# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_1 cds 370 609 + GCA003260325_00001 Large ribosomal subunit protein bL31 SO:0001217, UniRef:UniRef50_A0A7X5FPV7 contig_1 cds 2272 2514 + GCA003260325_00002 rplJ (pseudo) 50S ribosomal protein L10 GO:0003735, GO:0006412, GO:0015934, KEGG:K02864, SO:0001217, UniRef:UniRef50_A0A2U7P113, UniRef:UniRef90_A0A328EIX5 contig_1 cds 2752 3042 + GCA003260325_00003 rplL (pseudo) 50S ribosomal protein L7/L12 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_P07472, UniRef:UniRef90_A0A660MUQ3 contig_1 cds 4052 4351 - GCA003260325_00004 hypothetical protein contig_1 cds 6206 6514 + GCA003260325_00005 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MXC3, UniRef:UniRef90_A0A660MXC3 contig_1 cds 7067 7258 - GCA003260325_00006 hypothetical protein PFAM:PF00512.31 contig_1 cds 7688 7972 - GCA003260325_00007 hypothetical protein contig_1 cds 8538 8636 - GCA003260325_00008 hypothetical protein contig_1 cds 8742 8945 - GCA003260325_00009 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EIN2, UniRef:UniRef90_A0A328EIN2 contig_1 cds 9012 9212 - GCA003260325_00010 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EIN2, UniRef:UniRef90_A0A328EIN2 contig_1 cds 9325 9729 - GCA003260325_00011 hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EMI0, UniRef:UniRef90_A0A328EMI0 contig_1 cds 11617 11778 + GCA003260325_00012 hypothetical protein contig_1 cds 12298 12405 - GCA003260325_00013 hypothetical protein contig_1 cds 12730 12960 - GCA003260325_00014 hypothetical protein contig_1 cds 13468 13710 - GCA003260325_00015 hypothetical protein contig_1 cds 15446 15574 + GCA003260325_00016 hypothetical protein contig_1 cds 15921 16151 - GCA003260325_00017 lapA (pseudo) LapA family protein SO:0001217, UniRef:UniRef50_A0A2W4IZ34, UniRef:UniRef90_A0A660MQ53 contig_1 cds 16200 16391 - GCA003260325_00018 hypothetical protein contig_1 cds 16536 16820 - GCA003260325_00019 hypothetical protein contig_1 cds 17139 17378 - GCA003260325_00020 hypothetical protein contig_1 cds 17353 17616 - GCA003260325_00021 hypothetical protein contig_1 cds 17947 18177 - GCA003260325_00022 hypothetical protein contig_1 tRNA 18757 18832 - GCA003260325_00023 trnK tRNA-Lys(ttt) SO:0000265 contig_1 cds 19422 19664 + GCA003260325_00024 hypothetical protein contig_1 cds 20183 20320 - GCA003260325_00025 hypothetical protein PFAM:PF10502.14 contig_1 cds 20327 20467 - GCA003260325_00026 hypothetical protein contig_1 cds 21143 21283 - GCA003260325_00027 hypothetical protein contig_1 cds 22207 22596 + GCA003260325_00028 hypothetical protein contig_1 cds 23516 23692 - GCA003260325_00029 hypothetical protein contig_1 cds 23883 24029 + GCA003260325_00030 hypothetical protein contig_1 cds 27176 27307 + GCA003260325_00031 hypothetical protein contig_1 cds 28414 29007 - GCA003260325_00032 BPSL0067 family protein SO:0001217, UniParc:UPI000F1CAC23, UniRef:UniRef100_A0A660MZM2, UniRef:UniRef50_A0A660MZM2, UniRef:UniRef90_A0A660MZM2 contig_1 cds 29429 29599 - GCA003260325_00033 hypothetical protein contig_1 cds 30419 30736 + GCA003260325_00034 hypothetical protein contig_1 cds 31129 31434 - GCA003260325_00035 hypothetical protein contig_1 cds 31741 31992 - GCA003260325_00036 hypothetical protein contig_1 cds 32318 32647 + GCA003260325_00037 hypothetical protein contig_1 cds 33524 33643 + GCA003260325_00038 hypothetical protein contig_1 cds 33868 34062 - GCA003260325_00039 hypothetical protein contig_1 cds 34727 34909 - GCA003260325_00040 atpC (pseudo) ATP synthase F1 subunit epsilon EC:7.1.2.2, GO:0015986, GO:0045261, GO:0046933, SO:0001217, UniRef:UniRef50_A0A660MW83, UniRef:UniRef50_A0A944UYD7, UniRef:UniRef90_A0A660MW83 contig_1 cds 35311 35733 - GCA003260325_00041 atpD (pseudo) F0F1 ATP synthase subunit beta EC:7.1.2.2, GO:0015986, GO:0045261, GO:0046933, SO:0001217, UniRef:UniRef50_A0A0J7YM04, UniRef:UniRef90_A0A2W4KAD2 contig_1 cds 35779 35934 - GCA003260325_00042 ATPase F1/V1/A1 complex alpha/beta subunit nucleotide-binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A920NZ10 contig_1 cds 37285 37479 - GCA003260325_00043 F-ATPase gamma subunit SO:0001217, UniRef:UniRef50_A0A380NX76 contig_1 cds 37966 38127 - GCA003260325_00044 hypothetical protein contig_1 cds 40122 40400 - GCA003260325_00045 (pseudo) ATP synthase subunit b SO:0001217, UniRef:UniRef50_A0A660MTH1, UniRef:UniRef90_A0A660MXG1 contig_1 cds 42246 42434 + GCA003260325_00046 hypothetical protein contig_1 cds 44117 44260 + GCA003260325_00047 hypothetical protein contig_1 cds 44534 45268 + GCA003260325_00048 hypothetical protein contig_1 cds 46007 46132 + GCA003260325_00049 hypothetical protein contig_1 cds 46489 46755 - GCA003260325_00050 hypothetical protein contig_1 cds 46817 47089 + GCA003260325_00051 hypothetical protein contig_1 cds 47080 47202 - GCA003260325_00052 hypothetical protein contig_1 cds 47950 48198 - GCA003260325_00053 hypothetical protein contig_1 cds 48985 49128 - GCA003260325_00054 hypothetical protein contig_1 cds 49152 49400 + GCA003260325_00055 hypothetical protein contig_1 cds 49969 50223 - GCA003260325_00056 hypothetical protein contig_1 cds 52643 52948 - GCA003260325_00057 hypothetical protein contig_1 cds 53182 53310 - GCA003260325_00058 hypothetical protein contig_1 cds 53785 54207 - GCA003260325_00059 hypothetical protein contig_1 cds 54298 54585 + GCA003260325_00060 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A929QI40, UniRef:UniRef90_A0A929QI40 contig_1 cds 57651 57836 - GCA003260325_00061 hypothetical protein contig_1 cds 58471 58578 + GCA003260325_00062 hypothetical protein contig_1 cds 59690 59833 - GCA003260325_00063 hypothetical protein contig_1 cds 63036 63446 + GCA003260325_00064 hypothetical protein contig_1 cds 63673 63966 + GCA003260325_00065 hypothetical protein contig_1 cds 65064 65261 + GCA003260325_00066 hypothetical protein contig_1 cds 66424 66576 - GCA003260325_00067 hypothetical protein contig_1 cds 66731 66859 - GCA003260325_00068 hypothetical protein contig_1 cds 66884 67027 - GCA003260325_00069 (pseudo) Lipoprotein SO:0001217, UniRef:UniRef50_A0A2W4IEW3, UniRef:UniRef90_A0A660MUI2 contig_1 cds 68333 68422 + GCA003260325_00070 hypothetical protein contig_1 cds 69571 69678 - GCA003260325_00071 hypothetical protein contig_1 cds 71039 71227 + GCA003260325_00072 hypothetical protein contig_1 cds 71134 71325 - GCA003260325_00073 hypothetical protein contig_1 cds 71533 71793 + GCA003260325_00074 hypothetical protein contig_1 cds 72508 72756 - GCA003260325_00075 hypothetical protein contig_1 cds 72830 73042 - GCA003260325_00076 hypothetical protein contig_1 cds 73056 73244 + GCA003260325_00077 hypothetical protein contig_1 cds 73779 74243 + GCA003260325_00078 hypothetical protein contig_1 cds 74858 75187 + GCA003260325_00079 (pseudo) DNA polymerase III delta N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PD80, UniRef:UniRef90_A0A328EM67 contig_1 cds 75329 75544 + GCA003260325_00080 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J488 contig_1 cds 75671 75955 - GCA003260325_00081 hypothetical protein contig_1 cds 77559 77837 + GCA003260325_00082 frr (pseudo) ribosome recycling factor GO:0006412, GO:0008135, SO:0001217, UniRef:UniRef50_A0A2G6GDQ9, UniRef:UniRef90_A0A2W4IH09 contig_1 cds 77911 78093 + GCA003260325_00083 Large ribosomal subunit protein bL33 SO:0001217, UniParc:UPI000DBF8D2B, UniRef:UniRef100_A0A660MQF1, UniRef:UniRef50_A0A9E6K1V7, UniRef:UniRef90_A0A2W4IFQ0 contig_1 cds 78584 78847 - GCA003260325_00084 hypothetical protein contig_1 cds 79838 80125 - GCA003260325_00085 hypothetical protein contig_1 cds 80216 80359 - GCA003260325_00086 hypothetical protein SO:0001217, UniRef:UniRef50_A0A944YTP0 contig_1 cds 80974 81174 - GCA003260325_00087 30S ribosomal protein S21 SO:0001217, UniParc:UPI000DBF9C7C, UniRef:UniRef100_A0A328EIK4, UniRef:UniRef50_A0A328EBH1, UniRef:UniRef90_A0A660MRC1 contig_1 cds 83389 83634 - GCA003260325_00088 HU family DNA-binding protein SO:0001217, UniRef:UniRef50_A0A972GD28, UniRef:UniRef90_A0A660MPB2 contig_1 cds 85252 85410 - GCA003260325_00089 hypothetical protein contig_1 cds 86485 86769 - GCA003260325_00090 hypothetical protein PFAM:PF07963.17 contig_1 cds 87934 88164 - GCA003260325_00091 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MRD1, UniRef:UniRef90_A0A660MRD1 contig_1 cds 88482 88760 + GCA003260325_00092 hypothetical protein contig_1 cds 89039 89164 - GCA003260325_00093 hypothetical protein contig_1 cds 89552 89731 - GCA003260325_00094 hypothetical protein contig_1 cds 91758 91958 - GCA003260325_00095 hypothetical protein contig_1 cds 92371 92601 - GCA003260325_00096 hypothetical protein contig_1 cds 93547 93747 + GCA003260325_00097 hypothetical protein contig_1 cds 93885 94310 - GCA003260325_00098 hypothetical protein contig_1 cds 96006 96188 + GCA003260325_00099 hypothetical protein PFAM:PF14693.11 contig_1 cds 96339 96557 - GCA003260325_00100 hypothetical protein contig_1 cds 98012 98593 + GCA003260325_00101 hypothetical protein contig_1 cds 99041 99235 + GCA003260325_00102 hypothetical protein contig_1 cds 100245 100430 + GCA003260325_00103 hypothetical protein contig_1 cds 101856 102236 + GCA003260325_00104 hypothetical protein contig_1 cds 102182 102349 - GCA003260325_00105 hypothetical protein contig_1 cds 103425 103754 + GCA003260325_00106 hypothetical protein contig_1 cds 104167 104277 - GCA003260325_00107 hypothetical protein contig_1 cds 105138 105248 - GCA003260325_00108 hypothetical protein contig_1 cds 105461 105694 + GCA003260325_00109 hypothetical protein contig_1 cds 106517 106798 + GCA003260325_00110 hypothetical protein contig_1 cds 108519 108860 - GCA003260325_00111 (pseudo) LPXTG cell wall anchor domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MR70, UniRef:UniRef90_A0A660MR70 contig_1 cds 109502 109696 - GCA003260325_00112 Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UX95 