF13463.12 contig_47 cds 24958 25440 - GCA001639275_00431 hypothetical protein contig_47 cds 25450 26073 - GCA001639275_00432 hypothetical protein contig_47 cds 26906 27766 - GCA001639275_00433 hypothetical protein contig_47 cds 27774 28712 - GCA001639275_00434 Site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A097APE4 contig_47 cds 28840 29172 - GCA001639275_00435 hypothetical protein contig_47 cds 29490 30275 - GCA001639275_00436 hypothetical protein contig_47 cds 30283 31014 - GCA001639275_00437 hypothetical protein contig_47 cds 31017 31220 - GCA001639275_00438 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12, PFAM:PF13560.12 contig_47 cds 31834 32400 + GCA001639275_00439 Flavin reductase like domain-containing protein SO:0001217, UniRef:UniRef50_G4Q5S3 contig_48 cds 643 1428 - GCA001639275_00440 hypothetical protein PFAM:PF00590.25 contig_48 cds 1465 2469 + GCA001639275_00441 hypothetical protein PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF13649.12, PFAM:PF13847.12, PFAM:PF18093.7, PFAM:PF25133.1 contig_48 cds 2466 3395 - GCA001639275_00442 Methylthioribose-1-phosphate isomerase SO:0001217, UniRef:UniRef50_Q746Y8 contig_48 cds 3410 4330 - GCA001639275_00443 Manganese-dependent inorganic pyrophosphatase SO:0001217, UniRef:UniRef50_P37487 contig_48 cds 4837 7536 - GCA001639275_00444 hypothetical protein PFAM:PF01841.26, PFAM:PF02369.22, PFAM:PF09373.15, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF22433.2, PFAM:PF24025.1 contig_48 cds 7965 8441 - GCA001639275_00445 hypothetical protein contig_48 cds 8528 9394 - GCA001639275_00446 nifB FeMo cofactor biosynthesis protein NifB SO:0001217, UniRef:UniRef50_A0A161X9Z0 contig_48 cds 9465 10025 - GCA001639275_00447 hypothetical protein contig_48 cds 10044 11279 - GCA001639275_00448 (pseudo) Methanogenesis marker 5 protein SO:0001217, UniRef:UniRef50_A0AA96V0M9, UniRef:UniRef90_A0A9D1XQU7 contig_48 cds 11281 11733 - GCA001639275_00449 hypothetical protein contig_48 cds 11750 12217 - GCA001639275_00450 hypothetical protein contig_48 cds 12195 13736 - GCA001639275_00451 hypothetical protein contig_48 cds 13868 14587 + GCA001639275_00452 hypothetical protein PFAM:PF00565.23 contig_48 cds 14600 15574 - GCA001639275_00453 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_48 cds 15592 16710 - GCA001639275_00454 hypothetical protein contig_48 cds 16707 17213 - GCA001639275_00455 hypothetical protein PFAM:PF17146.10 contig_48 cds 17375 18166 + GCA001639275_00456 hypothetical protein PFAM:PF01022.26 contig_48 cds 18166 19005 + GCA001639275_00457 hypothetical protein contig_48 cds 18966 19274 + GCA001639275_00458 hypothetical protein PFAM:PF01022.26 contig_48 cds 19274 19780 + GCA001639275_00459 Molybdenum cofactor biosynthesis protein B SO:0001217, UniRef:UniRef50_O34457 contig_48 cds 19815 20342 - GCA001639275_00460 hypothetical protein PFAM:PF00156.33 contig_48 cds 20348 20581 - GCA001639275_00461 hypothetical protein PFAM:PF05239.21 contig_48 cds 20742 22064 + GCA001639275_00462 hypothetical protein PFAM:PF01336.31, PFAM:PF13742.12 contig_48 cds 22073 22291 + GCA001639275_00463 Exodeoxyribonuclease 7 small subunit SO:0001217, UniRef:UniRef50_R5M1Y4 contig_48 cds 22292 23308 - GCA001639275_00464 hypothetical protein contig_48 cds 23351 24964 - GCA001639275_00465 hypothetical protein contig_48 cds 25223 25843 + GCA001639275_00466 hypothetical protein contig_48 cds 25855 26991 - GCA001639275_00467 hypothetical protein contig_48 cds 27222 28271 - GCA001639275_00468 hypothetical protein PFAM:PF01118.30, PFAM:PF02774.23 contig_48 cds 28281 29102 - GCA001639275_00469 hypothetical protein PFAM:PF01113.26, PFAM:PF05173.19 contig_48 cds 29115 30008 - GCA001639275_00470 4-hydroxy-tetrahydrodipicolinate synthase SO:0001217, UniRef:UniRef50_Q1MPX7 contig_48 cds 30005 31225 - GCA001639275_00471 hypothetical protein PFAM:PF01842.31, PFAM:PF13840.12, PFAM:PF22468.2 contig_48 cds 31546 31743 - GCA001639275_00472 hypothetical protein contig_48 cds 31730 32071 - GCA001639275_00473 hypothetical protein PFAM:PF01817.26 contig_48 cds 32392 33258 - GCA001639275_00474 hypothetical protein PFAM:PF00288.32, PFAM:PF08544.19 contig_48 cds 33258 34325 - GCA001639275_00475 hypothetical protein PFAM:PF08323.17, PFAM:PF13439.12, PFAM:PF13477.12, PFAM:PF13579.12, PFAM:PF13692.12 contig_48 cds 34352 35425 - GCA001639275_00476 hypothetical protein contig_48 cds 35458 35718 - GCA001639275_00477 hypothetical protein PFAM:PF00085.26, PFAM:PF13192.12 contig_48 cds 35821 37890 + GCA001639275_00478 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF12826.13 contig_48 cds 37904 38200 - GCA001639275_00479 hypothetical protein contig_48 cds 38213 38494 - GCA001639275_00480 hypothetical protein PFAM:PF05239.21 contig_48 cds 38600 40276 + GCA001639275_00481 hypothetical protein PFAM:PF04055.27, PFAM:PF23613.1 contig_48 cds 40325 41056 + GCA001639275_00482 hypothetical protein PFAM:PF01791.15 contig_48 tRNA 41127 41199 - GCA001639275_00483 trnF tRNA-Phe(gaa) SO:0000267 contig_48 tRNA 41203 41274 - GCA001639275_00484 trnV tRNA-Val(gac) SO:0000273 contig_48 cds 41402 41602 - GCA001639275_00485 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23, PFAM:PF15630.12 contig_48 cds 41805 43085 - GCA001639275_00486 hypothetical protein PFAM:PF01938.26, PFAM:PF04055.27 contig_48 cds 43100 43717 - GCA001639275_00487 hypothetical protein contig_48 cds 43740 44225 - GCA001639275_00488 3-isopropylmalate dehydratase small subunit SO:0001217, UniRef:UniRef50_Q97EE1 contig_48 cds 44307 45815 - GCA001639275_00489 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11, PFAM:PF23545.1 contig_48 cds 45967 46530 + GCA001639275_00490 hypothetical protein contig_48 cds 46527 47546 - GCA001639275_00491 hypothetical protein contig_48 cds 47548 48636 - GCA001639275_00492 hypothetical protein contig_48 cds 48626 49942 - GCA001639275_00493 hypothetical protein contig_48 cds 50758 52506 - GCA001639275_00494 hypothetical protein PFAM:PF13248.11, PFAM:PF17032.10, PFAM:PF18912.6 contig_48 cds 52957 53820 - GCA001639275_00495 hypothetical protein PFAM:PF01416.25 contig_48 cds 53891 56329 - GCA001639275_00496 hypothetical protein PFAM:PF00702.32 contig_48 cds 56339 56725 - GCA001639275_00497 HTH arsR-type domain-containing protein SO:0001217, UniRef:UniRef50_R9JBG6 contig_48 cds 56930 57676 + GCA001639275_00498 hypothetical protein PFAM:PF00121.24, PFAM:PF01207.24, PFAM:PF01884.23, PFAM:PF05690.20 contig_48 cds 57673 58131 + GCA001639275_00499 hypothetical protein PFAM:PF01467.32 contig_48 cds 58133 59152 + GCA001639275_00500 N-acetyl-gamma-glutamyl-phosphate reductase SO:0001217, UniRef:UniRef50_A0LIV2 contig_48 cds 59165 59659 + GCA001639275_00501 hypothetical protein PFAM:PF00258.30, PFAM:PF03358.20, PFAM:PF12641.12, PFAM:PF12682.12, PFAM:PF12724.12 contig_48 cds 59666 60145 + GCA001639275_00502 hypothetical protein PFAM:PF01948.23, PFAM:PF02748.20 contig_48 cds 60151 61353 - GCA001639275_00503 hypothetical protein PFAM:PF00037.32, PFAM:PF00732.25, PFAM:PF05199.19, PFAM:PF07992.20, PFAM:PF13450.12 contig_48 cds 61475 62845 + GCA001639275_00504 hypothetical protein PFAM:PF01523.21, PFAM:PF19289.4, PFAM:PF19290.4 contig_48 cds 62845 63402 + GCA001639275_00505 hypothetical protein contig_48 cds 63414 64430 + GCA001639275_00506 hypothetical protein PFAM:PF02421.24, PFAM:PF03193.22, PFAM:PF17835.6 contig_48 cds 64501 65061 + GCA001639275_00507 hypothetical protein PFAM:PF00011.27 contig_48 cds 65185 66195 - GCA001639275_00508 hypothetical protein PFAM:PF01380.27 contig_48 cds 66456 68171 - GCA001639275_00509 Adenine deaminase SO:0001217, UniRef:UniRef50_Q2S006 contig_48 cds 68173 69408 - GCA001639275_00510 hypothetical protein PFAM:PF21570.3, PFAM:PF21571.2 contig_48 cds 69575 70381 - GCA001639275_00511 Class I SAM-dependent methyltransferase SO:0001217, UniRef:UniRef50_A0A2U8DSF1 contig_48 cds 70497 71369 - GCA001639275_00512 hypothetical protein PFAM:PF00491.26 contig_48 cds 71403 71792 - GCA001639275_00513 Translation initiation factor 5A SO:0001217, UniRef:UniRef50_A0A9E5XWC2 contig_48 cds 71896 72249 - GCA001639275_00514 hypothetical protein contig_48 cds 72365 72826 + GCA001639275_00515 hypothetical protein contig_48 cds 72829 74679 + GCA001639275_00516 hypothetical protein PFAM:PF01513.26, PFAM:PF20143.4 contig_48 cds 74660 76036 + GCA001639275_00517 hypothetical protein PFAM:PF08245.18 contig_48 cds 76188 77057 + GCA001639275_00518 hypothetical protein PFAM:PF01379.25, PFAM:PF03900.20 contig_48 cds 77070 78023 + GCA001639275_00519 hypothetical protein PFAM:PF01408.29, PFAM:PF02629.25, PFAM:PF02894.22, PFAM:PF22725.1 contig_48 cds 78037 78651 + GCA001639275_00520 hypothetical protein PFAM:PF00156.33 contig_48 cds 78696 79070 - GCA001639275_00521 hypothetical protein contig_48 cds 79358 79951 + GCA001639275_00522 hypothetical protein PFAM:PF00440.29 contig_48 cds 79953 81833 + GCA001639275_00523 hypothetical protein PFAM:PF01061.29 contig_48 cds 81883 82173 - GCA001639275_00524 hypothetical protein contig_48 cds 82255 82440 - GCA001639275_00525 hypothetical protein contig_48 cds 82503 82997 - GCA001639275_00526 hypothetical protein contig_48 cds 82991 84775 - GCA001639275_00527 hypothetical protein SO:0001217, UniRef:UniRef50_M5DZB3 contig_48 cds 85417 86394 - GCA001639275_00528 tRNA-dihydrouridine synthase SO:0001217, UniRef:UniRef50_A9NE09 contig_48 cds 86601 87560 - GCA001639275_00529 hypothetical protein contig_48 cds 88030 89364 - GCA001639275_00530 Glutamate dehydrogenase SO:0001217, UniRef:UniRef50_Q5QVZ2 contig_48 cds 89750 89956 + GCA001639275_00531 hypothetical protein contig_48 cds 89961 91205 - GCA001639275_00532 hypothetical protein PFAM:PF03463.20, PFAM:PF03464.20, PFAM:PF03465.20 contig_48 cds 91285 92256 - GCA001639275_00533 hypothetical protein contig_48 cds 92361 92927 + GCA001639275_00534 hypothetical protein PFAM:PF13240.11, PFAM:PF24463.1 contig_48 cds 92914 93351 - GCA001639275_00535 hypothetical protein PFAM:PF13302.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_48 cds 93467 93856 + GCA001639275_00536 hypothetical protein PFAM:PF03686.19 contig_48 cds 93863 96283 + GCA001639275_00537 hypothetical protein PFAM:PF00690.31, PFAM:PF00702.32, PFAM:PF08282.18 contig_48 cds 96283 97077 + GCA001639275_00538 hypothetical protein contig_48 tRNA 97097 97179 - GCA001639275_00539 trnS tRNA-Ser(tga) SO:0000269 contig_48 cds 97216 97524 - GCA001639275_00540 hypothetical protein PFAM:PF00338.27 contig_48 cds 97591 98832 - GCA001639275_00541 hypothetical protein PFAM:PF00009.33, PFAM:PF03143.23, PFAM:PF03144.31, PFAM:PF22594.2 contig_48 cds 98980 101157 - GCA001639275_00542 hypothetical protein PFAM:PF00009.33, PFAM:PF00679.30, PFAM:PF03144.31, PFAM:PF03764.24, PFAM:PF14492.12, PFAM:PF22042.2 contig_48 cds 101199 101771 - GCA001639275_00543 hypothetical protein PFAM:PF00177.27 contig_48 cds 101774 102199 - GCA001639275_00544 hypothetical protein PFAM:PF00164.32 contig_48 cds 102734 103165 - GCA001639275_00545 hypothetical protein PFAM:PF07650.23, PFAM:PF13184.12 contig_48 cds 103172 103468 - GCA001639275_00546 hypothetical protein PFAM:PF01248.31 contig_48 cds 103480 104634 - GCA001639275_00547 hypothetical protein PFAM:PF04998.22 contig_48 cds 104643 107366 - GCA001639275_00548 hypothetical protein PFAM:PF00623.25, PFAM:PF04983.23, PFAM:PF04997.17, PFAM:PF04998.22, PFAM:PF05000.22 contig_48 cds 107391 109352 - GCA001639275_00549 DNA-directed RNA polymerase subunit beta SO:0001217, UniRef:UniRef50_A0A2E7N7N6 contig_48 cds 109376 110920 - GCA001639275_00550 hypothetical protein PFAM:PF04561.19, PFAM:PF04565.21 contig_48 cds 111172 111408 - GCA001639275_00551 hypothetical protein PFAM:PF01191.24 contig_48 tRNA 111453 111526 - GCA001639275_00552 trnK tRNA-Lys(ttt) SO:0000265 contig_48 tRNA 111550 111621 - GCA001639275_00553 trnD tRNA-Asp(gtc) SO:0000256 contig_48 tRNA 111765 111838 - GCA001639275_00554 trnY tRNA-Tyr(gta) SO:0000272 contig_48 tRNA 111845 111919 - GCA001639275_00555 trnP tRNA-Pro(tgg) SO:0000268 contig_48 tRNA 112035 112108 - GCA001639275_00556 trnT tRNA-Thr(tgt) SO:0000270 contig_48 cds 112225 113088 + GCA001639275_00557 hypothetical protein PFAM:PF02110.20 contig_48 cds 113085 113708 + GCA001639275_00558 Thiamine-phosphate synthase SO:0001217, UniRef:UniRef50_A6TMN5 contig_48 cds 113689 114036 - GCA001639275_00559 VOC domain-containing protein SO:0001217, UniRef:UniRef50_A0A1G7HGK0 contig_48 cds 114042 115259 - GCA001639275_00560 hypothetical protein PFAM:PF00162.24 contig_48 cds 115308 115976 - GCA001639275_00561 hypothetical protein PFAM:PF00121.24 contig_48 cds 116079 116993 + GCA001639275_00562 hypothetical protein PFAM:PF04055.27 contig_48 cds 117002 117667 - GCA001639275_00563 2-amino-4-deoxychorismate dehydrogenase SO:0001217, UniRef:UniRef50_A0A162RUT0 contig_48 cds 117680 118786 - GCA001639275_00564 hypothetical protein PFAM:PF00549.24, PFAM:PF01071.24, PFAM:PF02786.22, PFAM:PF08442.15, PFAM:PF13549.11 contig_48 cds 118796 119341 - GCA001639275_00565 porC Pyruvate synthase subunit PorC SO:0001217, UniRef:UniRef50_A0A1V4IC63 contig_48 cds 119351 120217 - GCA001639275_00566 2-oxoglutarate ferredoxin oxidoreductase subunit beta SO:0001217, UniRef:UniRef50_A0A841L2V2 contig_48 cds 120218 121345 - GCA001639275_00567 2-oxoglutarate/2-oxoacid ferredoxin oxidoreductase subunit alpha SO:0001217, UniRef:UniRef50_A0A916MNS9 contig_48 cds 121354 121617 - GCA001639275_00568 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11 contig_48 cds 121733 122224 + GCA001639275_00569 L(+)-tartrate dehydratase subunit beta SO:0001217, UniRef:UniRef50_A0A1G9HC30 contig_48 cds 122234 122968 - GCA001639275_00570 hypothetical protein PFAM:PF00254.34, PFAM:PF18046.7, PFAM:PF22199.2 contig_48 cds 123051 124214 + GCA001639275_00571 hypothetical protein contig_48 cds 124211 124750 - GCA001639275_00572 hypothetical protein contig_48 cds 124772 125554 - GCA001639275_00573 hypothetical protein contig_48 cds 125557 126594 - GCA001639275_00574 hypothetical protein contig_48 cds 126749 127918 + GCA001639275_00575 hypothetical protein contig_48 cds 127915 128589 + GCA001639275_00576 hypothetical protein PFAM:PF00733.27, PFAM:PF06508.19 contig_48 cds 128811 129137 - GCA001639275_00577 hypothetical protein contig_48 cds 129116 129775 - GCA001639275_00578 hypothetical protein contig_48 cds 130495 131487 - GCA001639275_00579 hypothetical protein PFAM:PF00724.26, PFAM:PF01207.24 contig_48 cds 131611 133323 - GCA001639275_00580 hypothetical protein PFAM:PF00364.28, PFAM:PF00682.25, PFAM:PF02436.23, PFAM:PF13533.12 contig_48 cds 133447 134550 - GCA001639275_00581 Inositol-3-phosphate synthase SO:0001217, UniRef:UniRef50_Q8NLE6 contig_48 cds 134646 135053 + GCA001639275_00582 hypothetical protein contig_48 cds 135313 136155 + GCA001639275_00583 hypothetical protein contig_48 cds 136166 137734 + GCA001639275_00584 hypothetical protein contig_48 cds 138219 139751 + GCA001639275_00585 hypothetical protein contig_48 cds 139844 140896 - GCA001639275_00586 hypothetical protein PFAM:PF03102.20, PFAM:PF08666.17 contig_48 cds 140906 142579 - GCA001639275_00587 UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase SO:0001217, UniRef:UniRef50_A0A846JB83 contig_48 cds 142669 143715 + GCA001639275_00588 hypothetical protein contig_48 cds 143726 144427 + GCA001639275_00589 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_48 cds 144439 145743 + GCA001639275_00590 hypothetical protein PFAM:PF01523.21, PFAM:PF19289.4, PFAM:PF19290.4 contig_48 cds 145954 146070 + GCA001639275_00591 hypothetical protein contig_48 cds 146922 147311 - GCA001639275_00592 hypothetical protein PFAM:PF01638.23 contig_48 cds 147482 147772 + GCA001639275_00593 ABM domain-containing protein SO:0001217, UniRef:UniRef50_F3LE00 contig_48 cds 147785 148396 - GCA001639275_00594 metN Methionine import ATP-binding protein MetN 2 SO:0001217, UniRef:UniRef50_A0A1C5Z9F9 contig_48 cds 148386 149333 - GCA001639275_00595 nikD Nickel import system ATP-binding protein NikD SO:0001217, UniRef:UniRef50_A0A1M7T254 contig_48 cds 149342 150205 - GCA001639275_00596 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_Q24XL6 contig_48 cds 150202 151182 - GCA001639275_00597 hypothetical protein contig_48 cds 151264 152895 - GCA001639275_00598 hypothetical protein PFAM:PF00496.27 contig_49 cds 683 1195 - GCA001639275_00599 hypothetical protein contig_49 cds 1188 3779 - GCA001639275_00600 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37 contig_49 cds 3875 4732 - GCA001639275_00601 hypothetical protein contig_49 cds 4818 5588 - GCA001639275_00602 hypothetical protein contig_49 cds 5602 7101 - GCA001639275_00603 hypothetical protein contig_49 cds 7253 10138 - GCA001639275_00604 UvrABC system protein A SO:0001217, UniRef:UniRef50_A0A449B3I9 contig_49 cds 10241 12202 - GCA001639275_00605 UvrABC system protein B SO:0001217, UniRef:UniRef50_P37954 contig_49 cds 12210 12506 - GCA001639275_00606 hypothetical protein contig_49 cds 12508 13395 - GCA001639275_00607 hypothetical protein PFAM:PF00156.33, PFAM:PF13793.12, PFAM:PF14572.12, PFAM:PF14681.12, PFAM:PF24390.1 contig_49 cds 13859 14413 - GCA001639275_00608 hypothetical protein contig_49 cds 14548 15036 + GCA001639275_00609 hypothetical protein contig_49 cds 15150 15278 + GCA001639275_00610 hypothetical protein contig_49 cds 15393 15758 - GCA001639275_00611 hypothetical protein contig_49 cds 15791 16300 - GCA001639275_00612 hypothetical protein PFAM:PF13302.13, PFAM:PF13420.13 contig_49 cds 16337 17242 + GCA001639275_00613 ADP-ribosylglycohydrolase SO:0001217, UniRef:UniRef50_A0A1I2M4C7 contig_49 cds 17229 17708 + GCA001639275_00614 hypothetical protein contig_49 cds 17715 19685 - GCA001639275_00615 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF05362.19, PFAM:PF07728.20, PFAM:PF13541.12, PFAM:PF14532.12, PFAM:PF20436.4 contig_49 cds 19969 20343 + GCA001639275_00616 hypothetical protein contig_49 cds 20337 20708 + GCA001639275_00617 hypothetical protein contig_49 cds 20945 21094 + GCA001639275_00618 hypothetical protein contig_49 cds 21388 22215 + GCA001639275_00619 Bro-N domain-containing protein SO:0001217, UniRef:UniRef50_G5SVA9 contig_49 cds 24068 24331 - GCA001639275_00620 hypothetical protein PFAM:PF09297.16, PFAM:PF13240.11, PFAM:PF13248.11, PFAM:PF14803.11, PFAM:PF17032.10, PFAM:PF18912.6, PFAM:PF24460.1, PFAM:PF24463.1 contig_49 cds 24400 