# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_1 tRNA 37 111 + GCA002761215_00001 trnR tRNA-Arg(tct) SO:0001036 contig_1 cds 1354 1452 + GCA002761215_00002 hypothetical protein contig_1 cds 1528 1632 + GCA002761215_00003 hypothetical protein contig_1 cds 1878 2111 - GCA002761215_00004 hypothetical protein contig_1 cds 2313 2651 - GCA002761215_00005 hypothetical protein contig_1 cds 3363 3650 - GCA002761215_00006 hypothetical protein contig_1 cds 4831 5037 + GCA002761215_00007 Truncated glycosyltransferase SO:0001217, UniRef:UniRef50_Q1KYQ9 contig_1 cds 5864 6274 + GCA002761215_00008 hypothetical protein contig_1 cds 6520 6813 - GCA002761215_00009 hypothetical protein contig_1 cds 8666 8995 + GCA002761215_00010 hypothetical protein contig_1 cds 9035 9394 + GCA002761215_00011 hypothetical protein contig_1 cds 10978 11211 - GCA002761215_00012 hypothetical protein contig_1 cds 11290 11607 - GCA002761215_00013 hypothetical protein contig_1 cds 12272 12490 + GCA002761215_00014 hypothetical protein contig_1 cds 13859 14026 - GCA002761215_00015 hypothetical protein contig_1 cds 14505 14594 + GCA002761215_00016 hypothetical protein contig_1 cds 15952 16203 + GCA002761215_00017 hypothetical protein contig_1 cds 17805 18077 + GCA002761215_00018 (pseudo) Flavodoxin-like fold domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PG12, UniRef:UniRef90_A0A2U7PG12 contig_1 cds 18523 18888 - GCA002761215_00019 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P2I4, UniRef:UniRef90_A0A2U7P2I4 contig_1 cds 18936 19175 - GCA002761215_00020 (pseudo) Prolyl oligopeptidase family serine peptidase SO:0001217, UniRef:UniRef50_A0A929QH34, UniRef:UniRef90_A0A929QH34 contig_1 cds 20542 20781 + GCA002761215_00021 (pseudo) HD domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EC60, UniRef:UniRef90_A0A929QHW8 contig_1 cds 20890 21087 + GCA002761215_00022 (pseudo) Rhodanese-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A288GTB1, UniRef:UniRef90_A0A660MXY4 contig_1 cds 21091 21243 + GCA002761215_00023 hypothetical protein PFAM:PF00581.25 contig_1 cds 21378 21590 - GCA002761215_00024 (pseudo) Bacterial transcription activator effector binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PNE1, UniRef:UniRef90_A0A2U7PNE1 contig_1 cds 22129 22455 + GCA002761215_00025 hypothetical protein contig_1 cds 24088 24405 - GCA002761215_00026 hypothetical protein contig_1 cds 24748 24954 - GCA002761215_00027 hypothetical protein contig_1 cds 25143 25331 + GCA002761215_00028 hypothetical protein contig_1 cds 25265 25711 - GCA002761215_00029 DNA alkylation repair enzyme SO:0001217, UniRef:UniRef50_A0A3R9MX18 contig_1 cds 26464 26703 + GCA002761215_00030 hypothetical protein contig_1 cds 26717 26920 + GCA002761215_00031 hypothetical protein contig_1 cds 27111 27257 - GCA002761215_00032 hypothetical protein contig_1 cds 28832 29008 - GCA002761215_00033 hypothetical protein contig_1 cds 29160 29324 + GCA002761215_00034 DNA-directed RNA polymerase SO:0001217, UniRef:UniRef50_A0A359MZM9, UniRef:UniRef90_A0A946J3X2 contig_1 cds 29889 30011 + GCA002761215_00035 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NQQ6 contig_1 cds 30365 30499 - GCA002761215_00036 hypothetical protein contig_1 cds 30752 30913 - GCA002761215_00037 hypothetical protein contig_1 sorf 31119 31172 + GCA002761215_00038 rpoB DNA-directed RNA polymerase subunit beta EC:2.7.7.6, GO:0003677, GO:0003899, GO:0006351, KEGG:K03043, SO:0001217, UniParc:UPI001DED393E, UniRef:UniRef100_A0A944UYF8, UniRef:UniRef50_A0A0W0GJ23, UniRef:UniRef90_A0A1J4WTH7 contig_1 cds 31242 31427 + GCA002761215_00039 DNA-directed RNA polymerase subunit beta EC:2.7.7.6, GO:0003677, GO:0003899, GO:0006351, GO:0032549, KEGG:K03043, SO:0001217, UniParc:UPI001D32639C, UniRef:UniRef100_A0A944UX84, UniRef:UniRef50_A0A1F6NEH0, UniRef:UniRef90_A0A660MVS8 contig_1 cds 31757 32032 - GCA002761215_00040 hypothetical protein contig_1 cds 33305 33475 + GCA002761215_00041 hypothetical protein PFAM:PF04983.23 contig_1 cds 37364 37672 - GCA002761215_00042 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MQW6, UniRef:UniRef90_A0A660MQW6 contig_1 cds 37757 38128 - GCA002761215_00043 Tetratricopeptide repeat protein SO:0001217, UniParc:UPI000D777BDC, UniRef:UniRef100_A0A660MV66, UniRef:UniRef50_A0A7X5JJF8, UniRef:UniRef90_A0A660MV66 contig_1 cds 38320 38520 - GCA002761215_00044 hypothetical protein contig_1 cds 38550 38774 + GCA002761215_00045 (pseudo) Histidine triad nucleotide-binding protein SO:0001217, UniRef:UniRef50_A0A2U7NXC5, UniRef:UniRef90_A0A2U7NXC5 contig_1 cds 39302 39517 - GCA002761215_00046 hypothetical protein contig_1 cds 40426 40779 - GCA002761215_00047 hypothetical protein contig_1 cds 40817 40987 + GCA002761215_00048 hypothetical protein contig_1 cds 41586 41720 - GCA002761215_00049 (pseudo) Type I secretion C-terminal target domain-containing protein SO:0001217, UniRef:UniRef50_A0A5P8NE45, UniRef:UniRef90_A0A660MU30 contig_1 cds 42339 42455 + GCA002761215_00050 hypothetical protein PFAM:PF02934.20 contig_1 cds 42687 42899 + GCA002761215_00051 hypothetical protein contig_1 cds 43377 43511 + GCA002761215_00052 hypothetical protein contig_1 cds 43764 44003 + GCA002761215_00053 hypothetical protein contig_1 cds 44325 44663 - GCA002761215_00054 hypothetical protein contig_1 cds 44676 44918 - GCA002761215_00055 hypothetical protein contig_1 cds 46063 46167 + GCA002761215_00056 hypothetical protein contig_1 cds 47059 47154 + GCA002761215_00057 hypothetical protein contig_1 cds 48055 48408 + GCA002761215_00058 (pseudo) Methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2W4KFP9, UniRef:UniRef90_A0A2U7P0B0 contig_1 cds 48426 48563 - GCA002761215_00059 hypothetical protein contig_1 cds 49585 49728 + GCA002761215_00060 hypothetical protein contig_1 cds 49981 50151 + GCA002761215_00061 HD domain-containing protein SO:0001217, UniRef:UniRef50_UPI0034626F8F contig_1 cds 52340 52516 + GCA002761215_00062 hypothetical protein contig_1 cds 53212 53409 - GCA002761215_00063 hypothetical protein contig_1 cds 54178 54414 + GCA002761215_00064 hypothetical protein contig_1 cds 54402 54575 - GCA002761215_00065 hypothetical protein contig_1 tRNA 55932 56006 + GCA002761215_00066 trnF tRNA-Phe(gaa) SO:0000267 contig_1 cds 56117 56368 + GCA002761215_00067 hypothetical protein contig_1 cds 56311 56526 - GCA002761215_00068 hypothetical protein contig_1 cds 57876 58103 + GCA002761215_00069 hypothetical protein contig_1 cds 58291 58434 - GCA002761215_00070 hypothetical protein contig_1 cds 59413 59661 + GCA002761215_00071 hypothetical protein contig_1 cds 60789 60938 + GCA002761215_00072 hypothetical protein contig_1 cds 62138 62245 + GCA002761215_00073 hypothetical protein contig_1 cds 62744 63004 + GCA002761215_00074 hypothetical protein contig_1 cds 63078 63212 + GCA002761215_00075 hypothetical protein contig_1 cds 63747 63968 + GCA002761215_00076 hypothetical protein contig_1 cds 64251 64427 + GCA002761215_00077 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PG45, UniRef:UniRef90_A0A2U7PG45 contig_1 cds 64400 64612 - GCA002761215_00078 hypothetical protein contig_1 cds 64652 64759 + GCA002761215_00079 (pseudo) DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2U7P2L5, UniRef:UniRef90_A0A2U7P2L5 contig_1 cds 65188 65487 + GCA002761215_00080 hypothetical protein contig_1 cds 66390 66641 + GCA002761215_00081 (pseudo) tRNA (Adenine-N(6)-)-methyltransferase SO:0001217, UniRef:UniRef50_A0A2U7PNF4, UniRef:UniRef90_A0A2U7PNF4 contig_1 cds 67009 67182 + GCA002761215_00082 hypothetical protein contig_1 cds 67188 67307 + GCA002761215_00083 hypothetical protein contig_1 cds 68491 68697 + GCA002761215_00084 hypothetical protein contig_1 cds 68783 69019 - GCA002761215_00085 hypothetical protein contig_1 cds 70100 70345 - GCA002761215_00086 hypothetical protein contig_1 tRNA 71055 71126 + GCA002761215_00087 (pseudo) tRNA-Xxx contig_1 cds 71769 72029 - GCA002761215_00088 hypothetical protein contig_1 cds 72420 72548 + GCA002761215_00089 hypothetical protein contig_1 cds 72857 73108 - GCA002761215_00090 hypothetical protein contig_1 cds 73281 73511 + GCA002761215_00091 hypothetical protein contig_1 cds 74062 74319 + GCA002761215_00092 (pseudo) Mor transcription activator domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXF1, UniRef:UniRef90_A0A2U7NXF1 contig_1 cds 74782 74997 - GCA002761215_00093 hypothetical protein contig_1 cds 75051 75254 + GCA002761215_00094 hypothetical protein contig_1 cds 75785 75949 + GCA002761215_00095 hypothetical protein contig_1 cds 76089 76361 + GCA002761215_00096 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PG61, UniRef:UniRef90_A0A2U7PG61 contig_1 cds 76252 76614 - GCA002761215_00097 hypothetical protein contig_1 cds 77094 77366 + GCA002761215_00098 hypothetical protein contig_1 cds 77514 77765 + GCA002761215_00099 hypothetical protein contig_1 cds 77995 78102 + GCA002761215_00100 hypothetical protein contig_1 cds 78719 78904 + GCA002761215_00101 (pseudo) HK97 gp10 family phage protein SO:0001217, UniRef:UniRef50_A0A2U7PNG7, UniRef:UniRef90_A0A2U7PNG7 contig_1 cds 79084 79281 + GCA002761215_00102 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P0D1, UniRef:UniRef90_A0A2U7P0D1 contig_1 cds 79534 79656 + GCA002761215_00103 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PBX9, UniRef:UniRef90_A0A2U7PBX9 contig_1 cds 79890 80114 - GCA002761215_00104 hypothetical protein contig_1 cds 80626 80892 + GCA002761215_00105 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXF7, UniRef:UniRef90_A0A2U7NXF7 contig_1 cds 80886 81122 - GCA002761215_00106 hypothetical protein contig_1 cds 81921 82037 - GCA002761215_00107 hypothetical protein contig_1 cds 82404 82658 - GCA002761215_00108 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MYX2, UniRef:UniRef90_A0A2U7PG68 contig_1 cds 84295 84417 + GCA002761215_00109 hypothetical protein contig_1 cds 84855 84986 - GCA002761215_00110 hypothetical protein contig_1 cds 85716 86114 - GCA002761215_00111 hypothetical protein contig_1 cds 88711 88953 + GCA002761215_00112 hypothetical protein contig_1 cds 89215 89337 + GCA002761215_00113 hypothetical protein contig_1 cds 90428 90610 + GCA002761215_00114 (pseudo) CYTH domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PBZ0, UniRef:UniRef90_A0A2U7PBZ0 contig_1 cds 90744 90953 - GCA002761215_00115 hypothetical protein contig_1 cds 90954 91223 - GCA002761215_00116 hypothetical protein contig_1 cds 91541 91708 + GCA002761215_00117 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PGP7, UniRef:UniRef90_A0A2U7PGP7 contig_1 cds 93644 93916 - GCA002761215_00118 hypothetical protein contig_1 cds 94054 94314 + GCA002761215_00119 hypothetical protein PFAM:PF01406.26 contig_1 cds 95191 95376 + GCA002761215_00120 hypothetical protein contig_1 cds 99193 99333 - GCA002761215_00121 hypothetical protein contig_1 cds 100544 100810 + GCA002761215_00122 hypothetical protein contig_1 cds 101491 101682 - GCA002761215_00123 hypothetical protein contig_1 cds 102224 102466 + GCA002761215_00124 AMIN domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXI5, UniRef:UniRef90_A0A2U7NXI5 contig_1 cds 102678 102812 + GCA002761215_00125 hypothetical protein contig_1 cds 104200 104430 - GCA002761215_00126 hypothetical protein contig_1 cds 104897 105022 - GCA002761215_00127 hypothetical protein contig_1 cds 106386 106514 - GCA002761215_00128 hypothetical protein contig_1 cds 106608 106826 - GCA002761215_00129 (pseudo) DUF6620 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P4C5, UniRef:UniRef90_A0A2U7P4C5 contig_1 cds 107226 107330 - GCA002761215_00130 hypothetical protein contig_1 cds 107546 107767 - GCA002761215_00131 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MU68, UniRef:UniRef90_A0A660MU68 contig_1 cds 107774 107923 - GCA002761215_00132 hypothetical protein contig_1 cds 108516 108683 - GCA002761215_00133 hypothetical protein contig_1 cds 108902 109024 - GCA002761215_00134 hypothetical protein contig_1 cds 109117 109908 - GCA002761215_00135 CAAX protease SO:0001217, UniParc:UPI000D7772B8, UniRef:UniRef100_A0A2U7PG94, UniRef:UniRef50_A0A0B5CIE8, UniRef:UniRef90_A0A2U7PG94 contig_1 cds 110194 110952 - GCA002761215_00136 CAAX protease SO:0001217, UniRef:UniRef50_A0A069QMH8, UniRef:UniRef90_A0A2U7P2R3 contig_1 cds 110957 111781 - GCA002761215_00137 Serine aminopeptidase S33 domain-containing protein SO:0001217, UniParc:UPI000D7788D3, UniRef:UniRef100_A0A2U7NXJ6, UniRef:UniRef50_A0A2G6F0X1, UniRef:UniRef90_A0A328EES7 contig_1 cds 111788 112321 - GCA002761215_00138 tetR TetR family transcriptional regulator SO:0001217, UniParc:UPI000D776AB9, UniRef:UniRef100_A0A2U7P813, UniRef:UniRef50_A0A0B7H7Q9, UniRef:UniRef90_A0A2U7P813 contig_1 cds 112797 113072 - GCA002761215_00139 hypothetical protein PFAM:PF13421.11 contig_1 cds 113301 113420 - GCA002761215_00140 hypothetical protein contig_1 cds 113448 113654 + GCA002761215_00141 hypothetical protein contig_1 cds 114578 114754 - GCA002761215_00142 hypothetical protein contig_1 cds 115169 115372 - GCA002761215_00143 hypothetical protein contig_1 cds 116589 116765 - GCA002761215_00144 hypothetical protein contig_1 cds 116934 117242 - GCA002761215_00145 hypothetical protein contig_1 cds 118788 118955 + GCA002761215_00146 hypothetical protein contig_1 cds 119895 120020 + GCA002761215_00147 hypothetical protein contig_1 cds 121307 121495 + GCA002761215_00148 hypothetical protein SO:0001217, UniRef:UniRef50_A0AA36UIG3 contig_1 cds 122348 122650 + GCA002761215_00149 DEAD/DEAH box helicase family protein SO:0001217, UniRef:UniRef50_UPI000CB6EF6B contig_1 cds 123503 123772 + GCA002761215_00150 hypothetical protein PFAM:PF00271.37 contig_1 cds 124394 124501 + GCA002761215_00151 hypothetical protein contig_1 cds 124450 124719 - GCA002761215_00152 hypothetical protein contig_1 cds 124977 125090 - GCA002761215_00153 hypothetical protein contig_1 cds 125873 125965 + GCA002761215_00154 hypothetical protein contig_1 cds 127595 127744 + GCA002761215_00155 hypothetical protein contig_1 cds 128070 128333 + GCA002761215_00156 hypothetical protein PFAM:PF00881.29 contig_1 cds 128343 128636 + GCA002761215_00157 hypothetical protein contig_1 cds 128721 129041 + GCA002761215_00158 hypothetical protein contig_1 cds 130404 130577 - GCA002761215_00159 hypothetical protein contig_1 crispr 131652 131951 ? CRISPR array with 5 repeats of length 37, consensus sequence ATCTACAAAAGTAGAAATTAGATATTATGTTTAAACA and spacer length 26 SO:0001459 contig_1 crispr-repeat 131652 131688 ? CRISPR repeat contig_1 crispr-spacer 131689 131714 ? CRISPR spacer, sequence TTATTCAGATTTTGAATATGAAGAAA contig_1 crispr-repeat 131715 131751 ? CRISPR repeat contig_1 crispr-spacer 131752 131778 ? CRISPR spacer, sequence GTAGAGACCTAACAAGAAAAACTCTTA contig_1 crispr-repeat 131779 131815 ? CRISPR repeat contig_1 crispr-spacer 131816 131840 ? CRISPR spacer, sequence TTGTTTCTATCTCTTCAGGATAACC contig_1 crispr-repeat 131841 131877 ? CRISPR repeat contig_1 crispr-spacer 131878 131903 ? CRISPR spacer, sequence AACATTATATCATGTTGCTAGTATTG contig_1 crispr-repeat 131904 131940 ? CRISPR repeat contig_1 crispr-spacer 131941 131951 ? CRISPR spacer, sequence GTACTTTTATT contig_1 cds 132536 132991 - GCA002761215_00160 HXXEE domain-containing