contig_1 cds 110193 110414 + GCA003260325_00113 hypothetical protein contig_1 cds 110762 110902 + GCA003260325_00114 hypothetical protein contig_1 cds 113095 113241 - GCA003260325_00115 hypothetical protein contig_1 cds 113246 113494 + GCA003260325_00116 hypothetical protein contig_1 cds 114675 114875 - GCA003260325_00117 Ribonuclease J C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YSA7 contig_1 cds 116541 116645 - GCA003260325_00118 hypothetical protein contig_1 cds 117726 117869 - GCA003260325_00119 hypothetical protein contig_1 cds 118592 118735 - GCA003260325_00120 hypothetical protein contig_1 cds 119793 120086 + GCA003260325_00121 Glycosyltransferase family 4 protein SO:0001217, UniRef:UniRef50_A0A946NQT2 contig_1 cds 120273 120497 + GCA003260325_00122 hypothetical protein contig_1 cds 122260 122421 + GCA003260325_00123 hypothetical protein contig_1 cds 122479 122856 + GCA003260325_00124 hypothetical protein contig_1 cds 122995 123180 + GCA003260325_00125 hypothetical protein contig_1 cds 124344 124487 + GCA003260325_00126 hypothetical protein contig_1 cds 124587 125042 + GCA003260325_00127 hypothetical protein contig_1 cds 125118 125318 + GCA003260325_00128 hypothetical protein contig_1 cds 125424 125555 + GCA003260325_00129 hypothetical protein contig_1 cds 125670 125909 + GCA003260325_00130 hypothetical protein contig_1 cds 128058 128192 - GCA003260325_00131 hypothetical protein contig_1 cds 128267 128545 + GCA003260325_00132 hypothetical protein contig_1 cds 128745 129011 - GCA003260325_00133 hypothetical protein contig_1 cds 129237 129431 - GCA003260325_00134 hypothetical protein contig_1 cds 129462 130019 - GCA003260325_00135 hypothetical protein contig_1 cds 130882 131319 + GCA003260325_00136 hypothetical protein contig_1 cds 137622 137774 - GCA003260325_00137 hypothetical protein contig_1 cds 138450 138716 - GCA003260325_00138 hypothetical protein contig_1 cds 139972 140091 - GCA003260325_00139 hypothetical protein contig_1 cds 140119 140307 - GCA003260325_00140 hypothetical protein PFAM:PF02403.27 contig_1 cds 141007 141279 + GCA003260325_00141 Site-specific integrase SO:0001217, UniRef:UniRef50_A0A944V1I5 contig_1 cds 141613 141804 + GCA003260325_00142 Tyr recombinase domain-containing protein SO:0001217, UniRef:UniRef50_A0A944V252 contig_1 cds 142783 143076 + GCA003260325_00143 hypothetical protein contig_1 cds 143155 143418 + GCA003260325_00144 hypothetical protein contig_1 cds 143512 143805 + GCA003260325_00145 hypothetical protein contig_1 cds 144630 144911 - GCA003260325_00146 hypothetical protein contig_1 cds 145036 145371 + GCA003260325_00147 hypothetical protein contig_1 cds 147081 147395 - GCA003260325_00148 hypothetical protein contig_1 cds 147724 147879 + GCA003260325_00149 hypothetical protein contig_1 cds 152303 152467 + GCA003260325_00150 hypothetical protein PFAM:PF13603.12 contig_1 cds 153939 154205 - GCA003260325_00151 hypothetical protein contig_1 cds 157041 157172 + GCA003260325_00152 hypothetical protein contig_1 cds 157832 158044 - GCA003260325_00153 hypothetical protein contig_1 cds 158744 158905 - GCA003260325_00154 hypothetical protein contig_1 cds 160375 160518 + GCA003260325_00155 Aminoacyl-transfer RNA synthetases class-II family profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D5YG00 contig_1 cds 160699 160938 + GCA003260325_00156 hypothetical protein PFAM:PF00152.25 contig_1 cds 161418 161582 - GCA003260325_00157 hypothetical protein contig_1 cds 161821 161934 - GCA003260325_00158 hypothetical protein contig_1 cds 161944 162138 - GCA003260325_00159 hypothetical protein contig_1 cds 162527 162826 - GCA003260325_00160 hypothetical protein contig_1 cds 163511 163765 - GCA003260325_00161 hypothetical protein contig_1 cds 164174 164536 - GCA003260325_00162 hypothetical protein contig_1 cds 164586 164906 - GCA003260325_00163 hypothetical protein contig_1 cds 165499 165777 - GCA003260325_00164 (pseudo) VanZ-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PHC4, UniRef:UniRef90_A0A328EMD2 contig_1 cds 167790 168059 + GCA003260325_00165 hypothetical protein contig_1 cds 168230 169033 + GCA003260325_00166 Phosphodiester glycosidase domain-containing protein SO:0001217, UniParc:UPI000DC02C4E, UniRef:UniRef100_A0A328EM36, UniRef:UniRef50_A0A2W4KNS0, UniRef:UniRef90_A0A328EM36 contig_1 cds 171519 171671 + GCA003260325_00167 hypothetical protein contig_1 cds 175687 175818 + GCA003260325_00168 Superoxide dismutase [Fe] SO:0001217, UniRef:UniRef50_A0A7D6HSA0 contig_1 cds 176015 176203 - GCA003260325_00169 hypothetical protein contig_1 cds 177412 177771 + GCA003260325_00170 hypothetical protein contig_1 tRNA 178836 178910 - GCA003260325_00171 trnfM tRNA-fMet(cat) SO:0000266 contig_1 tRNA 178977 179051 - GCA003260325_00172 trnE tRNA-Glu(ttc) SO:0000259 contig_1 cds 180041 180283 - GCA003260325_00173 hypothetical protein contig_1 cds 180657 180908 + GCA003260325_00174 hypothetical protein contig_1 cds 180959 181075 - GCA003260325_00175 hypothetical protein contig_1 cds 181519 181836 - GCA003260325_00176 hypothetical protein contig_1 cds 182525 182761 + GCA003260325_00177 (pseudo) Septum formation initiator family protein SO:0001217, UniRef:UniRef50_A0A2U7P998, UniRef:UniRef90_A0A660MY07 contig_1 tRNA 184052 184137 - GCA003260325_00178 trnL tRNA-Leu(taa) SO:0000264 contig_1 cds 185309 185755 - GCA003260325_00179 Elongation factor Tu SO:0001217, UniRef:UniRef50_A0A380FDP6 contig_1 cds 185909 186025 - GCA003260325_00180 (pseudo) Elongation factor Tu SO:0001217, UniRef:UniRef50_A0A7Y1TE04, UniRef:UniRef90_A0A376DN61 contig_1 tRNA 186519 186595 - GCA003260325_00181 trnA tRNA-Ala(tgc) SO:0000254 contig_1 tRNA 186704 186782 - GCA003260325_00182 trnD tRNA-Asp(gtc) SO:0000256 contig_1 cds 187989 188141 + GCA003260325_00183 hypothetical protein contig_1 cds 189300 189458 + GCA003260325_00184 hypothetical protein contig_1 cds 191576 191839 + GCA003260325_00185 hypothetical protein contig_1 cds 193189 193482 - GCA003260325_00186 hypothetical protein contig_1 cds 195044 195199 + GCA003260325_00187 hypothetical protein contig_1 cds 195267 195515 - GCA003260325_00188 hypothetical protein contig_1 cds 195607 195933 - GCA003260325_00189 hypothetical protein contig_1 cds 196949 197173 - GCA003260325_00190 hypothetical protein contig_1 cds 197743 199806 - GCA003260325_00191 (pseudo) SLH domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EM68, UniRef:UniRef90_A0A328EM68 contig_1 cds 200068 200916 - GCA003260325_00192 hypothetical protein PFAM:PF00395.25 contig_1 cds 202823 203149 + GCA003260325_00193 hypothetical protein contig_1 cds 204827 204928 - GCA003260325_00194 hypothetical protein contig_1 cds 204986 205177 - GCA003260325_00195 hypothetical protein contig_1 cds 205205 205339 - GCA003260325_00196 hypothetical protein contig_1 cds 205455 205715 + GCA003260325_00197 hypothetical protein contig_1 cds 205781 205918 - GCA003260325_00198 hypothetical protein contig_1 cds 206015 206152 - GCA003260325_00199 hypothetical protein contig_1 cds 206870 207031 - GCA003260325_00200 hypothetical protein contig_1 cds 207035 207157 - GCA003260325_00201 hypothetical protein contig_1 cds 208494 208691 - GCA003260325_00202 hypothetical protein contig_1 cds 209119 209400 + GCA003260325_00203 hypothetical protein contig_1 cds 209583 209756 - GCA003260325_00204 hypothetical protein contig_1 cds 209900 210295 + GCA003260325_00205 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MX44, UniRef:UniRef90_A0A660MX44 contig_1 cds 212994 213215 - GCA003260325_00206 hypothetical protein contig_1 cds 213484 213687 - GCA003260325_00207 hypothetical protein contig_1 cds 217179 217427 + GCA003260325_00208 hypothetical protein contig_1 cds 218917 219078 + GCA003260325_00209 hypothetical protein contig_1 cds 220145 220300 - GCA003260325_00210 hypothetical protein contig_1 cds 222357 222596 - GCA003260325_00211 hypothetical protein SO:0001217, UniParc:UPI000DBFC9D2, UniRef:UniRef100_A0A660MT75, UniRef:UniRef50_A0A660MT75, UniRef:UniRef90_A0A660MT75 contig_1 cds 222771 222911 - GCA003260325_00212 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2W4IIF6, UniRef:UniRef90_A0A660MQS4 contig_1 cds 223689 224057 - GCA003260325_00213 hypothetical protein contig_1 cds 224274 224408 - GCA003260325_00214 hypothetical protein contig_1 cds 226236 226367 + GCA003260325_00215 hypothetical protein contig_1 cds 227083 227283 + GCA003260325_00216 hypothetical protein contig_1 tRNA 227567 227641 + GCA003260325_00217 trnR tRNA-Arg(cct) SO:0001036 contig_1 cds 228571 228843 - GCA003260325_00218 hypothetical protein contig_1 cds 230524 230634 + GCA003260325_00219 hypothetical protein contig_1 cds 230972 231121 + GCA003260325_00220 hypothetical protein contig_1 cds 231845 232003 + GCA003260325_00221 hypothetical protein contig_1 cds 233008 233790 - GCA003260325_00222 Phosphodiester glycosidase domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EMH7, UniRef:UniRef90_A0A328EMH7 contig_1 cds 234094 234351 - GCA003260325_00223 hypothetical protein contig_1 cds 235070 235240 + GCA003260325_00224 hypothetical protein contig_1 cds 235262 235474 + GCA003260325_00225 hypothetical protein contig_1 cds 235979 236131 - GCA003260325_00226 hypothetical protein contig_1 cds 239359 239472 - GCA003260325_00227 hypothetical protein contig_1 cds 239861 240061 + GCA003260325_00228 hypothetical protein contig_1 cds 240074 240496 + GCA003260325_00229 hypothetical protein contig_1 cds 240906 241046 - GCA003260325_00230 Elongation factor EFG domain-containing protein SO:0001217, UniRef:UniRef50_A0A967F6W0 contig_1 cds 241077 241304 - GCA003260325_00231 hypothetical protein PFAM:PF00679.30, PFAM:PF03764.24 contig_1 cds 241636 241761 + GCA003260325_00232 hypothetical protein contig_1 cds 242106 242219 - GCA003260325_00233 hypothetical protein contig_1 cds 242226 242483 - GCA003260325_00234 hypothetical protein