26001 - GCA001639275_00621 hypothetical protein PFAM:PF02369.22, PFAM:PF07602.17 contig_49 cds 26207 27736 + GCA001639275_00622 hypothetical protein PFAM:PF01656.29, PFAM:PF07685.20, PFAM:PF13500.12 contig_49 cds 27711 28454 - GCA001639275_00623 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_49 cds 29135 30421 - GCA001639275_00624 hypothetical protein PFAM:PF13635.12 contig_49 cds 31370 32650 - GCA001639275_00625 hypothetical protein PFAM:PF13635.12 contig_50 cds 169 1554 + GCA001639275_00626 hypothetical protein PFAM:PF01345.24, PFAM:PF24346.1 contig_50 cds 2887 3393 - GCA001639275_00627 hypothetical protein PFAM:PF13565.12, PFAM:PF13592.12 contig_50 cds 3975 4091 + GCA001639275_00628 hypothetical protein contig_50 cds 4252 4971 + GCA001639275_00629 hypothetical protein contig_50 cds 5387 5518 - GCA001639275_00630 hypothetical protein contig_50 cds 5717 6277 + GCA001639275_00631 hypothetical protein PFAM:PF13508.13, PFAM:PF13673.13 contig_50 cds 6267 7178 - GCA001639275_00632 hypothetical protein PFAM:PF00482.28 contig_50 cds 7171 8613 - GCA001639275_00633 hypothetical protein PFAM:PF00437.27 contig_50 cds 8725 9663 + GCA001639275_00634 hypothetical protein PFAM:PF05175.20 contig_50 cds 10038 10352 + GCA001639275_00635 hypothetical protein contig_50 cds 10629 11879 - GCA001639275_00636 hypothetical protein contig_50 cds 12050 12664 + GCA001639275_00637 hypothetical protein contig_50 cds 12661 13128 - GCA001639275_00638 hypothetical protein PFAM:PF01047.28 contig_50 cds 13224 13493 - GCA001639275_00639 hypothetical protein PFAM:PF00736.24 contig_50 cds 13514 13675 - GCA001639275_00640 hypothetical protein PFAM:PF07754.17 contig_50 cds 13676 14335 - GCA001639275_00641 hypothetical protein contig_50 cds 14389 14727 - GCA001639275_00642 hypothetical protein contig_50 cds 15262 16245 + GCA001639275_00643 hypothetical protein contig_50 cds 16257 17081 - GCA001639275_00644 hypothetical protein contig_50 cds 17087 18808 - GCA001639275_00645 hypothetical protein PFAM:PF00005.33, PFAM:PF00485.24, PFAM:PF00910.28, PFAM:PF00931.28, PFAM:PF01078.27, PFAM:PF02463.25, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13479.12, PFAM:PF13555.12, PFAM:PF20720.3 contig_50 cds 18818 20584 - GCA001639275_00646 hypothetical protein PFAM:PF00005.33 contig_50 cds 20584 22329 - GCA001639275_00647 hypothetical protein PFAM:PF00005.33 contig_50 cds 22396 22962 - GCA001639275_00648 hypothetical protein contig_50 cds 23298 25076 + GCA001639275_00649 hypothetical protein PFAM:PF00005.33, PFAM:PF00037.32 contig_50 cds 25073 25441 - GCA001639275_00650 hypothetical protein PFAM:PF08859.16 contig_50 cds 25463 25633 - GCA001639275_00651 hypothetical protein PFAM:PF00037.32 contig_50 cds 25883 27058 - GCA001639275_00652 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25 contig_50 cds 27421 28092 - GCA001639275_00653 hypothetical protein PFAM:PF13529.12 contig_50 cds 28143 28907 - GCA001639275_00654 hypothetical protein PFAM:PF22337.1 contig_50 cds 28912 31233 - GCA001639275_00655 hypothetical protein contig_51 cds 615 845 + GCA001639275_00656 hypothetical protein contig_51 cds 738 1115 - GCA001639275_00657 GtrA/DPMS transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_R9LNT3 contig_51 cds 1139 2635 - GCA001639275_00658 hypothetical protein contig_51 cds 2707 3645 - GCA001639275_00659 Bactoprenol glucosyl transferase-like protein from prophage CPS-53 SO:0001217, UniRef:UniRef50_A0A174NEJ2 contig_51 cds 4093 4671 - GCA001639275_00660 hypothetical protein PFAM:PF01609.27 contig_51 cds 5010 5300 - GCA001639275_00661 hypothetical protein contig_51 cds 5415 5702 - GCA001639275_00662 hypothetical protein PFAM:PF16363.11 contig_51 cds 6009 6644 - GCA001639275_00663 hypothetical protein PFAM:PF00571.33 contig_51 cds 6657 7484 - GCA001639275_00664 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_51 cds 7547 8479 - GCA001639275_00665 hypothetical protein PFAM:PF00294.29 contig_51 cds 8489 9379 - GCA001639275_00666 hypothetical protein PFAM:PF01913.23, PFAM:PF02741.20 contig_51 cds 9389 10435 - GCA001639275_00667 hypothetical protein contig_51 cds 10440 11798 - GCA001639275_00668 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13247.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_51 cds 11804 12829 - GCA001639275_00669 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_51 cds 12830 13954 - GCA001639275_00670 hypothetical protein contig_51 cds 13951 14400 - GCA001639275_00671 hypothetical protein PFAM:PF01058.29 contig_51 cds 14420 14806 - GCA001639275_00672 hypothetical protein PFAM:PF09218.15 contig_51 cds 14811 15119 - GCA001639275_00673 hypothetical protein contig_51 cds 15128 15382 - GCA001639275_00674 hypothetical protein contig_51 cds 15395 16246 - GCA001639275_00675 hypothetical protein contig_51 cds 16263 16478 - GCA001639275_00676 hypothetical protein contig_51 cds 16487 17158 - GCA001639275_00677 hypothetical protein PFAM:PF00361.26 contig_51 cds 17168 17863 - GCA001639275_00678 hypothetical protein contig_51 cds 17863 18456 - GCA001639275_00679 hypothetical protein contig_51 cds 18453 18713 - GCA001639275_00680 hypothetical protein contig_51 cds 18706 18975 - GCA001639275_00681 hypothetical protein PFAM:PF13244.11 contig_51 cds 18985 19233 - GCA001639275_00682 hypothetical protein contig_51 cds 19238 19735 - GCA001639275_00683 hypothetical protein contig_51 cds 19728 20111 - GCA001639275_00684 hypothetical protein contig_51 cds 20226 21158 + GCA001639275_00685 hypothetical protein PFAM:PF04321.23, PFAM:PF13460.12, PFAM:PF16363.11 contig_51 cds 21168 21998 + GCA001639275_00686 hypothetical protein contig_51 cds 21979 22344 - GCA001639275_00687 hypothetical protein contig_51 cds 22521 23072 + GCA001639275_00688 hypothetical protein PFAM:PF01381.28, PFAM:PF07883.17, PFAM:PF12844.13 contig_51 cds 23092 24759 + GCA001639275_00689 Acetyl-coenzyme A synthetase SO:0001217, UniRef:UniRef50_K5ZS30 contig_51 cds 24771 25049 + GCA001639275_00690 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF14697.11 contig_51 cds 25055 26167 + GCA001639275_00691 hypothetical protein PFAM:PF17147.9 contig_51 cds 26179 27621 + GCA001639275_00692 hypothetical protein PFAM:PF01558.24, PFAM:PF02775.26 contig_51 cds 27632 28942 + GCA001639275_00693 hypothetical protein PFAM:PF00710.25, PFAM:PF17763.6, PFAM:PF18195.6 contig_51 cds 28955 30820 + GCA001639275_00694 hypothetical protein PFAM:PF02637.23, PFAM:PF02934.20, PFAM:PF02938.19 contig_52 cds 1241 1501 - GCA001639275_00695 hypothetical protein contig_52 cds 1502 1708 - GCA001639275_00696 hypothetical protein contig_52 cds 2592 3665 + GCA001639275_00697 hypothetical protein contig_52 cds 3811 4596 + GCA001639275_00698 hypothetical protein contig_52 cds 4597 5256 - GCA001639275_00699 hypothetical protein PFAM:PF13291.12, PFAM:PF18462.6, PFAM:PF22629.2 contig_52 cds 5243 5500 - GCA001639275_00700 hypothetical protein contig_52 cds 5523 6521 - GCA001639275_00701 hypothetical protein contig_52 cds 6526 7653 - GCA001639275_00702 hypothetical protein contig_52 cds 7666 8112 - GCA001639275_00703 hypothetical protein PFAM:PF01058.29 contig_52 cds 8113 8604 - GCA001639275_00704 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF14697.11 contig_52 cds 8605 10014 - GCA001639275_00705 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13370.11, PFAM:PF13459.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_52 cds 10027 10275 - GCA001639275_00706 hypothetical protein contig_52 cds 10285 10758 - GCA001639275_00707 hypothetical protein contig_52 cds 10755 11036 - GCA001639275_00708 hypothetical protein contig_52 cds 11029 11364 - GCA001639275_00709 hypothetical protein contig_52 cds 11361 12815 - GCA001639275_00710 hypothetical protein PFAM:PF00361.26 contig_52 cds 12808 13194 - GCA001639275_00711 hypothetical protein contig_52 cds 13194 13427 - GCA001639275_00712 hypothetical protein PFAM:PF13244.11 contig_52 cds 13429 13857 - GCA001639275_00713 hypothetical protein contig_52 cds 13857 14117 - GCA001639275_00714 hypothetical protein contig_52 cds 14173 14487 - GCA001639275_00715 hypothetical protein contig_52 cds 14659 15627 + GCA001639275_00716 Arsenic resistance protein SO:0001217, UniRef:UniRef50_A0A0B5AP30 contig_52 cds 15624 16325 - GCA001639275_00717 hypothetical protein PFAM:PF04307.19 contig_52 cds 16454 17194 - GCA001639275_00718 hypothetical protein PFAM:PF24827.1 contig_52 cds 17254 19173 + GCA001639275_00719 hypothetical protein PFAM:PF13086.12, PFAM:PF13087.12, PFAM:PF13245.12, PFAM:PF13604.12 contig_52 cds 19507 19842 - GCA001639275_00720 hypothetical protein contig_52 cds 19991 21166 + GCA001639275_00721 hypothetical protein PFAM:PF00733.27, PFAM:PF00764.25, PFAM:PF20979.2 contig_52 cds 21181 21879 - GCA001639275_00722 Sugar fermentation stimulation -like protein SO:0001217, UniRef:UniRef50_Q97MP8 contig_52 cds 21866 23401 - GCA001639275_00723 hypothetical protein PFAM:PF01256.23, PFAM:PF03853.21 contig_52 cds 23907 24797 - GCA001639275_00724 hypothetical protein PFAM:PF01913.23, PFAM:PF02741.20 contig_52 cds 24884 25942 - GCA001639275_00725 Phosphatidylglycerol lysyltransferase SO:0001217, UniRef:UniRef50_A0A3B9Z9H3 contig_52 cds 26015 27448 + GCA001639275_00726 hypothetical protein contig_52 cds 27504 28154 + GCA001639275_00727 hypothetical protein PFAM:PF02080.26, PFAM:PF02254.24, PFAM:PF13241.12 contig_52 cds 28211 29764 - GCA001639275_00728 hypothetical protein contig_53 cds 351 992 + GCA001639275_00729 hypothetical protein contig_53 cds 1206 2495 + GCA001639275_00730 Uracil permease SO:0001217, UniRef:UniRef50_A0A3B8SNL8 contig_53 cds 2488 3114 + GCA001639275_00731 Uracil phosphoribosyltransferase SO:0001217, UniRef:UniRef50_Q5SIQ7 contig_53 cds 3381 4055 + GCA001639275_00732 hypothetical protein contig_53 cds 4094 4708 - GCA001639275_00733 Dipeptide ABC superfamily ATP binding cassette transporter, ABC protein SO:0001217, UniRef:UniRef50_F9ENK6 contig_53 cds 4710 5657 - GCA001639275_00734 nikD Nickel import system ATP-binding protein NikD SO:0001217, UniRef:UniRef50_A0A1M7T254 contig_53 cds 5668 6501 - GCA001639275_00735 hypothetical protein contig_53 cds 6494 7486 - GCA001639275_00736 hypothetical protein contig_53 cds 7548 9176 - GCA001639275_00737 hypothetical protein PFAM:PF00496.27 contig_53 cds 10406 10819 + GCA001639275_00738 hypothetical protein contig_53 cds 10785 11288 - GCA001639275_00739 Sulfate exporter family transporter SO:0001217, UniRef:UniRef50_A0A9D2U2K5 contig_53 cds 12018 12635 + GCA001639275_00740 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_53 cds 12651 13271 + GCA001639275_00741 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_53 cds 13364 13714 + GCA001639275_00742 hypothetical protein contig_53 cds 15909 16466 + GCA001639275_00743 hypothetical protein contig_53 cds 16438 16911 + GCA001639275_00744 hypothetical protein contig_53 cds 16954 18165 - GCA001639275_00745 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12569.14, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF22860.2, PFAM:PF25062.1, PFAM:PF25064.1 contig_53 cds 18176 18454 - GCA001639275_00746 hypothetical protein contig_53 cds 18527 18868 - GCA001639275_00747 hypothetical protein contig_53 cds 19050 19433 + GCA001639275_00748 hypothetical protein contig_53 cds 19498 19827 + GCA001639275_00749 hypothetical protein contig_53 cds 19842 20606 - GCA001639275_00750 hypothetical protein contig_53 cds 20618 21547 - GCA001639275_00751 hypothetical protein contig_53 cds 22004 22270 + GCA001639275_00752 hypothetical protein contig_53 cds 22298 24442 + GCA001639275_00753 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_U2JSI1 contig_53 cds 24667 28242 + GCA001639275_00754 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF24025.1 contig_54 cds 1074 2702 + GCA001639275_00755 hypothetical protein PFAM:PF00149.33, PFAM:PF01336.31 contig_54 cds 2714 3301 + GCA001639275_00756 hypothetical protein PFAM:PF00596.26 contig_54 cds 3298 3465 - GCA001639275_00757 hypothetical protein PFAM:PF01402.27 contig_54 cds 3587 3850 + GCA001639275_00758 hypothetical protein contig_54 cds 3863 4876 - GCA001639275_00759 hypothetical protein PFAM:PF01890.21, PFAM:PF11760.13 contig_54 cds 4873 5898 - GCA001639275_00760 hypothetical protein contig_54 cds 5950 6441 + GCA001639275_00761 hypothetical protein contig_54 cds 6970 8121 + GCA001639275_00762 hypothetical protein PFAM:PF09079.17, PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF22606.2, PFAM:PF22703.2 contig_54 cds 8114 9022 - GCA001639275_00763 Aspartate carbamoyltransferase catalytic subunit SO:0001217, UniRef:UniRef50_A6LA97 contig_54 cds 9075 9938 - GCA001639275_00764 hypothetical protein PFAM:PF08029.16 contig_54 cds 10128 10337 + GCA001639275_00765 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23 contig_54 cds 10375 11679 + GCA001639275_00766 5-methylthioadenosine/S-adenosylhomocysteine deaminase SO:0001217, UniRef:UniRef50_Q2RJW1 contig_54 cds 11672 13315 - GCA001639275_00767 hypothetical protein PFAM:PF02910.25, PFAM:PF07992.20 contig_54 cds 13425 13799 + GCA001639275_00768 hypothetical protein PFAM:PF01982.22 contig_54 ncRNA-region 13846 13972 + FMN riboswitch aptamer (RFN element) RFAM:RF00050, SO:0000035 contig_54 cds 14015 14698 + GCA001639275_00769 hypothetical protein contig_54 cds 14695 15105 - GCA001639275_00770 hypothetical protein contig_54 cds 15105 16595 - GCA001639275_00771 hypothetical protein PFAM:PF01656.29, PFAM:PF01965.30, PFAM:PF07685.20, PFAM:PF13500.12 contig_54 cds 16710 18080 - GCA001639275_00772 hypothetical protein PFAM:PF01425.27 contig_54 cds 18177 18971 + GCA001639275_00773 hypothetical protein PFAM:PF00702.32 contig_54 cds 18968 19684 - GCA001639275_00774 hypothetical protein PFAM:PF01261.30 contig_54 cds 19785 21317 + GCA001639275_00775 hypothetical protein PFAM:PF00682.25, PFAM:PF08502.15, PFAM:PF22617.1 contig_54 cds 21397 21669 + GCA001639275_00776 hypothetical protein contig_54 cds 21679 22338 - GCA001639275_00777 hypothetical protein PFAM:PF13263.12 contig_54 cds 22340 23371 - GCA001639275_00778 hypothetical protein contig_54 cds 23461 24762 + GCA001639275_00779 hypothetical protein contig_54 cds 25221 26069 + GCA001639275_00780 Sporulation initiation inhibitor protein Soj SO:0001217, UniRef:UniRef50_A0A1V5DY51 contig_54 cds 26062 26754 + GCA001639275_00781 hypothetical protein contig_54 cds 26751 27875 - GCA001639275_00782 hypothetical protein PFAM:PF04055.27, PFAM:PF12836.13 contig_55 cds 291 656 + GCA001639275_00783 hypothetical protein contig_55 cds 625 882 + GCA001639275_00784 hypothetical protein PFAM:PF01985.26 contig_55 cds 980 1417 + GCA001639275_00785 hypothetical protein contig_55 cds 1441 1797 + GCA001639275_00786 hypothetical protein contig_55 cds 1803 2387 + GCA001639275_00787 hypothetical protein contig_55 cds 2412 2567 + GCA001639275_00788 hypothetical protein contig_55 cds 2580 2825 + GCA001639275_00789 hypothetical protein contig_55 cds 2875 3567 + GCA001639275_00790 hypothetical protein contig_55 cds 3564 3788 + GCA001639275_00791 hypothetical protein PFAM:PF01775.22 contig_55 cds 3808 4239 + GCA001639275_00792 hypothetical protein PFAM:PF02996.22 contig_55 cds 4489 4665 + GCA001639275_00793 hypothetical protein contig_55 cds 5122 6306 + GCA001639275_00794 hypothetical protein PFAM:PF00448.28, PFAM:PF02881.24, PFAM:PF13604.12 contig_55 cds 7217 8140 + GCA001639275_00795 hypothetical protein PFAM:PF13200.12 contig_55 cds 8142 8519 - GCA001639275_00796 hypothetical protein contig_55 cds 8594 10072 + GCA001639275_00797 hypothetical protein contig_55 cds 10285 10470 - GCA001639275_00798 hypothetical protein PFAM:PF01361.26 contig_55 cds 10568 11026 + GCA001639275_00799 hypothetical protein PFAM:PF00692.24, PFAM:PF22769.1 contig_55 cds 11023 12555 + GCA001639275_00800 hypothetical protein PFAM:PF00205.28, PFAM:PF02775.26, PFAM:PF02776.23 contig_55 cds 12558 12821 - GCA001639275_00801 hypothetical protein contig_55 cds 12811 13362 - GCA001639275_00802 hypothetical protein contig_55 cds 13375 13797 - GCA001639275_00803 hypothetical protein contig_55 cds 13906 15048 - GCA001639275_00804 hypothetical protein PFAM:PF00266.25 contig_55 cds 15155 15391 - GCA001639275_00805 hypothetical protein contig_55 cds 15657 16376 + GCA001639275_00806 hypothetical protein contig_55 cds 16406 17515 + GCA001639275_00807 hypothetical protein PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF22703.2 contig_55 cds 17618 17800 - GCA001639275_00808 hypothetical protein contig_55 cds 17890 18309 + GCA001639275_00809 hypothetical protein PFAM:PF01951.21 contig_55 cds 18344 18664 + GCA001639275_00810 hypothetical protein contig_55 cds 18700 20148 + GCA001639275_00811 hypothetical protein contig_55 cds 20153 20911 + GCA001639275_00812 hypothetical protein PFAM:PF01048.26 contig_55 cds 20922 21491 + GCA001639275_00813 hypothetical protein PFAM:PF03358.20 contig_55 cds 21493 21813 + GCA001639275_00814 hypothetical protein contig_55 cds 21825 23219 - GCA001639275_00815 hypothetical protein contig_55 cds 24227 24808 + GCA001639275_00816 hypothetical protein contig_55 cds 24964 25644 + GCA001639275_00817 hypothetical protein contig_56 cds 1115 1702 + GCA001639275_00818 hypothetical protein PFAM:PF01345.24 contig_56 cds 1783 2112 + GCA001639275_00819 TIGR04076 family protein SO:0001217, UniRef:UniRef50_F9ZAD3 contig_56 cds 2096 2716 - GCA001639275_00820 hypothetical protein PFAM:PF00302.23 contig_56 cds 2808 4139 + GCA001639275_00821 hypothetical protein PFAM:PF00070.33, PFAM:PF01266.30, PFAM:PF02852.28, PFAM:PF07992.20, PFAM:PF13450.12 contig_56 cds 4159 5034 + GCA001639275_00822 Iron-sulfur cluster carrier protein SO:0001217, UniRef:UniRef50_A0A1G1GLI8 contig_56 cds 5021 5413 - GCA001639275_00823 hypothetical protein contig_56 cds 5507 10087 + GCA001639275_00824 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_56 cds 10229 14116 + GCA001639275_00825 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF18560.7 contig_56 cds 14156 16648 + GCA001639275_00826 hypothetical protein PFAM:PF16640.11 contig_56 cds 17542 17721 + GCA001639275_00827 hypothetical protein contig_56 cds 17730 17984 + GCA001639275_00828 hypothetical protein contig_56 cds 18187 18609 - GCA001639275_00829 hypothetical protein contig_56 cds 18784 19155 - GCA001639275_00830 hypothetical protein PFAM:PF08546.17 contig_56 cds 19162 19734 - GCA001639275_00831 hypothetical protein PFAM:PF02558.23 contig_56 cds 20194 20454 + GCA001639275_00832 hypothetical protein contig_56 cds 20479 20694 + GCA001639275_00833 hypothetical protein contig_56 cds 20738 22099 - GCA001639275_00834 hypothetical protein contig_56 cds 22101 22574 - GCA001639275_00835 hypothetical protein PFAM:PF01047.28, PFAM:PF01638.23, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13601.12 contig_56 cds 23359 23511 + GCA001639275_00836 hypothetical protein contig_57 cds 670 2316 - GCA001639275_00837 hypothetical protein contig_57 cds 2413 2529 - GCA001639275_00838 hypothetical protein contig_57 cds 3183 4196 - GCA001639275_00839 Ribulose-5-phosphate reductase SO:0001217, UniRef:UniRef50_A0A143XUA5 contig_57 cds 4200 4901 - GCA001639275_00840 Ribitol-5-phosphate cytidylyltransferase 2 SO:0001217, UniRef:UniRef50_Q2G2C4 contig_57 cds 4903 5508 - GCA001639275_00841 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_57 cds 5895 10295 - GCA001639275_00842 hypothetical protein PFAM:PF02369.22, PFAM:PF05048.19, PFAM:PF13229.