protein SO:0001217, UniRef:UniRef50_A0A929M784, UniRef:UniRef90_A0A929M784 contig_1 cds 133787 133927 - GCA002761215_00161 hypothetical protein contig_1 cds 135036 135299 - GCA002761215_00162 hypothetical protein contig_1 cds 135735 135920 - GCA002761215_00163 (pseudo) DUF4298 domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EK94, UniRef:UniRef90_A0A2U7NXK8 contig_1 cds 136330 136524 - GCA002761215_00164 hypothetical protein contig_1 cds 136804 136962 - GCA002761215_00165 hypothetical protein contig_1 cds 137277 137477 - GCA002761215_00166 hypothetical protein contig_1 cds 137721 137864 - GCA002761215_00167 hypothetical protein contig_1 cds 138727 138903 - GCA002761215_00168 hypothetical protein contig_1 cds 139128 139391 + GCA002761215_00169 hypothetical protein contig_1 cds 139520 139747 - GCA002761215_00170 hypothetical protein PFAM:PF21082.3 contig_1 cds 140049 140207 + GCA002761215_00171 hypothetical protein contig_1 cds 141553 141744 + GCA002761215_00172 hypothetical protein contig_1 cds 142100 142294 - GCA002761215_00173 hypothetical protein contig_1 cds 143078 143296 - GCA002761215_00174 hypothetical protein contig_1 cds 143588 143782 - GCA002761215_00175 hypothetical protein contig_1 cds 143962 144060 + GCA002761215_00176 hypothetical protein contig_1 cds 144252 144551 - GCA002761215_00177 hypothetical protein contig_1 cds 144552 144821 - GCA002761215_00178 hypothetical protein contig_1 cds 145030 145269 + GCA002761215_00179 hypothetical protein contig_1 cds 146534 146698 + GCA002761215_00180 hypothetical protein contig_1 cds 148515 148694 + GCA002761215_00181 hypothetical protein contig_1 cds 149866 150054 - GCA002761215_00182 hypothetical protein contig_1 cds 151248 151595 - GCA002761215_00183 (pseudo) DUF304 domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MW05, UniRef:UniRef90_A0A660MQX2 contig_1 cds 152591 152917 + GCA002761215_00184 grpE (pseudo) Protein GrpE KEGG:K03687, SO:0001217, UniRef:UniRef50_A0A2U7PGB9, UniRef:UniRef90_A0A2U7PGB9 contig_1 cds 154086 154286 + GCA002761215_00185 hypothetical protein contig_1 cds 154859 155302 - GCA002761215_00186 hypothetical protein contig_1 cds 155490 155735 - GCA002761215_00187 hypothetical protein contig_1 cds 156343 156945 - GCA002761215_00188 (pseudo) S-layer-like y domain-containing protein SO:0001217, UniRef:UniRef50_A0A328ELT9, UniRef:UniRef90_A0A660MTJ6 contig_1 cds 157522 157662 + GCA002761215_00189 hypothetical protein contig_1 cds 158355 158567 + GCA002761215_00190 hypothetical protein contig_1 cds 159047 159220 - GCA002761215_00191 hypothetical protein contig_1 cds 160497 160682 + GCA002761215_00192 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A1W9NX22 contig_1 cds 161234 161437 - GCA002761215_00193 hypothetical protein contig_1 cds 161708 161839 + GCA002761215_00194 hypothetical protein contig_1 cds 162332 162598 - GCA002761215_00195 hypothetical protein contig_1 cds 162660 163004 + GCA002761215_00196 hypothetical protein contig_1 cds 163457 163606 - GCA002761215_00197 hypothetical protein contig_1 cds 164455 164844 + GCA002761215_00198 hypothetical protein contig_1 cds 166420 166560 - GCA002761215_00199 hypothetical protein contig_1 cds 167425 167898 - GCA002761215_00200 hypothetical protein contig_1 cds 170066 170284 - GCA002761215_00201 hypothetical protein contig_1 cds 170311 170484 - GCA002761215_00202 hypothetical protein SO:0001217, UniRef:UniRef50_A0A929M404 contig_1 crispr 170617 171551 ? CRISPR array with 15 repeats of length 36, consensus sequence ATCTACAAAAGTAGAAATTAGATATTATGTTTAAAC and spacer length 27 SO:0001459 contig_1 crispr-repeat 170617 170652 ? CRISPR repeat contig_1 crispr-spacer 170653 170678 ? CRISPR spacer, sequence AGAGCCATTCCAAGCCTTAATATCTC contig_1 crispr-repeat 170679 170714 ? CRISPR repeat contig_1 crispr-spacer 170715 170742 ? CRISPR spacer, sequence AAGCTTGAAGTTTTTGATTAGTCATTTG contig_1 crispr-repeat 170743 170778 ? CRISPR repeat contig_1 crispr-spacer 170779 170805 ? CRISPR spacer, sequence GAACTACAGGTTCTGATTTATTAAAAG contig_1 crispr-repeat 170806 170841 ? CRISPR repeat contig_1 crispr-spacer 170842 170867 ? CRISPR spacer, sequence GCTCTGGCCGCCGAAGAATTTCGTCA contig_1 crispr-repeat 170868 170903 ? CRISPR repeat contig_1 crispr-spacer 170904 170931 ? CRISPR spacer, sequence CTTGATAAGGAGTTGTGAGAGGTAGCCA contig_1 crispr-repeat 170932 170967 ? CRISPR repeat contig_1 crispr-spacer 170968 170996 ? CRISPR spacer, sequence GCATATGATAATAAAACTCAAAGGAACTA contig_1 crispr-repeat 170997 171032 ? CRISPR repeat contig_1 crispr-spacer 171033 171058 ? CRISPR spacer, sequence CAGTAATACCATTTATAACATTTCAG contig_1 crispr-repeat 171059 171094 ? CRISPR repeat contig_1 crispr-spacer 171095 171120 ? CRISPR spacer, sequence GCTCTGGCCGCCGAAGAATTTCGTCA contig_1 crispr-repeat 171121 171156 ? CRISPR repeat contig_1 crispr-spacer 171157 171184 ? CRISPR spacer, sequence CTTGATAAGGAGTTGTGAGAGGTAGCCA contig_1 crispr-repeat 171185 171220 ? CRISPR repeat contig_1 crispr-spacer 171221 171249 ? CRISPR spacer, sequence GCATATGATAATAAAACTCAAAGGAACTA contig_1 crispr-repeat 171250 171285 ? CRISPR repeat contig_1 crispr-spacer 171286 171312 ? CRISPR spacer, sequence ACGTCAGGTGCCAGTCCTCAGCACCCT contig_1 crispr-repeat 171313 171348 ? CRISPR repeat contig_1 crispr-spacer 171349 171379 ? CRISPR spacer, sequence AAACCATTTTTTGTTCTAGGTTCAAAGTTAG contig_1 crispr-repeat 171380 171415 ? CRISPR repeat contig_1 crispr-spacer 171416 171441 ? CRISPR spacer, sequence AAGTTTTATGAGTTTTTGTTCTGAAT contig_1 crispr-repeat 171442 171477 ? CRISPR repeat contig_1 crispr-spacer 171478 171505 ? CRISPR spacer, sequence AAAAAAATACAATCAAATAGCAATATGG contig_1 crispr-repeat 171506 171541 ? CRISPR repeat contig_1 crispr-spacer 171542 171551 ? CRISPR spacer, sequence AGTACTTTTA contig_1 cds 172859 173020 - GCA002761215_00203 hypothetical protein contig_1 cds 174649 174804 + GCA002761215_00204 hypothetical protein contig_1 cds 175338 175589 - GCA002761215_00205 hypothetical protein PFAM:PF22222.1 contig_1 crispr 177972 178650 ? CRISPR array with 11 repeats of length 35, consensus sequence ATCTACAACTAGTAGAAATTTTATTATTTTTAATC and spacer length 28 SO:0001459 contig_1 crispr-repeat 177972 178006 ? CRISPR repeat contig_1 crispr-spacer 178007 178033 ? CRISPR spacer, sequence AAAGCCAAAAATCATATACCTACAATT contig_1 crispr-repeat 178034 178068 ? CRISPR repeat contig_1 crispr-spacer 178069 178097 ? CRISPR spacer, sequence AGGCGATACTGTAAGAGTTCAAACATTCC contig_1 crispr-repeat 178098 178132 ? CRISPR repeat contig_1 crispr-spacer 178133 178159 ? CRISPR spacer, sequence AAAGTGAATAATCAATGGTTGTTGAGG contig_1 crispr-repeat 178160 178194 ? CRISPR repeat contig_1 crispr-spacer 178195 178222 ? CRISPR spacer, sequence ATTAAGAGTTATGTTTAATTGGTTAGAG contig_1 crispr-repeat 178223 178257 ? CRISPR repeat contig_1 crispr-spacer 178258 178288 ? CRISPR spacer, sequence ACAGAAGAATGAAAAGCTAAATTTTGAATAA contig_1 crispr-repeat 178289 178323 ? CRISPR repeat contig_1 crispr-spacer 178324 178350 ? CRISPR spacer, sequence CTAGATTAAGTTTAGTTAAGTATGAAT contig_1 crispr-repeat 178351 178385 ? CRISPR repeat contig_1 crispr-spacer 178386 178413 ? CRISPR spacer, sequence ACTAGACCTATTTTCACAAACAATGTCT contig_1 crispr-repeat 178414 178448 ? CRISPR repeat contig_1 crispr-spacer 178449 178474 ? CRISPR spacer, sequence AATAAAACAGAAGATTATTTATTTTC contig_1 crispr-repeat 178475 178509 ? CRISPR repeat contig_1 crispr-spacer 178510 178538 ? CRISPR spacer, sequence CAATGATTAAAAGTACTTAATAATATTTT contig_1 crispr-repeat 178539 178573 ? CRISPR repeat contig_1 crispr-spacer 178574 178605 ? CRISPR spacer, sequence AATTGACTTTTGTAACACACTTTATGAGCTAA contig_1 crispr-repeat 178606 178640 ? CRISPR repeat contig_1 crispr-spacer 178641 178650 ? CRISPR spacer, sequence TGTACTTTTA contig_1 cds 179532 179708 - GCA002761215_00206 hypothetical protein contig_1 cds 181449 181613 - GCA002761215_00207 hypothetical protein contig_1 cds 182013 182426 - GCA002761215_00208 hypothetical protein contig_1 cds 182628 183215 - GCA002761215_00209 (pseudo) tRNA(Ile)-lysidine synthase EC:6.3.4.19, KEGG:K04075, SO:0001217, UniRef:UniRef50_A0A2U7NXM2, UniRef:UniRef90_A0A2U7NXM2 contig_1 cds 186388 186612 + GCA002761215_00210 hypothetical protein contig_1 cds 186751 186909 - GCA002761215_00211 hypothetical protein contig_1 cds 188791 188955 + GCA002761215_00212 hypothetical protein contig_1 cds 189550 189774 + GCA002761215_00213 hypothetical protein contig_1 cds 190036 190380 - GCA002761215_00214 hypothetical protein contig_1 cds 191937 192371 + GCA002761215_00215 htpX (pseudo) protease HtpX EC:3.4.24.-, GO:0004222, GO:0006508, SO:0001217, UniRef:UniRef50_A0A2U7P0J3, UniRef:UniRef90_A0A2U7P0J3 contig_1 cds 192684 192827 + GCA002761215_00216 hypothetical protein contig_1 cds 193181 193588 + GCA002761215_00217 hypothetical protein contig_1 cds 193555 193722 - GCA002761215_00218 hypothetical protein contig_1 cds 193841 194239 + GCA002761215_00219 hypothetical protein contig_1 cds 194158 194538 - GCA002761215_00220 hypothetical protein contig_1 cds 194657 194749 + GCA002761215_00221 hypothetical protein contig_1 cds 195503 196456 + GCA002761215_00222 hypothetical protein contig_1 cds 197263 197529 - GCA002761215_00223 hypothetical protein contig_1 cds 198369 198494 - GCA002761215_00224 hypothetical protein contig_1 cds 198530 198808 - GCA002761215_00225 hypothetical protein contig_1 cds 199314 199565 + GCA002761215_00226 hypothetical protein contig_1 cds 200348 200644 + GCA002761215_00227 hypothetical protein contig_1 cds 200761 201096 - GCA002761215_00228 hypothetical protein contig_1 cds 201375 201656 + GCA002761215_00229 hypothetical protein contig_1 cds 201720 201962 + GCA002761215_00230 hypothetical protein PFAM:PF07719.23, PFAM:PF13428.12, PFAM:PF14559.12 contig_1 cds 201993 202166 + GCA002761215_00231 hypothetical protein contig_1 cds 202678 202872 + GCA002761215_00232 hypothetical protein contig_1 cds 203340 203435 - GCA002761215_00233 hypothetical protein contig_1 cds 204846 204995 - GCA002761215_00234 Putative large conductance mechanosensitive channel protein SO:0001217, UniRef:UniRef50_B7CC35 contig_1 cds 206745 207092 - GCA002761215_00235 hypothetical protein contig_1 cds 207696 207923 - GCA002761215_00236 hypothetical protein contig_1 cds 209244 209672 - GCA002761215_00237 hypothetical protein contig_1 cds 210686 210913 - GCA002761215_00238 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXP3, UniRef:UniRef90_A0A2U7NXP3 contig_1 cds 211195 211455 + GCA002761215_00239 hypothetical protein contig_1 cds 211592 211702 + GCA002761215_00240 hypothetical protein contig_1 cds 212817 213065 - GCA002761215_00241 hypothetical protein contig_1 cds 213344 213640 + GCA002761215_00242 hypothetical protein PFAM:PF08264.19 contig_1 cds 214677 214892 + GCA002761215_00243 (pseudo) DUF4282 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PC85, UniRef:UniRef90_A0A2U7PC85 contig_1 cds 215180 215428 - GCA002761215_00244 hypothetical protein contig_1 cds 215511 215765 + GCA002761215_00245 hypothetical protein contig_1 cds 216193 216483 + GCA002761215_00246 (pseudo) YcxB-like protein domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXP0, UniRef:UniRef90_A0A2U7NXP0 contig_1 cds 216722 216898 + GCA002761215_00247 hypothetical protein contig_1 cds 219677 219826 - GCA002761215_00248 hypothetical protein contig_1 cds 221660 221797 + GCA002761215_00249 hypothetical protein contig_1 cds 221794 222324 + GCA002761215_00250 hypothetical protein contig_1 cds 222634 222792 + GCA002761215_00251 hypothetical protein contig_1 cds 223789 224046 + GCA002761215_00252 hypothetical protein contig_1 cds 225467 225715 + GCA002761215_00253 hypothetical protein contig_1 cds 226243 226419 + GCA002761215_00254 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXT4, UniRef:UniRef50_A0A2W4KF90, UniRef:UniRef90_A0A2U7NXT4 contig_1 cds 227947 228105 + GCA002761215_00255 hypothetical protein contig_1 cds 228817 229014 + GCA002761215_00256 hypothetical protein PFAM:PF04055.27 contig_1 cds 230710 230820 - GCA002761215_00257 hypothetical protein contig_1 cds 230817 231176 - GCA002761215_00258 hypothetical protein contig_1 cds 231173 231289 - GCA002761215_00259 hypothetical protein contig_1 cds 231456 231599 + GCA002761215_00260 hypothetical protein contig_1 cds 231886 232110 - GCA002761215_00261 hypothetical protein contig_1 cds 232219 232437 + GCA002761215_00262 hypothetical protein PFAM:PF00881.29 contig_1 cds 232848 232997 + GCA002761215_00263 hypothetical protein contig_1 cds 233511 233867 + GCA002761215_00264 hypothetical protein contig_1 cds 234276 234458 + GCA002761215_00265 hypothetical protein contig_1 cds 235038 235190 - GCA002761215_00266 hypothetical protein contig_1 cds 237609 237791 - GCA002761215_00267 hypothetical protein contig_1 ncRNA 238027 238447 - GCA002761215_00268 RNaseP_bact_a Bacterial RNase P class A RFAM:RF00010, SO:0000386 contig_1 cds 238311 238544 + GCA002761215_00269 hypothetical protein contig_1 cds 238759 238887 + GCA002761215_00270 hypothetical protein contig_1 cds 238903 239100 + GCA002761215_00271 hypothetical protein contig_1 cds 239761 239931 + GCA002761215_00272 hypothetical protein contig_1 cds 240216 240566 - GCA002761215_00273 Bypass of forespore C C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A929M2G0 contig_1 cds 240639 240818 - GCA002761215_00274 hypothetical protein SO:0001217, UniParc:UPI000D778419, UniRef:UniRef100_A0A2U7NXQ9, UniRef:UniRef50_A0A2U7NXQ9, UniRef:UniRef90_A0A2U7NXQ9 contig_1 cds 241332 241634 - GCA002761215_00275 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MTR6, UniRef:UniRef90_A0A660MTR6 contig_1 cds 241767 242039 - GCA002761215_00276 Auto-transporter adhesin head GIN domain-containing protein SO:0001217, UniParc:UPI000D7768CA, UniRef:UniRef100_A0A2U7P892, UniRef:UniRef50_A0A328EAS2, UniRef:UniRef90_A0A2U7P892 contig_1 cds 242185 242391 - GCA002761215_00277 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MV75, UniRef:UniRef90_A0A660MV75 contig_1 cds 242501 242716 + GCA002761215_00278 hypothetical protein contig_1 cds 244694 244789 + GCA002761215_00279 hypothetical protein contig_1 cds 247033 247401 + GCA002761215_00280 AAA family ATPase SO:0001217, UniRef:UniRef50_UPI00202A47B8 contig_1 cds 247506 247664 - GCA002761215_00281 hypothetical protein contig_1 cds 248977 249228 - GCA002761215_00282 hypothetical protein contig_1 cds 249556 249915 - GCA002761215_00283 (pseudo) Cyclic nucleotide-binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXR0, UniRef:UniRef90_A0A2U7NXR0 contig_1 cds 250406 250579 - GCA002761215_00284 hypothetical protein PFAM:PF00437.27 contig_1 cds 251370 251507 + GCA002761215_00285 hypothetical protein contig_1 cds 251549 251746 - GCA002761215_00286 hypothetical protein contig_1 cds 252143 252346 - GCA002761215_00287 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NRG8 contig_1 cds 252632 252829 - GCA002761215_00288 hypothetical protein contig_1 cds 255572 255982 + GCA002761215_00289 hypothetical protein PFAM:PF00580.27 contig_1 cds 256638 256889 - GCA002761215_00290 hypothetical protein contig_1 cds 257533 257805 + GCA002761215_00291 hypothetical protein contig_1 cds 257968 258387 - GCA002761215_00292 hypothetical protein SO:0001217, UniParc:UPI000D776941, UniRef:UniRef100_A0A2U7P0M5, UniRef:UniRef50_A0A2U7P0M5, UniRef:UniRef90_A0A2U7P0M5 