contig_1 cds 242721 242879 - GCA003260325_00235 Tr-type G domain-containing protein SO:0001217, UniRef:UniRef50_A0A168H987 contig_1 cds 243467 243775 + GCA003260325_00236 hypothetical protein contig_1 cds 244524 244883 + GCA003260325_00237 hypothetical protein contig_1 cds 245291 245695 + GCA003260325_00238 hypothetical protein contig_1 cds 250667 250846 + GCA003260325_00239 hypothetical protein contig_1 cds 251113 251406 - GCA003260325_00240 hypothetical protein contig_1 cds 252133 252363 - GCA003260325_00241 hypothetical protein contig_1 cds 252772 252939 + GCA003260325_00242 Heavy metal transport/detoxification protein SO:0001217, UniRef:UniRef50_F0IGB3, UniRef:UniRef90_A0A2U7PDL5 contig_1 cds 253739 253912 + GCA003260325_00243 hypothetical protein contig_1 cds 256111 256257 + GCA003260325_00244 hypothetical protein contig_1 cds 257459 257782 + GCA003260325_00245 Large ribosomal subunit protein uL4 SO:0001217, UniRef:UniRef50_A0A946J6X5 contig_1 cds 257795 257938 + GCA003260325_00246 rplW (pseudo) 50S ribosomal protein L23 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A5P8NC04, UniRef:UniRef90_A0A2U7NYP8 contig_1 cds 258646 258765 + GCA003260325_00247 hypothetical protein PFAM:PF03947.24 contig_1 cds 260729 260938 + GCA003260325_00248 rpmC 50S ribosomal protein L29 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A2G6PMG3, UniRef:UniRef90_A0A328EJ98 contig_1 cds 260969 261124 + GCA003260325_00249 rpsQ (pseudo) 30S ribosomal protein S17 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_O31164, UniRef:UniRef90_A0A2U7PI07 contig_1 cds 261214 261375 - GCA003260325_00250 hypothetical protein contig_1 cds 261597 261746 - GCA003260325_00251 hypothetical protein contig_1 cds 262551 262685 + GCA003260325_00252 (pseudo) Small ribosomal subunit protein uS14 KEGG:K02954, SO:0001217, UniRef:UniRef50_B7J480, UniRef:UniRef90_A0A2U7P9G1 contig_1 cds 262810 262971 + GCA003260325_00253 rpsH (pseudo) 30S ribosomal protein S8 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_A0A2U7PPW1, UniRef:UniRef90_A0A2U7PPW1 contig_1 cds 263962 264129 - GCA003260325_00254 hypothetical protein contig_1 cds 264490 264684 + GCA003260325_00255 rpsE (pseudo) 30S ribosomal protein S5 GO:0003735, GO:0006412, GO:0015935, KEGG:K02988, SO:0001217, UniRef:UniRef50_A0A9E6FD14, UniRef:UniRef90_A0A2U7PE92 contig_1 cds 264891 265061 + GCA003260325_00256 hypothetical protein contig_1 cds 267506 267649 - GCA003260325_00257 hypothetical protein contig_1 cds 267881 267991 - GCA003260325_00258 hypothetical protein contig_1 cds 268028 268228 - GCA003260325_00259 GTP-binding protein SO:0001217, UniRef:UniRef50_UPI003012FC1A contig_1 cds 268672 268890 - GCA003260325_00260 rpsR 30S ribosomal protein S18 GO:0000314, GO:0003735, GO:0006412, GO:0022627, KEGG:K02963, SO:0001217, UniParc:UPI000DBFB22C, UniRef:UniRef100_A0A660MXJ9, UniRef:UniRef50_A0A2G6GI16, UniRef:UniRef90_A0A660MXJ9 contig_1 cds 268971 269066 - GCA003260325_00261 hypothetical protein contig_1 cds 269190 269366 - GCA003260325_00262 (pseudo) Single-stranded DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2G6GBW2, UniRef:UniRef90_A0A660MXU7 contig_1 cds 269549 269680 - GCA003260325_00263 rpsF (pseudo) 30S ribosomal protein S6 GO:0000314, GO:0003735, GO:0006412, GO:0022627, KEGG:K02990, SO:0001217, UniRef:UniRef50_A0A7Y7QIS5, UniRef:UniRef90_A0A328EJ23 contig_1 tRNA 269844 269920 + GCA003260325_00264 trnM tRNA-Met(cat) SO:0000266 contig_1 cds 270840 271001 + GCA003260325_00265 hypothetical protein contig_1 cds 273497 273670 + GCA003260325_00266 hypothetical protein contig_1 cds 273818 273931 + GCA003260325_00267 hypothetical protein contig_1 cds 276203 276352 + GCA003260325_00268 arsR (pseudo) ArsR family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A2U7P3V1, UniRef:UniRef90_A0A660MVS0 contig_1 cds 276545 276904 + GCA003260325_00269 hypothetical protein PFAM:PF03462.23 contig_1 cds 279037 279216 - GCA003260325_00270 hypothetical protein contig_1 cds 279807 280013 + GCA003260325_00271 hypothetical protein contig_1 tRNA 282536 282610 + GCA003260325_00272 trnN tRNA-Asn(gtt) SO:0000257 contig_1 tRNA 282654 282743 + GCA003260325_00273 trnS tRNA-Ser(tga) SO:0000269 contig_1 tRNA 282756 282845 + GCA003260325_00274 trnS tRNA-Ser(gct) SO:0000269 contig_1 tRNA 282949 283024 + GCA003260325_00275 trnI tRNA-Ile2(cat) SO:0000263 contig_2 cds 694 1098 - GCA003260325_00276 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ELH4, UniRef:UniRef90_A0A328ELH4 contig_2 cds 1915 2085 - GCA003260325_00277 hypothetical protein contig_2 cds 2499 2732 + GCA003260325_00278 (pseudo) Type II secretion system protein SO:0001217, UniRef:UniRef50_A0A660MQM3, UniRef:UniRef90_A0A660MQM3 contig_2 cds 2762 2980 - GCA003260325_00279 hypothetical protein contig_2 cds 3246 3518 - GCA003260325_00280 (pseudo) AMMECR1 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PI34, UniRef:UniRef90_A0A660MNX6 contig_2 cds 4959 5177 + GCA003260325_00281 Hydrogenase maturation protease SO:0001217, UniParc:UPI000DBF4A02, UniRef:UniRef100_A0A328EK35, UniRef:UniRef50_A0A328EK35, UniRef:UniRef90_A0A328EK35 contig_2 tRNA 6572 6646 - GCA003260325_00282 trnQ tRNA-Gln(ctg) SO:0000261 contig_2 cds 8467 8640 + GCA003260325_00283 hypothetical protein contig_2 cds 10543 10761 + GCA003260325_00284 hypothetical protein contig_2 cds 12653 12829 + GCA003260325_00285 secA (pseudo) SecA family profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRQ2, UniRef:UniRef90_A0A946NRQ2 contig_2 cds 13907 14098 + GCA003260325_00286 hypothetical protein contig_2 cds 14207 14341 + GCA003260325_00287 secA SecA Wing/Scaffold domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J618 contig_2 cds 14363 14602 + GCA003260325_00288 hypothetical protein contig_2 cds 14685 14831 + GCA003260325_00289 hypothetical protein SO:0001217, UniRef:UniRef50_A0A7Y7UK72 contig_2 cds 14945 15091 + GCA003260325_00290 hypothetical protein contig_2 cds 15328 15528 - GCA003260325_00291 hypothetical protein contig_2 cds 15772 15999 - GCA003260325_00292 hypothetical protein contig_2 cds 17859 18002 - GCA003260325_00293 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NRP6, UniRef:UniRef90_A0A946NRP6 contig_2 cds 19053 19220 - GCA003260325_00294 hypothetical protein SO:0001217, UniRef:UniRef50_A0A351TC04 contig_2 cds 19941 20183 - GCA003260325_00295 hypothetical protein contig_2 cds 20483 21175 + GCA003260325_00296 Peptidase C39-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EK46, UniRef:UniRef90_A0A328EK46 contig_2 cds 22291 22539 - GCA003260325_00297 hypothetical protein PFAM:PF00395.25 contig_2 cds 24156 24374 + GCA003260325_00298 hypothetical protein PFAM:PF00395.25 contig_2 cds 25759 25917 + GCA003260325_00299 hypothetical protein contig_2 cds 26479 26673 - GCA003260325_00300 hypothetical protein contig_2 tRNA 26970 27048 - GCA003260325_00301 tRNA-Xxx contig_2 cds 27257 27424 + GCA003260325_00302 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A5P8NCW7, UniRef:UniRef90_A0A2U7P9L3 contig_2 cds 28594 28719 + GCA003260325_00303 hypothetical protein contig_2 cds 29750 29848 + GCA003260325_00304 hypothetical protein contig_2 cds 32953 33153 + GCA003260325_00305 hypothetical protein contig_2 cds 33320 33451 + GCA003260325_00306 hypothetical protein contig_2 cds 33529 33648 + GCA003260325_00307 hypothetical protein contig_2 cds 33912 34169 - GCA003260325_00308 hypothetical protein contig_2 cds 35693 35815 + GCA003260325_00309 hypothetical protein contig_2 cds 35837 36007 + GCA003260325_00310 hypothetical protein contig_2 cds 37291 37557 + GCA003260325_00311 (pseudo) Guanylate kinase-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PQ09, UniRef:UniRef90_A0A660MYP5 contig_2 cds 37560 37733 + GCA003260325_00312 hypothetical protein contig_2 cds 38227 38730 + GCA003260325_00313 Cardiolipin synthase N-terminal domain-containing protein SO:0001217, UniParc:UPI000DBFEBDD, UniRef:UniRef100_A0A328EIR4, UniRef:UniRef50_A0A2U7PDT7, UniRef:UniRef90_A0A328EIR4 contig_2 cds 38975 39085 - GCA003260325_00314 hypothetical protein contig_2 cds 39420 39695 + GCA003260325_00315 hypothetical protein contig_2 cds 39926 40054 - GCA003260325_00316 hypothetical protein contig_2 cds 41049 41264 - GCA003260325_00317 hypothetical protein contig_2 cds 41903 42613 + GCA003260325_00318 hypothetical protein contig_2 cds 42526 42972 - GCA003260325_00319 hypothetical protein contig_2 cds 43724 43864 + GCA003260325_00320 hypothetical protein PFAM:PF11987.13 contig_2 cds 46085 46225 + GCA003260325_00321 hypothetical protein contig_2 cds 46325 46510 - GCA003260325_00322 hypothetical protein contig_2 cds 46970 47107 + GCA003260325_00323 hypothetical protein contig_2 cds 48253 48489 - GCA003260325_00324 hypothetical protein contig_2 cds 48533 48628 + GCA003260325_00325 hypothetical protein contig_2 cds 48716 48868 + GCA003260325_00326 hypothetical protein contig_2 cds 49097 49423 + GCA003260325_00327 rplQ 50S ribosomal protein L17 GO:0003735, GO:0005840, GO:0006412, KEGG:K02879, SO:0001217, UniRef:UniRef50_A0A2H0I3M5, UniRef:UniRef90_A0A2W4I6C1 contig_2 cds 49486 49641 + GCA003260325_00328 hypothetical protein contig_2 cds 49904 50041 - GCA003260325_00329 hypothetical protein contig_2 cds 50883 51080 + GCA003260325_00330 rpsG (pseudo) 30S ribosomal protein S7 GO:0003735, GO:0006412, GO:0015935, KEGG:K02992, SO:0001217, UniRef:UniRef50_A0A2E5WLQ5, UniRef:UniRef90_A0A2U7P3Z5 contig_2 cds 51108 51311 + GCA003260325_00331 rpsG (pseudo) 30S ribosomal protein S7 GO:0003735, GO:0006412, GO:0015935, KEGG:K02992, SO:0001217, UniRef:UniRef50_A0A2E5WLQ5, UniRef:UniRef90_A0A2U7P3Z5 contig_2 cds 51766 51939 + GCA003260325_00332 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EIF7, UniRef:UniRef90_A0A328EIF7 contig_2 cds 53562 53792 - GCA003260325_00333 hypothetical protein contig_2 cds 55596 55844 + GCA003260325_00334 hypothetical protein contig_2 cds 55841 56041 + GCA003260325_00335 hypothetical protein contig_2 cds 56885 57127 - GCA003260325_00336 hypothetical protein contig_2 cds 59496 59762 - GCA003260325_00337 hypothetical protein contig_2 cds 61017 61175 - GCA003260325_00338 hypothetical protein contig_2 cds 62886 63026 - GCA003260325_00339 hypothetical protein contig_2 cds 63510 63710 - GCA003260325_00340 hypothetical protein contig_2 cds 63940 64098 - GCA003260325_00341 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2W4IQF8, UniRef:UniRef90_A0A660MU05 contig_2 cds 64111 64269 - GCA003260325_00342 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2W4IQF8, UniRef:UniRef90_A0A660MU05 contig_2 cds 64379 64507 + GCA003260325_00343 hypothetical protein contig_2 cds 67478 67657 + GCA003260325_00344 hypothetical protein contig_2 cds 67836 68060 - GCA003260325_00345 hypothetical protein contig_2 cds 68536 68775 - GCA003260325_00346 hypothetical protein PFAM:PF01814.28 contig_2 cds 69785 69949 + GCA003260325_00347 hypothetical protein contig_2 cds 70488 70838 - GCA003260325_00348 hypothetical protein contig_2 cds 72516 72722 + GCA003260325_00349 hypothetical protein contig_2 cds 73412 73615 - GCA003260325_00350 hypothetical protein contig_2 cds 74383 74565 + GCA003260325_00351 hypothetical protein contig_2 cds 74616 74846 - GCA003260325_00352 hypothetical protein contig_2 cds 76808 76957 - GCA003260325_00353 (pseudo) Septum formation initiator family protein SO:0001217, UniRef:UniRef50_A0A660MU63, UniRef:UniRef90_A0A660MS15 contig_2 cds 78021 78140 - GCA003260325_00354 hypothetical protein contig_2 cds 78815 79021 - GCA003260325_00355 hypothetical protein contig_2 cds 79206 79403 - GCA003260325_00356 hypothetical protein SO:0001217, UniParc:UPI000DC04724, UniRef:UniRef100_A0A328EKA6, UniRef:UniRef50_A0A328EKA6, UniRef:UniRef90_A0A328EKA6 contig_2 cds 80233 80613 - GCA003260325_00357 hypothetical protein contig_2 cds 81760 81927 - GCA003260325_00358 hypothetical protein contig_2 cds 81948 82175 - GCA003260325_00359 hypothetical protein contig_2 cds 83519 83695 + GCA003260325_00360 nifU (pseudo) NIF system FeS cluster assembly NifU N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EM82, UniRef:UniRef50_A0A946J4J5, UniRef:UniRef90_A0A328EM82 contig_2 cds 85358 85555 - GCA003260325_00361 hypothetical protein contig_2 cds 87630 87785 - GCA003260325_00362 hypothetical protein PFAM:PF05198.21 contig_2 cds 88013 88261 - GCA003260325_00363 rpsT (pseudo) 30S ribosomal protein S20 GO:0003723, GO:0003735, GO:0005840, GO:0006412, KEGG:K02968, SO:0001217, UniRef:UniRef50_A0A660MSL4, UniRef:UniRef90_A0A660MSL4 contig_2 cds 88768 88932 + GCA003260325_00364 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MUM7, UniRef:UniRef90_A0A660MUM7 contig_2 cds 89034 89243 + GCA003260325_00365 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ELR0, UniRef:UniRef90_A0A328ELR0 contig_2 cds 89854 90090 - GCA003260325_00366 hypothetical protein PFAM:PF03147.19 contig_2 cds 90388 90528 - GCA003260325_00367 hypothetical protein PFAM:PF17759.6 contig_2 cds 91460 91594 + GCA003260325_00368 hypothetical protein contig_2 cds 92260 92577 - GCA003260325_00369 hypothetical protein contig_2 cds 92726 93121 + GCA003260325_00370 hypothetical protein contig_2 cds 94171 94431 - GCA003260325_00371 hypothetical protein contig_2 cds 96361 96570 + GCA003260325_00372 hypothetical protein contig_2 cds 97930 98259 - GCA003260325_00373 hypothetical protein contig_2 cds 99926 100123 + GCA003260325_00374 hypothetical protein contig_2 cds 100443 100634 - GCA003260325_00375 hypothetical protein contig_2 cds 100824 100922 - GCA003260325_00376 hypothetical protein contig_2 cds 101223 101384 - GCA003260325_00377 hypothetical protein contig_2 cds 102347 102616 - GCA003260325_00378 Four helix bundle protein SO:0001217, UniRef:UniRef50_A0A2U7P438, UniRef:UniRef90_A0A328EIM2 contig_2 cds 102776 103057 - GCA003260325_00379 hypothetical protein SO:0001217, UniParc:UPI000DC00F4C, UniRef:UniRef100_A0A328EI65, UniRef:UniRef50_A0A328EI65, UniRef:UniRef90_A0A328EI65 contig_2 cds 103061 103246 + GCA003260325_00380 hypothetical protein contig_2 cds 103317 103478 - GCA003260325_00381 hypothetical protein contig_2 cds 104020 104223 - GCA003260325_00382 hypothetical protein SO:0001217, UniParc:UPI000DBFC89F, UniRef:UniRef100_A0A328EKD0, UniRef:UniRef50_A0A328EKD0, UniRef:UniRef90_A0A328EKD0 contig_2 cds 104335 104556 - GCA003260325_00383 hypothetical protein SO:0001217, UniParc:UPI000DBFB827, UniRef:UniRef100_A0A328EIZ2, UniRef:UniRef50_A0A328EIZ2, UniRef:UniRef90_A0A328EIZ2 contig_2 cds 104705 104815 + GCA003260325_00384 hypothetical protein contig_2 cds 104884 105000 + GCA003260325_00385 hypothetical protein contig_2 cds 105067 105336 + GCA003260325_00386 hypothetical protein PFAM:PF00587.30 contig_2 cds 105349 105483 + GCA003260325_00387 hypothetical protein contig_2 cds 105553 105777 + GCA003260325_00388 hypothetical protein contig_2 cds 105985 106125 + GCA003260325_00389 hypothetical protein contig_2 cds 106942 107262 + GCA003260325_00390 hypothetical protein contig_2 cds 107164 107538 - GCA003260325_00391 hypothetical protein contig_2 cds 108969 109187 + GCA003260325_00392 hypothetical protein contig_2 cds 109269 109445 + GCA003260325_00393 hypothetical protein contig_2 cds 109447 109563 + GCA003260325_00394 hypothetical protein contig_2 cds 109574 109933 + GCA003260325_00395 hypothetical protein contig_2 cds 111347 111490 + GCA003260325_00396 hypothetical protein contig_2 cds 112420 112563 + GCA003260325_00397 hypothetical protein contig_2 cds 112699 112866 + GCA003260325_00398 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J4P6 contig_2 cds 113266 113472 + GCA003260325_00399 hypothetical protein contig_2 cds 114630 114953 + GCA003260325_00400 hypothetical protein SO:0001217, UniParc:UPI000DBF9727, UniRef:UniRef100_A0A328EJ02, UniRef:UniRef50_A0A328EJ02, UniRef:UniRef90_A0A328EJ02 contig_2 cds 118522 118791 - GCA003260325_00401 hypothetical protein contig_2 cds 121027 121197 - GCA003260325_00402 hypothetical protein contig_2 cds 121927 122031 - GCA003260325_00403 hypothetical protein contig_2 cds 122522 122800 + GCA003260325_00404 hypothetical protein contig_2 cds 122775 123062 - GCA003260325_00405 hypothetical protein contig_2 cds 124375 124725 + GCA003260325_00406 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ELU3, UniRef:UniRef90_A0A328ELU3 contig_2 cds 124995 125297 - GCA003260325_00407 hypothetical protein contig_2 cds 125719 125889 + GCA003260325_00408 hypothetical protein contig_2 cds 129189 129485 - GCA003260325_00409 hypothetical protein contig_2 cds 130032 130214 - GCA003260325_00410 hypothetical protein contig_2 cds 131367 131576 + GCA003260325_00411 Glutamate/phenylalanine/leucine/valine/L-tryptophan dehydrogenase C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J4T3 contig_2 cds 131662 131940 - GCA003260325_00412 hypothetical protein contig_2 cds 133089 133235 - GCA003260325_00413 hypothetical protein PFAM:PF00719.24 contig_2 cds 133353 133523 - GCA003260325_00414 hypothetical protein PFAM:PF00719.24 contig_2 cds 133740 133919 - GCA003260325_00415 hypothetical protein contig_2 cds 134008 134334 + GCA003260325_00416 hypothetical protein contig_2 cds 135088 135237 + GCA003260325_00417 hypothetical protein contig_2 cds 136274 136513 + GCA003260325_00418 (pseudo) DUF721 domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MT54, UniRef:UniRef90_A0A660MT54 contig_2 cds 138371 138583 - GCA003260325_00419 hypothetical protein contig_2 cds 138860 139102 - GCA003260325_00420 hypothetical protein contig_2 cds 139967 140107 - GCA003260325_00421 hypothetical protein contig_2 cds 140204 140524 - GCA003260325_00422 hypothetical protein contig_2 cds 141140 141400 - GCA003260325_00423 hypothetical protein contig_2 cds 142258 142518 - GCA003260325_00424 hypothetical protein contig_2 cds 144023 144208 + GCA003260325_00425 hypothetical protein contig_2 cds 145898 146011 + GCA003260325_00426 hypothetical protein contig_2 cds 147220 147426 + GCA003260325_00427 hypothetical protein PFAM:PF09359.15 contig_2 cds 148550 148819 + GCA003260325_00428 hypothetical protein contig_2 cds 149327 149527 + GCA003260325_00429 hypothetical protein contig_3 cds 2503 2700 - GCA003260325_00430 hypothetical protein PFAM:PF04055.27 contig_3 cds 3412 3552 - GCA003260325_00431 MTTase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NS70 contig_3 cds 5210 5422 + GCA003260325_00432 hypothetical protein contig_3 cds 5618 5761 - GCA003260325_00433 hypothetical protein contig_3 cds 5786 6157 - GCA003260325_00434 hypothetical protein PFAM:PF00749.27 contig_3 cds 6580 6846 + GCA003260325_00435 hypothetical protein contig_3 cds 7829 7969 - GCA003260325_00436 hypothetical protein contig_3 cds 8226 8507 + GCA003260325_00437 hypothetical protein contig_3 cds 8682 8903 + GCA003260325_00438 hypothetical protein contig_3 cds 9560 9742 - GCA003260325_00439 hypothetical protein PFAM:PF17803.7, PFAM:PF17963.7 contig_3 cds 17386 17520 - GCA003260325_00440 hypothetical protein contig_3 cds 18491 18763 - GCA003260325_00441 hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EHU6, UniRef:UniRef90_A0A328EHU6 contig_3 cds 19363 19635 - GCA003260325_00442 valine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A944UZG1 contig_3 cds 20427 20723 + GCA003260325_00443 hypothetical protein contig_3 cds 21842 22036 - GCA003260325_00444 (pseudo) DUF6714 domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EJT5, UniRef:UniRef90_A0A328EJT5 contig_3 cds 22256 22360 + GCA003260325_00445 hypothetical protein contig_3 cds 23035 23433 + GCA003260325_00446 hypothetical protein contig_3 cds 24489 24701 + GCA003260325_00447 hypothetical protein contig_3 cds 25460 25780 + GCA003260325_00448 hypothetical protein SO:0001217, UniParc:UPI000DBF41C0, UniRef:UniRef100_A0A328EHT2, UniRef:UniRef50_A0A328EHT2, UniRef:UniRef90_A0A328EHT2 contig_3 