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_57 cds 10347 12422 - GCA001639275_00843 hypothetical protein PFAM:PF02369.22, PFAM:PF13229.12, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_57 cds 13356 14189 + GCA001639275_00844 hypothetical protein contig_57 cds 14207 16285 - GCA001639275_00845 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_57 cds 16523 16825 - GCA001639275_00846 hypothetical protein contig_57 cds 16826 17470 - GCA001639275_00847 hypothetical protein contig_57 cds 17467 18099 - GCA001639275_00848 hypothetical protein contig_57 cds 18171 18740 - GCA001639275_00849 hypothetical protein PFAM:PF01258.23, PFAM:PF02663.19 contig_57 cds 18751 19554 - GCA001639275_00850 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_57 cds 19545 20558 - GCA001639275_00851 Iron ABC transporter permease SO:0001217, UniRef:UniRef50_A0A0Q3VJE8 contig_57 cds 20567 21670 - GCA001639275_00852 hypothetical protein PFAM:PF01497.23 contig_57 cds 22331 23512 - GCA001639275_00853 hypothetical protein PFAM:PF01609.27 contig_57 cds 23916 24179 + GCA001639275_00854 hypothetical protein contig_57 cds 24183 24359 + GCA001639275_00855 hypothetical protein contig_58 cds 593 1627 - GCA001639275_00856 hypothetical protein PFAM:PF01170.24, PFAM:PF01555.25, PFAM:PF02926.22 contig_58 cds 1885 2805 - GCA001639275_00857 hypothetical protein PFAM:PF03703.20 contig_58 cds 2935 4188 - GCA001639275_00858 hypothetical protein PFAM:PF00004.35, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF16450.11, PFAM:PF17862.7 contig_58 cds 4322 4831 + GCA001639275_00859 hypothetical protein PFAM:PF01381.28 contig_58 cds 4832 5266 - GCA001639275_00860 hypothetical protein contig_58 cds 5304 6563 - GCA001639275_00861 hypothetical protein contig_58 cds 6568 7008 - GCA001639275_00862 hypothetical protein contig_58 cds 7081 8505 - GCA001639275_00863 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_58 cds 8514 9584 - GCA001639275_00864 hypothetical protein PFAM:PF10555.14 contig_58 cds 9652 10749 - GCA001639275_00865 hypothetical protein PFAM:PF02222.28, PFAM:PF02786.22 contig_58 cds 10746 11225 - GCA001639275_00866 hypothetical protein PFAM:PF01750.23 contig_58 cds 11235 12002 - GCA001639275_00867 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_58 cds 12013 12441 - GCA001639275_00868 hypothetical protein PFAM:PF01402.27, PFAM:PF08753.17 contig_58 cds 12587 13054 - GCA001639275_00869 hypothetical protein contig_58 cds 13420 13977 + GCA001639275_00870 hypothetical protein contig_58 cds 13977 14513 + GCA001639275_00871 Cytokinin riboside 5'-monophosphate phosphoribohydrolase SO:0001217, UniRef:UniRef50_A0A3R6TM45 contig_58 cds 14581 14772 - GCA001639275_00872 hypothetical protein contig_58 cds 14836 15060 - GCA001639275_00873 hypothetical protein contig_58 cds 15193 16914 + GCA001639275_00874 hypothetical protein PFAM:PF00005.33 contig_58 cds 16911 18689 + GCA001639275_00875 ABC transporter SO:0001217, UniRef:UniRef50_H1PMX0 contig_58 cds 19017 20264 - GCA001639275_00876 hypothetical protein PFAM:PF09670.15, PFAM:PF22205.1 contig_58 cds 20264 23491 - GCA001639275_00877 hypothetical protein PFAM:PF00580.27, PFAM:PF12705.13, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_58 cds 23661 24038 + GCA001639275_00878 hypothetical protein PFAM:PF08797.16 contig_59 cds 357 854 + GCA001639275_00879 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12 contig_59 cds 1745 2782 + GCA001639275_00880 hypothetical protein PFAM:PF13102.12 contig_59 cds 3035 5050 + GCA001639275_00881 hypothetical protein PFAM:PF07669.17, PFAM:PF20473.4 contig_59 cds 5274 5468 + GCA001639275_00882 hypothetical protein contig_59 cds 7060 7170 - GCA001639275_00883 hypothetical protein contig_59 cds 7145 7420 - GCA001639275_00884 hypothetical protein contig_59 cds 8526 10154 + GCA001639275_00885 hypothetical protein contig_59 cds 10165 13698 - GCA001639275_00886 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_D4K724 contig_59 cds 13816 16047 + GCA001639275_00887 hypothetical protein PFAM:PF07669.17 contig_59 cds 16113 16706 + GCA001639275_00888 hypothetical protein contig_59 cds 16707 17288 + GCA001639275_00889 hypothetical protein PFAM:PF08747.16 contig_59 cds 17301 20882 + GCA001639275_00890 hypothetical protein contig_59 cds 20893 21408 + GCA001639275_00891 hypothetical protein PFAM:PF08819.17 contig_59 cds 21410 23908 + GCA001639275_00892 hypothetical protein PFAM:PF08665.17 contig_59 cds 23919 25967 + GCA001639275_00893 ATP-dependent Lon protease SO:0001217, UniRef:UniRef50_A0A9X1VBT9 contig_59 cds 25987 26112 - GCA001639275_00894 hypothetical protein contig_59 cds 26144 26479 - GCA001639275_00895 hypothetical protein contig_59 cds 27002 27238 + GCA001639275_00896 hypothetical protein contig_59 cds 27314 27886 + GCA001639275_00897 hypothetical protein contig_59 cds 28027 28977 + GCA001639275_00898 hypothetical protein contig_59 cds 28984 29604 - GCA001639275_00899 hypothetical protein PFAM:PF04289.18, PFAM:PF20766.2 contig_59 cds 29601 29966 - GCA001639275_00900 hypothetical protein contig_59 cds 30019 32115 - GCA001639275_00901 hypothetical protein PFAM:PF02629.25, PFAM:PF13380.12, PFAM:PF13549.11, PFAM:PF13607.11, PFAM:PF19045.5 contig_59 cds 32359 33279 + GCA001639275_00902 hypothetical protein contig_59 cds 33289 34209 + GCA001639275_00903 hypothetical protein PFAM:PF00753.33, PFAM:PF12706.13, PFAM:PF13483.12 contig_59 cds 34213 35307 - GCA001639275_00904 Chorismate synthase SO:0001217, UniRef:UniRef50_Q3Z993 contig_59 cds 35362 35568 - GCA001639275_00905 hypothetical protein contig_59 cds 35717 36721 + GCA001639275_00906 Delta-aminolevulinic acid dehydratase SO:0001217, UniRef:UniRef50_A0A7V6YG86 contig_59 cds 36718 37593 + GCA001639275_00907 hypothetical protein contig_59 cds 37604 38350 + GCA001639275_00908 hypothetical protein PFAM:PF00515.34, PFAM:PF01239.28, PFAM:PF07719.23, PFAM:PF12569.14, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14863.12, PFAM:PF23914.1, PFAM:PF25063.1, PFAM:PF25064.1 contig_59 cds 38795 40339 + GCA001639275_00909 hypothetical protein PFAM:PF01409.25, PFAM:PF10771.15, PFAM:PF13412.12, PFAM:PF17759.6 contig_59 cds 40339 41112 + GCA001639275_00910 Exodeoxyribonuclease SO:0001217, UniRef:UniRef50_A0A0B7GZ74 contig_59 cds 41124 41825 - GCA001639275_00911 hypothetical protein PFAM:PF00702.32, PFAM:PF13242.12 contig_59 cds 41870 42565 - GCA001639275_00912 hypothetical protein contig_59 cds 42769 43116 + GCA001639275_00913 hypothetical protein contig_59 cds 43187 43627 + GCA001639275_00914 hypothetical protein contig_59 cds 43639 43896 + GCA001639275_00915 hypothetical protein contig_59 cds 44098 44472 + GCA001639275_00916 hypothetical protein contig_59 cds 44564 45583 + GCA001639275_00917 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_59 cds 45593 46006 + GCA001639275_00918 hypothetical protein PFAM:PF06271.18 contig_59 cds 46022 46714 - GCA001639275_00919 hypothetical protein PFAM:PF12705.13 contig_59 cds 46796 47662 + GCA001639275_00920 Radical SAM core domain-containing protein SO:0001217, UniRef:UniRef50_F7JM63 contig_59 cds 47690 48970 + GCA001639275_00921 RNA helicase SO:0001217, UniRef:UniRef50_A0A0P7YFH7 contig_59 cds 48976 49779 - GCA001639275_00922 hypothetical protein PFAM:PF01047.28, PFAM:PF08279.18, PFAM:PF13412.12, PFAM:PF13463.12 contig_59 cds 49840 51252 - GCA001639275_00923 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF21763.2 contig_59 cds 51249 51518 - GCA001639275_00924 hypothetical protein contig_59 cds 51540 52631 - GCA001639275_00925 UDP-galactopyranose mutase SO:0001217, UniRef:UniRef50_A0A7S6UFQ3 contig_59 cds 52636 53739 - GCA001639275_00926 hypothetical protein PFAM:PF00535.33 contig_59 cds 53729 54502 - GCA001639275_00927 hypothetical protein contig_59 cds 54772 56265 + GCA001639275_00928 hypothetical protein contig_59 cds 56411 56500 - GCA001639275_00929 hypothetical protein contig_59 cds 56500 56694 - GCA001639275_00930 hypothetical protein contig_59 cds 56798 57175 + GCA001639275_00931 hypothetical protein contig_59 cds 57543 58274 + GCA001639275_00932 Phosphoribosylaminoimidazole-succinocarboxamide synthase SO:0001217, UniRef:UniRef50_Q8RC58 contig_59 cds 58284 58550 + GCA001639275_00933 hypothetical protein contig_59 cds 58551 59195 + GCA001639275_00934 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ SO:0001217, UniRef:UniRef50_Q7NL01 contig_59 cds 59205 59915 + GCA001639275_00935 uroporphyrinogen-III C-methyltransferase SO:0001217, UniRef:UniRef50_A0A972SI56 contig_59 cds 59927 61714 + GCA001639275_00936 hypothetical protein PFAM:PF01380.27, PFAM:PF13522.11, PFAM:PF13537.11 contig_59 cds 61802 63658 + GCA001639275_00937 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7 contig_59 cds 64281 65768 + GCA001639275_00938 hypothetical protein contig_59 cds 65876 68479 + GCA001639275_00939 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7 contig_59 cds 68540 74137 + GCA001639275_00940 hypothetical protein PFAM:PF02415.23, PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF16640.11 contig_59 cds 74531 76420 + GCA001639275_00941 hypothetical protein PFAM:PF02369.22, PFAM:PF17789.7 contig_59 cds 76405 77604 - GCA001639275_00942 hypothetical protein contig_59 cds 77827 79806 + GCA001639275_00943 hypothetical protein PFAM:PF01702.25, PFAM:PF14810.12 contig_59 cds 79816 80484 + GCA001639275_00944 hypothetical protein PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_59 tRNA 80871 80944 + GCA001639275_00945 trnG tRNA-Gly(gcc) SO:0000260 contig_59 tRNA 80952 81025 + GCA001639275_00946 trnG tRNA-Gly(tcc) SO:0000260 contig_59 cds 81168 82205 + GCA001639275_00947 hypothetical protein PFAM:PF01154.23, PFAM:PF08541.16 contig_59 cds 82216 83376 + GCA001639275_00948 hypothetical protein PFAM:PF00108.29, PFAM:PF00109.32, PFAM:PF02803.24, PFAM:PF22691.2 contig_59 cds 83401 83691 + GCA001639275_00949 DUF1848 domain-containing protein SO:0001217, UniRef:UniRef50_A0A7U6KD63 contig_59 cds 83645 84298 + GCA001639275_00950 hypothetical protein contig_59 cds 84405 85370 + GCA001639275_00951 DUF1848 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Y4BM84 contig_59 cds 85455 86399 + GCA001639275_00952 hypothetical protein contig_59 cds 86366 86845 + GCA001639275_00953 hypothetical protein contig_59 cds 87003 87203 - GCA001639275_00954 hypothetical protein contig_59 cds 87599 87931 - GCA001639275_00955 hypothetical protein contig_59 cds 88285 88668 + GCA001639275_00956 hypothetical protein contig_59 cds 88647 89534 + GCA001639275_00957 hypothetical protein contig_59 cds 89473 90060 - GCA001639275_00958 hypothetical protein PFAM:PF01420.25 contig_59 cds 90084 90812 + GCA001639275_00959 Restriction endonuclease subunit S SO:0001217, UniRef:UniRef50_A0A7C6BWB3 contig_59 cds 90809 91795 + GCA001639275_00960 Tyr recombinase domain-containing protein SO:0001217, UniRef:UniRef50_R9JNC5 contig_59 cds 91912 93126 - GCA001639275_00961 hypothetical protein PFAM:PF01420.25 contig_59 cds 93110 94657 - GCA001639275_00962 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A223KNY2 contig_59 cds 94666 97791 - GCA001639275_00963 Type I restriction enzyme endonuclease subunit SO:0001217, UniRef:UniRef50_A0A1G6CMD2 contig_59 cds 98154 99029 + GCA001639275_00964 hypothetical protein PFAM:PF18864.6 contig_59 cds 99181 99666 + GCA001639275_00965 hypothetical protein contig_59 cds 99659 99940 + GCA001639275_00966 hypothetical protein contig_59 cds 99882 100337 + GCA001639275_00967 hypothetical protein contig_59 cds 100692 101618 + GCA001639275_00968 hypothetical protein contig_59 cds 101855 102016 + GCA001639275_00969 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A5UP60, UniRef:UniRef90_UPI002A912ACF contig_59 cds 102077 102247 + GCA001639275_00970 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A5UP60, UniRef:UniRef90_UPI002A912ACF contig_59 cds 102457 107127 + GCA001639275_00971 hypothetical protein contig_59 cds 107347 107724 + GCA001639275_00972 hypothetical protein PFAM:PF09373.15 contig_59 cds 107732 108157 + GCA001639275_00973 hypothetical protein contig_59 cds 108265 108684 - GCA001639275_00974 hypothetical protein contig_59 cds 108756 109052 - GCA001639275_00975 hypothetical protein contig_59 cds 110122 110313 + GCA001639275_00976 hypothetical protein contig_59 cds 110574 110708 + GCA001639275_00977 hypothetical protein contig_59 cds 110822 112093 + GCA001639275_00978 hypothetical protein PFAM:PF13635.12 contig_59 cds 112553 113755 + GCA001639275_00979 AAA domain-containing protein SO:0001217, UniRef:UniRef50_S3XZU5 contig_59 cds 114625 114867 + GCA001639275_00980 hypothetical protein contig_59 cds 114864 115286 + GCA001639275_00981 hypothetical protein contig_59 cds 115830 116063 + GCA001639275_00982 hypothetical protein contig_59 cds 116282 117517 + GCA001639275_00983 hypothetical protein PFAM:PF13635.12 contig_59 cds 118161 118382 + GCA001639275_00984 hypothetical protein contig_59 cds 118375 118638 + GCA001639275_00985 hypothetical protein PFAM:PF05016.21 contig_59 cds 119201 120652 + GCA001639275_00986 hypothetical protein PFAM:PF13635.12 contig_60 cds 188 847 + GCA001639275_00987 hypothetical protein contig_60 cds 870 1082 + GCA001639275_00988 hypothetical protein contig_60 cds 1241 1885 + GCA001639275_00989 hypothetical protein contig_60 cds 2098 3105 + GCA001639275_00990 hypothetical protein contig_60 cds 3102 3896 - GCA001639275_00991 Amidohydrolase-related domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I0RAS2 contig_60 cds 3916 4716 - GCA001639275_00992 hypothetical protein contig_60 cds 4840 4938 - GCA001639275_00993 hypothetical protein contig_60 cds 5150 5494 - GCA001639275_00994 hypothetical protein contig_60 cds 5736 6677 + GCA001639275_00995 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF14559.12, PFAM:PF25064.1 contig_60 cds 6680 8044 - GCA001639275_00996 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF14559.12, PFAM:PF14853.12 contig_60 cds 8072 8389 - GCA001639275_00997 hypothetical protein contig_60 cds 8398 9162 - GCA001639275_00998 hypothetical protein PFAM:PF00149.33 contig_60 cds 9183 11696 - GCA001639275_00999 hypothetical protein contig_60 cds 11726 12337 - GCA001639275_01000 hypothetical protein contig_60 cds 12359 13732 - GCA001639275_01001 hypothetical protein contig_60 cds 13754 15367 - GCA001639275_01002 hypothetical protein PFAM:PF00069.31, PFAM:PF07714.23 contig_60 cds 15398 17695 - GCA001639275_01003 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF01078.27, PFAM:PF05496.18, PFAM:PF05621.17, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF10431.15, PFAM:PF12775.13, PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF17871.7, PFAM:PF20720.3 contig_60 cds 17939 18379 + GCA001639275_01004 D-aminoacyl-tRNA deacylase SO:0001217, UniRef:UniRef50_A6GW89 contig_60 cds 18985 19314 + GCA001639275_01005 hypothetical protein PFAM:PF03553.21 contig_60 cds 19940 20860 + GCA001639275_01006 hypothetical protein contig_60 cds 20879 22018 + GCA001639275_01007 Toxic anion resistance protein SO:0001217, UniRef:UniRef50_A0A2M9MRB1 contig_60 cds 22033 22557 + GCA001639275_01008 hypothetical protein contig_60 cds 22751 23029 + GCA001639275_01009 hypothetical protein PFAM:PF13240.11 contig_60 cds 23203 23592 - GCA001639275_01010 hypothetical protein contig_61 cds 220 315 + GCA001639275_01011 hypothetical protein contig_61 cds 448 1302 - GCA001639275_01012 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13432.12, PFAM:PF14559.12 contig_61 cds 1356 3011 - GCA001639275_01013 hypothetical protein PFAM:PF02249.22, PFAM:PF02745.20 contig_61 cds 3004 3807 - GCA001639275_01014 hypothetical protein PFAM:PF02240.21 contig_61 cds 3825 4319 - GCA001639275_01015 hypothetical protein contig_61 cds 4329 5660 - GCA001639275_01016 hypothetical protein PFAM:PF02241.23, PFAM:PF02783.20 contig_61 cds 6801 7382 - GCA001639275_01017 hypothetical protein PFAM:PF00117.34, PFAM:PF01174.25 contig_61 cds 7472 7939 - GCA001639275_01018 hypothetical protein PFAM:PF00514.29, PFAM:PF02985.28, PFAM:PF03130.22, PFAM:PF12717.13, PFAM:PF13513.12, PFAM:PF13646.12 contig_61 cds 8066 9043 + GCA001639275_01019 Isocitrate/homoisocitrate dehydrogenase SO:0001217, UniRef:UniRef50_Q5SIJ1 contig_61 cds 9044 10513 + GCA001639275_01020 hypothetical protein PFAM:PF13193.12 contig_61 cds 10527 11078 - GCA001639275_01021 hypothetical protein PFAM:PF00881.29 contig_61 cds 11120 11254 - GCA001639275_01022 hypothetical protein contig_61 cds 11445 13118 - GCA001639275_01023 hypothetical protein contig_61 cds 14200 15807 - GCA001639275_01024 hypothetical protein PFAM:PF19077.6 contig_61 cds 15823 18945 - GCA001639275_01025 hypothetical protein PFAM:PF00112.29, PFAM:PF16640.11, PFAM:PF17802.7, PFAM:PF18560.7 contig_62 cds 172 618 - GCA001639275_01026 hypothetical protein contig_62 cds 1317 2195 - GCA001639275_01027 hypothetical protein PFAM:PF01047.28, PFAM:PF01895.24, PFAM:PF13412.12 contig_62 cds 2204 3022 - GCA001639275_01028 hypothetical protein contig_62 cds 3110 4606 - GCA001639275_01029 hypothetical protein contig_62 cds 4949 5965 + GCA001639275_01030 hypothetical protein PFAM:PF22616.2 contig_62 cds 6104 7102 + GCA001639275_01031 hypothetical protein PFAM:PF04055.27, PFAM:PF06968.18 contig_62 cds 7137 7616 + GCA001639275_01032 hypothetical protein PFAM:PF11576.13 contig_62 cds 7620 8405 + GCA001639275_01033 hypothetical protein contig_62 cds 8406 9101 + GCA001639275_01034 hypothetical protein contig_62 cds 9116 9766 + GCA001639275_01035 hypothetical protein contig_62 cds 9750 10316 + GCA001639275_01036 hypothetical protein contig_62 tRNA 10318 10390 - GCA001639275_01037 trnT tRNA-Thr(ggt) SO:0000270 contig_62 tRNA 10426 10508 - GCA001639275_01038 trnL tRNA-Leu(taa) SO:0000264 contig_62 cds 10679 10858 + GCA001639275_01039 hypothetical protein PFAM:PF00037.32, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11 contig_62 cds 10878 11648 + GCA001639275_01040 hypothetical protein contig_62 cds 11661 12938 + GCA001639275_01041 hypothetical protein contig_62 cds 13194 13823 + GCA001639275_01042 hypothetical protein contig_62 cds 13825 14124 + GCA001639275_01043 hypothetical protein PFAM:PF13190.11 contig_62 cds 14180 15010 + GCA001639275_01044 hypothetical protein contig_62 cds 15020 15862 + GCA001639275_01045 ecfA Energy-coupling factor transporter ATP-binding protein EcfA SO:0001217, UniRef:UniRef50_Q3ABN1 contig_62 cds 15855 16058 - GCA001639275_01046 hypothetical protein contig_62 cds 16097 16327 - GCA001639275_01047 Fe(2+) transport protein A SO:0001217, UniRef:UniRef50_A0A9E2F4A8 contig_62 cds 16359 18461 - GCA001639275_01048 Ferrous iron transport protein B SO:0001217, UniRef:UniRef50_A0A9E2Q8D9 contig_62 cds 19675 19944 - GCA001639275_01049 hypothetical protein contig_63 cds 167 1312 - GCA001639275_01050 dnaJ Chaperone protein DnaJ SO:0001217, UniRef:UniRef50_B8CXL0 contig_63 cds 1440 3311 - GCA001639275_01051 hypothetical protein contig_63 cds 3352 3903 - GCA001639275_01052 hypothetical protein contig_63 cds 4017 4715 + GCA001639275_01053 hypothetical protein PFAM:PF01022.26 contig_63 cds 4701 6944 - GCA001639275_01054 hypothetical protein PFAM:PF00708.24, PFAM:PF07503.17, PFAM:PF17788.7, PFAM:PF22521.2 contig_63 cds 7029 7790 + GCA001639275_01055 hypothetical protein PFAM:PF00731.26 contig_63 cds 7792 8349 + GCA001639275_01056 hypothetical protein PFAM:PF13302.