contig_1 cds 258566 258724 - GCA002761215_00293 hypothetical protein contig_1 cds 259092 259220 - GCA002761215_00294 (pseudo) Band 7 domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UXX7, UniRef:UniRef90_A0A944UXX7 contig_1 cds 259449 259694 - GCA002761215_00295 hypothetical protein contig_1 cds 259952 260158 + GCA002761215_00296 hypothetical protein contig_1 cds 260394 260717 - GCA002761215_00297 hypothetical protein contig_1 cds 260965 261168 - GCA002761215_00298 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NR38 contig_1 cds 262096 262242 - GCA002761215_00299 hypothetical protein contig_1 cds 262366 262950 + GCA002761215_00300 ykuD YkuD domain-containing protein SO:0001217, UniParc:UPI000D77621B, UniRef:UniRef100_A0A2U7PH08, UniRef:UniRef50_A0A2U7PH08, UniRef:UniRef90_A0A2U7PH08 contig_1 cds 263041 263640 - GCA002761215_00301 (pseudo) DUF5667 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PGG2, UniRef:UniRef90_A0A2U7PGG2 contig_1 cds 263641 263850 - GCA002761215_00302 hypothetical protein contig_1 cds 265467 265727 + GCA002761215_00303 hypothetical protein contig_1 cds 266623 266808 + GCA002761215_00304 hypothetical protein contig_1 cds 266824 266985 + GCA002761215_00305 hypothetical protein PFAM:PF01029.23 contig_1 cds 267182 267367 + GCA002761215_00306 RNase III domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UZ55 contig_1 cds 267941 268039 + GCA002761215_00307 hypothetical protein contig_1 cds 269475 269564 + GCA002761215_00308 hypothetical protein PFAM:PF01624.25 contig_1 cds 269681 269869 - GCA002761215_00309 hypothetical protein contig_1 cds 270237 270350 + GCA002761215_00310 hypothetical protein contig_1 cds 270305 270610 - GCA002761215_00311 hypothetical protein contig_1 cds 270681 270947 - GCA002761215_00312 hypothetical protein contig_1 cds 271111 271416 + GCA002761215_00313 hypothetical protein contig_1 cds 271736 271900 + GCA002761215_00314 hypothetical protein contig_1 cds 272068 272220 - GCA002761215_00315 hypothetical protein contig_1 cds 272300 272491 + GCA002761215_00316 hypothetical protein contig_1 cds 273596 273763 + GCA002761215_00317 hypothetical protein contig_1 cds 274328 274585 + GCA002761215_00318 hypothetical protein contig_1 cds 274951 275118 - GCA002761215_00319 hypothetical protein PFAM:PF06594.17 contig_1 cds 275122 275322 - GCA002761215_00320 hypothetical protein contig_1 cds 275608 275733 - GCA002761215_00321 hypothetical protein contig_1 cds 275967 276155 + GCA002761215_00322 hypothetical protein contig_1 cds 279056 279223 + GCA002761215_00323 hypothetical protein contig_1 cds 279276 279392 + GCA002761215_00324 hypothetical protein contig_1 cds 280357 280638 - GCA002761215_00325 hypothetical protein contig_1 cds 281279 281437 + GCA002761215_00326 hypothetical protein contig_1 cds 281695 281799 + GCA002761215_00327 hypothetical protein contig_1 cds 282044 282169 + GCA002761215_00328 hypothetical protein contig_1 cds 282243 282404 - GCA002761215_00329 hypothetical protein contig_1 cds 282886 283227 + GCA002761215_00330 hypothetical protein contig_1 cds 283756 283893 + GCA002761215_00331 hypothetical protein contig_1 cds 284202 284375 - GCA002761215_00332 hypothetical protein contig_1 cds 284941 285093 - GCA002761215_00333 hypothetical protein contig_1 cds 285423 285575 - GCA002761215_00334 hypothetical protein contig_1 cds 285989 286282 - GCA002761215_00335 hypothetical protein contig_1 cds 289298 289435 + GCA002761215_00336 hypothetical protein contig_1 cds 290514 290702 - GCA002761215_00337 hypothetical protein contig_1 cds 291667 291846 + GCA002761215_00338 hypothetical protein contig_1 cds 292093 292230 + GCA002761215_00339 hypothetical protein contig_1 cds 293106 293330 + GCA002761215_00340 hypothetical protein contig_1 cds 293884 294090 - GCA002761215_00341 hypothetical protein contig_1 cds 294769 295032 - GCA002761215_00342 hypothetical protein contig_1 cds 295816 295989 - GCA002761215_00343 hypothetical protein contig_1 cds 296854 297063 + GCA002761215_00344 hypothetical protein PFAM:PF00580.27 contig_1 cds 297112 297279 + GCA002761215_00345 hypothetical protein contig_1 cds 297514 297606 + GCA002761215_00346 hypothetical protein contig_1 cds 297607 297816 + GCA002761215_00347 hypothetical protein contig_1 cds 298186 298578 + GCA002761215_00348 hypothetical protein PFAM:PF13361.12 contig_1 cds 300094 300240 + GCA002761215_00349 hypothetical protein contig_1 cds 302518 302817 + GCA002761215_00350 hypothetical protein contig_1 cds 304817 305107 - GCA002761215_00351 hypothetical protein contig_1 cds 305870 305989 - GCA002761215_00352 hypothetical protein SO:0001217, UniRef:UniRef50_A0A944UX07 contig_1 cds 306913 307047 - GCA002761215_00353 hypothetical protein contig_1 tRNA 307795 307871 + GCA002761215_00354 trnR tRNA-Arg(ccg) SO:0001036 contig_1 cds 309934 310452 + GCA002761215_00355 hypothetical protein contig_1 cds 311637 311801 - GCA002761215_00356 hypothetical protein contig_1 cds 311821 311994 + GCA002761215_00357 hypothetical protein contig_1 cds 312825 313016 + GCA002761215_00358 hypothetical protein SO:0001217, UniParc:UPI000D7763DB, UniRef:UniRef100_A0A2U7P8D3, UniRef:UniRef50_A0A660MU93, UniRef:UniRef90_A0A660MU93 contig_1 cds 313416 313592 + GCA002761215_00359 hypothetical protein contig_1 cds 313751 313894 - GCA002761215_00360 hypothetical protein contig_1 cds 314058 314225 + GCA002761215_00361 hypothetical protein contig_1 cds 314232 314483 + GCA002761215_00362 hypothetical protein contig_1 cds 314844 315155 + GCA002761215_00363 hypothetical protein contig_1 cds 315249 315431 + GCA002761215_00364 hypothetical protein contig_1 cds 315983 316105 - GCA002761215_00365 hypothetical protein contig_1 cds 316389 316568 + GCA002761215_00366 hypothetical protein contig_1 cds 320223 320339 - GCA002761215_00367 hypothetical protein contig_1 cds 320361 320660 - GCA002761215_00368 hypothetical protein contig_1 cds 320743 320964 + GCA002761215_00369 hypothetical protein contig_1 cds 320946 321095 - GCA002761215_00370 hypothetical protein contig_1 cds 321171 321422 - GCA002761215_00371 hypothetical protein contig_1 cds 323160 323516 + GCA002761215_00372 hypothetical protein contig_1 cds 323999 324133 - GCA002761215_00373 hypothetical protein contig_1 cds 324275 324454 - GCA002761215_00374 hypothetical protein PFAM:PF01653.23 contig_1 cds 324494 324664 - GCA002761215_00375 hypothetical protein contig_1 cds 324926 325057 - GCA002761215_00376 hypothetical protein contig_1 cds 325136 325324 - GCA002761215_00377 hypothetical protein PFAM:PF22745.1 contig_1 cds 326222 326506 + GCA002761215_00378 hypothetical protein contig_1 cds 327727 327849 - GCA002761215_00379 hypothetical protein contig_1 cds 328338 328442 + GCA002761215_00380 hypothetical protein contig_1 cds 328689 328892 + GCA002761215_00381 Pyruvate kinase SO:0001217, UniRef:UniRef50_A0A351Y791 contig_1 cds 328920 329258 + GCA002761215_00382 hypothetical protein PFAM:PF02887.21 contig_1 cds 329233 329361 - GCA002761215_00383 hypothetical protein contig_1 cds 331661 331798 + GCA002761215_00384 hypothetical protein contig_1 cds 332353 332484 - GCA002761215_00385 hypothetical protein contig_1 cds 332561 332791 + GCA002761215_00386 hypothetical protein contig_1 cds 333472 333651 + GCA002761215_00387 hypothetical protein contig_1 cds 333707 334102 - GCA002761215_00388 hypothetical protein contig_1 cds 334112 334255 - GCA002761215_00389 hypothetical protein contig_1 cds 334403 334852 - GCA002761215_00390 hypothetical protein contig_1 cds 335412 335633 + GCA002761215_00391 hypothetical protein contig_1 cds 336071 336415 - GCA002761215_00392 hypothetical protein contig_1 cds 337143 337490 - GCA002761215_00393 hypothetical protein SO:0001217, UniParc:UPI000D776C00, UniRef:UniRef100_A0A2U7P0Q7, UniRef:UniRef50_A0A2U7P0Q7, UniRef:UniRef90_A0A2U7P0Q7 contig_1 cds 338466 338705 - GCA002761215_00394 hypothetical protein contig_1 cds 339756 340076 + GCA002761215_00395 Colicin D immunity protein domain-containing protein SO:0001217, UniParc:UPI000D777401, UniRef:UniRef100_A0A2U7PH55, UniRef:UniRef50_A0A2U7PH55, UniRef:UniRef90_A0A2U7PH55 contig_1 cds 340964 341140 + GCA002761215_00396 (pseudo) NTP pyrophosphohydrolase MazG-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXW1, UniRef:UniRef90_A0A2U7NXW1 contig_1 cds 341385 341561 + GCA002761215_00397 (pseudo) Class I tRNA ligase family protein SO:0001217, UniRef:UniRef50_A0A949E1N8, UniRef:UniRef90_A0A944YRL6 contig_1 cds 343452 343925 + GCA002761215_00398 hypothetical protein PFAM:PF08264.19 contig_1 cds 345274 345603 - GCA002761215_00399 hypothetical protein contig_1 cds 345727 345903 - GCA002761215_00400 hypothetical protein contig_1 cds 346079 346297 + GCA002761215_00401 hypothetical protein contig_1 cds 346387 346743 + GCA002761215_00402 hypothetical protein contig_1 cds 346791 347057 - GCA002761215_00403 hypothetical protein contig_1 cds 347544 347897 - GCA002761215_00404 hypothetical protein contig_1 cds 348102 348263 - GCA002761215_00405 hypothetical protein contig_1 cds 349704 349865 - GCA002761215_00406 hypothetical protein contig_1 cds 350145 350378 + GCA002761215_00407 (pseudo) YbaB/EbfC family DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2U7PH61, UniRef:UniRef90_A0A2W4IDI3 contig_1 cds 352005 352160 + GCA002761215_00408 hypothetical protein contig_1 cds 354707 354868 - GCA002761215_00409 hypothetical protein contig_1 cds 355431 355583 + GCA002761215_00410 hypothetical protein contig_1 cds 356503 356727 + GCA002761215_00411 hypothetical protein contig_1 cds 358333 358647 + GCA002761215_00412 hypothetical protein PFAM:PF17871.7 contig_1 cds 359137 359367 + GCA002761215_00413 AAA domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UZE0 contig_1 cds 359791 359943 - GCA002761215_00414 hypothetical protein contig_1 cds 360574 360684 - GCA002761215_00415 hypothetical protein contig_1 cds 360702 360908 + GCA002761215_00416 hypothetical protein contig_1 cds 360966 361274 - GCA002761215_00417 hypothetical protein contig_1 cds 361280 361483 + GCA002761215_00418 hypothetical protein contig_1 cds 362206 362559 - GCA002761215_00419 hypothetical protein contig_1 cds 362582 362740 + GCA002761215_00420 hypothetical protein contig_1 cds 364697 364894 - GCA002761215_00421 hypothetical protein contig_1 cds 365149 365370 - GCA002761215_00422 hypothetical protein contig_1 cds 365662 365799 - GCA002761215_00423 hypothetical protein contig_1 cds 366059 366250 + GCA002761215_00424 hypothetical protein contig_1 cds 366759 367007 + GCA002761215_00425 hypothetical protein contig_1 cds 367273 367644 + GCA002761215_00426 hypothetical protein contig_1 cds 367762 368067 + GCA002761215_00427 hypothetical protein contig_1 cds 369377 369499 - GCA002761215_00428 hypothetical protein contig_1 cds 371069 371386 + GCA002761215_00429 hypothetical protein contig_1 cds 372134 372262 + GCA002761215_00430 hypothetical protein contig_1 cds 372915 373022 - GCA002761215_00431 hypothetical protein contig_1 cds 374286 374390 + GCA002761215_00432 hypothetical protein contig_1 cds 374411 374716 + GCA002761215_00433 hypothetical protein contig_1 cds 374736 375002 + GCA002761215_00434 hypothetical protein contig_1 tRNA 376171 376246 + GCA002761215_00435 trnK tRNA-Lys(ctt) SO:0000265 contig_1 cds 377001 377183 + GCA002761215_00436 hypothetical protein contig_1 cds 377306 377584 - GCA002761215_00437 hypothetical protein contig_1 cds 378447 378575 + GCA002761215_00438 hypothetical protein contig_1 cds 378875 379129 + GCA002761215_00439 hypothetical protein contig_1 cds 379814 380029 + GCA002761215_00440 hypothetical protein contig_1 cds 380003 380332 - GCA002761215_00441 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MNN5, UniRef:UniRef90_A0A660MNN5 contig_1 cds 380506 380709 - GCA002761215_00442 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PGM5, UniRef:UniRef90_A0A2U7PGM5 contig_1 cds 380743 380892 - GCA002761215_00443 hypothetical protein contig_1 cds 380935 381144 - GCA002761215_00444 hypothetical protein contig_1 cds 381190 381420 - GCA002761215_00445 hypothetical protein contig_1 cds 381550 381678 - GCA002761215_00446 hypothetical protein contig_1 cds 381751 382092 - GCA002761215_00447 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXY4, UniRef:UniRef90_A0A2U7NXY4 contig_1 cds 382136 382255 - GCA002761215_00448 hypothetical protein contig_1 cds 382358 382471 - GCA002761215_00449 hypothetical protein contig_1 cds 382962 383231 - GCA002761215_00450 hypothetical protein contig_1 cds 383398 383598 + GCA002761215_00451 hypothetical protein contig_1 cds 383780 383986 - GCA002761215_00452 (pseudo) Phenylalanine--tRNA ligase subunit alpha SO:0001217, UniRef:UniRef50_A0A929M7G7, UniRef:UniRef90_A0A660MY28 contig_1 cds 384739 384960 - GCA002761215_00453 (pseudo) CRISPR type III-B/RAMP module-associated protein Cmr5 SO:0001217, UniRef:UniRef50_A0A2U7NY20, UniRef:UniRef90_A0A2U7NY20 contig_1 cds 384989 385456 - GCA002761215_00454 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXY1, UniRef:UniRef90_A0A2U7NXY1 contig_1 cds 388187 388531 - GCA002761215_00455 hypothetical protein contig_1 cds 389087 389341 - GCA002761215_00456 hypothetical protein contig_1 cds 389582 389752 - GCA002761215_00457 hypothetical protein contig_1 cds 389777 389914 - GCA002761215_00458 hypothetical protein contig_1 cds 390615 390923 + GCA002761215_00459 hypothetical protein contig_1 cds 390968 391111 - GCA002761215_00460 hypothetical protein contig_1 cds 392774 393082 - GCA002761215_00461 hypothetical protein contig_1 cds 393245 393553 - GCA002761215_00462 hypothetical protein contig_1 cds 394328 394498 - GCA002761215_00463 htpG Molecular chaperone HtpG SO:0001217, UniRef:UniRef50_A0A944V0Z4 contig_1 cds 394598 394786 - GCA002761215_00464 hypothetical protein contig_1 cds 395183 395356 - GCA002761215_00465 hypothetical protein contig_1 cds 395462 395758 - GCA002761215_00466 hypothetical protein contig_1 cds 395940 396215 + GCA002761215_00467 hypothetical protein contig_1 cds 396514 396792 + GCA002761215_00468 hypothetical protein SO:0001217, UniParc:UPI000D777F83, UniRef:UniRef100_A0A2U7PP16, UniRef:UniRef50_A0A660MXQ9, UniRef:UniRef90_A0A660MXQ9 contig_1 cds 396812 396928 + GCA002761215_00469 hypothetical protein contig_1 cds 396925 397161 + GCA002761215_00470 hypothetical protein SO:0001217, UniParc:UPI000D7786F2, UniRef:UniRef100_A0A2U7P0T4, UniRef:UniRef50_A0A2U7P0T4, UniRef:UniRef90_A0A2U7P0T4 contig_1 cds 397133 397513 + GCA002761215_00471 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MXR7, UniRef:UniRef90_A0A660MXR7 contig_1 cds 397645 397884 + GCA002761215_00472 hypothetical protein SO:0001217, UniParc:UPI0013C31FA8, UniRef:UniRef100_A0A2U7NY25, UniRef:UniRef50_A0A2U7NY25, UniRef:UniRef90_A0A2U7NY25 contig_1 cds 398008 398232 + GCA002761215_00473 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NXY6, UniRef:UniRef90_A0A2U7NXY6 contig_1 cds 398422 398709 + GCA002761215_00474 hypothetical protein SO:0001217, UniParc:UPI000D776254, UniRef:UniRef100_A0A2U7PH87, UniRef:UniRef50_A0A660MQ15, UniRef:UniRef90_A0A660MQ15 contig_1 cds 399503 399835 - GCA002761215_00475 hypothetical protein contig_1 cds 401048 401473 + GCA002761215_00476 hypothetical