cds 28122 28271 + GCA003260325_00449 Putative large conductance mechanosensitive channel protein SO:0001217, UniRef:UniRef50_B7CC35 contig_3 cds 28329 28508 + GCA003260325_00450 mscL (pseudo) large conductance mechanosensitive channel protein MscL GO:0008381, GO:0016020, GO:0034220, KEGG:K03282, SO:0001217, UniRef:UniRef50_B2ID03, UniRef:UniRef90_A0A660MV54 contig_3 cds 29446 29706 + GCA003260325_00451 hypothetical protein contig_3 cds 29976 30152 - GCA003260325_00452 hypothetical protein contig_3 cds 32434 32655 - GCA003260325_00453 hypothetical protein SO:0001217, UniParc:UPI000DBFCF9C, UniRef:UniRef100_A0A328EID1, UniRef:UniRef50_A0A328EID1, UniRef:UniRef90_A0A328EID1 contig_3 cds 32804 33220 - GCA003260325_00454 hypothetical protein SO:0001217, UniParc:UPI000DBFE230, UniRef:UniRef100_A0A328EKZ6, UniRef:UniRef50_A0A328EKZ6, UniRef:UniRef90_A0A328EKZ6 contig_3 cds 33661 33852 - GCA003260325_00455 hypothetical protein PFAM:PF03796.21 contig_3 cds 34441 34584 - GCA003260325_00456 DNA helicase DnaB-like N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NRW1 contig_3 cds 34977 35123 - GCA003260325_00457 hypothetical protein contig_3 cds 35639 35875 - GCA003260325_00458 hypothetical protein contig_3 cds 36380 36583 - GCA003260325_00459 hypothetical protein contig_3 cds 36815 37081 + GCA003260325_00460 hypothetical protein contig_3 cds 37369 37620 - GCA003260325_00461 hypothetical protein contig_3 cds 37669 37818 - GCA003260325_00462 hypothetical protein contig_3 cds 38680 39099 - GCA003260325_00463 hypothetical protein contig_3 cds 40239 40619 + GCA003260325_00464 hypothetical protein contig_3 cds 40538 40936 - GCA003260325_00465 hypothetical protein contig_3 cds 41189 41596 - GCA003260325_00466 hypothetical protein contig_3 cds 42257 42691 - GCA003260325_00467 htpX (pseudo) protease HtpX EC:3.4.24.-, GO:0004222, GO:0006508, SO:0001217, UniRef:UniRef50_A0A2U7P0J3, UniRef:UniRef90_A0A2U7P0J3 contig_3 cds 44286 44591 + GCA003260325_00468 hypothetical protein contig_3 cds 45425 45592 - GCA003260325_00469 hypothetical protein SO:0001217, UniRef:UniRef50_A0A929M2B9, UniRef:UniRef90_A0A929M2B9 contig_3 cds 45664 45828 - GCA003260325_00470 hypothetical protein contig_3 cds 45934 46077 - GCA003260325_00471 hypothetical protein SO:0001217, UniRef:UniRef50_A0A929M220, UniRef:UniRef90_A0A929M220 contig_3 cds 47441 47599 + GCA003260325_00472 hypothetical protein contig_3 cds 47738 47962 - GCA003260325_00473 hypothetical protein contig_3 cds 51156 51722 + GCA003260325_00474 (pseudo) tRNA(Ile)-lysidine synthase EC:6.3.4.19, KEGG:K04075, SO:0001217, UniRef:UniRef50_A0A2U7NXM2, UniRef:UniRef90_A0A2U7NXM2 contig_3 cds 51845 52228 + GCA003260325_00475 hypothetical protein contig_3 cds 54158 54268 + GCA003260325_00476 hypothetical protein contig_3 cds 54972 55139 + GCA003260325_00477 hypothetical protein contig_3 crispr 55885 56243 ? CRISPR array with 6 repeats of length 36, consensus sequence GAATATGATAGTATATTTCTACTTTAATTTGTAGAT and spacer length 26 SO:0001459 contig_3 crispr-repeat 55885 55920 ? CRISPR repeat contig_3 crispr-spacer 55921 55946 ? CRISPR spacer, sequence CCAAAATCTCAGGTTCTTCACAAAGT contig_3 crispr-repeat 55947 55982 ? CRISPR repeat contig_3 crispr-spacer 55983 56009 ? CRISPR spacer, sequence AGTTGCTTCTTTTTTATTATTCTTTAA contig_3 crispr-repeat 56010 56045 ? CRISPR repeat contig_3 crispr-spacer 56046 56073 ? CRISPR spacer, sequence TTTTTCGCTCAATGGAATGAATTAGACT contig_3 crispr-repeat 56074 56109 ? CRISPR repeat contig_3 crispr-spacer 56110 56135 ? CRISPR spacer, sequence AGAAAGTTCAAGATTATCTAGTTTTT contig_3 crispr-repeat 56136 56171 ? CRISPR repeat contig_3 crispr-spacer 56172 56197 ? CRISPR spacer, sequence ATCGTTGTCTCCATAATTGTAATAAA contig_3 crispr-repeat 56198 56233 ? CRISPR repeat contig_3 crispr-spacer 56234 56243 ? CRISPR spacer, sequence TGTACTATTC contig_3 cds 57790 57975 - GCA003260325_00478 hypothetical protein contig_3 cds 59557 59793 - GCA003260325_00479 hypothetical protein contig_3 cds 61150 61311 + GCA003260325_00480 hypothetical protein contig_3 cds 61471 61635 + GCA003260325_00481 hypothetical protein contig_3 crispr 62757 63834 ? CRISPR array with 4 repeats of length 36, consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGAT and spacer length 27 SO:0001459 contig_3 crispr-repeat 62757 62792 ? CRISPR repeat contig_3 crispr-spacer 62793 62821 ? CRISPR spacer, sequence TTATTCATTTTTTTTTAATTTTAATATTT contig_3 crispr-repeat 62822 62857 ? CRISPR repeat contig_3 crispr-spacer 62858 62884 ? CRISPR spacer, sequence TATTTGTTCGCATTATCTTCTTGTGTC contig_3 crispr-repeat 62885 62920 ? CRISPR repeat contig_3 crispr-spacer 62921 62945 ? CRISPR spacer, sequence GGATATATAGAAAAATAATTTTTAA contig_3 crispr-repeat 62946 62981 ? CRISPR repeat contig_3 crispr-spacer 62982 63834 ? CRISPR spacer, sequence AAGGAGTATCAAGTAAACTCATATCAAGTGTTTAAACATAATATCTAATTTCTACTTTTGTAGATCAATAATATTATGAAAGGGAATTATACAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAAGATAGCGTCAAATAATTGTTCTCTCTCGTTTAAACATAATATCTAATTTCTACTTTTGTAGATCTATAGAAATCCAAATTCATAGAAAAAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAACACACACTAAATTACTAAATGCATTTTTTAAACATAATATCTAATTTCTACTTTTGTAGATATACTAATACTTCATATTGGCACACTGTTTAAACATAATATCTAATTTCTACTTTTGTAGATATTGAATTGAATATAAAACTTGAACGGGTTTAAACATAATATCTAATTTCTACTTTTGTAGATTTTTACCCTTGCTATGTATCATTCAACTGTTTAAACATAATATCTAATTTCTACTTTTGTAGATTTTGAGATAAATTCTTGGGTTTTATTTAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAATTATAAAATTAAATTAAAAAAAATGTTTAAACATAATATCTAATTTCTACTTTTGTAGATATTCAAGTTAAATTTCATAATTTTTTAGTTTAAACATAATATCTAATTTCTACTTTTGTAGATGTTTCTATGGAGTACATTTGTTCTCTTGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAATTCTAAAACAATTTCTGCTAAAGATTGTTTAAACATAATATCTAATTTCTACTTTTGTAGATAAATAAAATCTATAAATTCAGCATCAGA contig_3 crispr 63011 63834 ? CRISPR array with 13 repeats of length 36, consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGAT and spacer length 27 SO:0001459 contig_3 crispr-repeat 63011 63046 ? CRISPR repeat contig_3 crispr-spacer 63047 63074 ? CRISPR spacer, sequence CAATAATATTATGAAAGGGAATTATACA contig_3 crispr-repeat 63075 63110 ? CRISPR repeat contig_3 crispr-spacer 63111 63139 ? CRISPR spacer, sequence AAGATAGCGTCAAATAATTGTTCTCTCTC contig_3 crispr-repeat 63140 63175 ? CRISPR repeat contig_3 crispr-spacer 63176 63202 ? CRISPR spacer, sequence CTATAGAAATCCAAATTCATAGAAAAA contig_3 crispr-repeat 63203 63238 ? CRISPR repeat contig_3 crispr-spacer 63239 63265 ? CRISPR spacer, sequence AACACACACTAAATTACTAAATGCATT contig_3 crispr-repeat 63266 63301 ? CRISPR repeat contig_3 crispr-spacer 63302 63327 ? CRISPR spacer, sequence ATACTAATACTTCATATTGGCACACT contig_3 crispr-repeat 63328 63363 ? CRISPR repeat contig_3 crispr-spacer 63364 63390 ? CRISPR spacer, sequence ATTGAATTGAATATAAAACTTGAACGG contig_3 crispr-repeat 63391 63426 ? CRISPR repeat contig_3 crispr-spacer 63427 63454 ? CRISPR spacer, sequence TTTTACCCTTGCTATGTATCATTCAACT contig_3 crispr-repeat 63455 63490 ? CRISPR repeat contig_3 crispr-spacer 63491 63518 ? CRISPR spacer, sequence TTTGAGATAAATTCTTGGGTTTTATTTA contig_3 crispr-repeat 63519 63554 ? CRISPR repeat contig_3 crispr-spacer 63555 63580 ? CRISPR spacer, sequence AATTATAAAATTAAATTAAAAAAAAT contig_3 crispr-repeat 63581 63616 ? CRISPR repeat contig_3 crispr-spacer 63617 63643 ? CRISPR spacer, sequence ATTCAAGTTAAATTTCATAATTTTTTA contig_3 crispr-repeat 63644 63679 ? CRISPR repeat contig_3 crispr-spacer 63680 63706 ? CRISPR spacer, sequence GTTTCTATGGAGTACATTTGTTCTCTT contig_3 crispr-repeat 63707 63742 ? CRISPR repeat contig_3 crispr-spacer 63743 63770 ? CRISPR spacer, sequence AATTCTAAAACAATTTCTGCTAAAGATT contig_3 crispr-repeat 63771 63806 ? CRISPR repeat contig_3 crispr-spacer 63807 63834 ? CRISPR spacer, sequence AAATAAAATCTATAAATTCAGCATCAGA contig_3 cds 63941 64114 + GCA003260325_00482 hypothetical protein SO:0001217, UniRef:UniRef50_A0A929M404 contig_3 cds 66345 66818 + GCA003260325_00483 hypothetical protein contig_3 cds 69399 69788 - GCA003260325_00484 hypothetical protein contig_3 cds 71239 71583 - GCA003260325_00485 hypothetical protein contig_3 cds 71630 71911 + GCA003260325_00486 hypothetical protein contig_3 cds 72404 72535 - GCA003260325_00487 hypothetical protein contig_3 cds 72794 73009 + GCA003260325_00488 hypothetical protein contig_3 cds 73561 73746 - GCA003260325_00489 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A1W9NX22 contig_3 cds 74193 74435 + GCA003260325_00490 hypothetical protein contig_3 cds 75717 75836 - GCA003260325_00491 hypothetical protein contig_3 cds 76998 77117 + GCA003260325_00492 hypothetical protein contig_3 cds 77283 77921 + GCA003260325_00493 (pseudo) SLH domain-containing protein SO:0001217, UniRef:UniRef50_A0A328ELT9, UniRef:UniRef90_A0A328ELT9 contig_3 cds 79284 79442 - GCA003260325_00494 hypothetical protein contig_3 cds 81238 81618 - GCA003260325_00495 grpE (pseudo) Protein GrpE KEGG:K03687, SO:0001217, UniRef:UniRef50_A0A2U7PGB9, UniRef:UniRef90_A0A328EHY8 contig_3 cds 82150 82395 - GCA003260325_00496 hypothetical protein contig_3 cds 83407 83592 + GCA003260325_00497 hypothetical protein contig_3 cds 84101 84337 + GCA003260325_00498 hypothetical protein contig_3 cds 84913 85080 - GCA003260325_00499 hypothetical protein contig_3 cds 85365 85505 + GCA003260325_00500 hypothetical protein contig_3 cds 86769 86933 + GCA003260325_00501 hypothetical protein contig_3 cds 86967 87158 + GCA003260325_00502 hypothetical protein contig_3 cds 88024 88287 - GCA003260325_00503 PRC-barrel domain-containing protein SO:0001217, UniParc:UPI000DBF6887, UniRef:UniRef100_A0A328ELU8, UniRef:UniRef50_A0A328ELU8, UniRef:UniRef90_A0A328ELU8 contig_3 cds 89033 89368 - GCA003260325_00504 hypothetical protein contig_3 cds 89626 89757 + GCA003260325_00505 hypothetical protein PFAM:PF01026.27 contig_3 cds 90671 90850 - GCA003260325_00506 hypothetical protein contig_3 cds 91990 92355 - GCA003260325_00507 (pseudo) histidine kinase