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_63 cds 8361 8870 - GCA001639275_01057 hypothetical protein contig_63 cds 8883 9704 - GCA001639275_01058 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_G1WG96 contig_63 cds 9714 10580 - GCA001639275_01059 hypothetical protein PFAM:PF01061.29 contig_63 cds 10555 10845 - GCA001639275_01060 hypothetical protein contig_63 cds 10846 11661 - GCA001639275_01061 hypothetical protein PFAM:PF00571.33 contig_63 cds 11666 13018 - GCA001639275_01062 hypothetical protein PFAM:PF02637.23, PFAM:PF02934.20 contig_63 cds 13163 13930 - GCA001639275_01063 hypothetical protein PFAM:PF12804.13, PFAM:PF20202.4 contig_63 cds 13940 14911 - GCA001639275_01064 hypothetical protein PFAM:PF02558.23, PFAM:PF02737.24, PFAM:PF03446.21, PFAM:PF07479.19, PFAM:PF20618.3 contig_63 cds 14946 15935 - GCA001639275_01065 hypothetical protein PFAM:PF04055.27 contig_63 tRNA 16129 16201 + GCA001639275_01066 trnN tRNA-Asn(gtt) SO:0000257 contig_63 tRNA 16207 16280 + GCA001639275_01067 trnI tRNA-Ile2(cat) SO:0000263 contig_63 tRNA 16310 16384 + GCA001639275_01068 trnE tRNA-Glu(ttc) SO:0000259 contig_63 tRNA 16439 16521 + GCA001639275_01069 trnL tRNA-Leu(tag) SO:0000264 contig_63 tRNA 16560 16635 + GCA001639275_01070 trnH tRNA-His(gtg) SO:0000262 contig_63 cds 16678 17085 + GCA001639275_01071 hypothetical protein contig_63 cds 17335 17949 + GCA001639275_01072 hypothetical protein PFAM:PF00753.33 contig_64 cds 664 1284 + GCA001639275_01073 hypothetical protein contig_64 cds 2581 3657 + GCA001639275_01074 NADP-dependent isopropanol dehydrogenase SO:0001217, UniRef:UniRef50_P25984 contig_64 cds 3727 4401 + GCA001639275_01075 hypothetical protein contig_64 cds 4414 4710 + GCA001639275_01076 hypothetical protein PFAM:PF03992.22 contig_64 cds 4829 6271 + GCA001639275_01077 hypothetical protein PFAM:PF02415.23 contig_64 cds 6249 8249 + GCA001639275_01078 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11 contig_64 cds 8356 11862 + GCA001639275_01079 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_64 cds 11869 12567 - GCA001639275_01080 hypothetical protein PFAM:PF00303.24 contig_64 cds 12645 13223 + GCA001639275_01081 hypothetical protein contig_64 cds 13220 14311 - GCA001639275_01082 Cation transporter SO:0001217, UniRef:UniRef50_A0A9D8QYH2 contig_64 cds 14455 15741 + GCA001639275_01083 hypothetical protein PFAM:PF13175.12, PFAM:PF13304.12 contig_64 cds 15751 16482 + GCA001639275_01084 hypothetical protein contig_65 cds 1009 1512 + GCA001639275_01085 hypothetical protein contig_65 cds 1525 2598 + GCA001639275_01086 hypothetical protein PFAM:PF00590.25 contig_65 cds 2607 3203 + GCA001639275_01087 hypothetical protein PFAM:PF01895.24, PFAM:PF02080.26 contig_65 cds 3237 4490 + GCA001639275_01088 hypothetical protein contig_65 cds 4487 5335 - GCA001639275_01089 hypothetical protein contig_65 cds 5335 6276 - GCA001639275_01090 hypothetical protein contig_65 cds 6447 6845 + GCA001639275_01091 hypothetical protein PFAM:PF01796.24, PFAM:PF12172.15 contig_65 cds 6817 7737 + GCA001639275_01092 hypothetical protein PFAM:PF01903.22 contig_65 cds 7798 8259 + GCA001639275_01093 hypothetical protein PFAM:PF01903.22 contig_65 cds 8317 9243 + GCA001639275_01094 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_65 cds 9230 10102 + GCA001639275_01095 hypothetical protein PFAM:PF04055.27 contig_65 cds 10522 16074 + GCA001639275_01096 hypothetical protein PFAM:PF02369.22, PFAM:PF02415.23, PFAM:PF13620.12, PFAM:PF16640.11 contig_66 cds 151 4866 + GCA001639275_01097 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11 contig_66 cds 5015 11848 + GCA001639275_01098 hypothetical protein PFAM:PF01011.27, PFAM:PF09430.16, PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF13620.12, PFAM:PF16640.11 contig_66 cds 14913 15032 - GCA001639275_01099 hypothetical protein contig_67 cds 669 863 + GCA001639275_01100 hypothetical protein contig_67 cds 913 1797 + GCA001639275_01101 hypothetical protein contig_67 cds 2231 2995 - GCA001639275_01102 hypothetical protein contig_67 cds 2992 3522 - GCA001639275_01103 hypothetical protein PFAM:PF04893.22 contig_67 cds 3956 4723 - GCA001639275_01104 hypothetical protein PFAM:PF13635.12 contig_67 cds 5620 6522 - GCA001639275_01105 hypothetical protein contig_67 cds 6535 6942 - GCA001639275_01106 hypothetical protein PFAM:PF01957.25 contig_67 cds 7305 7748 - GCA001639275_01107 hypothetical protein contig_67 cds 7873 8511 + GCA001639275_01108 hypothetical protein contig_67 cds 8517 9035 + GCA001639275_01109 hypothetical protein contig_67 cds 8991 9203 - GCA001639275_01110 hypothetical protein contig_67 cds 9427 9600 - GCA001639275_01111 hypothetical protein contig_67 cds 9779 13954 - GCA001639275_01112 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF13229.12, PFAM:PF24593.1 contig_67 cds 14068 14442 - GCA001639275_01113 hypothetical protein contig_68 cds 33 404 + GCA001639275_01114 hypothetical protein contig_68 cds 471 716 + GCA001639275_01115 hypothetical protein contig_68 cds 756 1283 - GCA001639275_01116 hypothetical protein contig_68 cds 1286 2209 - GCA001639275_01117 hypothetical protein PFAM:PF01916.23 contig_68 cds 2229 3131 - GCA001639275_01118 hypothetical protein PFAM:PF00571.33, PFAM:PF02082.26, PFAM:PF03444.21 contig_68 cds 3224 4198 - GCA001639275_01119 Xaa-Pro dipeptidyl-peptidase-like domain-containing protein SO:0001217, UniRef:UniRef50_H1CXB4 contig_68 cds 4268 6289 - GCA001639275_01120 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_A5N4C8 contig_68 cds 6617 7096 - GCA001639275_01121 Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_H1PY97 contig_68 cds 7151 8266 - GCA001639275_01122 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11 contig_68 cds 8310 8519 - GCA001639275_01123 hypothetical protein contig_68 cds 8643 9866 - GCA001639275_01124 hypothetical protein PFAM:PF00248.27, PFAM:PF13534.11 contig_68 cds 10123 10299 - GCA001639275_01125 hypothetical protein contig_68 cds 10265 10411 - GCA001639275_01126 hypothetical protein contig_68 cds 10401 11252 - GCA001639275_01127 UTP--glucose-1-phosphate uridylyltransferase SO:0001217, UniRef:UniRef50_Q05852 contig_68 tRNA 11386 11469 - GCA001639275_01128 trnL tRNA-Leu(gag) SO:0000264 contig_68 cds 11676 13013 + GCA001639275_01129 Xanthine/uracil/vitamin C permease SO:0001217, UniRef:UniRef50_M2P9U6 contig_68 cds 13000 13413 - GCA001639275_01130 hypothetical protein contig_68 cds 13639 14526 - GCA001639275_01131 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7 contig_69 cds 45 1976 + GCA001639275_01132 hypothetical protein PFAM:PF16640.11 contig_69 cds 2161 4368 + GCA001639275_01133 hypothetical protein contig_69 cds 4489 9663 + GCA001639275_01134 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_69 cds 10151 10414 - GCA001639275_01135 hypothetical protein contig_69 cds 12119 12313 - GCA001639275_01136 hypothetical protein contig_70 cds 853 2856 - GCA001639275_01137 hypothetical protein PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF07728.20, PFAM:PF14551.11, PFAM:PF17207.9, PFAM:PF17855.7, PFAM:PF21120.3 contig_70 cds 3495 3914 + GCA001639275_01138 hypothetical protein contig_70 cds 3911 4546 - GCA001639275_01139 hypothetical protein contig_70 cds 4548 5078 - GCA001639275_01140 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_70 cds 5225 6316 + GCA001639275_01141 hypothetical protein PFAM:PF06973.17 contig_70 cds 6322 6711 - GCA001639275_01142 hypothetical protein contig_70 cds 6727 7095 - GCA001639275_01143 hypothetical protein contig_70 cds 7112 7570 - GCA001639275_01144 hypothetical protein PFAM:PF12682.12, PFAM:PF12724.12 contig_70 cds 7583 10177 - GCA001639275_01145 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF19306.5 contig_70 cds 10268 11116 + GCA001639275_01146 hypothetical protein PFAM:PF00514.29, PFAM:PF02985.28, PFAM:PF03130.22, PFAM:PF13646.12 contig_70 cds 11117 11944 - GCA001639275_01147 Omega-amidase Nit SO:0001217, UniRef:UniRef50_K4LCP6 contig_70 cds 11991 12689 - GCA001639275_01148 hypothetical protein PFAM:PF18933.6 contig_70 cds 12788 13267 + GCA001639275_01149 hypothetical protein contig_70 cds 13264 14046 - GCA001639275_01150 hypothetical protein PFAM:PF01939.22, PFAM:PF21003.3 contig_70 cds 14202 15113 + GCA001639275_01151 hypothetical protein PFAM:PF00561.26 contig_70 cds 15118 15396 + GCA001639275_01152 hypothetical protein contig_70 cds 15427 16338 - GCA001639275_01153 Quinolinate synthase SO:0001217, UniRef:UniRef50_C6PX76 contig_70 cds 16335 17084 - GCA001639275_01154 hypothetical protein PFAM:PF00924.24, PFAM:PF21088.2 contig_70 cds 17093 17986 - GCA001639275_01155 hypothetical protein PFAM:PF00753.33, PFAM:PF12706.13 contig_70 cds 18055 18885 + GCA001639275_01156 hypothetical protein PFAM:PF01729.25, PFAM:PF02749.22 contig_70 cds 18964 20046 + GCA001639275_01157 Carbamoyl phosphate synthase pyrimidine-specific small chain SO:0001217, UniRef:UniRef50_P77885 contig_70 cds 20082 23258 + GCA001639275_01158 Carbamoyl phosphate synthase large chain SO:0001217, UniRef:UniRef50_Q72FQ1 contig_70 cds 23274 23867 - GCA001639275_01159 hypothetical protein contig_70 cds 24060 25232 + GCA001639275_01160 hypothetical protein PFAM:PF01979.26 contig_70 cds 25257 25685 + GCA001639275_01161 hypothetical protein PFAM:PF00582.32 contig_70 cds 25731 26573 + GCA001639275_01162 hypothetical protein PFAM:PF00571.33 contig_70 cds 26584 27039 + GCA001639275_01163 hypothetical protein contig_70 cds 27041 28051 - GCA001639275_01164 hypothetical protein PFAM:PF02540.23, PFAM:PF06508.19 contig_70 cds 28038 28709 - GCA001639275_01165 hypothetical protein contig_70 cds 28711 29916 - GCA001639275_01166 hypothetical protein contig_70 cds 29918 30559 - GCA001639275_01167 hypothetical protein contig_70 cds 30611 31633 + GCA001639275_01168 hypothetical protein PFAM:PF00557.29, PFAM:PF01321.24 contig_70 cds 32009 32926 + GCA001639275_01169 hypothetical protein PFAM:PF00482.28 contig_70 cds 32935 33117 + GCA001639275_01170 hypothetical protein PFAM:PF04021.17 contig_70 cds 33105 34229 - GCA001639275_01171 hypothetical protein contig_70 cds 34334 34816 + GCA001639275_01172 Flavodoxin-like domain-containing protein SO:0001217, UniRef:UniRef50_S3KFD0 contig_70 cds 34874 36286 + GCA001639275_01173 hypothetical protein contig_70 cds 36990 37712 - GCA001639275_01174 hypothetical protein PFAM:PF01588.26, PFAM:PF18489.6 contig_70 cds 37892 38296 + GCA001639275_01175 hypothetical protein PFAM:PF05239.21 contig_70 cds 38364 39128 + GCA001639275_01176 hypothetical protein PFAM:PF01408.29, PFAM:PF01958.23, PFAM:PF03447.22 contig_70 cds 39129 39851 + GCA001639275_01177 hypothetical protein PFAM:PF04446.17, PFAM:PF14413.11 contig_70 cds 39848 40519 + GCA001639275_01178 hypothetical protein contig_70 cds 40573 42147 - GCA001639275_01179 D-3-phosphoglycerate dehydrogenase SO:0001217, UniRef:UniRef50_F4LVI7 contig_70 cds 42390 43193 + GCA001639275_01180 hypothetical protein contig_70 cds 43180 43575 - GCA001639275_01181 hypothetical protein contig_70 cds 43577 44518 - GCA001639275_01182 hypothetical protein PFAM:PF01381.28 contig_70 cds 44586 45851 + GCA001639275_01183 hypothetical protein PFAM:PF01336.31, PFAM:PF08489.16, PFAM:PF22641.2, PFAM:PF23783.1 contig_70 cds 46057 46965 + GCA001639275_01184 DUF3100 domain-containing protein SO:0001217, UniRef:UniRef50_Q5WBB7 contig_70 cds 46965 47453 + GCA001639275_01185 hypothetical protein contig_70 cds 47610 49019 + GCA001639275_01186 hypothetical protein PFAM:PF03972.19, PFAM:PF19305.4 contig_70 cds 49025 49927 + GCA001639275_01187 Peptidase family U32 SO:0001217, UniRef:UniRef50_A0A1H9E331 contig_70 cds 49932 50804 + GCA001639275_01188 L(+)-tartrate dehydratase subunit alpha SO:0001217, UniRef:UniRef50_A0A1B1Q176 contig_70 cds 50823 52247 - GCA001639275_01189 Schlafen AlbA-2 domain-containing protein SO:0001217, UniRef:UniRef50_R9MRR4 contig_70 cds 53135 53932 + GCA001639275_01190 hypothetical protein PFAM:PF00285.26 contig_70 cds 53941 54447 + GCA001639275_01191 hypothetical protein PFAM:PF00881.29 contig_70 cds 54453 54791 + GCA001639275_01192 hypothetical protein contig_70 cds 54781 55116 - GCA001639275_01193 hypothetical protein contig_70 cds 55249 55407 + GCA001639275_01194 hypothetical protein contig_70 cds 55462 55809 + GCA001639275_01195 hypothetical protein contig_70 cds 55974 56288 + GCA001639275_01196 hypothetical protein contig_70 cds 56301 58304 + GCA001639275_01197 hypothetical protein contig_70 cds 58362 58853 + GCA001639275_01198 hypothetical protein PFAM:PF00137.26 contig_70 cds 58867 59490 + GCA001639275_01199 hypothetical protein contig_70 cds 59503 60657 + GCA001639275_01200 hypothetical protein contig_70 cds 60654 60971 + GCA001639275_01201 hypothetical protein contig_70 cds 60968 62722 + GCA001639275_01202 V-type ATP synthase alpha chain SO:0001217, UniRef:UniRef50_A5I557 contig_70 cds 62725 64116 + GCA001639275_01203 hypothetical protein PFAM:PF00006.31, PFAM:PF02874.29, PFAM:PF22919.1 contig_70 cds 64144 64827 + GCA001639275_01204 hypothetical protein contig_70 cds 64965 65114 + GCA001639275_01205 hypothetical protein contig_70 cds 65097 66272 - GCA001639275_01206 hypothetical protein PFAM:PF02786.22, PFAM:PF15632.11 contig_70 tRNA 66308 66379 - GCA001639275_01207 trnQ tRNA-Gln(ttg) SO:0000261 contig_70 cds 66438 66824 - GCA001639275_01208 hypothetical protein contig_70 cds 66859 67470 - GCA001639275_01209 hypothetical protein contig_70 cds 67797 69050 - GCA001639275_01210 hypothetical protein PFAM:PF13662.12 contig_70 cds 69475 70212 + GCA001639275_01211 hypothetical protein contig_70 cds 70342 70629 + GCA001639275_01212 hypothetical protein PFAM:PF04410.20 contig_70 cds 70674 71606 + GCA001639275_01213 hypothetical protein PFAM:PF00382.24, PFAM:PF08271.17 contig_70 cds 71674 73566 - GCA001639275_01214 hypothetical protein PFAM:PF00535.33, PFAM:PF04101.22, PFAM:PF13528.12 contig_70 cds 73601 74680 - GCA001639275_01215 hypothetical protein contig_70 cds 74734 75543 + GCA001639275_01216 hypothetical protein contig_70 cds 75540 76394 - GCA001639275_01217 hypothetical protein contig_70 cds 76396 76719 - GCA001639275_01218 UPF0145 protein SO:0001217, UniRef:UniRef50_Q8VMY3 contig_70 cds 76725 76916 - GCA001639275_01219 hypothetical protein contig_70 cds 76937 77728 - GCA001639275_01220 tatD 3'-5' ssDNA/RNA exonuclease TatD SO:0001217, UniRef:UniRef50_A0A1X0WFV0 contig_70 cds 77737 78414 - GCA001639275_01221 hypothetical protein contig_70 cds 78490 79173 - GCA001639275_01222 Glycerol uptake facilitator SO:0001217, UniRef:UniRef50_F7UYC6 contig_70 cds 79217 80350 - GCA001639275_01223 hypothetical protein contig_70 cds 80816 85681 + GCA001639275_01224 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF07705.17, PFAM:PF17973.7, PFAM:PF24346.1, PFAM:PF24593.1, PFAM:PF24595.1 contig_70 cds 85950 86387 + GCA001639275_01225 hypothetical protein contig_70 cds 86397 86978 - GCA001639275_01226 hypothetical protein PFAM:PF03367.19, PFAM:PF22794.1 contig_70 cds 86971 87915 - GCA001639275_01227 hypothetical protein PFAM:PF13238.12 contig_70 cds 88120 89175 + GCA001639275_01228 hypothetical protein PFAM:PF07755.17, PFAM:PF17396.8 contig_70 cds 89181 89690 + GCA001639275_01229 hypothetical protein contig_70 cds 89705 90460 - GCA001639275_01230 hypothetical protein PFAM:PF01026.27 contig_70 cds 91179 91964 + GCA001639275_01231 hypothetical protein contig_70 cds 91978 93672 - GCA001639275_01232 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25 contig_70 cds 93688 94272 - GCA001639275_01233 hypothetical protein PFAM:PF00692.24, PFAM:PF06559.16, PFAM:PF22569.1, PFAM:PF22769.1 contig_70 cds 94301 94495 - GCA001639275_01234 hypothetical protein contig_70 cds 94523 95425 - GCA001639275_01235 hypothetical protein contig_70 cds 95429 96907 - GCA001639275_01236 hypothetical protein PFAM:PF02754.22, PFAM:PF12838.12, PFAM:PF13085.11, PFAM:PF13183.11, PFAM:PF13534.11 contig_70 cds 97025 98920 + GCA001639275_01237 hypothetical protein PFAM:PF00037.32, PFAM:PF02775.26 contig_70 cds 98925 99509 + GCA001639275_01238 hypothetical protein PFAM:PF01558.24 contig_70 cds 99564 99842 + GCA001639275_01239 hypothetical protein contig_70 cds 99907 100338 - GCA001639275_01240 hypothetical protein PFAM:PF01842.31, PFAM:PF19571.5 contig_70 cds 100350 101648 - GCA001639275_01241 Phenylacetate-coenzyme