protein contig_1 cds 401605 401865 - GCA002761215_00477 hypothetical protein contig_1 cds 402253 402450 - GCA002761215_00478 t-SNARE coiled-coil-like y domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRH1 contig_1 cds 402454 402807 - GCA002761215_00479 hypothetical protein SO:0001217, UniRef:UniRef50_A0A944YQX8 contig_1 cds 403985 404269 - GCA002761215_00480 hypothetical protein PFAM:PF00152.25 contig_1 cds 406326 406439 + GCA002761215_00481 hypothetical protein contig_1 cds 406461 406823 + GCA002761215_00482 hypothetical protein contig_1 cds 407094 407495 + GCA002761215_00483 hypothetical protein PFAM:PF03976.20 contig_1 cds 407882 408277 + GCA002761215_00484 hypothetical protein contig_1 cds 408370 408555 - GCA002761215_00485 hypothetical protein contig_1 cds 409168 409323 - GCA002761215_00486 hypothetical protein contig_1 cds 409378 409560 + GCA002761215_00487 dksA DksA C4-type domain-containing protein SO:0001217, UniParc:UPI000D778A6B, UniRef:UniRef100_A0A2U7NXZ2, UniRef:UniRef50_A0A2U7NXZ2, UniRef:UniRef90_A0A2U7NXZ2 contig_1 cds 410718 410831 - GCA002761215_00488 hypothetical protein contig_1 cds 410843 411010 - GCA002761215_00489 hypothetical protein contig_1 cds 411029 411289 - GCA002761215_00490 (pseudo) DUF4129 domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MW48, UniRef:UniRef90_A0A660MW48 contig_1 cds 412409 412564 - GCA002761215_00491 hypothetical protein PFAM:PF17863.7 contig_1 cds 413097 413393 + GCA002761215_00492 hypothetical protein contig_1 cds 413625 413723 - GCA002761215_00493 hypothetical protein contig_1 cds 413742 413990 - GCA002761215_00494 hypothetical protein contig_1 cds 416081 416323 + GCA002761215_00495 hypothetical protein PFAM:PF00512.31 contig_1 cds 417059 417283 + GCA002761215_00496 hypothetical protein contig_1 cds 417434 417613 + GCA002761215_00497 hypothetical protein contig_1 cds 417824 417982 + GCA002761215_00498 PABS domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J487 contig_1 cds 418346 418690 + GCA002761215_00499 hypothetical protein contig_1 cds 418805 419017 + GCA002761215_00500 hypothetical protein contig_1 cds 419200 419520 - GCA002761215_00501 hypothetical protein contig_1 cds 420300 420560 + GCA002761215_00502 RRM domain-containing protein SO:0001217, UniParc:UPI000D776E97, UniRef:UniRef100_A0A2U7PGP9, UniRef:UniRef50_A0A9W9EQ50, UniRef:UniRef90_A0A2U7PGP9 contig_1 cds 420711 421055 - GCA002761215_00503 hypothetical protein contig_1 cds 421333 421512 + GCA002761215_00504 hypothetical protein contig_1 cds 421491 421682 - GCA002761215_00505 hypothetical protein contig_1 cds 422598 422732 + GCA002761215_00506 hypothetical protein contig_1 cds 423526 423729 - GCA002761215_00507 hypothetical protein contig_1 cds 425105 425248 + GCA002761215_00508 hypothetical protein contig_1 cds 427192 427434 + GCA002761215_00509 (pseudo) Polysaccharide biosynthesis protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A7Y7QJJ6, UniRef:UniRef90_A0A929M4F8 contig_1 cds 427645 427869 - GCA002761215_00510 hypothetical protein contig_1 cds 429034 429339 - GCA002761215_00511 hypothetical protein contig_1 cds 429947 430108 - GCA002761215_00512 hypothetical protein contig_1 cds 430654 430848 - GCA002761215_00513 hypothetical protein contig_1 cds 431498 431698 + GCA002761215_00514 hypothetical protein contig_1 cds 431843 431959 + GCA002761215_00515 hypothetical protein contig_1 cds 433028 433390 - GCA002761215_00516 hypothetical protein contig_1 cds 433733 433867 + GCA002761215_00517 hypothetical protein contig_1 cds 433918 434010 - GCA002761215_00518 hypothetical protein contig_1 cds 434506 434673 + GCA002761215_00519 hypothetical protein contig_1 cds 436321 436692 + GCA002761215_00520 hypothetical protein contig_1 cds 437297 437413 - GCA002761215_00521 hypothetical protein contig_1 tRNA 438710 438783 + GCA002761215_00522 trnC tRNA-Cys(gca) SO:0000258 contig_1 cds 439352 439633 - GCA002761215_00523 hypothetical protein contig_1 cds 439922 440152 + GCA002761215_00524 hypothetical protein SO:0001217, UniParc:UPI000D777892, UniRef:UniRef100_A0A2U7NY12, UniRef:UniRef50_A0A660MSU3, UniRef:UniRef90_A0A660MSU3 contig_1 cds 440299 440553 + GCA002761215_00525 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MSS2, UniRef:UniRef90_A0A660MSS2 contig_1 cds 440645 440869 + GCA002761215_00526 hypothetical protein SO:0001217, UniParc:UPI000D77833A, UniRef:UniRef100_A0A2U7PGR2, UniRef:UniRef50_A0A660MUL8, UniRef:UniRef90_A0A660MUL8 contig_1 cds 441496 441684 - GCA002761215_00527 hypothetical protein contig_1 cds 441882 442088 + GCA002761215_00528 hypothetical protein contig_1 cds 442641 443162 + GCA002761215_00529 hypothetical protein contig_1 cds 444526 444699 - GCA002761215_00530 hypothetical protein contig_1 cds 446407 446538 + GCA002761215_00531 hypothetical protein contig_1 cds 447296 447445 + GCA002761215_00532 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MST1, UniRef:UniRef90_A0A660MST1 contig_1 cds 447563 447754 + GCA002761215_00533 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MSR1, UniRef:UniRef90_A0A660MSR1 contig_1 tRNA 447930 448004 - GCA002761215_00534 trnW tRNA-Trp(cca) SO:0000271 contig_1 cds 448200 448376 - GCA002761215_00535 Elongation factor Ts SO:0001217, UniRef:UniRef50_A0A3C1S3Q0 contig_1 cds 449432 449545 - GCA002761215_00536 hypothetical protein SO:0001217, UniRef:UniRef50_A0A3C1S2Z3 contig_1 cds 449813 450004 - GCA002761215_00537 hypothetical protein contig_1 cds 450358 450669 - GCA002761215_00538 hypothetical protein PFAM:PF00575.29 contig_1 cds 450958 451101 - GCA002761215_00539 hypothetical protein contig_1 cds 451111 451323 - GCA002761215_00540 hypothetical protein PFAM:PF00575.29 contig_1 tRNA 451455 451531 - GCA002761215_00541 trnH tRNA-His(gtg) SO:0000262 contig_1 cds 451874 452083 + GCA002761215_00542 hypothetical protein contig_1 cds 452387 452680 + GCA002761215_00543 (pseudo) Response regulatory domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P0W4, UniRef:UniRef90_A0A2U7P0W4 contig_1 cds 453899 454147 + GCA002761215_00544 hypothetical protein contig_1 cds 454336 454440 - GCA002761215_00545 hypothetical protein contig_1 cds 454501 454659 - GCA002761215_00546 hypothetical protein PFAM:PF00009.33 contig_1 cds 455168 455374 - GCA002761215_00547 hypothetical protein contig_1 cds 455930 456250 - GCA002761215_00548 hypothetical protein contig_1 cds 456456 456638 + GCA002761215_00549 hypothetical protein contig_1 cds 457633 457794 - GCA002761215_00550 hypothetical protein contig_1 cds 458149 458619 + GCA002761215_00551 hypothetical protein contig_1 cds 459580 459732 - GCA002761215_00552 hypothetical protein contig_1 cds 460305 460406 - GCA002761215_00553 hypothetical protein contig_1 cds 460490 460714 - GCA002761215_00554 hypothetical protein contig_1 cds 461543 461830 + GCA002761215_00555 hypothetical protein contig_1 cds 461806 461961 - GCA002761215_00556 trxA (pseudo) thioredoxin GO:0015035, SO:0001217, UniRef:UniRef50_A0A0F4HAG5, UniRef:UniRef90_A0A660MUS4 contig_1 cds 466006 466215 + GCA002761215_00557 hypothetical protein contig_1 cds 466355 466513 + GCA002761215_00558 hypothetical protein contig_1 cds 466805 467050 - GCA002761215_00559 hypothetical protein SO:0001217, UniRef:UniRef50_A0A944UZD4 contig_1 cds 467054 467179 - GCA002761215_00560 hypothetical protein contig_1 cds 467577 467840 + GCA002761215_00561 hypothetical protein contig_1 cds 468154 468411 - GCA002761215_00562 hypothetical protein contig_1 cds 469774 469971 - GCA002761215_00563 hypothetical protein contig_1 cds 471971 472324 - GCA002761215_00564 (pseudo) YgjP-like metallopeptidase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P8M7, UniRef:UniRef90_A0A2U7P8M7 contig_1 cds 474317 474508 - GCA002761215_00565 hypothetical protein contig_1 cds 475226 475405 + GCA002761215_00566 hypothetical protein contig_1 cds 476466 476618 - GCA002761215_00567 hypothetical protein PFAM:PF09851.14 contig_1 cds 477172 477459 + GCA002761215_00568 hypothetical protein contig_1 cds 479294 479464 - GCA002761215_00569 hypothetical protein contig_1 cds 479760 479954 - GCA002761215_00570 hypothetical protein contig_1 cds 480085 480252 + GCA002761215_00571 hypothetical protein contig_1 cds 480264 480827 - GCA002761215_00572 hypothetical protein contig_1 cds 481143 481364 - GCA002761215_00573 hypothetical protein contig_1 cds 481437 481538 - GCA002761215_00574 hypothetical protein contig_1 cds 481910 482128 - GCA002761215_00575 hypothetical protein contig_1 cds 482328 482447 - GCA002761215_00576 hypothetical protein contig_1 cds 482749 483039 + GCA002761215_00577 hypothetical protein contig_1 tRNA 485642 485717 + GCA002761215_00578 trnR tRNA-Arg(gcg) SO:0001036 contig_1 cds 485807 485941 + GCA002761215_00579 hypothetical protein contig_1 cds 487258 487896 - GCA002761215_00580 (pseudo) Peptidase C39-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A2W4IHQ4, UniRef:UniRef90_A0A2U7P3A2 contig_1 cds 488170 488505 + GCA002761215_00581 (pseudo) Methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NY51, UniRef:UniRef90_A0A2U7NY51 contig_1 cds 488533 488928 + GCA002761215_00582 (pseudo) Methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NY51, UniRef:UniRef90_A0A2U7NY51 contig_1 cds 488921 489091 + GCA002761215_00583 hypothetical protein PFAM:PF02492.25 contig_1 cds 489382 489612 - GCA002761215_00584 hypothetical protein contig_1 cds 489860 490075 + GCA002761215_00585 hypothetical protein contig_1 cds 491050 491223 - GCA002761215_00586 hypothetical protein contig_1 cds 491881 492045 + GCA002761215_00587 hypothetical protein contig_1 cds 492562 492753 + GCA002761215_00588 hypothetical protein contig_1 cds 492871 493053 + GCA002761215_00589 hypothetical protein contig_1 cds 493087 493275 + GCA002761215_00590 hypothetical protein PFAM:PF09359.15 contig_1 cds 494034 494249 + GCA002761215_00591 hypothetical protein contig_1 cds 494871 495002 - GCA002761215_00592 hypothetical protein contig_1 cds 496089 496283 - GCA002761215_00593 hypothetical protein contig_1 cds 497018 497356 + GCA002761215_00594 hypothetical protein contig_1 cds 498040 498138 - GCA002761215_00595 hypothetical protein contig_1 cds 498825 499013 + GCA002761215_00596 hypothetical protein contig_1 cds 499518 499643 + GCA002761215_00597 hypothetical protein contig_1 cds 499890 500141 + GCA002761215_00598 hypothetical protein contig_1 cds 500204 500404 + GCA002761215_00599 (pseudo) Homing endonuclease LAGLIDADG domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MTG7, UniRef:UniRef90_A0A660MTG7 contig_1 cds 501315 501473 - GCA002761215_00600 hypothetical protein contig_1 cds 501492 501719 - GCA002761215_00601 hypothetical protein contig_1 cds 501852 502058 - GCA002761215_00602 hypothetical protein contig_1 cds 502163 502333 + GCA002761215_00603 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MTP0, UniRef:UniRef90_A0A660MTP0 contig_1 cds 502515 502808 + GCA002761215_00604 hypothetical protein SO:0001217, UniParc:UPI000D776E1E, UniRef:UniRef100_A0A660MRX7, UniRef:UniRef50_A0A660MWL4, UniRef:UniRef90_A0A660MRX7 contig_1 cds 503188 503307 - GCA002761215_00605 hypothetical protein contig_1 cds 503970 504143 + GCA002761215_00606 hypothetical protein contig_1 cds 505045 505197 + GCA002761215_00607 (pseudo) Type II secretion system protein SO:0001217, UniRef:UniRef50_A0A2W4IJC2, UniRef:UniRef90_A0A660MSP8 contig_1 cds 505934 506047 - GCA002761215_00608 hypothetical protein contig_1 cds 506328 506585 - GCA002761215_00609 hypothetical protein contig_1 cds 507721 507852 + GCA002761215_00610 hypothetical protein contig_1 cds 508338 508628 - GCA002761215_00611 hypothetical protein contig_1 cds 508757 508855 + GCA002761215_00612 hypothetical protein contig_1 cds 510187 510384 - GCA002761215_00613 hypothetical protein contig_1 cds 510995 511177 - GCA002761215_00614 hypothetical protein PFAM:PF00113.28 contig_1 cds 512132 512227 - GCA002761215_00615 hypothetical protein PFAM:PF03952.21 contig_1 cds 512751 512933 + GCA002761215_00616 hypothetical protein contig_1 cds 513716 514084 + GCA002761215_00617 hypothetical protein SO:0001217, UniParc:UPI000D776F3E, UniRef:UniRef100_A0A2U7P3B9, UniRef:UniRef50_A0A2U7P3B9, UniRef:UniRef90_A0A2U7P3B9 contig_1 cds 514210 514347 - GCA002761215_00618 hypothetical protein contig_1 cds 514516 514629 - GCA002761215_00619 hypothetical protein contig_1 cds 514873 515190 - GCA002761215_00620 hypothetical protein PFAM:PF06415.18 contig_1 cds 516438 516602 + GCA002761215_00621 hypothetical protein contig_1 cds 517677 517811 + GCA002761215_00622 hypothetical protein contig_1 cds 518446 518667 + GCA002761215_00623 hypothetical protein contig_1 cds 518784 518939 - GCA002761215_00624 hypothetical protein contig_1 cds 520631 520741 + GCA002761215_00625 hypothetical protein PFAM:PF09313.17 contig_1 cds 520901 521056 + GCA002761215_00626 hypothetical protein contig_1 cds 521339 521458 + GCA002761215_00627 hypothetical protein contig_1 cds 521916 522050 - GCA002761215_00628 hypothetical protein contig_1 cds 522970 523272 + GCA002761215_00629 hypothetical protein contig_1 cds 523885 524103 - GCA002761215_00630 hypothetical protein contig_1 cds 524788 525093 - GCA002761215_00631 hypothetical protein contig_1 cds 526258 526668 - GCA002761215_00632 hypothetical protein contig_1 cds 527058 527456 - GCA002761215_00633 hypothetical protein contig_1 cds 527623 527721 + GCA002761215_00634 hypothetical protein contig_1 cds 527992 528168 + GCA002761215_00635 hypothetical protein contig_1 cds 528292 528603 + GCA002761215_00636 hypothetical protein contig_1 cds 529084 529227 + GCA002761215_00637 hypothetical protein contig_1 cds 529574 529813 + GCA002761215_00638 hypothetical protein contig_1 cds 530272 530631 - GCA002761215_00639 hypothetical protein contig_1 cds 530669 530953 + GCA002761215_00640 hypothetical protein contig_1 cds 532158 532433 - GCA002761215_00641 hypothetical protein contig_1 cds 532499 532702 - GCA002761215_00642 hypothetical protein PFAM:PF00575.29 contig_1 cds 532820 533023 - GCA002761215_00643 hypothetical protein PFAM:PF17674.7 contig_1 cds 533768 534007 - GCA002761215_00644 hypothetical protein contig_1 cds 534122 534496 - GCA002761215_00645 hypothetical protein PFAM:PF09371.15 contig_1 cds 534503 534640 - GCA002761215_00646 hypothetical protein contig_1 cds 534785 534910 + GCA002761215_00647 hypothetical protein contig_1 cds 535430 535882 + GCA002761215_00648 (pseudo) Toxic anion resistance protein SO:0001217, UniRef:UniRef50_A0A2U7PCX7, UniRef:UniRef50_A0A955I5Y3, UniRef:UniRef90_A0A2U7PCX7 contig_1 cds 536929 537117 + GCA002761215_00649 hypothetical protein contig_1 cds 537178 537411 - GCA002761215_00650 hypothetical protein contig_1 cds 537449 537616 + GCA002761215_00651 hypothetical protein contig_1 cds 537733 537945 - GCA002761215_00652 hypothetical protein contig_1 cds 538048 538260 - GCA002761215_00653 hypothetical protein contig_1 cds 538398 538781 + GCA002761215_00654 hypothetical protein contig_1 cds 539457 539681 + GCA002761215_00655 hypothetical protein contig_1 cds 539726 539887 - GCA002761215_00656 hypothetical protein contig_1 tRNA 541135 541210 + GCA002761215_00657 trnT tRNA-Thr(tgt) SO:0000270 contig_1 tRNA 541262 541346 + GCA002761215_00658 trnY tRNA-Tyr(gta) SO:0000272 contig_1 tRNA 