SO:0001217, UniRef:UniRef50_A0A2U7P2T0, UniRef:UniRef90_A0A328EIH9 contig_3 cds 93509 93724 + GCA003260325_00508 hypothetical protein contig_3 cds 93806 94018 + GCA003260325_00509 hypothetical protein contig_3 cds 94457 94639 + GCA003260325_00510 hypothetical protein PFAM:PF13687.11 contig_3 cds 94651 94818 - GCA003260325_00511 hypothetical protein contig_3 cds 94809 95033 - GCA003260325_00512 hypothetical protein contig_3 cds 96239 96496 - GCA003260325_00513 hypothetical protein contig_3 cds 96583 96768 + GCA003260325_00514 hypothetical protein contig_3 cds 96858 97109 - GCA003260325_00515 hypothetical protein contig_3 cds 97528 97761 + GCA003260325_00516 hypothetical protein PFAM:PF21082.3 contig_3 cds 98204 98491 + GCA003260325_00517 hypothetical protein contig_3 cds 98743 99060 - GCA003260325_00518 hypothetical protein contig_3 cds 99684 99863 + GCA003260325_00519 hypothetical protein contig_3 cds 100524 100667 - GCA003260325_00520 hypothetical protein contig_3 cds 101099 101287 - GCA003260325_00521 hypothetical protein contig_3 cds 102012 102227 - GCA003260325_00522 hypothetical protein contig_3 cds 102303 102455 - GCA003260325_00523 hypothetical protein contig_3 cds 103493 103756 - GCA003260325_00524 hypothetical protein contig_3 cds 104190 104375 - GCA003260325_00525 (pseudo) DUF4298 domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EK94, UniRef:UniRef90_A0A2U7NXK8 contig_3 cds 104785 104979 - GCA003260325_00526 hypothetical protein contig_3 cds 105732 105932 - GCA003260325_00527 hypothetical protein contig_3 cds 106176 106319 - GCA003260325_00528 hypothetical protein contig_3 cds 107965 108081 - GCA003260325_00529 (pseudo) ClbS/DfsB family four-helix bundle protein SO:0001217, UniRef:UniRef50_A0A328ELE5, UniRef:UniRef90_A0A328ELE5 contig_3 cds 108290 108412 - GCA003260325_00530 hypothetical protein contig_3 cds 108533 108724 - GCA003260325_00531 hypothetical protein contig_3 cds 109230 109493 - GCA003260325_00532 DNA alkylation repair enzyme SO:0001217, UniRef:UniRef50_W3AKC2 contig_3 cds 109497 109790 - GCA003260325_00533 (pseudo) DNA alkylation repair protein SO:0001217, UniRef:UniRef50_A0A1T4Q681, UniRef:UniRef90_A0A328EK14 contig_3 cds 110161 110430 - GCA003260325_00534 (pseudo) Flavodoxin-like fold domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EIK6, UniRef:UniRef90_A0A328EIK6 contig_3 cds 112355 112495 - GCA003260325_00535 hypothetical protein contig_3 cds 112709 112846 - GCA003260325_00536 hypothetical protein contig_3 cds 113388 113711 - GCA003260325_00537 hypothetical protein contig_3 cds 114399 114722 + GCA003260325_00538 (pseudo) SLH domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EI93, UniRef:UniRef90_A0A328EI93 contig_3 cds 115525 115713 - GCA003260325_00539 hypothetical protein contig_3 cds 116590 116742 - GCA003260325_00540 hypothetical protein PFAM:PF09851.14 contig_3 cds 117297 117449 + GCA003260325_00541 hypothetical protein contig_3 cds 117373 117567 - GCA003260325_00542 hypothetical protein PFAM:PF13421.11 contig_3 cds 118466 118612 + GCA003260325_00543 hypothetical protein contig_3 cds 119400 119585 + GCA003260325_00544 hypothetical protein contig_3 cds 120258 120467 + GCA003260325_00545 hypothetical protein contig_3 cds 121245 121481 + GCA003260325_00546 hypothetical protein contig_4 cds 2364 2573 - GCA003260325_00547 hypothetical protein contig_4 cds 3312 3449 - GCA003260325_00548 hypothetical protein contig_4 cds 3446 3553 - GCA003260325_00549 hypothetical protein contig_4 cds 3557 3679 - GCA003260325_00550 hypothetical protein contig_4 cds 4910 5254 + GCA003260325_00551 hypothetical protein contig_4 cds 5480 5653 + GCA003260325_00552 hypothetical protein contig_4 cds 6002 6169 + GCA003260325_00553 hypothetical protein contig_4 cds 6851 7000 - GCA003260325_00554 hypothetical protein contig_4 cds 7209 7385 + GCA003260325_00555 hypothetical protein contig_4 cds 8340 8525 + GCA003260325_00556 hypothetical protein contig_4 cds 9971 10183 - GCA003260325_00557 Class I tRNA ligase family protein SO:0001217, UniRef:UniRef50_A0A944YSQ1 contig_4 cds 10505 10618 - GCA003260325_00558 hypothetical protein contig_4 cds 11050 11346 + GCA003260325_00559 hypothetical protein contig_4 cds 14080 14427 + GCA003260325_00560 hypothetical protein SO:0001217, UniParc:UPI000DBFDC4C, UniRef:UniRef100_A0A328EFF8, UniRef:UniRef50_A0A660MQF6, UniRef:UniRef90_A0A328EFF8 contig_4 cds 14760 15014 + GCA003260325_00561 hypothetical protein contig_4 cds 15070 15222 - GCA003260325_00562 hypothetical protein contig_4 cds 15937 16137 - GCA003260325_00563 hypothetical protein contig_4 cds 16757 16948 + GCA003260325_00564 hypothetical protein contig_4 cds 17002 17196 - GCA003260325_00565 hypothetical protein contig_4 cds 17594 17752 + GCA003260325_00566 hypothetical protein contig_4 cds 18906 19310 + GCA003260325_00567 hypothetical protein contig_4 cds 19422 19580 + GCA003260325_00568 hypothetical protein contig_4 cds 19851 20045 + GCA003260325_00569 hypothetical protein contig_4 cds 20083 20298 - GCA003260325_00570 hypothetical protein contig_4 cds 20751 20939 - GCA003260325_00571 hypothetical protein contig_4 cds 20955 21185 - GCA003260325_00572 hypothetical protein contig_4 cds 21948 22085 - GCA003260325_00573 hypothetical protein contig_4 cds 22273 22374 + GCA003260325_00574 hypothetical protein contig_4 cds 24469 24684 - GCA003260325_00575 Pyruvate kinase SO:0001217, UniRef:UniRef50_A0A920QIF0 contig_4 cds 25031 25192 + GCA003260325_00576 hypothetical protein contig_4 cds 26050 26262 + GCA003260325_00577 hypothetical protein contig_4 cds 27520 27738 + GCA003260325_00578 NAD-dependent DNA ligase adenylation domain-containing protein SO:0001217, UniRef:UniRef50_A0A944V1E7 contig_4 cds 27787 27918 + GCA003260325_00579 hypothetical protein contig_4 cds 28081 28170 + GCA003260325_00580 hypothetical protein PFAM:PF01653.23 contig_4 cds 28866 29147 - GCA003260325_00581 hypothetical protein contig_4 cds 29165 29545 - GCA003260325_00582 hypothetical protein contig_4 cds 31369 31542 + GCA003260325_00583 hypothetical protein contig_4 cds 32845 33147 + GCA003260325_00584 hypothetical protein contig_4 cds 33259 33471 + GCA003260325_00585 hypothetical protein contig_4 cds 34675 34938 + GCA003260325_00586 hypothetical protein contig_4 cds 36098 36235 - GCA003260325_00587 hypothetical protein contig_4 cds 36241 36486 + GCA003260325_00588 hypothetical protein contig_4 cds 36942 37307 - GCA003260325_00589 hypothetical protein contig_4 cds 38341 38463 - GCA003260325_00590 hypothetical protein contig_4 cds 38502 38663 - GCA003260325_00591 hypothetical protein contig_4 tRNA 42502 42578 - GCA003260325_00592 trnR tRNA-Arg(ccg) SO:0001036 contig_4 cds 44291 44482 + GCA003260325_00593 hypothetical protein PFAM:PF00437.27 contig_4 cds 45203 45505 + GCA003260325_00594 hypothetical protein contig_4 cds 45740 45844 - GCA003260325_00595 hypothetical protein PFAM:PF00303.24 contig_4 cds 51465 51683 - GCA003260325_00596 hypothetical protein contig_4 cds 52398 52697 - GCA003260325_00597 hypothetical protein contig_4 cds 52708 53016 + GCA003260325_00598 hypothetical protein contig_4 cds 53133 53375 - GCA003260325_00599 hypothetical protein PFAM:PF00580.27 contig_4 cds 56969 57190 + GCA003260325_00600 hypothetical protein contig_4 cds 59395 59520 - GCA003260325_00601 hypothetical protein PFAM:PF00334.24 contig_4 cds 59608 59730 - GCA003260325_00602 hypothetical protein PFAM:PF00334.24 contig_4 cds 59752 59913 - GCA003260325_00603 hypothetical protein contig_4 cds 60512 60676 - GCA003260325_00604 hypothetical protein contig_4 cds 61303 61419 - GCA003260325_00605 hypothetical protein contig_4 cds 61876 62118 + GCA003260325_00606 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J484 contig_4 cds 63605 63805 - GCA003260325_00607 ftsK FtsK domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J5W8 contig_4 cds 64293 64733 + GCA003260325_00608 hypothetical protein contig_4 cds 65393 65587 - GCA003260325_00609 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EH10, UniRef:UniRef90_A0A328EH10 contig_4 cds 65967 66125 - GCA003260325_00610 hypothetical protein contig_4 cds 66943 67275 + GCA003260325_00611 hypothetical protein contig_4 cds 68196 68369 - GCA003260325_00612 hypothetical protein contig_4 cds 69493 69618 + GCA003260325_00613 hypothetical protein contig_4 cds 70005 70205 + GCA003260325_00614 hypothetical protein contig_4 cds 71095 71247 - GCA003260325_00615 hypothetical protein contig_4 cds 71667 71774 + GCA003260325_00616 hypothetical protein contig_4 cds 72555 72707 + GCA003260325_00617 hypothetical protein contig_4 cds 73149 73391 - GCA003260325_00618 hypothetical protein contig_4 cds 73632 73901 - GCA003260325_00619 hypothetical protein contig_4 cds 76180 76347 - GCA003260325_00620 hypothetical protein contig_4 cds 77657 77842 - GCA003260325_00621 RNase III domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UZ55 contig_4 cds 78023 78409 - GCA003260325_00622 NusB/RsmB/TIM44 domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MSH3, UniRef:UniRef90_A0A328EFM9 contig_4 cds 80027 80185 + GCA003260325_00623 hypothetical protein contig_4 cds 80426 80596 + GCA003260325_00624 hypothetical protein contig_4 cds 81096 81308 + GCA003260325_00625 hypothetical protein contig_4 cds 81561 81908 + GCA003260325_00626 (pseudo) DUF5667 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PGG2, UniRef:UniRef90_A0A660MQY4 contig_4 cds 82161 82316 + GCA003260325_00627 hypothetical protein contig_4 cds 83120 83326 - GCA003260325_00628 hypothetical protein contig_4 cds 84103 84231 + GCA003260325_00629 (pseudo) Band 7 domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UXX7, UniRef:UniRef90_A0A944UXX7 contig_4 cds 84582 84974 + GCA003260325_00630 hypothetical protein contig_4 cds 86309 86437 - GCA003260325_00631 hypothetical protein contig_4 cds 89071 89181 - GCA003260325_00632 hypothetical protein contig_4 cds 