A ligase SO:0001217, UniRef:UniRef50_A0A1S7LEF0 contig_70 cds 101838 103448 + GCA001639275_01242 Sodium:solute symporter family protein SO:0001217, UniRef:UniRef50_A0A7C1HTU5 contig_70 cds 103451 103561 + GCA001639275_01243 hypothetical protein contig_70 cds 104531 105550 + GCA001639275_01244 hypothetical protein PFAM:PF01047.28, PFAM:PF13412.12 contig_70 cds 106591 107088 - GCA001639275_01245 hypothetical protein contig_70 cds 107218 107451 - GCA001639275_01246 hypothetical protein contig_70 cds 107565 108113 - GCA001639275_01247 DNA-3-methyladenine glycosylase 1 SO:0001217, UniRef:UniRef50_A0A2A9I771 contig_70 cds 108348 108617 + GCA001639275_01248 hypothetical protein contig_71 cds 202 1389 + GCA001639275_01249 hypothetical protein PFAM:PF01637.24, PFAM:PF13191.12, PFAM:PF13401.12 contig_71 cds 1472 1624 + GCA001639275_01250 hypothetical protein PFAM:PF08220.18 contig_71 cds 1861 2343 + GCA001639275_01251 hypothetical protein PFAM:PF01710.22, PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_71 cds 2472 2714 - GCA001639275_01252 hypothetical protein contig_71 cds 4389 4790 - GCA001639275_01253 hypothetical protein PFAM:PF01850.27 contig_71 cds 4787 5023 - GCA001639275_01254 hypothetical protein PFAM:PF04014.23 contig_71 cds 5138 6124 - GCA001639275_01255 hypothetical protein PFAM:PF00535.33 contig_71 cds 6814 7896 + GCA001639275_01256 hypothetical protein contig_71 cds 8490 8969 - GCA001639275_01257 hypothetical protein PFAM:PF02943.20, PFAM:PF21349.2 contig_71 cds 9004 9285 - GCA001639275_01258 hypothetical protein PFAM:PF00462.30, PFAM:PF13098.12 contig_71 cds 9341 9691 + GCA001639275_01259 hypothetical protein contig_71 cds 9870 10733 - GCA001639275_01260 Oxidoreductase, aldo/keto reductase family SO:0001217, UniRef:UniRef50_A0A377JWK0 contig_71 cds 10875 11321 - GCA001639275_01261 Cupin type-2 domain-containing protein SO:0001217, UniRef:UniRef50_C4Z234 contig_71 cds 11381 12214 - GCA001639275_01262 Glyoxal reductase SO:0001217, UniRef:UniRef50_M1WRM0 contig_71 cds 12644 13093 + GCA001639275_01263 hypothetical protein PFAM:PF01047.28 contig_71 cds 13238 13699 - GCA001639275_01264 hypothetical protein contig_72 cds 442 1647 + GCA001639275_01265 putative hydrolase or acyltransferase of alpha/beta superfamily SO:0001217, UniRef:UniRef50_C7N2K6 contig_72 cds 1698 2180 + GCA001639275_01266 hypothetical protein contig_72 cds 2186 2836 - GCA001639275_01267 hypothetical protein contig_72 cds 2861 3247 - GCA001639275_01268 hypothetical protein contig_72 cds 3314 3427 - GCA001639275_01269 hypothetical protein contig_72 cds 3503 3982 - GCA001639275_01270 hypothetical protein contig_72 cds 4078 6717 - GCA001639275_01271 hypothetical protein PFAM:PF02663.19 contig_72 cds 7353 7784 + GCA001639275_01272 hypothetical protein PFAM:PF01047.28, PFAM:PF01638.23, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13601.12 contig_72 cds 7798 9189 + GCA001639275_01273 hypothetical protein contig_72 cds 9186 9581 - GCA001639275_01274 trmO tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO SO:0001217, UniRef:UniRef50_A0A5D6WFA6 contig_72 cds 9611 10105 - GCA001639275_01275 hypothetical protein contig_72 cds 10232 11524 + GCA001639275_01276 hypothetical protein PFAM:PF13635.12 contig_72 cds 11668 11919 + GCA001639275_01277 hypothetical protein contig_72 cds 11994 12968 + GCA001639275_01278 hypothetical protein PFAM:PF13635.12 contig_73 cds 319 609 + GCA001639275_01279 hypothetical protein contig_73 cds 615 959 + GCA001639275_01280 hypothetical protein contig_73 cds 1127 1771 + GCA001639275_01281 hypothetical protein contig_73 cds 1776 2645 + GCA001639275_01282 hypothetical protein PFAM:PF00398.26, PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_73 cds 2654 3238 + GCA001639275_01283 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_73 cds 3253 4113 - GCA001639275_01284 hypothetical protein PFAM:PF01678.24 contig_73 cds 4122 5405 - GCA001639275_01285 hypothetical protein PFAM:PF00278.28, PFAM:PF02784.22 contig_73 cds 5573 5962 - GCA001639275_01286 hypothetical protein contig_73 cds 6021 6359 - GCA001639275_01287 hypothetical protein contig_73 cds 6328 6720 - GCA001639275_01288 hypothetical protein contig_73 cds 7092 7517 - GCA001639275_01289 hypothetical protein contig_73 cds 7534 8010 - GCA001639275_01290 hypothetical protein contig_73 cds 8000 8140 - GCA001639275_01291 hypothetical protein contig_73 cds 8227 8484 - GCA001639275_01292 hypothetical protein contig_73 cds 8758 9288 - GCA001639275_01293 hypothetical protein PFAM:PF13240.11 contig_73 cds 10183 10401 - GCA001639275_01294 hypothetical protein contig_73 cds 10424 10552 - GCA001639275_01295 hypothetical protein contig_73 cds 11025 11429 + GCA001639275_01296 hypothetical protein PFAM:PF00293.34, PFAM:PF14815.12 contig_73 cds 11426 12592 - GCA001639275_01297 hypothetical protein PFAM:PF00202.27 contig_73 cds 12668 13099 + GCA001639275_01298 Peptidyl-prolyl cis-trans isomerase SO:0001217, UniRef:UniRef50_Q7UP01 contig_74 cds 117 302 + GCA001639275_01299 hypothetical protein contig_74 cds 317 655 + GCA001639275_01300 Nitrogen regulatory protein P-II SO:0001217, UniRef:UniRef50_A0A2Z4UHA8 contig_74 cds 686 1306 - GCA001639275_01301 hypothetical protein PFAM:PF00717.28, PFAM:PF10502.14 contig_74 cds 1306 1980 - GCA001639275_01302 hypothetical protein PFAM:PF01487.21 contig_74 cds 3226 3687 - GCA001639275_01303 hypothetical protein contig_74 cds 3997 4722 + GCA001639275_01304 hypothetical protein contig_74 cds 4736 5596 + GCA001639275_01305 Succinate--CoA ligase [ADP-forming] subunit alpha SO:0001217, UniRef:UniRef50_Q51567 contig_74 cds 5597 6799 + GCA001639275_01306 hydroxymethylglutaryl-CoA reductase (NADPH) SO:0001217, UniRef:UniRef50_A0A2T2S8Q0 contig_74 cds 6801 7439 - GCA001639275_01307 hypothetical protein contig_74 cds 7449 7901 - GCA001639275_01308 hypothetical protein contig_74 cds 7939 8094 - GCA001639275_01309 hypothetical protein contig_74 cds 9038 10678 + GCA001639275_01310 hypothetical protein contig_74 cds 10760 13075 + GCA001639275_01311 hypothetical protein PFAM:PF02369.22, PFAM:PF13200.12, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_75 cds 1077 2372 - GCA001639275_01312 hypothetical protein contig_75 cds 2381 5068 - GCA001639275_01313 hypothetical protein PFAM:PF07728.20 contig_75 cds 5236 8214 - GCA001639275_01314 DEAD/DEAH box helicase family protein SO:0001217, UniRef:UniRef50_A0AAJ1JK52 contig_75 cds 8223 9692 - GCA001639275_01315 hypothetical protein PFAM:PF01555.25 contig_75 cds 9694 10185 - GCA001639275_01316 hypothetical protein contig_75 cds 10192 11532 - GCA001639275_01317 hypothetical protein PFAM:PF01555.25 contig_75 cds 11546 12034 - GCA001639275_01318 hypothetical protein contig_75 cds 12041 12922 - GCA001639275_01319 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A7C5Q3Q0 contig_76 cds 561 917 + GCA001639275_01320 hypothetical protein contig_76 cds 992 3463 + GCA001639275_01321 hypothetical protein PFAM:PF18211.6, PFAM:PF22335.1 contig_76 cds 3468 3923 + GCA001639275_01322 hypothetical protein contig_76 cds 3926 4654 + GCA001639275_01323 hypothetical protein contig_76 cds 4667 5605 + GCA001639275_01324 hypothetical protein PFAM:PF17953.6 contig_76 cds 5605 6735 + GCA001639275_01325 hypothetical protein contig_76 cds 6737 8065 + GCA001639275_01326 hypothetical protein PFAM:PF09670.15 contig_76 cds 8067 8732 + GCA001639275_01327 hypothetical protein PFAM:PF17262.7, PFAM:PF17955.6 contig_76 cds 8732 9013 + GCA001639275_01328 hypothetical protein contig_76 cds 9010 10014 + GCA001639275_01329 hypothetical protein contig_76 crispr 10325 11824 ? CRISPR array with 21 repeats of length 34, consensus sequence ATTGCAAAGTTAATTCCATAAAAACAAGGATTGT and spacer length 38 SO:0001459 contig_76 crispr-repeat 10325 10358 ? CRISPR repeat contig_76 crispr-spacer 10359 10397 ? CRISPR spacer, sequence AGCTGATGAAGCTAGAATTGCTGAATTAGCGATAGATAA contig_76 crispr-repeat 10398 10431 ? CRISPR repeat contig_76 crispr-spacer 10432 10469 ? CRISPR spacer, sequence AGCACTTTATTATTTGATTCATTTTTTAATGAATTCGA contig_76 crispr-repeat 10470 10503 ? CRISPR repeat contig_76 crispr-spacer 10504 10541 ? CRISPR spacer, sequence AGCCCCATCAACCTCCAAGTTTCCCTAGGAGTCAACCG contig_76 crispr-repeat 10542 10575 ? CRISPR repeat contig_76 crispr-spacer 10576 10614 ? CRISPR spacer, sequence AGCATTTTTTGCTAATAGTCATAACCATTTGGTTTTAAA contig_76 crispr-repeat 10615 10648 ? CRISPR repeat contig_76 crispr-spacer 10649 10687 ? CRISPR spacer, sequence AGCTTGGCGACTTCTTCCTCGCTTAATTTTCCTACTATT contig_76 crispr-repeat 10688 10721 ? CRISPR repeat contig_76 crispr-spacer 10722 10759 ? CRISPR spacer, sequence AGCTCCTTGCTATTCATTTTTTCACCAACTACGCGGGG contig_76 crispr-repeat 10760 10793 ? CRISPR repeat contig_76 crispr-spacer 10794 10832 ? CRISPR spacer, sequence AGCTGAGGCGACAGGCGAGAAAAATAAACCCCATTTAAA contig_76 crispr-repeat 10833 10866 ? CRISPR repeat contig_76 crispr-spacer 10867 10905 ? CRISPR spacer, sequence AGCATGTCCAGTCTCAGATGGTCAACTGCAGAAATTTTT contig_76 crispr-repeat 10906 10939 ? CRISPR repeat contig_76 crispr-spacer 10940 10979 ? CRISPR spacer, sequence AGCCTTATCAGCGCATGTAATACCGTATTCGGCTAAAGAG contig_76 crispr-repeat 10980 11013 ? CRISPR repeat contig_76 crispr-spacer 11014 11052 ? CRISPR spacer, sequence AGCCCCCTTTCTTCTCTTCTATTCTTCTGTTCCTCCAGG contig_76 crispr-repeat 11053 11086 ? CRISPR repeat contig_76 crispr-spacer 11087 11125 ? CRISPR spacer, sequence GGCCCTTAAATTCCTTATTATTCGTTTTTTTCACCAACT contig_76 crispr-repeat 11126 11159 ? CRISPR repeat contig_76 crispr-spacer 11160 11197 ? CRISPR spacer, sequence GGCTTTATAGTGAAGAATATATAAGATTGGTTAATTTA contig_76 crispr-repeat 11198 11231 ? CRISPR repeat contig_76 crispr-spacer 11232 11270 ? CRISPR spacer, sequence GGCAATAAATAGGTTTTTGTTGTATATATATATTGCTAT contig_76 crispr-repeat 11271 11304 ? CRISPR repeat contig_76 crispr-spacer 11305 11342 ? CRISPR spacer, sequence GGTTAAAGTCTTTTAATAGCTTTTTTGAGGGTTTTGAG contig_76 crispr-repeat 11343 11376 ? CRISPR repeat contig_76 crispr-spacer 11377 11414 ? CRISPR spacer, sequence GGTGATGAATAAGATAATAAAATTTTCAAATTCTCTTT contig_76 crispr-repeat 11415 11448 ? CRISPR repeat contig_76 crispr-spacer 11449 11487 ? CRISPR spacer, sequence GGCCTAGAAGACGATATAGAATAACTAACTCAAACCCAA contig_76 crispr-repeat 11488 11521 ? CRISPR repeat contig_76 crispr-spacer 11522 11560 ? CRISPR spacer, sequence GGCTAATAAACCGATAATGAACCCTAAACTAGAATTGTT contig_76 crispr-repeat 11561 11594 ? CRISPR repeat contig_76 crispr-spacer 11595 11633 ? CRISPR spacer, sequence GGCAAAATCCATTGACTGTTAATATCTGTTCCTAATTCG contig_76 crispr-repeat 11634 11667 ? CRISPR repeat contig_76 crispr-spacer 11668 11707 ? CRISPR spacer, sequence GGCAGGAATAGGTTGGGATTTGGTTTTAACTGACATTCCT contig_76 crispr-repeat 11708 11741 ? CRISPR repeat contig_76 crispr-spacer 11742 11778 ? CRISPR spacer, sequence GGCCCCTATGGAGGACATCCTCCACACACACCATCAC contig_76 crispr-repeat 11779 11812 ? CRISPR repeat contig_76 crispr-spacer 11813 11824 ? CRISPR spacer, sequence GGAATCTTAGCA contig_77 cds 79 5400 + GCA001639275_01330 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7 contig_77 cds 5677 11988 - GCA001639275_01331 hypothetical protein PFAM:PF02369.22, PFAM:PF05688.17, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_78 cds 954 3455 + GCA001639275_01332 hypothetical protein contig_78 cds 3452 5875 + GCA001639275_01333 hypothetical protein contig_78 cds 5955 7880 + GCA001639275_01334 hypothetical protein PFAM:PF00488.27 contig_78 cds 7917 9563 + GCA001639275_01335 hypothetical protein PFAM:PF03109.22 contig_78 cds 9941 11125 + GCA001639275_01336 hypothetical protein PFAM:PF00004.35, PFAM:PF01022.26, PFAM:PF01637.24, PFAM:PF13191.12, PFAM:PF13401.12 contig_78 rRNA 11480 11597 - GCA001639275_01337 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_78 rRNA 11649 11766 - GCA001639275_01338 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_79 cds 203 850 - GCA001639275_01339 hypothetical protein PFAM:PF00215.30 contig_79 cds 1113 1778 + GCA001639275_01340 cbiM Cobalt transport protein CbiM SO:0001217, UniRef:UniRef50_A5VM74 contig_79 cds 1788 2075 + GCA001639275_01341 cbiN Cobalt transport protein CbiN SO:0001217, UniRef:UniRef50_A8AEQ5 contig_79 cds 2116 2811 + GCA001639275_01342 hypothetical protein contig_79 cds 2814 3647 + GCA001639275_01343 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 SO:0001217, UniRef:UniRef50_Q0TUN8 contig_79 cds 4318 4854 + GCA001639275_01344 hypothetical protein contig_79 cds 4861 5160 + GCA001639275_01345 hypothetical protein contig_79 cds 5382 5840 + GCA001639275_01346 hypothetical protein PFAM:PF00885.24 contig_79 cds 5860 6576 + GCA001639275_01347 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_79 cds 6589 6933 + GCA001639275_01348 hypothetical protein contig_79 cds 6939 7607 + GCA001639275_01349 hypothetical protein PFAM:PF02754.22 contig_79 cds 7597 8799 + GCA001639275_01350 hypothetical protein PFAM:PF00037.32, PFAM:PF02589.21, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13534.11 contig_79 cds 8996 9712 + GCA001639275_01351 hypothetical protein contig_79 cds 9721 11202 + GCA001639275_01352 Inosine-5'-monophosphate dehydrogenase SO:0001217, UniRef:UniRef50_O50316 contig_80 rRNA 244 361 + GCA001639275_01353 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_80 cds 438 1907 + GCA001639275_01354 hypothetical protein PFAM:PF00682.25, PFAM:PF08502.15, PFAM:PF22617.1 contig_80 cds 1915 2403 + GCA001639275_01355 hypothetical protein PFAM:PF08617.15 contig_80 cds 2381 3343 - GCA001639275_01356 hypothetical protein PFAM:PF01041.23 contig_80 cds 3348 4517 - GCA001639275_01357 hypothetical protein contig_80 cds 4569 5495 - GCA001639275_01358 hypothetical protein PFAM:PF00958.27, PFAM:PF02540.23, PFAM:PF03054.22 contig_80 cds 5497 5751 - GCA001639275_01359 hypothetical protein contig_80 cds 5744 6316 - GCA001639275_01360 hypothetical protein PFAM:PF00117.34, PFAM:PF07722.19 contig_80 cds 6633 7556 - GCA001639275_01361 hypothetical protein PFAM:PF00070.33, PFAM:PF07992.20, PFAM:PF13450.12 contig_80 cds 7608 8219 + GCA001639275_01362 hypothetical protein contig_80 cds 8826 9341 - GCA001639275_01363 hypothetical protein PFAM:PF00440.29 contig_80 cds 9407 10087 - GCA001639275_01364 hypothetical protein PFAM:PF03749.19, PFAM:PF17746.7 contig_80 cds 10089 10499 - GCA001639275_01365 hypothetical protein contig_81 cds 203 895 + GCA001639275_01366 hypothetical protein PFAM:PF03459.23 contig_81 cds 1149 1727 + GCA001639275_01367 Imidazoleglycerol-phosphate dehydratase SO:0001217, UniRef:UniRef50_Q6ANL7 contig_81 cds 1767 2594 - GCA001639275_01368 hypothetical protein contig_81 tRNA 2849 2920 - GCA001639275_01369 trnV tRNA-Val(tac) SO:0000273 contig_81 cds 3052 3975 + GCA001639275_01370 Branched-chain-amino-acid aminotransferase SO:0001217, UniRef:UniRef50_A0A537X7K9 contig_81 cds 3975 4820 + GCA001639275_01371 hypothetical protein contig_81 cds 4847 5914 - GCA001639275_01372 hypothetical protein contig_81 cds 5916 6392 - GCA001639275_01373 hypothetical protein contig_81 cds 6483 8075 + GCA001639275_01374 hypothetical protein PFAM:PF01163.29, PFAM:PF22521.2 contig_81 cds 8120 8671 + GCA001639275_01375 hypothetical protein PFAM:PF01725.21 contig_81 cds 8739 9137 + GCA001639275_01376 hypothetical protein PFAM:PF00312.27, PFAM:PF08069.17 contig_81 cds 9127 10461 + GCA001639275_01377 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF21763.2 contig_81 cds 10454 11650 + GCA001639275_01378 hypothetical protein contig_81 cds 11891 13276 + GCA001639275_01379 hypothetical protein PFAM:PF01070.24, PFAM:PF01645.23 contig_81 cds 13415 14797 + GCA001639275_01380 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_81 cds 14790 16313 + GCA001639275_01381 hypothetical protein PFAM:PF08245.18 contig_81 cds 16362 19433 - GCA001639275_01382 hypothetical protein PFAM:PF16640.11 contig_81 cds 19677 21725 - GCA001639275_01383 hypothetical protein contig_81 cds 22366 22737 - GCA001639275_01384 hypothetical protein contig_81 cds 23262 23504 + GCA001639275_01385 hypothetical protein contig_81 cds 23494 23916 + GCA001639275_01386 hypothetical protein PFAM:PF01850.27 contig_81 cds 24225 26540 + GCA001639275_01387 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF00633.29, PFAM:PF02732.21, PFAM:PF12826.13, PFAM:PF14520.12, PFAM:PF21210.2 contig_81 cds 26590 27282 - GCA001639275_01388 hypothetical protein PFAM:PF01261.30 contig_81 cds 27290 29143 - GCA001639275_01389 hypothetical protein PFAM:PF00437.27, PFAM:PF01850.27 contig_81 cds 29133 29540 - GCA001639275_01390 Phosphoribosyl-AMP cyclohydrolase SO:0001217, UniRef:UniRef50_Q9K0H5 contig_81 cds 29530 30837 - GCA001639275_01391 hypothetical protein PFAM:PF00587.30, PFAM:PF01409.25, PFAM:PF03129.25, PFAM:PF13393.11 contig_81 cds 30923 31771 + GCA001639275_01392 hypothetical protein PFAM:PF08501.16, PFAM:PF18317.6 contig_81 cds 31779 32462 + GCA001639275_01393 hypothetical protein contig_81 cds 32445 33851 - GCA001639275_01394 hypothetical protein PFAM:PF00004.35, PFAM:PF03215.21, PFAM:PF05496.18, PFAM:PF07728.20, PFAM:PF21960.2 contig_81 cds 33861 34808 - GCA001639275_01395 hypothetical protein PFAM:PF00004.35, PFAM:PF01078.27, PFAM:PF03215.21, PFAM:PF08542.16, PFAM:PF13177.12, PFAM:PF21960.2 contig_81 cds 35401 36357 + GCA001639275_01396 hypothetical protein PFAM:PF01435.24, PFAM:PF13202.12 contig_81 cds 36373 37098 + GCA001639275_01397 hypothetical protein PFAM:PF01596.23, PFAM:PF08241.