541466 541550 + GCA002761215_00659 trnL tRNA-Leu(tag) SO:0000264 contig_1 cds 542372 542632 + GCA002761215_00660 type B 50S ribosomal protein L31 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniParc:UPI000D7782E7, UniRef:UniRef100_A0A2U7P8T1, UniRef:UniRef50_A0A7X5FPV7, UniRef:UniRef90_A0A660MXK5 contig_1 cds 544077 544478 + GCA002761215_00661 rplJ (pseudo) 50S ribosomal protein L10 GO:0003735, GO:0006412, GO:0015934, KEGG:K02864, SO:0001217, UniRef:UniRef50_A0A2U7P113, UniRef:UniRef90_A0A2U7P113 contig_1 cds 545170 545382 - GCA002761215_00662 hypothetical protein contig_1 cds 545960 546196 - GCA002761215_00663 hypothetical protein contig_1 cds 546544 546810 - GCA002761215_00664 hypothetical protein contig_1 cds 548559 548774 - GCA002761215_00665 hypothetical protein PFAM:PF00512.31 contig_1 cds 548928 549197 - GCA002761215_00666 hypothetical protein contig_1 cds 549498 549746 - GCA002761215_00667 hypothetical protein PFAM:PF00486.34 contig_1 cds 553619 554137 - GCA002761215_00668 hypothetical protein contig_1 cds 554297 554488 - GCA002761215_00669 hypothetical protein contig_1 cds 554495 554737 - GCA002761215_00670 hypothetical protein contig_1 cds 554817 554984 + GCA002761215_00671 hypothetical protein contig_1 cds 555663 555965 + GCA002761215_00672 MFS transporter DHA3 family macrolide efflux protein SO:0001217, UniRef:UniRef50_A0A5J4PKZ8 contig_1 cds 556215 556583 + GCA002761215_00673 hypothetical protein contig_1 cds 557122 557292 - GCA002761215_00674 hypothetical protein contig_1 cds 557792 557965 - GCA002761215_00675 hypothetical protein contig_1 cds 558260 558532 - GCA002761215_00676 hypothetical protein contig_1 cds 559187 559624 - GCA002761215_00677 lapA LapA family protein SO:0001217, UniRef:UniRef50_A0A2W4IZ34, UniRef:UniRef90_A0A660MYY0 contig_1 cds 561804 562019 + GCA002761215_00678 hypothetical protein contig_1 cds 564098 564271 - GCA002761215_00679 hypothetical protein contig_1 cds 564328 564609 + GCA002761215_00680 hypothetical protein contig_1 cds 566628 566816 - GCA002761215_00681 hypothetical protein contig_1 cds 567777 568046 + GCA002761215_00682 hypothetical protein contig_1 cds 568572 568715 + GCA002761215_00683 hypothetical protein contig_1 cds 568827 569015 + GCA002761215_00684 hypothetical protein contig_1 cds 570841 571065 + GCA002761215_00685 hypothetical protein contig_1 cds 571897 572022 + GCA002761215_00686 hypothetical protein contig_1 cds 574183 574437 - GCA002761215_00687 hypothetical protein contig_1 tRNA 575857 575932 - GCA002761215_00688 trnK tRNA-Lys(ttt) SO:0000265 contig_1 cds 577441 577653 - GCA002761215_00689 hypothetical protein contig_1 cds 577717 578001 + GCA002761215_00690 hypothetical protein contig_1 cds 578063 578464 - GCA002761215_00691 hypothetical protein contig_1 cds 578522 578758 - GCA002761215_00692 hypothetical protein contig_1 cds 578786 579007 - GCA002761215_00693 hypothetical protein contig_1 cds 579246 579671 + GCA002761215_00694 hypothetical protein contig_1 cds 579968 580144 - GCA002761215_00695 hypothetical protein contig_1 cds 582242 582490 - GCA002761215_00696 hypothetical protein contig_1 cds 584326 584502 + GCA002761215_00697 hypothetical protein contig_1 cds 585642 586235 - GCA002761215_00698 BPSL0067 family protein SO:0001217, UniParc:UPI000F1CAC23, UniRef:UniRef100_A0A660MZM2, UniRef:UniRef50_A0A660MZM2, UniRef:UniRef90_A0A660MZM2 contig_1 cds 587189 587461 - GCA002761215_00699 hypothetical protein contig_1 cds 587656 587985 + GCA002761215_00700 hypothetical protein contig_1 cds 588073 588162 + GCA002761215_00701 hypothetical protein contig_1 cds 588304 588510 + GCA002761215_00702 hypothetical protein contig_1 cds 589042 589350 + GCA002761215_00703 hypothetical protein contig_1 cds 590266 590568 + GCA002761215_00704 hypothetical protein contig_1 cds 591120 591290 - GCA002761215_00705 hypothetical protein contig_1 cds 591512 591754 - GCA002761215_00706 hypothetical protein contig_1 cds 592073 592348 - GCA002761215_00707 DUF721 domain-containing protein SO:0001217, UniParc:UPI000D777C2D, UniRef:UniRef100_A0A2U7P3F3, UniRef:UniRef50_A0A660MT54, UniRef:UniRef90_A0A2U7P3F3 contig_1 cds 593685 593885 - GCA002761215_00708 hypothetical protein contig_1 cds 596002 596184 - GCA002761215_00709 (pseudo) Prepilin-type N-terminal cleavage/methylation domain-containing protein SO:0001217, UniRef:UniRef50_A0A929M259, UniRef:UniRef90_A0A929M259 contig_1 cds 596214 596384 - GCA002761215_00710 hypothetical protein contig_1 cds 597226 597357 + GCA002761215_00711 hypothetical protein contig_1 cds 598487 598615 + GCA002761215_00712 hypothetical protein contig_1 cds 598688 598942 + GCA002761215_00713 hypothetical protein contig_1 cds 599258 599518 + GCA002761215_00714 (pseudo) Inorganic pyrophosphatase SO:0001217, UniRef:UniRef50_A0A328EIU6, UniRef:UniRef90_A0A660MV90 contig_1 cds 599973 600110 - GCA002761215_00715 hypothetical protein contig_1 cds 600745 601017 + GCA002761215_00716 hypothetical protein contig_1 cds 601699 601827 - GCA002761215_00717 hypothetical protein contig_1 cds 605357 605785 - GCA002761215_00718 hypothetical protein contig_1 cds 605865 606101 + GCA002761215_00719 hypothetical protein contig_1 cds 606511 606693 - GCA002761215_00720 hypothetical protein contig_1 cds 606770 606880 + GCA002761215_00721 hypothetical protein contig_1 cds 607106 607297 + GCA002761215_00722 hypothetical protein contig_1 cds 607610 607780 + GCA002761215_00723 hypothetical protein contig_1 cds 612365 612514 - GCA002761215_00724 hypothetical protein contig_1 cds 614023 614346 + GCA002761215_00725 hypothetical protein contig_1 cds 614591 614836 + GCA002761215_00726 hypothetical protein contig_1 cds 616543 616647 - GCA002761215_00727 hypothetical protein contig_1 cds 617685 617822 - GCA002761215_00728 hypothetical protein contig_1 cds 618218 618538 - GCA002761215_00729 (pseudo) Lipoprotein SO:0001217, UniRef:UniRef50_A0A2U7P8Y4, UniRef:UniRef90_A0A2U7P8Y4 contig_1 cds 621288 621476 - GCA002761215_00730 (pseudo) ATP synthase epsilon chain SO:0001217, UniRef:UniRef50_A0A660MW83, UniRef:UniRef50_A0A944UYD7, UniRef:UniRef90_A0A2U7NYB7 contig_1 cds 621516 621629 - GCA002761215_00731 hypothetical protein contig_1 cds 621892 622305 - GCA002761215_00732 atpD (pseudo) F0F1 ATP synthase subunit beta EC:7.1.2.2, GO:0015986, GO:0045261, GO:0046933, SO:0001217, UniRef:UniRef50_A0A0J7YM04, UniRef:UniRef90_A0A2W4KAD2 contig_1 cds 622397 622642 + GCA002761215_00733 hypothetical protein contig_1 cds 622655 622816 + GCA002761215_00734 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J4R9 contig_1 cds 623861 624067 - GCA002761215_00735 hypothetical protein PFAM:PF00231.24 contig_1 cds 626496 626729 + GCA002761215_00736 hypothetical protein contig_1 cds 626722 627072 - GCA002761215_00737 atpF (pseudo) F0F1 ATP synthase subunit B EC:7.1.2.2, GO:0015078, GO:0015986, GO:0045263, SO:0001217, UniRef:UniRef50_A0A660MTH1, UniRef:UniRef90_A0A660MTH1 contig_1 cds 627951 628052 - GCA002761215_00738 hypothetical protein contig_1 cds 631068 631703 + GCA002761215_00739 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A929M7G5, UniRef:UniRef90_A0A929M7G5 contig_1 cds 632711 633220 - GCA002761215_00740 hypothetical protein contig_1 cds 633947 634282 - GCA002761215_00741 hypothetical protein contig_1 cds 634627 634980 + GCA002761215_00742 hypothetical protein contig_1 cds 635663 635911 - GCA002761215_00743 hypothetical protein contig_1 cds 636828 636956 - GCA002761215_00744 hypothetical protein contig_1 cds 637987 638139 + GCA002761215_00745 hypothetical protein contig_1 cds 638247 638498 - GCA002761215_00746 hypothetical protein contig_1 cds 639254 639475 - GCA002761215_00747 hypothetical protein contig_1 cds 639939 640172 + GCA002761215_00748 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A929QI40, UniRef:UniRef90_A0A929QI40 contig_1 cds 642353 642466 + GCA002761215_00749 hypothetical protein contig_1 cds 643083 643196 + GCA002761215_00750 hypothetical protein contig_1 cds 644109 644216 + GCA002761215_00751 hypothetical protein contig_1 cds 645050 645205 - GCA002761215_00752 hypothetical protein contig_1 cds 645691 645867 - GCA002761215_00753 (pseudo) Methylated-DNA-[protein]-cysteine S-methyltransferase DNA binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P3I5, UniRef:UniRef90_A0A2U7P3I5 contig_1 cds 648713 648922 - GCA002761215_00754 hypothetical protein contig_1 cds 650483 650671 + GCA002761215_00755 hypothetical protein contig_1 cds 651392 651532 + GCA002761215_00756 hypothetical protein contig_1 cds 651584 651760 + GCA002761215_00757 hypothetical protein contig_1 cds 652375 652515 - GCA002761215_00758 hypothetical protein contig_1 cds 652850 653623 + GCA002761215_00759 hypothetical protein contig_1 cds 654482 654607 - GCA002761215_00760 hypothetical protein contig_1 cds 655079 655279 - GCA002761215_00761 hypothetical protein PFAM:PF02899.23 contig_1 tRNA 655388 655464 + GCA002761215_00762 trnV tRNA-Val(tac) SO:0000273 contig_1 cds 655850 656119 + GCA002761215_00763 hypothetical protein contig_1 cds 656939 657094 - GCA002761215_00764 hypothetical protein contig_1 cds 657176 657583 - GCA002761215_00765 hypothetical protein contig_1 cds 657629 657787 + GCA002761215_00766 hypothetical protein contig_1 cds 658102 658380 - GCA002761215_00767 Ribosome recycling factor domain-containing protein SO:0001217, UniRef:UniRef50_A0A920LDG6 contig_1 cds 658719 658868 - GCA002761215_00768 hypothetical protein contig_1 cds 659372 659638 + GCA002761215_00769 hypothetical protein contig_1 cds 660415 660645 - GCA002761215_00770 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J488 contig_1 cds 660682 660822 - GCA002761215_00771 hypothetical protein PFAM:PF13177.12 contig_1 cds 661291 661506 + GCA002761215_00772 hypothetical protein contig_1 cds 661459 661689 - GCA002761215_00773 hypothetical protein SO:0001217, UniParc:UPI000D7763B4, UniRef:UniRef100_A0A2U7NYD8, UniRef:UniRef50_A0A2U7NYD8, UniRef:UniRef90_A0A2U7NYD8 contig_1 cds 661741 662205 - GCA002761215_00774 hypothetical protein contig_1 cds 662306 662479 + GCA002761215_00775 Magnesium chelatase ChlI-like catalytic domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D0UWI3 contig_1 cds 662666 662830 + GCA002761215_00776 hypothetical protein PFAM:PF01078.27 contig_1 cds 662942 663154 + GCA002761215_00777 chlI Magnesium chelatase, subunit ChlI family protein SO:0001217, UniRef:UniRef50_A0A1S2WWP1 contig_1 cds 665124 665333 - GCA002761215_00778 hypothetical protein PFAM:PF09351.15 contig_1 crispr 666301 666742 ? CRISPR array with 3 repeats of length 40, consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGATGAAA and spacer length 25 SO:0001459 contig_1 crispr-repeat 666301 666340 ? CRISPR repeat contig_1 crispr-spacer 666337 666363 ? CRISPR spacer, sequence CAGTTGGTCTATGACTGATAGGAAATC contig_1 crispr-repeat 666364 666403 ? CRISPR repeat contig_1 crispr-spacer 666404 666426 ? CRISPR spacer, sequence AATAAAGTATTTTATTTCAAAAA contig_1 crispr-repeat 666427 666466 ? CRISPR repeat contig_1 crispr-spacer 666467 666742 ? CRISPR spacer, sequence TTTTAACACTTTCCTTTTTTGAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATATCTATCATTTGGTCGCTGTCAATTCCGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAAAATGGAAAAAATATTATGAAGACCGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAAAGCCCAGCACACAAGTACTGAAAAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATTTTCGGCTAATTCTTCTTTTGTGATTTTTTC contig_1 crispr 666489 666742 ? CRISPR array with 4 repeats of length 36, consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGAT and spacer length 26 SO:0001459 contig_1 crispr-repeat 666489 666524 ? CRISPR repeat contig_1 crispr-spacer 666525 666551 ? CRISPR spacer, sequence ATCTATCATTTGGTCGCTGTCAATTCC contig_1 crispr-repeat 666552 666587 ? CRISPR repeat contig_1 crispr-spacer 666588 666613 ? CRISPR spacer, sequence AAAATGGAAAAAATATTATGAAGACC contig_1 crispr-repeat 666614 666649 ? CRISPR repeat contig_1 crispr-spacer 666650 666675 ? CRISPR spacer, sequence AAAGCCCAGCACACAAGTACTGAAAA contig_1 crispr-repeat 666676 666711 ? CRISPR repeat contig_1 crispr-spacer 666712 666742 ? CRISPR spacer, sequence TTTCGGCTAATTCTTCTTTTGTGATTTTTTC contig_1 cds 667713 667874 - GCA002761215_00779 hypothetical protein contig_1 cds 669132 669275 - GCA002761215_00780 hypothetical protein contig_1 cds 670051 670284 - GCA002761215_00781 hypothetical protein contig_1 cds 670513 670734 - GCA002761215_00782 hypothetical protein contig_1 cds 671781 672068 - GCA002761215_00783 hypothetical protein contig_1 cds 673098 673397 - GCA002761215_00784 hypothetical protein contig_1 cds 675450 675677 - GCA002761215_00785 hypothetical protein contig_1 cds 675712 675984 - GCA002761215_00786 HU family DNA-binding protein SO:0001217, UniParc:UPI000D777DF7, UniRef:UniRef100_A0A660MS65, UniRef:UniRef50_A0A972GD28, UniRef:UniRef90_A0A660MPB2 contig_1 cds 677612 677749 - GCA002761215_00787 hypothetical protein contig_1 cds 678872 679066 - GCA002761215_00788 Prepilin-type N-terminal cleavage/methylation domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRY4 contig_1 cds 679630 679914 - GCA002761215_00789 hypothetical protein PFAM:PF00482.28 contig_1 cds 680030 680302 + GCA002761215_00790 hypothetical protein contig_1 cds 680286 680558 - GCA002761215_00791 pilO (pseudo) Type 4a pilus biogenesis protein PilO SO:0001217, UniRef:UniRef50_A0A660MU89, UniRef:UniRef90_A0A660MU89 contig_1 cds 680559 680714 - GCA002761215_00792 hypothetical protein contig_1 cds 683324 683470 - GCA002761215_00793 hypothetical protein contig_1 cds 683896 684069 + GCA002761215_00794 hypothetical protein contig_1 cds 683999 684163 - GCA002761215_00795 hypothetical protein contig_1 cds 685627 685905 + GCA002761215_00796 hypothetical protein contig_1 cds 685976 686176 + GCA002761215_00797 hypothetical protein contig_1 cds 686314 686703 - GCA002761215_00798 hypothetical protein contig_1 cds 686936 687139 + GCA002761215_00799 hypothetical protein contig_1 cds 688007 688171 + GCA002761215_00800 hypothetical protein PFAM:PF01386.24 contig_1 cds 688321 688512 - GCA002761215_00801 hypothetical protein contig_1 cds 688551 688742 - GCA002761215_00802 hypothetical protein contig_1 cds 688720 688962 - GCA002761215_00803 hypothetical protein contig_1 cds 692881 693066 - GCA002761215_00804 hypothetical protein contig_1 cds 694478 694642 + GCA002761215_00805 hypothetical protein contig_1 cds 695988 696317 - GCA002761215_00806 hypothetical protein contig_1 cds 697389 697553 - GCA002761215_00807 hypothetical protein contig_1 cds 699092 699262 + GCA002761215_00808 hypothetical protein contig_1 cds 700279 700416 - GCA002761215_00809 hypothetical protein contig_1 cds 701891 702136 + GCA002761215_00810 hypothetical protein contig_1 cds 702217 702441 - GCA002761215_00811 hypothetical protein contig_1 cds 702514 702660 - GCA002761215_00812 hypothetical protein contig_1 cds 703123 703260 - GCA002761215_00813 hypothetical protein contig_1 cds 705767 705934 + GCA002761215_00814 hypothetical protein contig_1 cds 706151 706459 + GCA002761215_00815 hypothetical protein contig_1 cds 706453 706560 - GCA002761215_00816 hypothetical protein PFAM:PF08139.17 contig_1 cds 706678 706896 - GCA002761215_00817 hypothetical protein contig_1 cds 707102 707335 + GCA002761215_00818 hypothetical protein contig_1 cds 708719 708877 - GCA002761215_00819 hypothetical protein contig_1 cds 709565 709765 + GCA002761215_00820 hypothetical protein contig_1 cds 710806 710919 - GCA002761215_00821 hypothetical protein contig_1 cds 711333 711587 - GCA002761215_00822 Zinc-dependent peptidase SO:0001217, UniRef:UniRef50_A0A944V188 contig_1 cds 713187 713297 - GCA002761215_00823 hypothetical protein contig_1 cds 713299 713415 - GCA002761215_00824 hypothetical protein contig_1 cds 713815 713934 - GCA002761215_00825 hypothetical protein contig_1 cds 717364 717612 - GCA002761215_00826 hypothetical protein contig_1 cds 717941 718150 - GCA002761215_00827 hypothetical protein contig_1 cds 718825 718986 + GCA002761215_00828 hypothetical protein contig_1 cds 719553 719747 - GCA002761215_00829 hypothetical protein contig_1 cds 719884 720003 + GCA002761215_00830 hypothetical protein contig_1 cds 720079 720396 + GCA002761215_00831 hypothetical protein contig_1 cds 720780 720884 - GCA002761215_00832 hypothetical protein contig_1 cds 725170 725643 - GCA002761215_00833 hypothetical protein contig_1 cds 725677 725856 - GCA002761215_00834 hypothetical protein contig_1 cds 725920 726432 - GCA002761215_00835 hypothetical protein contig_1 cds 727493 727972 + GCA002761215_00836 hypothetical protein contig_1 cds 728971 729123 - GCA002761215_00837 hypothetical protein contig_1 cds 731974 732243 - GCA002761215_00838 hypothetical protein contig_1 cds 732439 732540 - GCA002761215_00839 hypothetical protein contig_1 cds 733126 733413 - GCA002761215_00840 hypothetical protein contig_1 cds 734113 734229 - GCA002761215_00841 hypothetical protein contig_1 cds 734992 735354 - GCA002761215_00842 hypothetical protein contig_1 cds 736526 736756 - GCA002761215_00843 hypothetical protein PFAM:PF02403.27 contig_1 cds 736943 737065 - GCA002761215_00844 hypothetical protein contig_1 cds 738105 738422 + GCA002761215_00845 hypothetical protein contig_1 cds 739256 739375 - GCA002761215_00846 hypothetical protein contig_1 cds 739436 739600 - GCA002761215_00847 hypothetical protein contig_1 cds 740910 741056 + GCA002761215_00848 hypothetical protein contig_1 cds 741156 741335 + GCA002761215_00849 hypothetical protein PFAM:PF13603.12 contig_1 cds 742039 742251 - GCA002761215_00850 hypothetical protein contig_1 cds 742319 742459 - GCA002761215_00851 hypothetical protein contig_1 cds 743067 743405 + GCA002761215_00852 psiE Protein PsiE SO:0001217, UniParc:UPI000D777EAB, UniRef:UniRef100_A0A660MQN4, UniRef:UniRef50_A0A944H738, UniRef:UniRef90_A0A660MQN4 contig_1 cds 744061 744279 + GCA002761215_00853 hypothetical protein contig_1 cds 745984 746166 - GCA002761215_00854 hypothetical protein PFAM:PF00081.27 contig_1 cds 749795 749947 - GCA002761215_00855 hypothetical protein contig_1 cds 751400 751519 - GCA002761215_00856 hypothetical protein contig_1 cds 752166 752291 - GCA002761215_00857 hypothetical protein contig_1 cds 752390 753187 - GCA002761215_00858 Phosphodiester glycosidase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2W4KNS0, UniRef:UniRef90_A0A2U7P199 contig_1 cds 753336 753497 - GCA002761215_00859 hypothetical protein contig_1 cds 755708 755902 + GCA002761215_00860 hypothetical protein contig_1 cds 756519 756893 - GCA002761215_00861 hypothetical protein contig_1 cds 757316 757636 + GCA002761215_00862 hypothetical protein contig_1 cds 757689 758027 + GCA002761215_00863 hypothetical protein contig_1 cds 758018 758257 + GCA002761215_00864 hypothetical protein contig_1 cds 758305 758490 - GCA002761215_00865 DNA polymerase III subunit alpha SO:0001217, UniRef:UniRef50_A0A1V5ZLX6 contig_1 cds 759840 759965 + GCA002761215_00866 hypothetical protein contig_1 cds 760273 760506 - GCA002761215_00867 hypothetical protein contig_1 cds 760847 761089 - GCA002761215_00868 hypothetical protein contig_1 cds 761151 761420 + GCA002761215_00869 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MSV4, UniRef:UniRef90_A0A660MTL7 contig_1 cds 761618 761890 - GCA002761215_00870 hypothetical protein contig_1 cds 762285 762428 - GCA002761215_00871 Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J434 contig_1 cds 762687 762830 - GCA002761215_00872 Aminoacyl-transfer RNA synthetases class-II family profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D5YG00 contig_1 cds 764070 764240 + GCA002761215_00873 hypothetical protein contig_1 cds 765633 765773 + GCA002761215_00874 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NR13 contig_1 cds 766386 766613 + GCA002761215_00875 hypothetical protein SO:0001217, UniRef:UniRef50_A0A661K3K4 contig_1 cds 769228 769338 + GCA002761215_00876 (pseudo) Nudix hydrolase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PHD4, UniRef:UniRef90_A0A2U7PHD4 contig_1 tRNA 769363 769437 - GCA002761215_00877 trnfM tRNA-fMet(cat) SO:0000266 contig_1 tRNA 769486 769560 - GCA002761215_00878 trnE tRNA-Glu(ttc) SO:0000259 contig_1 cds 770361 770630 + GCA002761215_00879 hypothetical protein contig_1 cds 771356 771727 - GCA002761215_00880 hypothetical protein PFAM:PF05226.16 contig_1 cds 772007 772399 - GCA002761215_00881 hypothetical protein contig_1 cds 772671 772835 + GCA002761215_00882 hypothetical protein contig_1 cds 773009 773245 + GCA002761215_00883 (pseudo) Septum formation initiator SO:0001217, UniRef:UniRef50_A0A2U7P998, UniRef:UniRef90_A0A2U7P998 contig_1 cds 773252 773422 + GCA002761215_00884 hypothetical protein SO:0001217, UniParc:UPI001CAEC716, UniRef:UniRef100_A0A929SN26, UniRef:UniRef50_A0A929SN26, UniRef:UniRef90_A0A929SN26 contig_1 cds 774007 774138 - GCA002761215_00885 khpA (pseudo) RNA-binding protein KhpA SO:0001217, UniRef:UniRef50_A0A2U7P1B1, UniRef:UniRef90_A0A2U7P1B1 contig_1 tRNA 774547 774631 - GCA002761215_00886 trnL tRNA-Leu(taa) SO:0000264 contig_1 cds 774939 775232 - GCA002761215_00887 rpsJ 30S ribosomal protein S10 GO:0003723, GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniParc:UPI001CADBA7E, UniRef:UniRef100_A0A929SM83, UniRef:UniRef50_P94266, UniRef:UniRef90_A0A2W4IH90 contig_1 cds 775401 775685 - GCA002761215_00888 (pseudo) GTPase-translation elongation factor SO:0001217, UniRef:UniRef50_A0A0R0CZB4, UniRef:UniRef90_A0A0C5VSD2 contig_1 cds 775701 776258 - GCA002761215_00889 Elongation factor Tu SO:0001217, UniRef:UniRef50_A7L755 contig_1 cds 776403 776528 - GCA002761215_00890 (pseudo) GTP-binding protein SO:0001217, UniRef:UniRef50_A0A0G9LEY2, UniRef:UniRef90_UPI002F91F916 contig_1 tRNA 777011 777087 - GCA002761215_00891 trnA tRNA-Ala(tgc) SO:0000254 contig_1 tRNA 777193 777271 - GCA002761215_00892 trnD tRNA-Asp(gtc) SO:0000256 contig_1 cds 777794 778105 - GCA002761215_00893 hypothetical protein contig_1 cds 778136 778327 - GCA002761215_00894 hypothetical protein contig_1 cds 778907 779083 - GCA002761215_00895 hypothetical protein contig_1 cds 779168 779689 - GCA002761215_00896 hypothetical protein contig_1 cds 779767 780087 - GCA002761215_00897 hypothetical protein contig_1 cds 780172 780324 + GCA002761215_00898 hypothetical protein contig_1 cds 781336 781638 + GCA002761215_00899 hypothetical protein contig_1 cds 782263 782484 + GCA002761215_00900 hypothetical protein contig_1 cds 783775 783939 - GCA002761215_00901 hypothetical protein contig_1 cds 783967 784161 - GCA002761215_00902 hypothetical protein contig_1 cds 784829 785074 + GCA002761215_00903 hypothetical protein contig_1 cds 785216 785446 + GCA002761215_00904 hypothetical protein contig_1 cds 787330 787536 + GCA002761215_00905 hypothetical protein contig_1 cds 788224 788325 + GCA002761215_00906 hypothetical protein contig_1 cds 788784 788906 - GCA002761215_00907 hypothetical protein contig_1 cds 790091 790237 - GCA002761215_00908 hypothetical protein contig_1 cds 790578 791222 - GCA002761215_00909 hypothetical protein contig_1 cds 791262 793877 - GCA002761215_00910 (pseudo) SLH domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EM68, UniRef:UniRef90_A0A2U7NYL2 contig_1 cds 796312 796488 - GCA002761215_00911 hypothetical protein contig_1 cds 797925 798089 + GCA002761215_00912 hypothetical protein contig_1 cds 799788 799979 - GCA002761215_00913 hypothetical protein contig_1 cds 801249 801512 - GCA002761215_00914 hypothetical protein contig_1 cds 801892 802179 + GCA002761215_00915 hypothetical protein contig_1 cds 802759 803064 + GCA002761215_00916 (pseudo) DUF5667 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PHX1, UniRef:UniRef90_A0A2U7PHX1 contig_1 cds 803133 803414 - GCA002761215_00917 hypothetical protein contig_1 cds 804945 805109 - GCA002761215_00918 hypothetical protein contig_1 cds 805474 805710 - GCA002761215_00919 hypothetical protein contig_1 cds 805894 806115 - GCA002761215_00920 hypothetical protein contig_1 cds 810220 810462 + GCA002761215_00921 hypothetical protein contig_1 cds 810916 811071 - GCA002761215_00922 hypothetical protein contig_1 cds 813075 813230 - GCA002761215_00923 hypothetical protein contig_1 cds 815334 815519 - GCA002761215_00924 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MRE2, UniRef:UniRef90_A0A660MRE2 contig_1 cds 815694 815834 - GCA002761215_00925 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2W4IIF6, UniRef:UniRef90_A0A2U7NYM8 contig_1 cds 816469 816690 - GCA002761215_00926 hypothetical protein contig_1 cds 817547 817672 + GCA002761215_00927 hypothetical protein PFAM:PF00464.25 contig_1 cds 821442 821672 + GCA002761215_00928 hypothetical protein contig_1 cds 821706 821879 + GCA002761215_00929 hypothetical protein contig_1 tRNA 821953 822027 + GCA002761215_00930 trnR tRNA-Arg(cct) SO:0001036 contig_1 cds 822345 822563 + GCA002761215_00931 hypothetical protein contig_1 cds 822863 823198 - GCA002761215_00932 hypothetical protein contig_1 cds 823554 823943 + GCA002761215_00933 hypothetical protein contig_1 cds 825344 825685 - GCA002761215_00934 hypothetical protein contig_1 cds 826791 826958 - GCA002761215_00935 hypothetical protein contig_1 cds 830468 830704 + GCA002761215_00936 hypothetical protein contig_1 cds 832360 832530 - GCA002761215_00937 Translation elongation factor P/YeiP central domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YTM8 contig_1 cds 833051 833164 - GCA002761215_00938 hypothetical protein contig_1 cds 833592 833753 + GCA002761215_00939 hypothetical protein contig_1 cds 833766 834257 + GCA002761215_00940 hypothetical protein contig_1 cds 834827 835459 - GCA002761215_00941 hypothetical protein contig_1 cds 836313 836504 + GCA002761215_00942 hypothetical protein contig_1 cds 836661 836927 - GCA002761215_00943 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PHH5, UniRef:UniRef90_A0A2U7PHH5 contig_1 cds 837058 837570 - GCA002761215_00944 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P3S1, UniRef:UniRef90_A0A2U7P3S1 contig_1 cds 838507 838770 - GCA002761215_00945 hypothetical protein contig_1 cds 838957 839121 - GCA002761215_00946 hypothetical protein PFAM:PF00679.30 contig_1 cds 839143 839379 - GCA002761215_00947 hypothetical protein PFAM:PF00679.30, PFAM:PF03764.24 contig_1 cds 840094 840237 - GCA002761215_00948 hypothetical protein contig_1 cds 840301 840459 - GCA002761215_00949 hypothetical protein contig_1 cds 840545 840760 + GCA002761215_00950 hypothetical protein contig_1 cds 840796 840954 - GCA002761215_00951 Tr-type G domain-containing protein SO:0001217, UniRef:UniRef50_A0A168H987 contig_1 cds 841221 841355 - GCA002761215_00952 hypothetical protein contig_1 cds 841447 841755 + GCA002761215_00953 hypothetical protein contig_1 cds 842333 842527 + GCA002761215_00954 hypothetical protein contig_1 cds 844112 844351 + GCA002761215_00955 hypothetical protein contig_1 cds 844364 844630 + GCA002761215_00956 hypothetical protein contig_1 cds 846038 846253 + GCA002761215_00957 hypothetical protein contig_1 cds 846660 846857 + GCA002761215_00958 hypothetical protein contig_1 cds 847802 847966 + GCA002761215_00959 hypothetical protein contig_1 cds 849259 849348 - GCA002761215_00960 hypothetical protein PFAM:PF01409.25 contig_1 cds 849437 849682 + GCA002761215_00961 hypothetical protein contig_1 cds 850026 850205 + GCA002761215_00962 hypothetical protein contig_1 cds 850472 850765 - GCA002761215_00963 hypothetical protein contig_1 cds 851492 851722 - GCA002761215_00964 hypothetical protein contig_1 cds 852131 852298 + GCA002761215_00965 Heavy metal transport/detoxification protein SO:0001217, UniRef:UniRef50_F0IGB3, UniRef:UniRef90_A0A2U7PDL5 contig_1 cds 853077 853307 + GCA002761215_00966 hypothetical protein contig_1 cds 855778 856101 + GCA002761215_00967 Large ribosomal subunit protein uL4 SO:0001217, UniRef:UniRef50_A0A946J6X5 contig_1 cds 856113 856256 + GCA002761215_00968 rplW (pseudo) 50S ribosomal protein L23 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A5P8NC04, UniRef:UniRef90_A0A2U7NYP8 contig_1 cds 859064 859285 + GCA002761215_00969 rpmC 50S ribosomal protein L29 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniParc:UPI000D776634, UniRef:UniRef100_A0A2U7NYP6, UniRef:UniRef50_A0A2G6PMG3, UniRef:UniRef90_A0A2U7NYP6 contig_1 cds 859310 859465 + GCA002761215_00970 rpsQ (pseudo) 30S ribosomal protein S17 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_O31164, UniRef:UniRef90_A0A2U7PI07 contig_1 cds 860072 860218 + GCA002761215_00971 rplX (pseudo) 50S ribosomal protein L24 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A352A0Q9, UniRef:UniRef90_A0A2U7P3U0 contig_1 cds 860327 860437 + GCA002761215_00972 hypothetical protein contig_1 cds 860609 860716 + GCA002761215_00973 hypothetical protein PFAM:PF00673.26 contig_1 cds 860890 861024 + GCA002761215_00974 (pseudo) Small ribosomal subunit protein uS14 KEGG:K02954, SO:0001217, UniRef:UniRef50_B7J480, UniRef:UniRef90_A0A2U7P9G1 contig_1 cds 861149 861415 + GCA002761215_00975 rpsH (pseudo) 30S ribosomal protein S8 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A2U7PPW1, UniRef:UniRef90_A0A2U7PPW1 contig_1 cds 862184 862324 + GCA002761215_00976 rplR (pseudo) 50S ribosomal protein L18 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A2U7PDN0, UniRef:UniRef90_A0A2U7PDN0 contig_1 cds 862300 862467 - GCA002761215_00977 hypothetical protein contig_1 cds 862548 862658 + GCA002761215_00978 hypothetical protein contig_1 cds 863158 863511 - GCA002761215_00979 hypothetical protein contig_1 cds 863626 863739 + GCA002761215_00980 hypothetical protein contig_1 cds 863706 863861 - GCA002761215_00981 hypothetical protein contig_1 cds 864696 864812 - GCA002761215_00982 hypothetical protein contig_1 cds 865070 865216 + GCA002761215_00983 hypothetical protein PFAM:PF07963.17 contig_1 cds 865840 866544 - GCA002761215_00984 hypothetical protein contig_1 cds 866698 866847 - GCA002761215_00985 hypothetical protein contig_1 cds 867611 867919 + GCA002761215_00986 hypothetical protein PFAM:PF03382.20 contig_1 cds 868950 869210 + GCA002761215_00987 hypothetical protein contig_1 cds 869642 869989 - GCA002761215_00988 Tr-type G domain-containing protein SO:0001217, UniRef:UniRef50_A0A3C1S3P3 contig_1 cds 870074 870298 - GCA002761215_00989 hypothetical protein PFAM:PF00009.33 contig_1 cds 870396 870587 - GCA002761215_00990 hypothetical protein contig_1 cds 870961 871245 + GCA002761215_00991 hypothetical protein contig_1 tRNA 873120 873196 + GCA002761215_00992 trnM