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_81 cds 37120 39975 - GCA001639275_01398 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF08264.19, PFAM:PF13603.12 contig_81 cds 39986 40774 - GCA001639275_01399 NH(3)-dependent NAD(+) synthetase SO:0001217, UniRef:UniRef50_A0A351JPZ2 contig_81 cds 40955 41962 + GCA001639275_01400 hypothetical protein PFAM:PF01656.29, PFAM:PF02374.21, PFAM:PF13614.12 contig_81 cds 41999 42346 - GCA001639275_01401 hypothetical protein contig_81 cds 42343 45471 - GCA001639275_01402 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_81 cds 45589 46227 - GCA001639275_01403 hypothetical protein PFAM:PF00590.25 contig_81 cds 46229 46606 - GCA001639275_01404 hypothetical protein PFAM:PF01638.23 contig_81 cds 46718 47500 + GCA001639275_01405 Protein-ADP-ribose hydrolase SO:0001217, UniRef:UniRef50_A0A9J6NZK5 contig_81 cds 47502 48350 + GCA001639275_01406 Deacetylase sirtuin-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A136Q6J6 contig_81 cds 48339 50444 - GCA001639275_01407 hypothetical protein contig_81 cds 50437 51315 - GCA001639275_01408 hypothetical protein PFAM:PF00149.33 contig_81 cds 51395 52588 + GCA001639275_01409 hypothetical protein PFAM:PF02421.24, PFAM:PF02824.27, PFAM:PF08438.16 contig_81 cds 52746 53924 + GCA001639275_01410 hypothetical protein PFAM:PF01637.24, PFAM:PF13191.12, PFAM:PF13401.12 contig_81 cds 54182 55828 + GCA001639275_01411 hypothetical protein contig_81 cds 55976 57046 + GCA001639275_01412 hypothetical protein PFAM:PF00148.24 contig_81 cds 57043 57642 + GCA001639275_01413 hisH Imidazole glycerol phosphate synthase subunit HisH SO:0001217, UniRef:UniRef50_P60599 contig_81 cds 57644 59008 + GCA001639275_01414 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_81 cds 59562 61274 + GCA001639275_01415 hypothetical protein contig_81 cds 61338 63836 + GCA001639275_01416 hypothetical protein PFAM:PF16640.11, PFAM:PF19077.6 contig_81 cds 63967 69564 + GCA001639275_01417 hypothetical protein PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF16640.11 contig_81 cds 69586 72342 + GCA001639275_01418 hypothetical protein PFAM:PF16640.11 contig_81 cds 72572 73009 + GCA001639275_01419 hypothetical protein contig_81 tRNA 73061 73134 + GCA001639275_01420 trnR tRNA-Arg(gcg) SO:0001036 contig_81 cds 73155 74411 + GCA001639275_01421 hypothetical protein contig_81 cds 74464 74856 + GCA001639275_01422 hypothetical protein PFAM:PF01989.22 contig_81 cds 74861 75145 + GCA001639275_01423 hypothetical protein contig_81 cds 75262 76074 + GCA001639275_01424 hypothetical protein PFAM:PF01979.26 contig_81 cds 76071 76865 + GCA001639275_01425 hypothetical protein PFAM:PF00037.32, PFAM:PF00881.29, PFAM:PF12797.12, PFAM:PF12838.12, PFAM:PF13237.11 contig_81 cds 76914 79406 + GCA001639275_01426 hypothetical protein PFAM:PF00403.32, PFAM:PF00702.32, PFAM:PF08282.18 contig_81 cds 79411 80277 - GCA001639275_01427 hypothetical protein contig_81 cds 80268 81617 - GCA001639275_01428 hypothetical protein PFAM:PF00206.25, PFAM:PF10397.14 contig_81 cds 81740 81943 + GCA001639275_01429 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12, PFAM:PF13560.12 contig_81 cds 81943 82641 + GCA001639275_01430 hypothetical protein contig_81 cds 82650 83372 + GCA001639275_01431 hypothetical protein contig_81 cds 83406 83807 + GCA001639275_01432 hypothetical protein contig_81 cds 84088 84822 + GCA001639275_01433 hypothetical protein PFAM:PF00705.23, PFAM:PF02747.20 contig_81 cds 84868 85692 + GCA001639275_01434 hypothetical protein PFAM:PF22090.1 contig_81 cds 85955 86233 + GCA001639275_01435 hypothetical protein contig_81 cds 86242 86421 + GCA001639275_01436 hypothetical protein contig_81 cds 86486 87283 + GCA001639275_01437 hypothetical protein PFAM:PF00575.29 contig_81 cds 87290 87457 + GCA001639275_01438 hypothetical protein contig_81 cds 87462 88235 + GCA001639275_01439 hypothetical protein contig_81 cds 88300 89478 + GCA001639275_01440 hypothetical protein contig_81 tRNA 89489 89562 - GCA001639275_01441 trnR tRNA-Arg(cct) SO:0001036 contig_81 tRNA 89616 89689 - GCA001639275_01442 trnR tRNA-Arg(tct) SO:0001036 contig_81 cds 89777 90295 - GCA001639275_01443 hypothetical protein contig_81 cds 90542 91759 + GCA001639275_01444 hypothetical protein contig_81 cds 91784 92401 + GCA001639275_01445 hypothetical protein PFAM:PF01750.23 contig_81 cds 92353 93168 + GCA001639275_01446 hypothetical protein PFAM:PF00037.32, PFAM:PF01058.29, PFAM:PF12838.12 contig_81 cds 93180 94031 + GCA001639275_01447 hypothetical protein PFAM:PF04432.18 contig_81 cds 94082 94999 - GCA001639275_01448 hypothetical protein PFAM:PF00557.29 contig_81 cds 95091 95495 + GCA001639275_01449 hypothetical protein contig_81 cds 95505 96017 + GCA001639275_01450 hypothetical protein contig_81 tRNA 96120 96194 + GCA001639275_01451 trnfM tRNA-fMet(cat) SO:0000266 contig_81 ncRNA 96216 96496 + GCA001639275_01452 RNaseP_arch Archaeal RNase P RFAM:RF00373, SO:0000386 contig_81 cds 97239 102050 + GCA001639275_01453 hypothetical protein PFAM:PF13620.12, PFAM:PF17802.7 contig_81 cds 102184 106443 + GCA001639275_01454 hypothetical protein PFAM:PF13229.12, PFAM:PF17789.7 contig_82 cds 693 1118 + GCA001639275_01455 hypothetical protein PFAM:PF00582.32 contig_82 cds 1137 1517 + GCA001639275_01456 hypothetical protein contig_82 cds 1564 3369 + GCA001639275_01457 hypothetical protein contig_82 cds 3470 5689 + GCA001639275_01458 hypothetical protein PFAM:PF00535.33 contig_82 cds 5714 7864 + GCA001639275_01459 hypothetical protein PFAM:PF00535.33 contig_82 cds 8011 9141 + GCA001639275_01460 DegT/DnrJ/EryC1/StrS aminotransferase SO:0001217, UniRef:UniRef50_G5GHY7 contig_83 cds 312 3611 + GCA001639275_01461 hypothetical protein PFAM:PF03833.19, PFAM:PF22912.2, PFAM:PF24844.1, PFAM:PF24846.1 contig_83 cds 3807 6125 + GCA001639275_01462 hypothetical protein PFAM:PF03477.21 contig_83 cds 8021 8239 - GCA001639275_01463 hypothetical protein contig_83 cds 8445 8615 - GCA001639275_01464 hypothetical protein contig_84 cds 299 571 - GCA001639275_01465 hypothetical protein contig_84 cds 2049 2537 + GCA001639275_01466 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12 contig_84 cds 3203 3892 - GCA001639275_01467 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12, PFAM:PF14582.11 contig_84 cds 3906 4430 - GCA001639275_01468 hypothetical protein PFAM:PF09869.16, PFAM:PF23100.1 contig_84 cds 4427 4693 - GCA001639275_01469 hypothetical protein contig_84 cds 4946 5842 - GCA001639275_01470 hypothetical protein PFAM:PF02754.22 contig_84 cds 5864 6769 - GCA001639275_01471 hypothetical protein PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13534.11 contig_84 cds 7122 7865 + GCA001639275_01472 hypothetical protein PFAM:PF01702.25 contig_84 cds 7862 8284 - GCA001639275_01473 hypothetical protein contig_84 cds 8288 9205 - GCA001639275_01474 hypothetical protein contig_85 cds 696 1658 + GCA001639275_01475 hypothetical protein PFAM:PF00296.26 contig_85 cds 1784 2866 + GCA001639275_01476 hypothetical protein contig_85 cds 2906 3388 + GCA001639275_01477 hypothetical protein PFAM:PF03729.18 contig_85 cds 3411 4691 + GCA001639275_01478 hypothetical protein PFAM:PF01467.32, PFAM:PF16581.11 contig_85 cds 4681 5406 - GCA001639275_01479 hypothetical protein contig_85 cds 5413 6279 - GCA001639275_01480 hypothetical protein PFAM:PF01937.24 contig_85 cds 6280 6483 - GCA001639275_01481 hypothetical protein PFAM:PF02597.26 contig_85 cds 6492 7406 - GCA001639275_01482 hypothetical protein PFAM:PF03054.22, PFAM:PF22082.2 contig_85 cds 7415 8572 - GCA001639275_01483 hypothetical protein contig_85 cds 8584 9438 - GCA001639275_01484 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF05496.18, PFAM:PF07724.20, PFAM:PF07726.17, PFAM:PF07728.20, PFAM:PF13191.12, PFAM:PF13401.12 contig_86 cds 123 1178 - GCA001639275_01485 Site-specific DNA-methyltransferase SO:0001217, UniRef:UniRef50_A0A970ISN8 contig_86 cds 1179 1970 - GCA001639275_01486 hypothetical protein contig_86 cds 1975 5214 - GCA001639275_01487 hypothetical protein PFAM:PF00176.29, PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF20720.3 contig_86 cds 5317 8673 - GCA001639275_01488 hypothetical protein PFAM:PF00580.27, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12, PFAM:PF13604.12, PFAM:PF21396.3 contig_86 cds 8702 8911 + GCA001639275_01489 hypothetical protein contig_87 cds 310 1056 + GCA001639275_01490 hypothetical protein contig_87 cds 1065 1817 + GCA001639275_01491 cmpD Bicarbonate transport ATP-binding protein CmpD SO:0001217, UniRef:UniRef50_A0A1S1V9B1 contig_87 cds 1822 2562 - GCA001639275_01492 hypothetical protein PFAM:PF00294.29 contig_87 cds 2563 3237 - GCA001639275_01493 hypothetical protein PFAM:PF12804.13 contig_87 cds 3247 4650 - GCA001639275_01494 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25, PFAM:PF09180.16 contig_87 cds 6610 6930 + GCA001639275_01495 hypothetical protein contig_87 cds 7060 7413 + GCA001639275_01496 hypothetical protein contig_87 cds 7541 7849 + GCA001639275_01497 hypothetical protein contig_88 cds 3455 3709 - GCA001639275_01498 hypothetical protein contig_88 cds 3873 4277 - GCA001639275_01499 hypothetical protein PFAM:PF08000.17 contig_88 cds 4391 5707 + GCA001639275_01500 hypothetical protein contig_88 cds 5707 6342 + GCA001639275_01501 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_88 cds 6372 7334 + GCA001639275_01502 hypothetical protein contig_88 cds 7486 7743 + GCA001639275_01503 hypothetical protein contig_89 cds 690 1535 - GCA001639275_01504 hypothetical protein contig_89 cds 1711 1965 - GCA001639275_01505 hypothetical protein PFAM:PF00037.32, PFAM:PF12837.12 contig_89 cds 1969 2469 - GCA001639275_01506 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13247.11 contig_89 cds 2480 3346 - GCA001639275_01507 hypothetical protein PFAM:PF02775.26 contig_89 cds 3349 4494 - GCA001639275_01508 hypothetical protein PFAM:PF02780.25, PFAM:PF17147.9 contig_89 cds 4511 4753 - GCA001639275_01509 porD Pyruvate synthase subunit PorD SO:0001217, UniRef:UniRef50_A0A285GZ84 contig_89 cds 4766 5290 - GCA001639275_01510 hypothetical protein PFAM:PF01558.24 contig_89 cds 5596 7197 + GCA001639275_01511 hypothetical protein PFAM:PF00809.28, PFAM:PF14251.12 contig_89 cds 7199 7561 - GCA001639275_01512 hypothetical protein contig_90 cds 538 876 - GCA001639275_01513 hypothetical protein contig_90 cds 923 1072 - GCA001639275_01514 hypothetical protein contig_90 cds 3449 4426 - GCA001639275_01515 hypothetical protein contig_90 cds 7103 7399 + GCA001639275_01516 hypothetical protein contig_91 cds 1390 2715 - GCA001639275_01517 CDP-glycerol glycerophosphotransferase family protein SO:0001217, UniRef:UniRef50_A0A398AXH0 contig_91 cds 2736 3953 - GCA001639275_01518 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_91 cds 3970 5811 - GCA001639275_01519 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_91 cds 5830 7155 - GCA001639275_01520 Carbamoylphosphate synthase large subunit short form SO:0001217, UniRef:UniRef50_A8FI10 contig_92 cds 198 1436 + GCA001639275_01521 hypothetical protein contig_92 cds 1447 2784 + GCA001639275_01522 hypothetical protein PFAM:PF00408.26, PFAM:PF02878.22, PFAM:PF02879.22, PFAM:PF02880.22 contig_92 cds 2806 2973 - GCA001639275_01523 hypothetical protein PFAM:PF00301.25 contig_92 cds 3117 4397 + GCA001639275_01524 hypothetical protein PFAM:PF00132.30, PFAM:PF12804.13, PFAM:PF14602.12, PFAM:PF24894.1, PFAM:PF25084.1 contig_92 cds 4409 4891 + GCA001639275_01525 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A4Y7S493 contig_92 cds 4893 5993 + GCA001639275_01526 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25, PFAM:PF01041.23, PFAM:PF01053.26, PFAM:PF04864.19 contig_92 cds 5993 6703 + GCA001639275_01527 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11 contig_92 cds 6721 7857 + GCA001639275_01528 hypothetical protein PFAM:PF00515.34, PFAM:PF01239.28, PFAM:PF01535.26, PFAM:PF03704.23, PFAM:PF04266.20, PFAM:PF07719.23, PFAM:PF07721.20, PFAM:PF12569.14, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14853.12, PFAM:PF20308.4, PFAM:PF25064.1 contig_92 cds 8029 9393 - GCA001639275_01529 hypothetical protein PFAM:PF00408.26, PFAM:PF02878.22, PFAM:PF02879.22, PFAM:PF02880.22 contig_92 cds 9450 9848 - GCA001639275_01530 hypothetical protein contig_92 cds 9997 11655 - GCA001639275_01531 hypothetical protein PFAM:PF01068.26 contig_92 cds 11655 12929 - GCA001639275_01532 Phosphomethylpyrimidine synthase SO:0001217, UniRef:UniRef50_A8F821 contig_92 cds 13640 15832 - GCA001639275_01533 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF00910.28, PFAM:PF01078.27, PFAM:PF02359.24, PFAM:PF02933.23, PFAM:PF05496.18, PFAM:PF06068.19, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF13481.12, PFAM:PF13671.12, PFAM:PF17862.7, PFAM:PF23902.1, PFAM:PF24883.1 contig_92 cds 16168 17469 - GCA001639275_01534 hypothetical protein PFAM:PF02153.23, PFAM:PF03446.21, PFAM:PF20463.3 contig_92 cds 17541 18602 + GCA001639275_01535 hypothetical protein PFAM:PF03463.20, PFAM:PF03464.20, PFAM:PF03465.20 contig_92 cds 18683 19642 + GCA001639275_01536 hypothetical protein contig_92 cds 19647 20696 + GCA001639275_01537 hypothetical protein PFAM:PF13692.12 contig_92 cds 20702 22003 - GCA001639275_01538 hypothetical protein PFAM:PF00070.33, PFAM:PF07992.20 contig_92 cds 22079 22348 + GCA001639275_01539 HypC/HybG/HupF family hydrogenase formation chaperone SO:0001217, UniRef:UniRef50_A0A3B9V7P3 contig_92 cds 22345 22848 - GCA001639275_01540 hypothetical protein contig_92 tRNA 22960 23034 - GCA001639275_01541 trnI tRNA-Ile(gat) SO:0000263 contig_92 cds 23140 23424 - GCA001639275_01542 hypothetical protein PFAM:PF01883.24 contig_92 cds 23505 24413 - GCA001639275_01543 hypothetical protein PFAM:PF14810.12, PFAM:PF17884.7 contig_92 cds 24415 24906 - GCA001639275_01544 HD domain-containing protein SO:0001217, UniRef:UniRef50_A0A1G1GSR3 contig_92 cds 24912 25433 - GCA001639275_01545 hypothetical protein contig_92 cds 25550 26749 - GCA001639275_01546 Glutamine--scyllo-inositol transaminase SO:0001217, UniRef:UniRef50_A0A7Z9DJ26 contig_92 cds 26764 28626 - GCA001639275_01547 UDP-N-acetylglucosamine 4 6-dehydratase SO:0001217, UniRef:UniRef50_R7MBD1 contig_92 cds 28768 29625 - GCA001639275_01548 hypothetical protein contig_92 cds 29699 30271 + GCA001639275_01549 hypothetical protein PFAM:PF02887.21 contig_92 cds 31747 32685 - GCA001639275_01550 hypothetical protein contig_92 cds 33470 34606 + GCA001639275_01551 hypothetical protein PFAM:PF00091.31, PFAM:PF12327.13 contig_92 cds 34691 34870 + GCA001639275_01552 hypothetical protein contig_92 cds 35249 35716 + GCA001639275_01553 hypothetical protein contig_92 cds 35716 36195 + GCA001639275_01554 hypothetical protein PFAM:PF00298.24, PFAM:PF03946.19 contig_92 cds 36368 37006 + GCA001639275_01555 hypothetical protein PFAM:PF00687.26 contig_92 cds 37006 38013 + GCA001639275_01556 hypothetical protein PFAM:PF17777.6 contig_92 cds 38075 38380 + GCA001639275_01557 hypothetical protein contig_92 cds 38538 41225 + GCA001639275_01558 hypothetical protein PFAM:PF02272.25, PFAM:PF07973.19 contig_92 cds 41370 41834 + GCA001639275_01559 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_92 cds 42245 42697 + GCA001639275_01560 hypothetical protein PFAM:PF13358.12 contig_92 cds 42898 43497 - GCA001639275_01561 hypothetical protein contig_92 cds 43560 43709 - GCA001639275_01562 hypothetical protein contig_92 cds 43719 43979 - GCA001639275_01563 hypothetical protein contig_92 cds 44055 44435 + GCA001639275_01564 hypothetical protein contig_92 cds 44674 45819 + GCA001639275_01565 hypothetical protein PFAM:PF02540.23, PFAM:PF02926.22, PFAM:PF03054.22, PFAM:PF06508.19, PFAM:PF22025.1 contig_92 cds 45928 47022 + GCA001639275_01566 hypothetical protein contig_92 cds 46935 47294 - GCA001639275_01567 hypothetical protein PFAM:PF12636.12 contig_92 cds 47329 48465 + GCA001639275_01568 hypothetical protein PFAM:PF02687.27, PFAM:PF12704.14 contig_92 cds 48474 49178 + GCA001639275_01569 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_92 cds 49189 49431 - GCA001639275_01570 hypothetical protein contig_92 cds 49428 49994 - GCA001639275_01571 hypothetical protein contig_92 cds 50042 50623 + GCA001639275_01572 hypothetical protein contig_92 cds 50631 51539 - GCA001639275_01573 hypothetical protein contig_92 cds 51651 52355 + GCA001639275_01574 hypothetical protein PFAM:PF05707.18, PFAM:PF06745.19, PFAM:PF08423.17, PFAM:PF13479.12, PFAM:PF13481.12 contig_92 cds 52457 53569 + GCA001639275_01575 hypothetical protein contig_92 cds 53712 54209 + GCA001639275_01576 hypothetical protein contig_92 cds 54166 54369 + GCA001639275_01577 hypothetical protein contig_92 cds 54509 54793 + GCA001639275_01578 hypothetical protein contig_92 cds 54871 55179 + GCA001639275_01579 hypothetical protein contig_92 cds 55205 55648 + GCA001639275_01580 hypothetical protein contig_92 cds 55652 56032 + GCA001639275_01581 hypothetical protein contig_92 cds 56166 56717 - GCA001639275_01582 Type II restriction endonuclease subunit S SO:0001217, UniRef:UniRef50_A0A4U8UBQ3 contig_92 cds 56695 57258 - GCA001639275_01583 hypothetical protein PFAM:PF01420.25, SO:0001217, UniRef:UniRef50_A0AB34AF80 contig_92 cds 57266 59149 - GCA001639275_01584 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A378PLV9 contig_92 cds 59687 60829 + GCA001639275_01585 hypothetical protein contig_92 cds 60826 61293 + GCA001639275_01586 hypothetical protein contig_92 cds 61749 61904 - GCA001639275_01587 hypothetical protein contig_92 cds 62019 62180 + GCA001639275_01588 hypothetical protein contig_92 cds 62197 62409 - GCA001639275_01589 KTSC domain-containing protein SO:0001217, UniRef:UniRef50_W0N2E5 contig_92 cds 62603 62767 + GCA001639275_01590 hypothetical protein contig_92 cds 62760 63449 + GCA001639275_01591 hypothetical protein contig_92 cds 63446 63943 + GCA001639275_01592 hypothetical protein contig_92 cds 63940 64203 + GCA001639275_01593 hypothetical protein contig_92 cds 64206 64766 + GCA001639275_01594 hypothetical protein PFAM:PF13479.12 contig_92 cds 64736 65248 + GCA001639275_01595 hypothetical protein PFAM:PF13392.12 contig_92 cds 65254 65568 + GCA001639275_01596 hypothetical protein PFAM:PF08960.15 contig_92 cds 65570 66067 + GCA001639275_01597 hypothetical protein contig_92 cds 66072 66305 + GCA001639275_01598 hypothetical protein PFAM:PF04434.22 contig_92 cds 66298 66915 + GCA001639275_01599 hypothetical protein PFAM:PF13391.12 contig_92 cds 66908 67390 + GCA001639275_01600 hypothetical protein contig_92 cds 67595 67930 + GCA001639275_01601 hypothetical protein contig_92 cds 67940 68047 + GCA001639275_01602 hypothetical protein contig_92 cds 68065 68274 + GCA001639275_01603 hypothetical protein contig_92 cds 68603 68800 + GCA001639275_01604 hypothetical protein contig_92 cds 68802 69035 + GCA001639275_01605 hypothetical protein contig_92 cds 69107 69586 + GCA001639275_01606 hypothetical protein contig_92 cds 69855 70181 + GCA001639275_01607 hypothetical protein contig_92 cds 70508 70777 + GCA001639275_01608 hypothetical protein contig_92 cds 70784 71113 + GCA001639275_01609 hypothetical protein contig_92 cds 71206 71787 + GCA001639275_01610 hypothetical protein contig_92 cds 71741 73123 + GCA001639275_01611 hypothetical protein PFAM:PF17289.8 contig_92 cds 73147 74445 + GCA001639275_01612 hypothetical protein contig_92 cds 74447 76189 + GCA001639275_01613 hypothetical protein contig_92 cds 76231 76539 + GCA001639275_01614 hypothetical protein contig_92 cds 76708 77235 + GCA001639275_01615 hypothetical protein contig_92 cds 77272 77379 - GCA001639275_01616 hypothetical protein contig_92 cds 77635 78687 + GCA001639275_01617 hypothetical protein contig_92 cds 78714 79736 + GCA001639275_01618 hypothetical protein contig_92 cds 79801 80262 + GCA001639275_01619 hypothetical protein contig_92 cds 80263 80598 + GCA001639275_01620 hypothetical protein contig_92 cds 80603 81085 + GCA001639275_01621 hypothetical protein contig_92 cds 81121 81732 + GCA001639275_01622 hypothetical protein contig_92 cds 81729 81977 + GCA001639275_01623 hypothetical protein contig_92 cds 81983 83116 + GCA001639275_01624 hypothetical protein contig_92 cds 83154 83561 + GCA001639275_01625 hypothetical protein contig_92 cds 83598 84332 + GCA001639275_01626 hypothetical protein contig_92 cds 84307 84525 + GCA001639275_01627 hypothetical protein contig_92 cds 84546 87959 + GCA001639275_01628 hypothetical protein contig_92 cds 87965 88468 + GCA001639275_01629 hypothetical protein contig_92 cds 88473 89387 + GCA001639275_01630 hypothetical protein PFAM:PF01841.26 contig_92 cds 89413 90504 + GCA001639275_01631 hypothetical protein PFAM:PF24032.1 contig_92 cds 90501 91187 + GCA001639275_01632 hypothetical protein contig_92 cds 91191 92468 + GCA001639275_01633 hypothetical protein contig_92 cds 92491 92919 + GCA001639275_01634 hypothetical protein contig_92 cds 92916 94061 + GCA001639275_01635 hypothetical protein contig_92 cds 94063 95739 + GCA001639275_01636 hypothetical protein PFAM:PF07602.17 contig_92 cds 95717 97306 + GCA001639275_01637 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11 contig_92 cds 97336 97593 + GCA001639275_01638 hypothetical protein contig_92 cds 97590 98261 + GCA001639275_01639 hypothetical protein contig_93 cds 393 677 + GCA001639275_01640 hypothetical protein contig_93 cds 2201 2332 + GCA001639275_01641 hypothetical protein contig_93 cds 2600 3163 + GCA001639275_01642 hypothetical protein PFAM:PF01420.25 contig_93 cds 3164 4663 + GCA001639275_01643 hypothetical protein PFAM:PF12161.14 contig_93 cds 4847 5284 + GCA001639275_01644 hypothetical protein contig_93 cds 5288 5689 + GCA001639275_01645 hypothetical protein contig_93 cds 5742 6764 - GCA001639275_01646 Adenylosuccinate synthetase SO:0001217, UniRef:UniRef50_A0A401RB49 contig_94 cds 257 451 - GCA001639275_01647 hypothetical protein contig_94 cds 408 680 - GCA001639275_01648 hypothetical protein contig_94 cds 955 1059 - GCA001639275_01649 hypothetical protein contig_94 cds 1147 2370 - GCA001639275_01650 argJ Arginine biosynthesis bifunctional protein ArgJ 1 SO:0001217, UniRef:UniRef50_Q97GH6 contig_94 cds 2391 2663 - GCA001639275_01651 hypothetical protein contig_94 cds 2684 3886 - GCA001639275_01652 hypothetical protein contig_94 cds 3879 4904 - GCA001639275_01653 hypothetical protein PFAM:PF11977.14 contig_94 cds 5298 6041 - GCA001639275_01654 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_94 cds 6047 6397 - GCA001639275_01655 hypothetical protein PFAM:PF19026.7 contig_95 cds 231 2165 + GCA001639275_01656 hypothetical protein PFAM:PF02369.22, PFAM:PF17789.7 contig_95 cds 2335 6339 + GCA001639275_01657 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_96 cds 178 522 + GCA001639275_01658 hypothetical protein contig_96 cds 522 755 + GCA001639275_01659 hypothetical protein contig_96 cds 1272 1574 - GCA001639275_01660 hypothetical protein contig_96 cds 1887 2069 - GCA001639275_01661 hypothetical protein contig_96 cds 3342 3740 - GCA001639275_01662 hypothetical protein contig_96 cds 3798 4145 - GCA001639275_01663 hypothetical protein contig_97 cds 329 1087 - GCA001639275_01664 hypothetical protein contig_97 cds 1520 1834 + GCA001639275_01665 HEAT repeat domain-containing protein SO:0001217, UniRef:UniRef50_A0A4Z0GHC0 contig_97 cds 2068 2808 - GCA001639275_01666 hypothetical protein contig_97 cds 2825 3754 - GCA001639275_01667 drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA SO:0001217, UniRef:UniRef50_A0A7U9SDZ3 contig_97 cds 3847 4548 - GCA001639275_01668 hypothetical protein contig_98 cds 646 5277 - GCA001639275_01669 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF13229.12, PFAM:PF22508.2, PFAM:PF24595.1 contig_99 cds 2365 2514 + GCA001639275_01670 hypothetical protein contig_99 cds 2454 3332 - GCA001639275_01671 Acetylglutamate kinase SO:0001217, UniRef:UniRef50_Q9X2A4 contig_99 cds 3365 3613 - GCA001639275_01672 hypothetical protein contig_99 cds 4091 4231 - GCA001639275_01673 hypothetical protein contig_99 cds 4238 5116 - GCA001639275_01674 hypothetical protein PFAM:PF02037.33 contig_100 rRNA 79 1565 + GCA001639275_01675 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_100 rRNA 2045 5067 + GCA001639275_01676 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_101 cds 321 4361 - GCA001639275_01677 hypothetical protein PFAM:PF01841.26, PFAM:PF02369.22, PFAM:PF09373.15, PFAM:PF13200.12, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_102 cds 467 718 - GCA001639275_01678 hypothetical protein contig_102 cds 1789 2061 + GCA001639275_01679 hypothetical protein contig_102 cds 2568 3371 - GCA001639275_01680 hypothetical protein contig_102 cds 3472 4443 - GCA001639275_01681 hypothetical protein PFAM:PF02289.21 contig_103 tRNA 409 492 + GCA001639275_01682 trnS tRNA-Ser(gct) SO:0000269 contig_103 cds 497 1402 - GCA001639275_01683 hypothetical protein PFAM:PF16916.10 contig_103 cds 1395 2510 - GCA001639275_01684 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25, PFAM:PF01041.23, PFAM:PF01053.26 contig_103 cds 2576 4192 - GCA001639275_01685 hypothetical protein PFAM:PF04055.27, PFAM:PF19864.4 contig_103 cds 5321 7594 + GCA001639275_01686 hypothetical protein PFAM:PF01841.26, PFAM:PF02369.22, PFAM:PF09134.16, PFAM:PF09373.15, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_103 cds 7826 8284 + GCA001639275_01687 hypothetical protein PFAM:PF01467.32 contig_103 cds 8383 8574 + GCA001639275_01688 hypothetical protein PFAM:PF00037.32, PFAM:PF12837.12 contig_103 cds 8584 9594 + GCA001639275_01689 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_103 cds 9613 9792 - GCA001639275_01690 hypothetical protein PFAM:PF04021.17 contig_103 cds 9785 10003 - GCA001639275_01691 hypothetical protein PFAM:PF04021.17 contig_103 cds 10181 11350 + GCA001639275_01692 hypothetical protein contig_103 cds 11340 12044 + GCA001639275_01693 UPF0173 metal-dependent hydrolase DRQ10_01330 SO:0001217, UniRef:UniRef50_A0A660ZKB3 contig_103 cds 12041 14047 - GCA001639275_01694 hypothetical protein PFAM:PF05670.18 contig_103 cds 14134 14406 + GCA001639275_01695 hypothetical protein contig_103 cds 14401 16221 - GCA001639275_01696 hypothetical protein contig_103 cds 16329 16850 + GCA001639275_01697 L(+)-tartrate dehydratase subunit beta SO:0001217, UniRef:UniRef50_A0A448HJ19 contig_103 cds 17305 17634 + GCA001639275_01698 hypothetical protein contig_103 cds 17636 18805 + GCA001639275_01699 hypothetical protein PFAM:PF00155.27, PFAM:PF03841.19, PFAM:PF22583.2 contig_103 cds 18996 19913 - GCA001639275_01700 hypothetical protein PFAM:PF02237.23, PFAM:PF03099.24, PFAM:PF21948.1 contig_103 cds 19933 21426 - GCA001639275_01701 Biotin carboxylase SO:0001217, UniRef:UniRef50_A0A2L2XBB6 contig_103 cds 21495 22124 + GCA001639275_01702 hypothetical protein PFAM:PF01170.24, PFAM:PF05175.20, PFAM:PF13649.12, PFAM:PF13847.12 contig_103 cds 22369 23196 + GCA001639275_01703 hypothetical protein contig_103 cds 23539 24549 + GCA001639275_01704 hypothetical protein contig_103 cds 24552 25316 + GCA001639275_01705 hypothetical protein contig_103 cds 25340 25600 + GCA001639275_01706 hypothetical protein contig_103 cds 25613 26338 + GCA001639275_01707 hypothetical protein PFAM:PF00181.29, PFAM:PF03947.24 contig_103 cds 26354 26764 + GCA001639275_01708 hypothetical protein PFAM:PF00203.26 contig_103 cds 26777 27241 + GCA001639275_01709 hypothetical protein PFAM:PF00237.24 contig_103 cds 27241 27999 + GCA001639275_01710 hypothetical protein PFAM:PF00189.25, PFAM:PF07650.23 contig_103 cds 28032 28238 + GCA001639275_01711 Large ribosomal subunit protein uL29 SO:0001217, UniRef:UniRef50_A0A9E5Y480 contig_103 cds 28239 28577 + GCA001639275_01712 hypothetical protein PFAM:PF01253.27 contig_103 cds 28663 28941 + GCA001639275_01713 hypothetical protein contig_103 cds 28953 29270 + GCA001639275_01714 hypothetical protein PFAM:PF00366.26 contig_103 cds 29275 29673 + GCA001639275_01715 hypothetical protein PFAM:PF00238.24 contig_103 cds 29683 30033 + GCA001639275_01716 hypothetical protein contig_103 cds 30035 30763 + GCA001639275_01717 hypothetical protein PFAM:PF01479.30, PFAM:PF08071.17 contig_103 cds 30760 31272 + GCA001639275_01718 hypothetical protein PFAM:PF00281.24, PFAM:PF00673.26 contig_103 cds 31436 31828 + GCA001639275_01719 hypothetical protein PFAM:PF00410.24 contig_103 cds 31837 32373 + GCA001639275_01720 hypothetical protein PFAM:PF00347.28 contig_103 cds 32387 32716 + GCA001639275_01721 hypothetical protein contig_103 cds 32849 33295 + GCA001639275_01722 hypothetical protein contig_103 cds 33307 33888 + GCA001639275_01723 hypothetical protein contig_103 cds 33891 34532 + GCA001639275_01724 hypothetical protein PFAM:PF00333.26, PFAM:PF03719.21 contig_103 cds 34545 35003 + GCA001639275_01725 hypothetical protein PFAM:PF00327.25 contig_103 cds 35019 35456 + GCA001639275_01726 hypothetical protein PFAM:PF00828.25 contig_103 cds 35489 36853 + GCA001639275_01727 hypothetical protein PFAM:PF10559.14 contig_103 cds 36892 37449 + GCA001639275_01728 hypothetical protein PFAM:PF13207.12, PFAM:PF13238.12 contig_103 cds 37460 38050 + GCA001639275_01729 hypothetical protein contig_103 cds 38195 38461 + GCA001639275_01730 hypothetical protein contig_103 cds 38461 38979 + GCA001639275_01731 hypothetical protein PFAM:PF02224.24, PFAM:PF13189.12, PFAM:PF13207.12, PFAM:PF13238.12 contig_103 cds 38980 39201 + GCA001639275_01732 hypothetical protein contig_103 cds 39272 40234 + GCA001639275_01733 hypothetical protein PFAM:PF08068.17 contig_103 cds 40300 42084 - GCA001639275_01734 hypothetical protein PFAM:PF09972.14 contig_103 cds 42094 42648 - GCA001639275_01735 lemA LemA family protein SO:0001217, UniRef:UniRef50_F7UX26 contig_103 tRNA 42900 42984 + GCA001639275_01736 trnS tRNA-Ser(gga) SO:0000269 contig_103 cds 43179 43625 + GCA001639275_01737 hypothetical protein contig_103 cds 43676 44200 + GCA001639275_01738 hypothetical protein PFAM:PF01479.30 contig_103 cds 44212 44604 + GCA001639275_01739 hypothetical protein contig_103 cds 44617 45417 + GCA001639275_01740 hypothetical protein PFAM:PF01000.31, PFAM:PF01193.29 contig_103 cds 45417 45782 + GCA001639275_01741 hypothetical protein PFAM:PF00828.25 contig_103 cds 45798 46223 + GCA001639275_01742 hypothetical protein contig_103 cds 46242 46643 + GCA001639275_01743 hypothetical protein contig_103 cds 46692 46862 + GCA001639275_01744 hypothetical protein PFAM:PF01194.22 contig_103 cds 46938 47117 + GCA001639275_01745 hypothetical protein contig_103 cds 47252 48496 + GCA001639275_01746 hypothetical protein PFAM:PF00113.28, PFAM:PF03952.21, PFAM:PF13378.12 contig_103 cds 48516 48710 + GCA001639275_01747 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF13237.11 contig_103 cds 48735 49334 + GCA001639275_01748 hypothetical protein contig_103 cds 49344 50192 + GCA001639275_01749 hypothetical protein PFAM:PF02900.23 contig_103 cds 50202 51164 + GCA001639275_01750 hypothetical protein PFAM:PF00288.32, PFAM:PF08544.19 contig_103 cds 51170 51970 + GCA001639275_01751 hypothetical protein contig_103 cds 51972 53018 + GCA001639275_01752 hypothetical protein PFAM:PF00478.31, PFAM:PF01070.24, PFAM:PF01645.23, PFAM:PF03060.21 contig_103 cds 53025 54368 + GCA001639275_01753 hypothetical protein PFAM:PF00753.33, PFAM:PF07521.17, PFAM:PF12706.13, PFAM:PF22505.1 contig_103 cds 54381 55370 + GCA001639275_01754 hypothetical protein PFAM:PF00348.22 contig_103 cds 55823 56173 + GCA001639275_01755 hypothetical protein contig_103 cds 56220 57254 + GCA001639275_01756 hypothetical protein PFAM:PF00384.28, PFAM:PF04879.21 contig_103 cds 57262 58407 + GCA001639275_01757 hypothetical protein PFAM:PF00037.32, PFAM:PF04432.18, PFAM:PF13183.11, PFAM:PF13534.11 contig_103 cds 58417 58824 + GCA001639275_01758 F420-non-reducing hydrogenase iron-sulfur subunit SO:0001217, UniRef:UniRef50_A0A916CBX2 contig_103 cds 59207 60022 + GCA001639275_01759 hypothetical protein PFAM:PF03119.21, PFAM:PF08271.17, PFAM:PF09297.16, PFAM:PF13240.11, PFAM:PF13248.11, PFAM:PF14803.11, PFAM:PF17032.10, PFAM:PF18912.6, PFAM:PF24460.1, PFAM:PF24463.1 contig_103 cds 60014 60793 - GCA001639275_01760 hypothetical protein PFAM:PF01978.25 contig_103 cds 60914 62221 + GCA001639275_01761 hypothetical protein contig_103 cds 62225 62554 + GCA001639275_01762 hypothetical protein PFAM:PF02311.25, PFAM:PF07883.17 contig_103 cds 62822 64054 + GCA001639275_01763 hypothetical protein PFAM:PF13635.12 contig_103 cds 64220 64534 + GCA001639275_01764 hypothetical protein contig_103 cds 64604 64708 + GCA001639275_01765 hypothetical protein contig_103 cds 65069 65635 + GCA001639275_01766 hypothetical protein PFAM:PF00440.29 contig_103 cds 65855 67582 + GCA001639275_01767 Xenobiotic-transporting ATPase SO:0001217, UniRef:UniRef50_A0A449I3P3 contig_103 cds 67584 69314 + GCA001639275_01768 ABC transporter SO:0001217, UniRef:UniRef50_G5GB05 contig_103 cds 69332 69526 + GCA001639275_01769 hypothetical protein contig_103 cds 69566 71098 + GCA001639275_01770 hypothetical protein PFAM:PF00005.33, PFAM:PF00931.28, PFAM:PF01078.27, PFAM:PF02463.25, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13555.12 contig_103 cds 71079 71792 + GCA001639275_01771 hypothetical protein contig_103 cds 71816 72421 + GCA001639275_01772 hypothetical protein contig_103 cds 72763 72981 + GCA001639275_01773 hypothetical protein contig_103 cds 73275 74087 - GCA001639275_01774 hypothetical protein PFAM:PF00398.26, PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_103 cds 74092 75102 - GCA001639275_01775 4Fe-4S ferredoxin-type domain-containing protein SO:0001217, UniRef:UniRef50_F7JS10 contig_103 cds 75105 76109 - GCA001639275_01776 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13374.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF14559.12 contig_103 cds 76592 78259 + GCA001639275_01777 hypothetical protein PFAM:PF00749.27, PFAM:PF03950.23, PFAM:PF20974.2 contig_103 cds 78269 78727 + GCA001639275_01778 hypothetical protein contig_103 cds 78734 80134 - GCA001639275_01779 hypothetical protein contig_103 cds 80835 82214 + GCA001639275_01780 hypothetical protein contig_103 cds 82441 83676 + GCA001639275_01781 LL-diaminopimelate aminotransferase SO:0001217, UniRef:UniRef50_A3DK17 contig_103 cds 83686 84369 + GCA001639275_01782 hypothetical protein contig_103 cds 84374 84961 + GCA001639275_01783 hypothetical protein PFAM:PF21831.1 contig_103 cds 84958 85551 + GCA001639275_01784 hypothetical protein contig_104 cds 1097 4225 - GCA001639275_01785 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF13229.12, PFAM:PF24346.1 contig_105 cds 173 751 + GCA001639275_01786 hypothetical protein PFAM:PF02223.23 contig_105 cds 764 1174 - GCA001639275_01787 hypothetical protein contig_105 cds 1167 2135 - GCA001639275_01788 hypothetical protein contig_105 cds 2144 3187 - GCA001639275_01789 hypothetical protein contig_105 cds 3215 3622 - GCA001639275_01790 hypothetical protein contig_105 cds 3932 4144 + GCA001639275_01791 hypothetical protein contig_106 cds 738 1019 - GCA001639275_01792 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13414.12 contig_106 cds 1138 2031 - GCA001639275_01793 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13432.12, PFAM:PF14559.12 contig_106 cds 2063 2872 - GCA001639275_01794 hypothetical protein contig_106 cds 3238 3558 - GCA001639275_01795 hypothetical protein contig_107 cds 146 1105 + GCA001639275_01796 hypothetical protein PFAM:PF01345.24, PFAM:PF07705.17 contig_107 cds 1272 1457 - GCA001639275_01797 hypothetical protein contig_107 cds 2681 3154 - GCA001639275_01798 hypothetical protein contig_108 cds 439 828 - GCA001639275_01799 hypothetical protein PFAM:PF00571.33 contig_108 cds 806 1720 - GCA001639275_01800 hypothetical protein PFAM:PF03477.21 contig_109 cds 3488 3670 + GCA001639275_01801 hypothetical protein contig_110 cds 66 248 - GCA001639275_01802 hypothetical protein contig_111 cds 1534 1857 - GCA001639275_01803 hypothetical protein contig_112 cds 720 1004 - GCA001639275_01804 hypothetical protein contig_112 cds 1034 1387 - GCA001639275_01805 hypothetical protein PFAM:PF01920.25 contig_112 cds 1444 1710 - GCA001639275_01806 hypothetical protein contig_112 cds 1712 2191 - GCA001639275_01807 hypothetical protein contig_112 cds 2368 2637 - GCA001639275_01808 hypothetical protein contig_113 cds 1141 1305 + GCA001639275_01809 hypothetical protein contig_113 cds 1702 1854 + GCA001639275_01810 hypothetical protein contig_113 cds 2041 2211 + GCA001639275_01811 hypothetical protein contig_114 cds 463 3567 + GCA001639275_01812 hypothetical protein PFAM:PF00112.29, PFAM:PF16640.11, PFAM:PF18560.7 contig_114 cds 3572 5257 + GCA001639275_01813 hypothetical protein PFAM:PF17789.7 contig_114 cds 5353 5946 + GCA001639275_01814 hypothetical protein contig_114 cds 5943 6458 + GCA001639275_01815 hypothetical protein PFAM:PF01242.24 contig_114 cds 6458 7156 + GCA001639275_01816 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11 contig_114 cds 7219 8160 + GCA001639275_01817 hypothetical protein PFAM:PF00571.33 contig_114 cds 8184 8984 + GCA001639275_01818 hypothetical protein PFAM:PF00571.33 contig_114 cds 9388 9843 + GCA001639275_01819 hypothetical protein PFAM:PF01842.31 contig_114 cds 9905 10615 + GCA001639275_01820 hypothetical protein contig_114 cds 10632 11180 + GCA001639275_01821 hypothetical protein contig_114 cds 11207 11716 + GCA001639275_01822 hypothetical protein PFAM:PF02441.25 contig_114 cds 11709 12365 + GCA001639275_01823 hypothetical protein PFAM:PF04127.22 contig_114 cds 12982 13623 - GCA001639275_01824 hypothetical protein PFAM:PF01269.23 contig_114 cds 13627 14778 - GCA001639275_01825 hypothetical protein contig_114 cds 14873 15418 + GCA001639275_01826 hypothetical protein contig_114 cds 15455 16366 + GCA001639275_01827 hypothetical protein PFAM:PF01180.27, PFAM:PF01207.24 contig_114 cds 16369 17169 + GCA001639275_01828 hypothetical protein PFAM:PF00175.26, PFAM:PF10418.14 contig_114 cds 17185 18204 + GCA001639275_01829 hypothetical protein contig_114 cds 18206 19996 + GCA001639275_01830 hypothetical protein PFAM:PF13482.12 contig_114 cds 20018 22285 - GCA001639275_01831 hypothetical protein PFAM:PF16640.11, PFAM:PF24025.1 contig_114 cds 22577 23605 - GCA001639275_01832 hypothetical protein contig_114 cds 23625 24644 - GCA001639275_01833 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_114 cds 24749 26662 - GCA001639275_01834 hypothetical protein PFAM:PF00753.33, PFAM:PF07521.17, PFAM:PF07650.23, PFAM:PF10996.14, PFAM:PF12706.13, PFAM:PF16661.11, PFAM:PF17214.9 contig_114 cds 26793 27407 - GCA001639275_01835 hypothetical protein PFAM:PF00227.31 contig_114 cds 27592 28329 + GCA001639275_01836 hypothetical protein PFAM:PF02475.23, PFAM:PF25133.1 contig_114 cds 28307 29407 - GCA001639275_01837 hypothetical protein PFAM:PF04055.27 contig_114 cds 29404 29844 - GCA001639275_01838 hypothetical protein contig_114 cds 29849 30787 - GCA001639275_01839 hypothetical protein contig_114 cds 30967 31443 - GCA001639275_01840 hypothetical protein PFAM:PF01037.27, PFAM:PF13404.12, PFAM:PF13412.12 contig_114 cds 31746 32906 - GCA001639275_01841 hypothetical protein contig_114 cds 33005 34123 + GCA001639275_01842 degT Aminotransferase DegT SO:0001217, UniRef:UniRef50_A0A7W7SEN9 contig_114 cds 34208 35149 - GCA001639275_01843 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11, PFAM:PF13353.11 contig_114 cds 35124 36131 - GCA001639275_01844 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11, PFAM:PF13353.11 contig_114 cds 36828 36995 - GCA001639275_01845 hypothetical protein contig_114 cds 37330 37875 + GCA001639275_01846 hypothetical protein contig_114 cds 38265 38804 + GCA001639275_01847 hypothetical protein contig_114 cds 38969 39607 + GCA001639275_01848 hypothetical protein contig_114 cds 39607 41250 + GCA001639275_01849 hypothetical protein PFAM:PF00005.33, PFAM:PF00485.24, PFAM:PF01078.27, PFAM:PF02463.25, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13555.12 contig_114 cds 41243 42973 + GCA001639275_01850 hypothetical protein PFAM:PF00005.33 contig_114 cds 42973 44697 + GCA001639275_01851 hypothetical protein PFAM:PF00005.33 contig_114 cds 44730 45035 - GCA001639275_01852 hypothetical protein PFAM:PF01910.22 contig_114 cds 45088 45954 + GCA001639275_01853 hypothetical protein contig_114 cds 45922 46887 - GCA001639275_01854 Sodium/calcium exchanger membrane region domain-containing protein SO:0001217, UniRef:UniRef50_V9H470 contig_114 cds 46868 48190 - GCA001639275_01855 hypothetical protein PFAM:PF00571.33, PFAM:PF01595.25, PFAM:PF03471.22 contig_114 cds 48213 48425 - GCA001639275_01856 hypothetical protein PFAM:PF09082.15 contig_114 cds 48480 49649 - GCA001639275_01857 hypothetical protein contig_114 cds 49711 50400 - GCA001639275_01858 hypothetical protein contig_114 cds 50439 50960 + GCA001639275_01859 hypothetical protein contig_114 cds 51013 51930 + GCA001639275_01860 hypothetical protein contig_114 cds 51941 53185 - GCA001639275_01861 hypothetical protein PFAM:PF04055.27, PFAM:PF19238.5 contig_114 cds 53670 54998 + GCA001639275_01862 hypothetical protein PFAM:PF02241.23, PFAM:PF02783.20 contig_114 cds 55038 55493 + GCA001639275_01863 hypothetical protein contig_114 cds 55495 56094 + GCA001639275_01864 hypothetical protein contig_114 cds 56097 56855 + GCA001639275_01865 hypothetical protein PFAM:PF02240.21 contig_114 cds 56861 58516 + GCA001639275_01866 hypothetical protein PFAM:PF02249.22, PFAM:PF02745.20 contig_114 cds 58745 59620 + GCA001639275_01867 hypothetical protein contig_114 cds 59633 60334 + GCA001639275_01868 hypothetical protein contig_114 cds 60335 61147 + GCA001639275_01869 hypothetical protein contig_114 cds 61164 61493 + GCA001639275_01870 hypothetical protein contig_114 cds 61494 62210 + GCA001639275_01871 hypothetical protein contig_114 cds 62223 62429 + GCA001639275_01872 hypothetical protein contig_114 cds 62441 62683 + GCA001639275_01873 hypothetical protein contig_114 cds 62697 63635 + GCA001639275_01874 hypothetical protein contig_114 cds 63750 65219 + GCA001639275_01875 hypothetical protein PFAM:PF09887.15 contig_114 cds 65240 65866 + GCA001639275_01876 hypothetical protein PFAM:PF12804.13 contig_114 cds 65853 66167 + GCA001639275_01877 hypothetical protein PFAM:PF05239.21 contig_114 cds 66284 67042 + GCA001639275_01878 sufC Iron-sulfur cluster assembly ATPase protein SufC SO:0001217, UniRef:UniRef50_A0A0F7GD74 contig_114 cds 66999 68258 + GCA001639275_01879 SUF system FeS cluster assembly SufBD core domain-containing protein SO:0001217, UniRef:UniRef50_A0A1F8MQ93 contig_114 cds 68588 69013 + GCA001639275_01880 F420-non-reducing hydrogenase iron-sulfur subunit SO:0001217, UniRef:UniRef50_A0A916HS97 contig_114 cds 69028 69954 + GCA001639275_01881 hypothetical protein PFAM:PF01058.29 contig_114 cds 69956 71380 + GCA001639275_01882 hypothetical protein contig_114 cds 71398 72636 + GCA001639275_01883 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_114 cds 72676 73932 - GCA001639275_01884 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_114 cds 73946 74500 - GCA001639275_01885 hypothetical protein contig_114 cds 74580 75668 + GCA001639275_01886 hypothetical protein PFAM:PF01467.32, PFAM:PF16581.11 contig_114 cds 75654 76571 - GCA001639275_01887 hypothetical protein contig_114 cds 76722 76970 - GCA001639275_01888 hypothetical protein contig_114 cds 77144 77626 + GCA001639275_01889 hypothetical protein PFAM:PF00252.24 contig_115 cds 1919 2131 + GCA001639275_01890 hypothetical protein contig_116 cds 552 872 + GCA001639275_01891 hypothetical protein contig_117 cds 166 831 - GCA001639275_01892 hypothetical protein contig_117 cds 854 1498 - GCA001639275_01893 hypothetical protein contig_117 cds 1524 1745 - GCA001639275_01894 hypothetical protein contig_118 cds 1168 1362 + GCA001639275_01895 hypothetical protein contig_119 cds 728 946 - GCA001639275_01896 hypothetical protein contig_120 cds 133 567 - GCA001639275_01897 hypothetical protein contig_121 cds 590 1651 - GCA001639275_01898 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF17789.7, PFAM:PF24025.1 contig_122 cds 706 813 + GCA001639275_01899 hypothetical protein contig_125 cds 678 1769 - GCA001639275_01900 hypothetical protein PFAM:PF02415.23 contig_125 cds 2856 3104 - GCA001639275_01901 hypothetical protein contig_125 cds 3114 3575 - GCA001639275_01902 hypothetical protein PFAM:PF06445.20 contig_125 cds 3624 4847 - GCA001639275_01903 hypothetical protein PFAM:PF00994.29, PFAM:PF03454.20 contig_125 cds 4966 5271 + GCA001639275_01904 hypothetical protein PFAM:PF01176.25 contig_125 cds 5298 6077 + GCA001639275_01905 hypothetical protein PFAM:PF01163.29 contig_125 cds 6127 6744 + GCA001639275_01906 hypothetical protein PFAM:PF00013.35, PFAM:PF21800.4, PFAM:PF22891.2 contig_125 cds 7052 8728 + GCA001639275_01907 hypothetical protein PFAM:PF02518.31, PFAM:PF09239.17, PFAM:PF13589.12 contig_125 cds 8733 9830 + GCA001639275_01908 hypothetical protein PFAM:PF04406.19, PFAM:PF20768.2, PFAM:PF21180.3 contig_125 cds 9945 10205 + GCA001639275_01909 Metal-sensitive transcriptional repressor SO:0001217, UniRef:UniRef50_S3CFU3 contig_125 cds 10265 12106 + GCA001639275_01910 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_A0A9D1EAV7 contig_125 cds 12180 12392 + GCA001639275_01911 copZ Copper chaperone CopZ SO:0001217, UniRef:UniRef50_C8WVM7 contig_125 cds 12515 13531 + GCA001639275_01912 hypothetical protein PFAM:PF01113.26, PFAM:PF02800.25 contig_125 cds 13559 14395 + GCA001639275_01913 hypothetical protein PFAM:PF01261.30 contig_125 cds 14481 15602 + GCA001639275_01914 hypothetical protein PFAM:PF00004.35, PFAM:PF05496.18, PFAM:PF06068.19, PFAM:PF07728.20, PFAM:PF13401.12, PFAM:PF17862.7, PFAM:PF23900.1, PFAM:PF23902.1 contig_125 cds 15691 16509 + GCA001639275_01915 hypothetical protein contig_125 cds 16519 17715 - GCA001639275_01916 hypothetical protein PFAM:PF00745.25, PFAM:PF05201.20, PFAM:PF13241.12 contig_125 cds 17705 18340 - GCA001639275_01917 hypothetical protein PFAM:PF13241.12 contig_125 cds 18342 18824 - GCA001639275_01918 hypothetical protein contig_125 cds 19032 19703 + GCA001639275_01919 hypothetical protein PFAM:PF10263.15 contig_125 cds 19717 21321 - GCA001639275_01920 hypothetical protein PFAM:PF00005.33, PFAM:PF03193.22 contig_125 cds 21381 22088 - GCA001639275_01921 hypothetical protein PFAM:PF01207.24 contig_125 cds 22121 22885 - GCA001639275_01922 hypothetical protein PFAM:PF18182.6 contig_125 cds 22902 23807 - GCA001639275_01923 hypothetical protein contig_125 cds 23816 24580 - GCA001639275_01924 hypothetical protein contig_125 cds 24608 25234 - GCA001639275_01925 hypothetical protein PFAM:PF07826.16 contig_125 cds 25251 25661 - GCA001639275_01926 hypothetical protein contig_125 cds 25670 26509 - GCA001639275_01927 hypothetical protein contig_125 cds 26587 27186 - GCA001639275_01928 hypothetical protein contig_125 cds 27244 28317 - GCA001639275_01929 hypothetical protein PFAM:PF14450.12 contig_125 cds 28320 28958 - GCA001639275_01930 hypothetical protein contig_125 cds 29348 30043 + GCA001639275_01931 hypothetical protein contig_125 cds 30087 31238 + GCA001639275_01932 hypothetical protein contig_125 cds 31279 32001 + GCA001639275_01933 hypothetical protein PFAM:PF04203.18 contig_125 cds 32002 32373 + GCA001639275_01934 hypothetical protein contig_125 cds 32370 33527 - GCA001639275_01935 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25, PFAM:PF00282.25, PFAM:PF01041.23 contig_125 cds 33583 35856 - GCA001639275_01936 hypothetical protein PFAM:PF00391.29, PFAM:PF02896.24 contig_125 cds 36909 39485 - GCA001639275_01937 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_125 cds 39552 41051 - GCA001639275_01938 hypothetical protein PFAM:PF00005.33 contig_125 cds 41062 41862 - GCA001639275_01939 hypothetical protein PFAM:PF01061.29 contig_125 cds 42241 44835 + GCA001639275_01940 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_125 cds 44832 45827 + GCA001639275_01941 hypothetical protein PFAM:PF05050.19 contig_125 cds 45830 46636 + GCA001639275_01942 hypothetical protein PFAM:PF00132.30 contig_125 cds 46646 47644 + GCA001639275_01943 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_125 cds 47641 48720 + GCA001639275_01944 hypothetical protein PFAM:PF00132.30 contig_125 cds 48754 49332 + GCA001639275_01945 ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG SO:0001217, UniRef:UniRef50_UPI0024AE16CD contig_125 cds 49346 49954 + GCA001639275_01946 Methyltransferase type 11 domain-containing protein SO:0001217, UniRef:UniRef50_W4LQH0 contig_125 cds 50916 52079 - GCA001639275_01947 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_125 cds 52160 53386 - GCA001639275_01948 hypothetical protein contig_125 cds 53879 54322 + GCA001639275_01949 hypothetical protein contig_125 cds 54489 55745 + GCA001639275_01950 hypothetical protein PFAM:PF00984.24, PFAM:PF03446.21, PFAM:PF03720.21, PFAM:PF03721.20 contig_125 cds 55791 56888 + GCA001639275_01951 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_125 cds 57590 59749 - GCA001639275_01952 hypothetical protein contig_126 cds 326 1156 - GCA001639275_01953 hypothetical protein contig_127 cds 15 1526 + GCA001639275_01954 hypothetical protein PFAM:PF00535.33 contig_128 cds 8 1327 - GCA001639275_01955 hypothetical protein contig_132 cds 8 667 - GCA001639275_01956 hypothetical protein contig_132 cds 631 1230 - GCA001639275_01957 hypothetical protein contig_133 cds 51 539 + GCA001639275_01958 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12 contig_133 cds 575 1360 + GCA001639275_01959 hypothetical protein PFAM:PF13358.12 contig_135 cds 510 677 + GCA001639275_01960 hypothetical protein contig_136 cds 145 381 + GCA001639275_01961 hypothetical protein contig_136 cds 772 1311 + GCA001639275_01962 hypothetical protein contig_136 cds 1397 2110 + GCA001639275_01963 hypothetical protein PFAM:PF01325.25, PFAM:PF02742.21, PFAM:PF04023.20, PFAM:PF13412.12 contig_136 cds 2201 2716 + GCA001639275_01964 hypothetical protein PFAM:PF01974.23, PFAM:PF02778.19 contig_136 cds 2814 3911 + GCA001639275_01965 hypothetical protein contig_136 cds 3911 4537 + GCA001639275_01966 hypothetical protein contig_136 cds 4580 5776 + GCA001639275_01967 hypothetical protein contig_136 cds 6010 6207 + GCA001639275_01968 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23, PFAM:PF15630.12 contig_136 cds 6670 7041 + GCA001639275_01969 hypothetical protein PFAM:PF01248.31 contig_136 cds 7077 7283 + GCA001639275_01970 hypothetical protein contig_136 cds 7298 7459 + GCA001639275_01971 hypothetical protein PFAM:PF01246.26, PFAM:PF06467.20 contig_136 cds 7456 7908 + GCA001639275_01972 Nucleoside diphosphate kinase SO:0001217, UniRef:UniRef50_Q5KXU2 contig_136 cds 7947 9737 + GCA001639275_01973 hypothetical protein PFAM:PF00009.33, PFAM:PF03144.31, PFAM:PF11987.13, PFAM:PF14578.12 contig_136 cds 9774 10157 + GCA001639275_01974 hypothetical protein contig_136 cds 10208 11422 + GCA001639275_01975 hypothetical protein PFAM:PF00009.33, PFAM:PF09173.17 contig_136 cds 11437 11829 + GCA001639275_01976 hypothetical protein PFAM:PF13638.12, PFAM:PF18477.7 contig_136 cds 11866 12432 + GCA001639275_01977 hypothetical protein PFAM:PF00575.29, PFAM:PF03876.22 contig_136 cds 12429 12605 + GCA001639275_01978 hypothetical protein PFAM:PF06093.19 contig_136 cds 12617 13126 + GCA001639275_01979 hypothetical protein contig_136 cds 13142 13453 + GCA001639275_01980 hypothetical protein contig_136 cds 13462 13614 + GCA001639275_01981 hypothetical protein PFAM:PF01599.25 contig_136 cds 13664 15085 + GCA001639275_01982 hypothetical protein PFAM:PF00206.25, PFAM:PF14698.11 contig_136 cds 15114 15293 - GCA001639275_01983 hypothetical protein contig_136 cds 15303 16316 - GCA001639275_01984 hypothetical protein PFAM:PF06508.19 contig_136 cds 16572 16973 + GCA001639275_01985 hypothetical protein contig_136 cds 17086 17868 + GCA001639275_01986 hypothetical protein PFAM:PF00132.30, PFAM:PF14602.12 contig_136 cds 17929 18090 + GCA001639275_01987 hypothetical protein PFAM:PF00301.25, PFAM:PF21349.2 contig_136 cds 18247 18381 + GCA001639275_01988 Rubredoxin SO:0001217, UniRef:UniRef50_A0A2U3LEZ3 contig_136 cds 18391 18501 + GCA001639275_01989 hypothetical protein PFAM:PF00301.25, PFAM:PF21349.2 contig_136 cds 18515 19114 - GCA001639275_01990 Impact N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_E7G631 contig_136 cds 19182 19550 + GCA001639275_01991 hypothetical protein contig_136 cds 19568 20260 - GCA001639275_01992 hypothetical protein contig_136 cds 20274 20756 - GCA001639275_01993 hypothetical protein PFAM:PF09183.16 contig_136 cds 21454 21867 + GCA001639275_01994 hypothetical protein contig_136 cds 21842 22075 + GCA001639275_01995 hypothetical protein contig_136 cds 22086 22547 + GCA001639275_01996 hypothetical protein contig_136 cds 23134 23367 + GCA001639275_01997 hypothetical protein PFAM:PF01423.28 contig_136 cds 23433 23621 + GCA001639275_01998 hypothetical protein contig_136 cds 23783 24193 + GCA001639275_01999 hypothetical protein contig_136 cds 24251 24598 + GCA001639275_02000 hypothetical protein contig_136 cds 24610 24954 - GCA001639275_02001 hypothetical protein contig_136 cds 25126 25806 + GCA001639275_02002 hypothetical protein PFAM:PF00035.32 contig_136 cds 25796 27262 + GCA001639275_02003 hypothetical protein PFAM:PF00561.26, PFAM:PF00571.33 contig_136 cds 27289 28578 - GCA001639275_02004 Methionine gamma-lyase SO:0001217, UniRef:UniRef50_A0AAP8BEH7 contig_136 cds 28644 30092 + GCA001639275_02005 hypothetical protein PFAM:PF00733.27, PFAM:PF13522.11, PFAM:PF13537.11 contig_136 cds 30282 31580 + GCA001639275_02006 hypothetical protein PFAM:PF02463.25, PFAM:PF13175.12, PFAM:PF13304.12 contig_136 cds 31573 32127 + GCA001639275_02007 hypothetical protein contig_136 cds 32499 33614 + GCA001639275_02008 hypothetical protein PFAM:PF01497.23 contig_136 cds 33638 34687 + GCA001639275_02009 hypothetical protein PFAM:PF00891.24, PFAM:PF08100.17 contig_136 cds 34694 35734 + GCA001639275_02010 hypothetical protein contig_136 cds 35743 36498 + GCA001639275_02011 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_136 cds 36657 36872 + GCA001639275_02012 hypothetical protein contig_136 cds 36886 37371 + GCA001639275_02013 hypothetical protein contig_136 cds 37380 38399 + GCA001639275_02014 Homoserine dehydrogenase SO:0001217, UniRef:UniRef50_A0A496RUS7 contig_136 cds 38440 39678 + GCA001639275_02015 hypothetical protein contig_136 cds 39747 41114 + GCA001639275_02016 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_T0UIN7 contig_136 cds 41133 41912 + GCA001639275_02017 hypothetical protein PFAM:PF00756.26, PFAM:PF02230.22 contig_136 cds 41953 43569 + GCA001639275_02018 CTP synthase SO:0001217, UniRef:UniRef50_Q97F61 contig_136 cds 43653 44522 + GCA001639275_02019 hypothetical protein contig_136 cds 44523 44951 + GCA001639275_02020 hypothetical protein PFAM:PF04021.17 contig_136 cds 45011 45832 + GCA001639275_02021 hypothetical protein contig_136 cds 45837 46517 + GCA001639275_02022 hypothetical protein PFAM:PF01902.24 contig_136 cds 46519 47058 - GCA001639275_02023 hypothetical protein PFAM:PF13207.12, PFAM:PF13238.12, PFAM:PF13671.12 contig_136 cds 47068 47805 - GCA001639275_02024 hypothetical protein contig_136 cds 47816 48199 - GCA001639275_02025 hypothetical protein contig_136 cds 49027 50076 + GCA001639275_02026 hypothetical protein PFAM:PF13482.12 contig_136 cds 50078 51580 + GCA001639275_02027 hypothetical protein PFAM:PF02985.28, PFAM:PF13646.12 contig_136 cds 51663 52691 + GCA001639275_02028 hypothetical protein PFAM:PF04389.22 contig_136 cds 52741 54177 - GCA001639275_02029 hypothetical protein PFAM:PF08245.18 contig_136 cds 54387 54950 - GCA001639275_02030 Acetyltransferase SO:0001217, UniRef:UniRef50_A0A1I7JY25 contig_136 cds 55624 56616 + GCA001639275_02031 hypothetical protein PFAM:PF00891.24, PFAM:PF05175.20, PFAM:PF08100.17, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12