tRNA-Met(cat) SO:0000266 contig_1 cds 873249 873416 - GCA002761215_00993 hypothetical protein contig_1 cds 874107 874388 + GCA002761215_00994 hypothetical protein contig_1 cds 874515 874652 + GCA002761215_00995 hypothetical protein contig_1 cds 879788 880138 + GCA002761215_00996 hypothetical protein PFAM:PF03462.23 contig_1 cds 881856 881996 - GCA002761215_00997 hypothetical protein contig_1 cds 882408 882587 - GCA002761215_00998 hypothetical protein contig_1 cds 883922 884065 + GCA002761215_00999 hypothetical protein PFAM:PF00204.31 contig_1 cds 886277 886552 + GCA002761215_01000 hypothetical protein contig_1 tRNA 887498 887572 + GCA002761215_01001 trnN tRNA-Asn(gtt) SO:0000257 contig_1 tRNA 887646 887735 + GCA002761215_01002 trnS tRNA-Ser(tga) SO:0000269 contig_1 tRNA 887747 887835 + GCA002761215_01003 trnS tRNA-Ser(gct) SO:0000269 contig_1 tRNA 887928 888003 + GCA002761215_01004 trnI tRNA-Ile2(cat) SO:0000263 contig_1 rRNA 888189 889675 + GCA002761215_01005 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_1 rRNA 889811 892740 + GCA002761215_01006 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_1 rRNA 892929 893044 + GCA002761215_01007 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_1 tRNA 893096 893170 + GCA002761215_01008 trnR tRNA-Arg(tct) SO:0001036 contig_1 tRNA 893187 893263 + GCA002761215_01009 trnV tRNA-Val(tac) SO:0000273 contig_1 cds 893697 893906 + GCA002761215_01010 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J5S3 contig_1 cds 894301 894561 + GCA002761215_01011 hypothetical protein contig_1 cds 895138 895437 - GCA002761215_01012 hypothetical protein contig_1 cds 895684 895884 - GCA002761215_01013 hypothetical protein contig_1 cds 896851 897129 - GCA002761215_01014 hypothetical protein PFAM:PF00496.27 contig_1 cds 897304 897435 - GCA002761215_01015 hypothetical protein contig_1 cds 897516 897698 + GCA002761215_01016 hypothetical protein contig_1 cds 899162 899509 - GCA002761215_01017 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ELH4, UniRef:UniRef90_A0A2W4IET9 contig_1 cds 899941 900030 - GCA002761215_01018 hypothetical protein contig_1 cds 900063 900155 - GCA002761215_01019 hypothetical protein contig_1 cds 900891 900980 + GCA002761215_01020 hypothetical protein PFAM:PF07963.17 contig_1 cds 901805 901954 - GCA002761215_01021 hypothetical protein contig_1 cds 902180 902338 - GCA002761215_01022 hypothetical protein contig_1 cds 902995 903198 + GCA002761215_01023 hypothetical protein contig_1 cds 903808 903966 + GCA002761215_01024 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MSX0, UniRef:UniRef90_A0A660MSX0 contig_1 cds 905976 906116 + GCA002761215_01025 hypothetical protein contig_1 cds 907037 907318 + GCA002761215_01026 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A5P8NEW1, UniRef:UniRef90_A0A929M3Q0 contig_1 cds 909947 910108 + GCA002761215_01027 hypothetical protein contig_1 cds 910352 910576 + GCA002761215_01028 hypothetical protein contig_1 cds 910598 910837 + GCA002761215_01029 hypothetical protein contig_1 cds 911498 911650 - GCA002761215_01030 hypothetical protein SO:0001217, UniParc:UPI0013C332C5, UniRef:UniRef100_A0A929M9H0, UniRef:UniRef50_A0A7Y7UK72, UniRef:UniRef90_A0A929M9H0 contig_1 cds 911760 911960 - GCA002761215_01031 hypothetical protein contig_1 cds 912183 912374 - GCA002761215_01032 hypothetical protein contig_1 cds 912637 912924 + GCA002761215_01033 hypothetical protein contig_1 cds 913533 913709 - GCA002761215_01034 secA (pseudo) SecA family profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRQ2, UniRef:UniRef90_A0A946NRQ2 contig_1 cds 914007 914357 - GCA002761215_01035 hypothetical protein PFAM:PF07517.20 contig_1 cds 914590 914724 + GCA002761215_01036 hypothetical protein PFAM:PF01330.27 contig_1 cds 914691 914909 - GCA002761215_01037 hypothetical protein contig_1 cds 915602 915817 + GCA002761215_01038 rmuC DNA recombination protein RmuC SO:0001217, UniRef:UniRef50_A0A944UZZ9 contig_1 cds 915914 916066 + GCA002761215_01039 hypothetical protein contig_1 cds 918615 919076 - GCA002761215_01040 (pseudo) Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein SO:0001217, UniRef:UniRef50_H1HG86, UniRef:UniRef50_U2RNF0, UniRef:UniRef90_A0A2U7NZ99 contig_1 cds 919287 919481 - GCA002761215_01041 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NRP6 contig_1 cds 919596 919781 - GCA002761215_01042 traM TraD/TraG TraM recognition site domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRT8 contig_1 cds 920272 920454 + GCA002761215_01043 hypothetical protein contig_1 cds 920940 921191 - GCA002761215_01044 hypothetical protein contig_1 cds 921423 921665 - GCA002761215_01045 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J5R3 contig_1 cds 922177 922353 + GCA002761215_01046 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MPJ1, UniRef:UniRef90_A0A660MPJ1 contig_1 cds 923695 923844 + GCA002761215_01047 hypothetical protein contig_1 tRNA 926517 926595 - GCA002761215_01048 tRNA-Xxx contig_1 cds 926751 926852 + GCA002761215_01049 hypothetical protein contig_1 cds 927918 928130 - GCA002761215_01050 hypothetical protein contig_1 cds 928202 928396 - GCA002761215_01051 hypothetical protein contig_1 cds 928862 929011 + GCA002761215_01052 hypothetical protein contig_1 cds 933053 933217 - GCA002761215_01053 hypothetical protein contig_1 cds 933293 933388 - GCA002761215_01054 hypothetical protein contig_1 cds 933886 934176 + GCA002761215_01055 hypothetical protein contig_1 cds 937056 937229 + GCA002761215_01056 hypothetical protein contig_1 cds 937723 937923 + GCA002761215_01057 hypothetical protein contig_1 cds 937939 938253 + GCA002761215_01058 (pseudo) Cardiolipin synthase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PDT7, UniRef:UniRef90_A0A2U7PDT7 contig_1 cds 938477 938587 - GCA002761215_01059 hypothetical protein contig_1 cds 939071 939181 - GCA002761215_01060 hypothetical protein contig_1 cds 939428 939556 - GCA002761215_01061 hypothetical protein contig_1 cds 940213 940443 + GCA002761215_01062 hypothetical protein contig_1 cds 940412 940582 + GCA002761215_01063 hypothetical protein contig_1 cds 940867 941064 - GCA002761215_01064 hypothetical protein contig_1 cds 941626 941787 - GCA002761215_01065 hypothetical protein contig_1 cds 942125 942256 + GCA002761215_01066 hypothetical protein contig_1 cds 942497 942652 + GCA002761215_01067 hypothetical protein contig_1 cds 943495 943653 - GCA002761215_01068 hypothetical protein contig_1 cds 943723 943974 - GCA002761215_01069 hypothetical protein contig_1 cds 944591 944731 + GCA002761215_01070 hypothetical protein contig_1 cds 944846 944974 + GCA002761215_01071 hypothetical protein contig_1 cds 945907 946209 - GCA002761215_01072 hypothetical protein contig_1 cds 948329 948457 + GCA002761215_01073 hypothetical protein contig_1 cds 948629 948778 + GCA002761215_01074 hypothetical protein contig_1 cds 948972 949067 + GCA002761215_01075 infA (pseudo) translation initiation factor IF-1 GO:0003743, GO:0006413, KEGG:K02518, SO:0001217, UniRef:UniRef50_C6XBL1, UniRef:UniRef90_A0A2U7PQ15 contig_1 cds 950483 950635 + GCA002761215_01076 hypothetical protein PFAM:PF01479.30 contig_1 cds 951950 952312 + GCA002761215_01077 rplQ 50S ribosomal protein L17 GO:0003735, GO:0005840, GO:0006412, KEGG:K02879, SO:0001217, UniParc:UPI000D7780C8, UniRef:UniRef100_A0A2U7NYX5, UniRef:UniRef50_A0A2H0I3M5, UniRef:UniRef90_A0A2W4I6C1 contig_1 cds 952337 952585 + GCA002761215_01078 50S ribosomal protein L13 SO:0001217, UniRef:UniRef50_A0A536VAZ2 contig_1 cds 953221 953340 + GCA002761215_01079 hypothetical protein contig_1 cds 953776 953973 + GCA002761215_01080 rpsG (pseudo) 30S ribosomal protein S7 GO:0003735, GO:0006412, GO:0015935, KEGG:K02992, SO:0001217, UniRef:UniRef50_A0A2E5WLQ5, UniRef:UniRef90_A0A2U7P3Z5 contig_1 cds 954714 954845 + GCA002761215_01081 hypothetical protein contig_1 cds 955950 956093 + GCA002761215_01082 hypothetical protein contig_1 cds 963017 963247 - GCA002761215_01083 hypothetical protein contig_1 cds 963314 963463 - GCA002761215_01084 hypothetical protein contig_1 cds 963667 963894 - GCA002761215_01085 hypothetical protein contig_1 cds 964805 964972 + GCA002761215_01086 hypothetical protein contig_1 cds 965327 965503 + GCA002761215_01087 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P9P5, UniRef:UniRef90_A0A2U7P9P5 contig_1 cds 966866 966994 + GCA002761215_01088 hypothetical protein contig_1 cds 967615 968061 - GCA002761215_01089 hypothetical protein contig_1 cds 969003 969230 + GCA002761215_01090 hypothetical protein contig_1 cds 969740 969994 - GCA002761215_01091 hypothetical protein contig_1 cds 971519 971719 - GCA002761215_01092 hypothetical protein contig_1 cds 971948 972109 - GCA002761215_01093 hypothetical protein contig_1 cds 972119 972262 - GCA002761215_01094 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2W4IQF8, UniRef:UniRef90_A0A2U7P1L6 contig_1 cds 972394 972522 + GCA002761215_01095 hypothetical protein contig_1 cds 975388 975546 - GCA002761215_01096 hypothetical protein contig_1 cds 975642 976187 - GCA002761215_01097 hypothetical protein contig_1 cds 976815 976907 - GCA002761215_01098 (pseudo) UVR domain-containing protein SO:0001217, UniRef:UniRef50_A0A7Y7QK42, UniRef:UniRef90_A0A660MRH1 contig_1 cds 977159 977305 + GCA002761215_01099 hypothetical protein contig_1 cds 977381 977713 + GCA002761215_01100 hypothetical protein contig_1 cds 978395 978607 - GCA002761215_01101 hypothetical protein contig_1 cds 979224 979466 + GCA002761215_01102 hypothetical protein contig_1 cds 979488 979682 + GCA002761215_01103 hypothetical protein contig_1 cds 980136 980315 - GCA002761215_01104 hypothetical protein contig_1 cds 980608 980742 + GCA002761215_01105 hypothetical protein contig_1 cds 980958 981074 - GCA002761215_01106 hypothetical protein contig_1 cds 981673 981963 - GCA002761215_01107 hypothetical protein contig_1 cds 983240 983338 - GCA002761215_01108 hypothetical protein contig_1 cds 984922 985077 + GCA002761215_01109 hypothetical protein contig_1 cds 985539 985754 - GCA002761215_01110 hypothetical protein contig_1 cds 986455 986616 + GCA002761215_01111 hypothetical protein PFAM:PF02082.26 contig_1 cds 987183 987347 + GCA002761215_01112 (pseudo) DUF3796 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P9R0, UniRef:UniRef90_A0A2U7P9R0 contig_1 cds 988060 988293 - GCA002761215_01113 hypothetical protein PFAM:PF00687.26 contig_1 cds 988502 988726 + GCA002761215_01114 hypothetical protein SO:0001217, UniParc:UPI000D776A4E, UniRef:UniRef100_A0A2U7PDY3, UniRef:UniRef50_A0A660MPN1, UniRef:UniRef90_A0A660MPN1 contig_1 cds 988820 989053 + GCA002761215_01115 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NYZ7, UniRef:UniRef90_A0A2U7NYZ7 contig_1 cds 989050 989220 + GCA002761215_01116 hypothetical protein contig_1 cds 989553 989822 - GCA002761215_01117 50S ribosomal protein L20 SO:0001217, UniRef:UniRef50_K1XH92 contig_1 cds 990423 990578 - GCA002761215_01118 hypothetical protein PFAM:PF05198.21 contig_1 cds 990731 990982 - GCA002761215_01119 rpsT 30S ribosomal protein S20 GO:0003723, GO:0003735, GO:0005840, GO:0006412, KEGG:K02968, SO:0001217, UniRef:UniRef50_A0A660MSL4, UniRef:UniRef90_A0A2U7NYY7 contig_1 cds 991762 991875 - GCA002761215_01120 hypothetical protein contig_1 cds 992184 992345 + GCA002761215_01121 hypothetical protein contig_1 cds 992974 993276 - GCA002761215_01122 hypothetical protein PFAM:PF03147.19 contig_1 cds 993666 993923 + GCA002761215_01123 hypothetical protein contig_1 cds 994322 994513 + GCA002761215_01124 hypothetical protein contig_1 cds 994622 994729 + GCA002761215_01125 hypothetical protein contig_1 cds 995188 995304 - GCA002761215_01126 hypothetical protein contig_1 cds 995447 995590 + GCA002761215_01127 hypothetical protein contig_1 cds 996116 996298 + GCA002761215_01128 hypothetical protein contig_1 cds 996892 996981 - GCA002761215_01129 hypothetical protein contig_1 cds 997605 997733 - GCA002761215_01130 hypothetical protein contig_1 cds 997965 998207 - GCA002761215_01131 hypothetical protein contig_1 cds 998229 998429 - GCA002761215_01132 hypothetical protein contig_1 cds 998706 998834 - GCA002761215_01133 hypothetical protein contig_1 cds 998888 999040 - GCA002761215_01134 hypothetical protein contig_1 cds 999338 999478 - GCA002761215_01135 hypothetical protein contig_1 cds 999632 999829 - GCA002761215_01136 hypothetical protein contig_1 cds 1000380 1000544 + GCA002761215_01137 hypothetical protein contig_1 cds 1002368 1002487 + GCA002761215_01138 hypothetical protein contig_1 cds 1003328 1003519 + GCA002761215_01139 hypothetical protein contig_1 cds 1003554 1003754 - GCA002761215_01140 hypothetical protein contig_1 cds 1004420 1004524 + GCA002761215_01141 hypothetical protein contig_1 cds 1005918 1006013 + GCA002761215_01142 hypothetical protein contig_1 cds 1006109 1006570 - GCA002761215_01143 hypothetical protein contig_1 cds 1008097 1008336 - GCA002761215_01144 hypothetical protein contig_1 cds 1008994 1009242 - GCA002761215_01145 hypothetical protein contig_1 cds 1009706 1010020 + GCA002761215_01146 hypothetical protein contig_1 cds 1011559 1011735 + GCA002761215_01147 hypothetical protein contig_1 cds 1011915 1012181 - GCA002761215_01148 hypothetical protein contig_1 cds 1013349 1013468 - GCA002761215_01149 hypothetical protein contig_1 cds 1013740 1014093 + GCA002761215_01150 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MXG6, UniRef:UniRef90_A0A660MXG6 contig_1 cds 1014889 1015128 + GCA002761215_01151 THUMP domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YRF7 contig_1 cds 1015998 1016120 + GCA002761215_01152 hypothetical protein contig_1 cds 1016157 1016273 + GCA002761215_01153 hypothetical protein contig_1 cds 1016376 1016579 + GCA002761215_01154 hypothetical protein contig_1 cds 1017549 1017689 + GCA002761215_01155 hypothetical protein contig_1 cds 1018206 1018421 + GCA002761215_01156 hypothetical protein contig_1 cds 1018502 1018843 - GCA002761215_01157 hypothetical protein contig_1 cds 1019432 1019593 - GCA002761215_01158 hypothetical protein contig_1 cds 1020165 1020374 + GCA002761215_01159 hypothetical protein contig_1 cds 1020511 1020765 - GCA002761215_01160 Four helix bundle protein SO:0001217, UniParc:UPI000D7766A4, UniRef:UniRef100_A0A2U7P438, UniRef:UniRef50_A0A2U7P438, UniRef:UniRef90_A0A2U7P438 contig_1 cds 1020930 1021226 - GCA002761215_01161 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NZ10, UniRef:UniRef90_A0A2U7NZ10 contig_1 cds 1021447 1021608 - GCA002761215_01162 hypothetical protein contig_1 cds 1022308 1022424 + GCA002761215_01163 hypothetical protein contig_1 cds 1022491 1022748 + GCA002761215_01164 hypothetical protein PFAM:PF00587.30 contig_1 cds 1022977 1023201 + GCA002761215_01165 hypothetical protein contig_1 cds 1023794 1023964 - GCA002761215_01166 hypothetical protein contig_1 cds 1024366 1024686 + GCA002761215_01167 hypothetical protein contig_1 cds 1024588 1024962 - GCA002761215_01168 hypothetical protein contig_1 cds 1026150 1026404 + GCA002761215_01169 (pseudo) RNA polymerase sigma-70 region 2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NYZ4, UniRef:UniRef90_A0A2U7NYZ4 contig_1 cds 1026408 1026569 + GCA002761215_01170 hypothetical protein contig_1 cds 1026777 1026944 + GCA002761215_01171 hypothetical protein contig_1 cds 1027071 1027172 + GCA002761215_01172 hypothetical protein contig_1 cds 1028865 1029008 + GCA002761215_01173 hypothetical protein contig_1 cds 1029490 1029636 + GCA002761215_01174 hypothetical protein contig_1 cds 1029640 1029849 + GCA002761215_01175 hypothetical protein contig_1 cds 1029765 1030070 - GCA002761215_01176 hypothetical protein contig_1 cds 1030213 1030371 + GCA002761215_01177 hypothetical protein contig_1 cds 1031134 1031277 + GCA002761215_01178 hypothetical protein contig_1 cds 1031265 1031450 - GCA002761215_01179 hypothetical protein contig_1 cds 1031776 1031931 + GCA002761215_01180 hypothetical protein PFAM:PF22421.1 contig_1 cds 1031980 1032102 + GCA002761215_01181 hypothetical protein contig_1 cds 1032269 1032478 - GCA002761215_01182 hypothetical protein contig_1 cds 1033291 1033503 + GCA002761215_01183 hypothetical protein contig_1 cds 1033478 1033681 + GCA002761215_01184 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EJ02, UniRef:UniRef90_A0A328EJ02 contig_1 cds 1034034 1034156 - GCA002761215_01185 hypothetical protein contig_1 cds 1034409 1034579 - GCA002761215_01186 hypothetical protein contig_1 cds 1034844 1035065 - GCA002761215_01187 hypothetical protein contig_1 cds 1035192 1035647 - GCA002761215_01188 hypothetical protein contig_1 cds 1035741 1036043 - GCA002761215_01189 hypothetical protein contig_1 cds 1036141 1036320 + GCA002761215_01190 hypothetical protein contig_1 cds 1036317 1036454 + GCA002761215_01191 hypothetical protein contig_1 cds 1037592 1038176 + GCA002761215_01192 Peptidase C51 domain-containing protein SO:0001217, UniParc:UPI000D7762FC, UniRef:UniRef100_A0A2U7NZ30, UniRef:UniRef50_A0A2U7NZ30, UniRef:UniRef90_A0A2U7NZ30 contig_1 cds 1038344 1038544 - GCA002761215_01193 hypothetical protein contig_1 cds 1039076 1039303 - GCA002761215_01194 hypothetical protein contig_1 cds 1039926 1040081 - GCA002761215_01195 Tetratricopeptide repeat protein SO:0001217, UniRef:UniRef50_A0A946J5V3 contig_1 cds 1040760 1040981 + GCA002761215_01196 hypothetical protein contig_1 cds 1041521 1041775 + GCA002761215_01197 hypothetical protein contig_1 cds 1042075 1042191 - GCA002761215_01198 hypothetical protein contig_1 tRNA 1042494 1042569 - GCA002761215_01199 trnP tRNA-Pro(tgg) SO:0000268 contig_1 tRNA 1042576 1042652 - GCA002761215_01200 trnI tRNA-Ile(gat) SO:0000263 contig_1 tRNA 1042779 1042855 - GCA002761215_01201 trnG tRNA-Gly(tcc) SO:0000260 contig_1 cds 1042960 1043343 + GCA002761215_01202 hypothetical protein contig_1 cds 1043673 1043777 - GCA002761215_01203 hypothetical protein contig_1 cds 1045967 1046146 - GCA002761215_01204 hypothetical protein contig_1 cds 1049005 1049256 + GCA002761215_01205 nrdR (pseudo) transcriptional regulator NrdR GO:0006355, GO:0008270, GO:0140110, SO:0001217, UniRef:UniRef50_A0A660MNV6, UniRef:UniRef90_A0A660MNV6 contig_1 cds 1049558 1049806 + GCA002761215_01206 hypothetical protein contig_1 cds 1049950 1050147 - GCA002761215_01207 hypothetical protein contig_1 cds 1050475 1050648 + GCA002761215_01208 hypothetical protein contig_1 cds 1052539 1052715 + GCA002761215_01209 hypothetical protein contig_1 cds 1053658 1053861 + GCA002761215_01210 (pseudo) EF-hand domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MSE8, UniRef:UniRef90_A0A660MSE8 contig_1 cds 1054588 1054878 + GCA002761215_01211 hypothetical protein contig_1 cds 1056274 1056459 - GCA002761215_01212 hypothetical protein contig_1 tRNA 1056530 1056605 - GCA002761215_01213 trnE tRNA-Glu(ctc) SO:0000259 contig_1 cds 1056639 1057007 - GCA002761215_01214 rplK (pseudo) 50S ribosomal protein L11 GO:0003735, GO:0005840, GO:0006412, KEGG:K02867, SO:0001217, UniRef:UniRef50_A0A7V9K9B0, UniRef:UniRef90_A0A2U7P1R2 contig_1 cds 1057550 1057807 + GCA002761215_01215 hypothetical protein contig_1 cds 1058347 1058643 + GCA002761215_01216 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7NZ43, UniRef:UniRef90_A0A2U7NZ43 contig_1 cds 1059126 1059368 + GCA002761215_01217 hypothetical protein contig_1 cds 1061041 1061259 + GCA002761215_01218 hypothetical protein contig_1 cds 1061260 1061412 + GCA002761215_01219 hypothetical protein contig_1 cds 1062215 1062379 - GCA002761215_01220 hypothetical protein contig_1 cds 1062376 1062708 - GCA002761215_01221 hypothetical protein contig_1 cds 1063631 1064122 - GCA002761215_01222 hypothetical protein contig_1 cds 1064321 1064482 - GCA002761215_01223 hypothetical protein contig_1 cds 1065992 1066117 + GCA002761215_01224 hypothetical protein PFAM:PF08529.16 contig_1 cds 1067219 1067356 + GCA002761215_01225 hypothetical protein contig_1 cds 1068051 1068194 + GCA002761215_01226 hypothetical protein contig_1 cds 1068456 1068737 + GCA002761215_01227 hypothetical protein contig_1 cds 1070265 1070537 + GCA002761215_01228 hypothetical protein contig_1 cds 1070691 1070867 + GCA002761215_01229 hypothetical protein contig_1 cds 1071846 1072019 + GCA002761215_01230 hypothetical protein contig_1 cds 1071998 1072201 - GCA002761215_01231 hypothetical protein PFAM:PF07963.17 contig_1 cds 1072236 1072409 + GCA002761215_01232 hypothetical protein contig_1 cds 1072918 1073097 - GCA002761215_01233 hypothetical protein contig_1 cds 1073126 1073269 + GCA002761215_01234 hypothetical protein contig_1 cds 1073273 1073461 + GCA002761215_01235 hypothetical protein contig_1 cds 1074616 1074837 + GCA002761215_01236 hypothetical protein contig_1 cds 1074971 1075456 - GCA002761215_01237 hypothetical protein contig_1 cds 1076103 1076231 + GCA002761215_01238 hypothetical protein contig_1 cds 1076591 1076704 - GCA002761215_01239 hypothetical protein contig_1 cds 1077474 1077749 + GCA002761215_01240 hypothetical protein contig_1 cds 1079229 1079432 + GCA002761215_01241 hypothetical protein PFAM:PF07963.17 contig_1 cds 1079616 1079774 + GCA002761215_01242 hypothetical protein contig_1 cds 1079789 1079998 + GCA002761215_01243 hypothetical protein contig_1 cds 1080247 1080375 - GCA002761215_01244 hypothetical protein contig_1 cds 1080472 1080657 - GCA002761215_01245 hypothetical protein contig_1 cds 1080958 1081170 - GCA002761215_01246 hypothetical protein contig_1 cds 1081707 1081877 + GCA002761215_01247 hypothetical protein contig_1 cds 1082639 1082803 - GCA002761215_01248 hypothetical protein contig_1 cds 1083065 1083202 - GCA002761215_01249 hypothetical protein contig_1 cds 1083269 1083490 + GCA002761215_01250 (pseudo) Rubredoxin-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A5P8NEG4, UniRef:UniRef90_A0A2U7PID8 contig_1 cds 1084152 1084391 + GCA002761215_01251 hypothetical protein contig_1 cds 1084346 1084462 - GCA002761215_01252 hypothetical protein contig_1 cds 1084728 1084850 + GCA002761215_01253 hypothetical protein contig_1 cds 1085099 1085428 - GCA002761215_01254 hypothetical protein contig_1 cds 1085586 1085792 + GCA002761215_01255 traM TraM recognition domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YQS2, UniRef:UniRef90_A0A944YQS2 contig_1 cds 1085946 1086221 + GCA002761215_01256 hypothetical protein contig_1 cds 1086253 1086474 - GCA002761215_01257 (pseudo) DUF5667 domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EFB1, UniRef:UniRef90_A0A2U7P477 contig_1 cds 1086556 1086702 - GCA002761215_01258 hypothetical protein contig_1 cds 1086910 1087224 + GCA002761215_01259 hypothetical protein contig_1 cds 1088508 1088708 - GCA002761215_01260 (pseudo) Trigger factor C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2G6PLV5, UniRef:UniRef90_A0A660MQ89 contig_1 cds 1089936 1090187 + GCA002761215_01261 hypothetical protein PFAM:PF00560.39, PFAM:PF12799.13, PFAM:PF13855.12 contig_1 cds 1091069 1091326 - GCA002761215_01262 hypothetical protein contig_1 cds 1092491 1092880 - GCA002761215_01263 hypothetical protein contig_1 cds 1093542 1093673 + GCA002761215_01264 hypothetical protein contig_1 cds 1093818 1094078 + GCA002761215_01265 hypothetical protein PFAM:PF00560.39, PFAM:PF12799.13 contig_1 cds 1095838 1096176 - GCA002761215_01266 hypothetical protein contig_1 cds 1096249 1096542 - GCA002761215_01267 hypothetical protein contig_1 cds 1098672 1098893 - GCA002761215_01268 hypothetical protein contig_1 cds 1099009 1099119 + GCA002761215_01269 hypothetical protein contig_1 cds 1099883 1100062 + GCA002761215_01270 hypothetical protein contig_1 cds 1100519 1100899 + GCA002761215_01271 hypothetical protein contig_1 cds 1101230 1101352 + GCA002761215_01272 hypothetical protein contig_1 cds 1102353 1102508 + GCA002761215_01273 hypothetical protein PFAM:PF03054.22 contig_1 cds 1103706 1103873 + GCA002761215_01274 hypothetical protein contig_1 cds 1105673 1105795 + GCA002761215_01275 hypothetical protein contig_1 cds 1105915 1106130 - GCA002761215_01276 hypothetical protein contig_1 cds 1106587 1106835 + GCA002761215_01277 hypothetical protein contig_1 cds 1106875 1107105 + GCA002761215_01278 hypothetical protein contig_1 cds 1107603 1107764 - GCA002761215_01279 hypothetical protein contig_1 cds 1107955 1108203 + GCA002761215_01280 hypothetical protein contig_1 cds 1109578 1109739 + GCA002761215_01281 hypothetical protein contig_1 cds 1110030 1110236 - GCA002761215_01282 hypothetical protein contig_1 cds 1111499 1111813 + GCA002761215_01283 (pseudo) DUF420 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NZ70, UniRef:UniRef90_A0A2U7NZ70 contig_1 cds 1112666 1112809 - GCA002761215_01284 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J5I5 contig_1 cds 1113396 1113878 - GCA002761215_01285 hypothetical protein contig_1 cds 1114120 1114596 + GCA002761215_01286 hypothetical protein contig_1 cds 1114893 1115087 - GCA002761215_01287 hypothetical protein contig_1 cds 1115904 1116248 - GCA002761215_01288 lemA (pseudo) LemA family protein SO:0001217, UniRef:UniRef50_A0A660MWU4, UniRef:UniRef90_A0A660MWU4 contig_1 cds 1116418 1116531 + GCA002761215_01289 secE Preprotein translocase subunit SecE SO:0001217, UniRef:UniRef50_A0A946J5J8 contig_1 cds 1116689 1116850 + GCA002761215_01290 hypothetical protein contig_1 cds 1117054 1117299 - GCA002761215_01291 hypothetical protein contig_1 cds 1117403 1117588 + GCA002761215_01292 hypothetical protein contig_1 cds 1118266 1118439 - GCA002761215_01293 hypothetical protein contig_1 cds 1122593 1122823 + GCA002761215_01294 hypothetical protein contig_1 cds 1123044 1123343 + GCA002761215_01295 hypothetical protein contig_1 cds 1123895 1124059 + GCA002761215_01296 hypothetical protein contig_1 cds 1125204 1125476 + GCA002761215_01297 hypothetical protein SO:0001217, UniParc:UPI000D776175, UniRef:UniRef100_A0A2U7NZ55, UniRef:UniRef50_A0A2U7NZ55, UniRef:UniRef90_A0A2U7NZ55 contig_1 cds 1125527 1125799 - GCA002761215_01298 (pseudo) Transposase SO:0001217, UniRef:UniRef50_A0A2W4IA66, UniRef:UniRef90_A0A328EFP5 contig_1 cds 1125934 1126296 + GCA002761215_01299 hypothetical protein contig_1 tRNA 1126516 1126590 + GCA002761215_01300 trnQ tRNA-Gln(ttg) SO:0000261 contig_1 cds 1126687 1126893 + GCA002761215_01301 hypothetical protein contig_1 cds 1127828 1127998 - GCA002761215_01302 hypothetical protein contig_1 cds 1129042 1129239 - GCA002761215_01303 hypothetical protein contig_1 cds 1129594 1129836 + GCA002761215_01304 hypothetical protein contig_1 cds 1129966 1130136 + GCA002761215_01305 hypothetical protein contig_1 cds 1130454 1130654 + GCA002761215_01306 hypothetical protein contig_1 cds 1130873 1131112 - GCA002761215_01307 hypothetical protein contig_1 cds 1131289 1131660 + GCA002761215_01308 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P1V5, UniRef:UniRef90_A0A2U7P1V5 contig_1 cds 1133397 1133621 - GCA002761215_01309 hypothetical protein contig_1 cds 1133701 1133937 + GCA002761215_01310 hypothetical protein contig_1 cds 1134134 1134367 + GCA002761215_01311 (pseudo) Toxin SO:0001217, UniRef:UniRef50_A0A660MR34, UniRef:UniRef90_A0A660MR34 contig_1 cds 1135485 1135706 + GCA002761215_01312 hypothetical protein contig_1 cds 1135703 1135828 + GCA002761215_01313 hypothetical protein contig_1 cds 1136233 1136328 - GCA002761215_01314 hypothetical protein contig_1 cds 1136341 1136562 - GCA002761215_01315 hypothetical protein contig_1 cds 1136628 1136813 + GCA002761215_01316 hypothetical protein contig_1 cds 1137409 1137573 - GCA002761215_01317 hypothetical protein contig_1 cds 1140553 1140714 + GCA002761215_01318 (pseudo) Toxin SO:0001217, UniRef:UniRef50_A0A2U7NZE2, UniRef:UniRef90_A0A2U7NZE2 contig_1 tRNA 1141356 1141439 - GCA002761215_01319 trnL tRNA-Leu(caa) SO:0000264 contig_1 cds 1142915 1143235 + GCA002761215_01320 hypothetical protein PFAM:PF00773.24 contig_1 cds 1144077 1144190 + GCA002761215_01321 hypothetical protein contig_1 cds 1145602 1145757 + GCA002761215_01322 hypothetical protein contig_1 cds 1147131 1147406 + GCA002761215_01323 hypothetical protein contig_1 cds 1147728 1147883 + GCA002761215_01324 hypothetical protein contig_1 cds 1149802 1149936 + GCA002761215_01325 hypothetical protein contig_1 cds 1150468 1150569 + GCA002761215_01326 hypothetical protein contig_1 cds 1150605 1150778 - GCA002761215_01327 hypothetical protein contig_1 cds 1151773 1151925 - GCA002761215_01328 hypothetical protein contig_1 cds 1152265 1152444 - GCA002761215_01329 hypothetical protein contig_1 cds 1155362 1155565 - GCA002761215_01330 hypothetical protein PFAM:PF07963.17 contig_1 cds 1156068 1156235 + GCA002761215_01331 hypothetical protein contig_1 cds 1156878 1157120 + GCA002761215_01332 hypothetical protein PFAM:PF00587.30 contig_1 cds 1159335 1159790 + GCA002761215_01333 (pseudo) Polyphosphate kinase-2-related domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MTT9, UniRef:UniRef90_A0A2U7PA33 contig_1 cds 1162599 1162706 + GCA002761215_01334 hypothetical protein contig_1 cds 1162727 1162906 - GCA002761215_01335 hypothetical protein contig_1 cds 1164494 1164685 - GCA002761215_01336 hypothetical protein contig_1 cds 1165254 1165496 + GCA002761215_01337 hypothetical protein contig_1 cds 1165730 1165915 - GCA002761215_01338 hypothetical protein contig_1 cds 1166565 1166846 + GCA002761215_01339 hypothetical protein PFAM:PF18991.6 contig_1 cds 1167468 1167635 + GCA002761215_01340 hypothetical protein contig_1 cds 1168120 1168263 + GCA002761215_01341 hypothetical protein contig_1 cds 1169928 1170119 - GCA002761215_01342 hypothetical protein contig_1 cds 1170396 1170647 - GCA002761215_01343 hypothetical protein contig_1 cds 1171987 1172079 + GCA002761215_01344 hypothetical protein contig_1 cds 1172269 1172508 - GCA002761215_01345 (pseudo) L-threonylcarbamoyladenylate synthase SO:0001217, UniRef:UniRef50_A0A2U7PA42, UniRef:UniRef90_A0A2U7PA42 contig_1 cds 1173474 1173695 + GCA002761215_01346 hypothetical protein PFAM:PF17191.10 contig_1 cds 1175931 1176119 + GCA002761215_01347 hypothetical protein contig_1 cds 1177723 1177980 + GCA002761215_01348 hypothetical protein contig_1 cds 1178590 1178730 + GCA002761215_01349 hypothetical protein contig_1 cds 1179010 1179132 + GCA002761215_01350 hypothetical protein contig_1 rRNA 1179659 1181145 + GCA002761215_01351 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_1 rRNA 1181281 1184210 + GCA002761215_01352 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_1 rRNA 1184399 1184514 + GCA002761215_01353 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652