90063 90266 + GCA003260325_00633 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NRG8 contig_4 cds 90633 90869 + GCA003260325_00634 hypothetical protein SO:0001217, UniRef:UniRef50_UPI00292A3FAD contig_4 cds 90958 91299 - GCA003260325_00635 hypothetical protein SO:0001217, UniParc:UPI000DC00547, UniRef:UniRef100_A0A328EIY2, UniRef:UniRef50_A0A328EIY2, UniRef:UniRef90_A0A328EIY2 contig_4 cds 91627 91803 + GCA003260325_00636 hypothetical protein contig_4 cds 91740 91907 - GCA003260325_00637 hypothetical protein contig_4 cds 92068 92253 + GCA003260325_00638 hypothetical protein PFAM:PF00437.27 contig_4 cds 92965 93120 + GCA003260325_00639 hypothetical protein contig_4 cds 95844 96104 + GCA003260325_00640 hypothetical protein contig_4 cds 98907 99053 + GCA003260325_00641 hypothetical protein contig_4 cds 99559 99921 + GCA003260325_00642 hypothetical protein contig_4 cds 100177 100365 - GCA003260325_00643 hypothetical protein contig_4 cds 100939 101094 + GCA003260325_00644 hypothetical protein contig_5 cds 530 730 + GCA003260325_00645 hypothetical protein contig_5 cds 706 828 + GCA003260325_00646 (pseudo) Anaerobic ribonucleoside-triphosphate reductase SO:0001217, UniRef:UniRef50_A0A351Y3B0, UniRef:UniRef90_A0A351Y3B0 contig_5 cds 3110 3361 + GCA003260325_00647 nrdR (pseudo) transcriptional regulator NrdR GO:0006355, GO:0008270, GO:0140110, SO:0001217, UniRef:UniRef50_A0A660MNV6, UniRef:UniRef90_A0A660MUG0 contig_5 cds 4145 4402 - GCA003260325_00648 hypothetical protein contig_5 cds 4897 5190 - GCA003260325_00649 hypothetical protein contig_5 cds 5270 5599 - GCA003260325_00650 hypothetical protein contig_5 cds 6918 7097 - GCA003260325_00651 hypothetical protein contig_5 cds 7172 7333 - GCA003260325_00652 hypothetical protein contig_5 cds 7949 8167 + GCA003260325_00653 hypothetical protein contig_5 cds 8140 8232 - GCA003260325_00654 hypothetical protein contig_5 cds 8246 8587 + GCA003260325_00655 hypothetical protein contig_5 cds 8783 8944 + GCA003260325_00656 hypothetical protein contig_5 cds 9373 9537 - GCA003260325_00657 hypothetical protein contig_5 cds 10101 10253 - GCA003260325_00658 hypothetical protein contig_5 cds 10377 10640 - GCA003260325_00659 hypothetical protein contig_5 cds 10812 11129 - GCA003260325_00660 hypothetical protein contig_5 tRNA 12449 12524 - GCA003260325_00661 trnE tRNA-Glu(ctc) SO:0000259 contig_5 cds 12657 12878 - GCA003260325_00662 rplK (pseudo) 50S ribosomal protein L11 GO:0003735, GO:0005840, GO:0006412, KEGG:K02867, SO:0001217, UniRef:UniRef50_A0A7V9K9B0, UniRef:UniRef90_A0A2U7P1R2 contig_5 cds 14055 14351 + GCA003260325_00663 hypothetical protein contig_5 tRNA 16381 16465 - GCA003260325_00664 trnL tRNA-Leu(tag) SO:0000264 contig_5 tRNA 16665 16749 - GCA003260325_00665 trnY tRNA-Tyr(gta) SO:0000272 contig_5 tRNA 16804 16879 - GCA003260325_00666 trnT tRNA-Thr(tgt) SO:0000270 contig_5 cds 18039 18191 + GCA003260325_00667 hypothetical protein contig_5 cds 18910 19116 + GCA003260325_00668 hypothetical protein contig_5 cds 19569 19724 - GCA003260325_00669 hypothetical protein contig_5 cds 19878 20057 - GCA003260325_00670 hypothetical protein contig_5 cds 21314 21586 - GCA003260325_00671 hypothetical protein contig_5 cds 21588 21917 + GCA003260325_00672 hypothetical protein contig_5 cds 22286 22417 - GCA003260325_00673 hypothetical protein contig_5 cds 22701 22808 + GCA003260325_00674 hypothetical protein contig_5 cds 22962 23189 + GCA003260325_00675 hypothetical protein contig_5 cds 23489 23962 - GCA003260325_00676 hypothetical protein contig_5 cds 24175 24495 - GCA003260325_00677 hypothetical protein contig_5 cds 24689 24898 - GCA003260325_00678 hypothetical protein contig_5 cds 25300 25656 + GCA003260325_00679 hypothetical protein contig_5 cds 26187 26369 + GCA003260325_00680 hypothetical protein contig_5 cds 26430 26627 + GCA003260325_00681 hypothetical protein contig_5 cds 26917 27078 - GCA003260325_00682 hypothetical protein contig_5 cds 27192 27467 + GCA003260325_00683 hypothetical protein contig_5 cds 28087 28392 + GCA003260325_00684 hypothetical protein contig_5 cds 28864 29058 + GCA003260325_00685 Type I site-specific restriction-modification system, R (Restriction) subunit domain protein SO:0001217, UniRef:UniRef50_A0AAI8FTQ8 contig_5 cds 30593 30832 + GCA003260325_00686 hypothetical protein contig_5 cds 30836 31027 + GCA003260325_00687 hypothetical protein contig_5 cds 31957 32175 + GCA003260325_00688 hypothetical protein PFAM:PF01420.25 contig_5 cds 32264 32446 + GCA003260325_00689 hypothetical protein contig_5 cds 32392 32673 + GCA003260325_00690 hypothetical protein PFAM:PF01420.25 contig_5 cds 32690 33127 + GCA003260325_00691 hypothetical protein PFAM:PF12161.14 contig_5 cds 33302 33655 + GCA003260325_00692 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A1E5IIP8 contig_5 cds 33905 34102 + GCA003260325_00693 hypothetical protein contig_5 cds 34127 34411 - GCA003260325_00694 hypothetical protein contig_5 cds 34449 34808 + GCA003260325_00695 hypothetical protein contig_5 cds 35267 35506 - GCA003260325_00696 hypothetical protein contig_5 cds 36446 36712 - GCA003260325_00697 hypothetical protein contig_5 cds 37821 38063 + GCA003260325_00698 hypothetical protein contig_5 cds 38618 38788 + GCA003260325_00699 hypothetical protein contig_5 cds 38829 38966 - GCA003260325_00700 hypothetical protein contig_5 cds 39769 40044 + GCA003260325_00701 hypothetical protein contig_5 cds 41708 42031 + GCA003260325_00702 hypothetical protein contig_5 cds 42073 42213 - GCA003260325_00703 hypothetical protein contig_5 cds 47163 47297 - GCA003260325_00704 hypothetical protein contig_5 cds 48337 48651 + GCA003260325_00705 hypothetical protein contig_5 cds 48688 48867 + GCA003260325_00706 hypothetical protein contig_5 cds 49850 50101 + GCA003260325_00707 hypothetical protein PFAM:PF06415.18 contig_5 cds 50345 50458 + GCA003260325_00708 hypothetical protein contig_5 cds 51846 52028 + GCA003260325_00709 hypothetical protein PFAM:PF00113.28 contig_5 cds 52222 52407 - GCA003260325_00710 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MUN5, UniRef:UniRef90_A0A660MUN5 contig_5 cds 53041 53238 + GCA003260325_00711 hypothetical protein contig_5 cds 54039 54176 - GCA003260325_00712 hypothetical protein contig_5 cds 54797 55087 + GCA003260325_00713 hypothetical protein contig_5 cds 55262 55402 + GCA003260325_00714 hypothetical protein contig_5 cds 55573 55704 - GCA003260325_00715 hypothetical protein contig_5 cds 56840 57097 + GCA003260325_00716 hypothetical protein contig_5 cds 58228 58380 - GCA003260325_00717 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MVU5, UniRef:UniRef90_A0A660MVU5 contig_5 cds 58818 59105 - GCA003260325_00718 hypothetical protein contig_5 cds 59208 59435 - GCA003260325_00719 hypothetical protein contig_5 cds 59703 59810 - GCA003260325_00720 hypothetical protein contig_5 cds 60118 60318 - GCA003260325_00721 hypothetical protein contig_5 cds 60561 60854 - GCA003260325_00722 hypothetical protein SO:0001217, UniParc:UPI000DC0077C, UniRef:UniRef100_A0A660MWL4, UniRef:UniRef50_A0A660MWL4, UniRef:UniRef90_A0A660MWL4 contig_5 cds 61475 61621 - GCA003260325_00723 hypothetical protein SO:0001217, UniRef:UniRef50_A0A944YSH4 contig_5 cds 64610 64729 + GCA003260325_00724 hypothetical protein contig_5 cds 65044 65184 + GCA003260325_00725 hypothetical protein contig_5 cds 65773 65967 + GCA003260325_00726 hypothetical protein contig_5 cds 66677 66871 + GCA003260325_00727 hypothetical protein contig_5 cds 67832 67933 + GCA003260325_00728 hypothetical protein contig_5 cds 69077 69211 - GCA003260325_00729 hypothetical protein contig_5 cds 69629 69973 - GCA003260325_00730 VTC domain-containing protein SO:0001217, UniRef:UniRef50_A0A946NQZ7 contig_5 cds 70169 70435 + GCA003260325_00731 hypothetical protein contig_5 cds 70756 70932 - GCA003260325_00732 hypothetical protein contig_5 cds 71777 71971 - GCA003260325_00733 hypothetical protein contig_5 cds 72585 72845 + GCA003260325_00734 hypothetical protein contig_5 cds 73052 73180 - GCA003260325_00735 hypothetical protein contig_5 cds 74582 74743 + GCA003260325_00736 hypothetical protein contig_5 cds 74751 74870 - GCA003260325_00737 hypothetical protein contig_5 cds 75162 75500 - GCA003260325_00738 (pseudo) Methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NY51, UniRef:UniRef90_A0A328EDM1 contig_5 cds 75815 76312 + GCA003260325_00739 (pseudo) Peptidase C39-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A2W4IHQ4, UniRef:UniRef90_A0A328EH11 contig_5 cds 77768 78001 + GCA003260325_00740 hypothetical protein contig_5 cds 79847 79954 - GCA003260325_00741 hypothetical protein contig_5 cds 79982 80275 - GCA003260325_00742 (pseudo) Auto-transporter adhesin head GIN domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MTK2, UniRef:UniRef90_A0A660MTK2 contig_5 cds 80441 80611 + GCA003260325_00743 hypothetical protein contig_5 cds 80791 80970 - GCA003260325_00744 hypothetical protein contig_5 cds 81789 82055 + GCA003260325_00745 (pseudo) t-SNARE coiled-coil-like y domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MU56, UniRef:UniRef90_A0A328EH66 contig_5 cds 82098 82187 + GCA003260325_00746 hypothetical protein contig_5 tRNA 82450 82525 - GCA003260325_00747 trnR tRNA-Arg(gcg) SO:0001036 contig_5 cds 82836 83069 - GCA003260325_00748 hypothetical protein contig_5 cds 85090 85200 - GCA003260325_00749 hypothetical protein contig_5 cds 85465 85680 - GCA003260325_00750 DUF2202 domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YS76 contig_5 cds 87152 87466 + GCA003260325_00751 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7PP80, UniRef:UniRef90_A0A328ECY4 contig_5 cds 87676 88257 + GCA003260325_00752 hypothetical protein contig_5 cds 89854 90024 + GCA003260325_00753 hypothetical protein contig_5 cds 91756 91977 - GCA003260325_00754 hypothetical protein contig_5 cds 93598 93957 - GCA003260325_00755 (pseudo) DUF1993 domain-containing protein KEGG:K09983, SO:0001217, UniRef:UniRef50_A0A328EH21, UniRef:UniRef90_A0A328EH21 contig_5 cds 96015 96152 - GCA003260325_00756 hypothetical protein contig_5 cds 98895 99104 - GCA003260325_00757 (pseudo) Impact N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7PP72, UniRef:UniRef90_A0A328EDP4 contig_6 rRNA 159 1645 - GCA003260325_00758 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_6 cds 2020 2250 - GCA003260325_00759 hypothetical protein contig_6 cds 3293 3841 - GCA003260325_00760 hypothetical protein contig_6 cds 5668 5901 - GCA003260325_00761 hypothetical protein contig_6 cds 6865 7062 + GCA003260325_00762 hypothetical protein contig_6 cds 7147 7278 + GCA003260325_00763 hypothetical protein contig_6 cds 8052 8231 - GCA003260325_00764 hypothetical protein contig_6 cds 8978 9112 - GCA003260325_00765 hypothetical protein contig_6 cds 9109 9261 - GCA003260325_00766 hypothetical protein contig_6 cds 9415 9618 + GCA003260325_00767 hypothetical protein contig_6 cds 10911 11339 - GCA003260325_00768 hypothetical protein contig_6 cds 11810 12343 + GCA003260325_00769 tetR TetR family transcriptional regulator SO:0001217, UniParc:UPI000DBFD255, UniRef:UniRef100_A0A660MRF8, UniRef:UniRef50_A0A0B7H7Q9, UniRef:UniRef90_A0A2U7P813 contig_6 cds 12350 12643 + GCA003260325_00770 hypothetical protein contig_6 cds 12659 13168 + GCA003260325_00771 (pseudo) Serine aminopeptidase S33 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2G6F0X1, UniRef:UniRef90_A0A328EES7 contig_6 cds 13134 13388 - GCA003260325_00772 hypothetical protein contig_6 cds 13483 13764 + GCA003260325_00773 hypothetical protein contig_6 cds 13792 13938 + GCA003260325_00774 hypothetical protein contig_6 cds 14224 14946 + GCA003260325_00775 CAAX protease SO:0001217, UniRef:UniRef50_A0A0B5CIE8, UniRef:UniRef90_A0A2U7PG94 contig_6 cds 15115 15360 + GCA003260325_00776 hypothetical protein contig_6 cds 15595 16098 + GCA003260325_00777 Alpha/beta hydrolase SO:0001217, UniRef:UniRef50_S3B9P8 contig_6 cds 16209 16343 + GCA003260325_00778 hypothetical protein contig_6 cds 16458 16586 + GCA003260325_00779 hypothetical protein contig_6 cds 17336 17461 - GCA003260325_00780 hypothetical protein contig_6 cds 17517 17936 + GCA003260325_00781 hypothetical protein contig_6 cds 18017 18205 - GCA003260325_00782 hypothetical protein contig_6 cds 20067 20324 + GCA003260325_00783 hypothetical protein contig_6 cds 20930 21175 - GCA003260325_00784 AMIN domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7NXI5, UniRef:UniRef90_A0A328ECM1 contig_6 cds 21556 21675 - GCA003260325_00785 hypothetical protein contig_6 cds 21715 21906 + GCA003260325_00786 hypothetical protein contig_6 cds 23318 23506 - GCA003260325_00787 hypothetical protein contig_6 cds 26200 26313 - GCA003260325_00788 hypothetical protein contig_6 cds 26674 26802 - GCA003260325_00789 hypothetical protein contig_6 cds 27222 27326 - GCA003260325_00790 hypothetical protein PFAM:PF09190.17 contig_6 cds 27763 28032 + GCA003260325_00791 hypothetical protein contig_6 cds 28026 28292 - GCA003260325_00792 hypothetical protein PFAM:PF01406.26 contig_6 tRNA 28838 28912 - GCA003260325_00793 trnF tRNA-Phe(gaa) SO:0000267 contig_6 cds 30477 30719 + GCA003260325_00794 hypothetical protein contig_6 cds 31169 31345 - GCA003260325_00795 hypothetical protein contig_6 cds 32668 32868 - GCA003260325_00796 hypothetical protein contig_6 cds 32992 33153 - GCA003260325_00797 hypothetical protein contig_6 cds 33966 34085 - GCA003260325_00798 hypothetical protein contig_6 cds 35607 35744 - GCA003260325_00799 hypothetical protein contig_6 cds 35907 36185 - GCA003260325_00800 hypothetical protein contig_6 cds 36519 36725 - GCA003260325_00801 hypothetical protein contig_6 cds 37097 37315 + GCA003260325_00802 hypothetical protein contig_6 cds 37461 37736 - GCA003260325_00803 hypothetical protein contig_6 cds 38512 38787 + GCA003260325_00804 hypothetical protein contig_6 cds 39446 39751 - GCA003260325_00805 Bifunctional (P)ppGpp synthetase/guanosine-3',5'-bis(Diphosphate) 3'-pyrophosphohydrolase SO:0001217, UniRef:UniRef50_A0A955I3V6 contig_6 cds 39827 39985 - GCA003260325_00806 HD domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D0UUX2 contig_6 cds 41552 41737 + GCA003260325_00807 hypothetical protein contig_6 cds 41656 42123 - GCA003260325_00808 hypothetical protein PFAM:PF02934.20 contig_6 cds 42160 42318 - GCA003260325_00809 hypothetical protein PFAM:PF02934.20 contig_6 cds 42930 43112 + GCA003260325_00810 (pseudo) Ribosomal subunit interface protein SO:0001217, UniRef:UniRef50_A0A5P8NE45, UniRef:UniRef90_A0A328EDD2 contig_6 cds 43498 43863 - GCA003260325_00811 Tetratricopeptide repeat protein SO:0001217, UniParc:UPI000DBFEF0E, UniRef:UniRef100_A0A328EHB2, UniRef:UniRef50_A0A7X5JJF8, UniRef:UniRef90_A0A660MV66 contig_6 cds 44287 44523 + GCA003260325_00812 (pseudo) Histidine triad nucleotide-binding protein SO:0001217, UniRef:UniRef50_A0A2U7NXC5, UniRef:UniRef90_A0A328EGS8 contig_6 cds 46530 46721 + GCA003260325_00813 hypothetical protein contig_6 cds 47244 47474 - GCA003260325_00814 hypothetical protein contig_6 cds 52099 52296 - GCA003260325_00815 hypothetical protein contig_6 cds 52837 53109 - GCA003260325_00816 hypothetical protein contig_6 cds 53909 54175 + GCA003260325_00817 hypothetical protein contig_6 cds 55087 55296 - GCA003260325_00818 hypothetical protein PFAM:PF04997.17, SO:0001217, UniRef:UniRef50_A0A351TBL6 contig_6 cds 55408 55695 - GCA003260325_00819 hypothetical protein contig_6 cds 56332 56517 - GCA003260325_00820 DNA-directed RNA polymerase beta chain SO:0001217, UniRef:UniRef50_A0A916P862 contig_6 sorf 56587 56640 - GCA003260325_00821 rpoB DNA-directed RNA polymerase subunit beta EC:2.7.7.6, GO:0003677, GO:0003899, GO:0006351, KEGG:K03043, SO:0001217, UniParc:UPI001DED393E, UniRef:UniRef100_A0A944UYF8, UniRef:UniRef50_A0A0W0GJ23, UniRef:UniRef90_A0A1J4WTH7 contig_6 cds 57250 57459 - GCA003260325_00822 DNA-directed RNA polymerase SO:0001217, UniRef:UniRef50_A0A944YR34 contig_6 cds 57748 57870 - GCA003260325_00823 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946NQQ6 contig_6 cds 58435 58599 - GCA003260325_00824 DNA-directed RNA polymerase SO:0001217, UniRef:UniRef50_A0A359MZM9, UniRef:UniRef90_A0A946J3X2 contig_6 cds 58742 58927 + GCA003260325_00825 hypothetical protein contig_6 cds 58988 59305 + GCA003260325_00826 hypothetical protein contig_6 cds 59850 60005 - GCA003260325_00827 hypothetical protein contig_6 cds 61324 61584 + GCA003260325_00828 hypothetical protein contig_6 cds 63114 63320 + GCA003260325_00829 hypothetical protein contig_6 cds 63663 63941 + GCA003260325_00830 hypothetical protein contig_6 cds 64246 64410 - GCA003260325_00831 hypothetical protein contig_6 cds 64601 64756 - GCA003260325_00832 hypothetical protein contig_6 cds 65254 65673 + GCA003260325_00833 Integron-associated effector binding protein domain-containing protein SO:0001217, UniParc:UPI000DBF719B, UniRef:UniRef100_A0A328EDG1, UniRef:UniRef50_A0A2U7PNE1, UniRef:UniRef90_A0A328EDG1 contig_6 cds 66223 66369 + GCA003260325_00834 hypothetical protein contig_6 cds 66397 66762 + GCA003260325_00835 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A2U7P2I4, UniRef:UniRef90_A0A328EGY3 contig_6 cds 67208 67393 - GCA003260325_00836 hypothetical protein PFAM:PF02525.22 contig_6 cds 68471 68629 + GCA003260325_00837 hypothetical protein contig_6 cds 71795 71995 - GCA003260325_00838 hypothetical protein contig_6 cds 74033 74209 - GCA003260325_00839 hypothetical protein contig_6 cds 74339 74530 - GCA003260325_00840 hypothetical protein contig_6 cds 75105 75215 + GCA003260325_00841 hypothetical protein contig_6 cds 77003 77332 - GCA003260325_00842 hypothetical protein contig_6 cds 79178 79726 - GCA003260325_00843 (pseudo) Glycosyltransferase subfamily 4-like N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P7R2, UniRef:UniRef90_A0A328EDH0 contig_6 cds 80415 80621 - GCA003260325_00844 glycosyltransferase SO:0001217, UniRef:UniRef50_UPI001E2F4E5E contig_6 cds 82406 82741 - GCA003260325_00845 hypothetical protein contig_6 cds 82790 83080 - GCA003260325_00846 hypothetical protein contig_6 cds 83831 84031 - GCA003260325_00847 hypothetical protein contig_6 cds 84099 84212 - GCA003260325_00848 hypothetical protein contig_6 cds 85713 85823 - GCA003260325_00849 hypothetical protein PFAM:PF12706.13 contig_7 cds 5 502 + GCA003260325_00850 ppk2 (pseudo) polyphosphate kinase 2 EC:2.7.4.1, GO:0006793, GO:0008976, SO:0001217, UniRef:UniRef50_A0A7M1B5E4, UniRef:UniRef90_A0A929M4U3 contig_7 cds 773 1114 + GCA003260325_00851 hypothetical protein PFAM:PF03976.20 contig_7 cds 1725 2117 + GCA003260325_00852 hypothetical protein contig_7 cds 2181 2480 + GCA003260325_00853 hypothetical protein contig_7 cds 2528 2713 - GCA003260325_00854 hypothetical protein contig_7 cds 4376 4768 - GCA003260325_00855 hypothetical protein contig_7 cds 4781 4939 - GCA003260325_00856 hypothetical protein contig_7 cds 6492 6704 - GCA003260325_00857 hypothetical protein contig_7 cds 7571 7711 - GCA003260325_00858 hypothetical protein contig_7 cds 8301 8510 + GCA003260325_00859 hypothetical protein contig_7 cds 8681 8914 - GCA003260325_00860 hypothetical protein contig_7 cds 8945 9190 - GCA003260325_00861 hypothetical protein contig_7 cds 9736 9900 + GCA003260325_00862 hypothetical protein contig_7 cds 10646 10738 - GCA003260325_00863 hypothetical protein contig_7 cds 11589 11732 - GCA003260325_00864 hypothetical protein contig_7 cds 12040 12336 + GCA003260325_00865 hypothetical protein contig_7 cds 12578 12733 - GCA003260325_00866 hypothetical protein PFAM:PF03880.21 contig_7 cds 13373 13675 - GCA003260325_00867 hypothetical protein contig_7 cds 13802 14002 - GCA003260325_00868 hypothetical protein PFAM:PF00270.35 contig_7 cds 14048 14182 - GCA003260325_00869 hypothetical protein contig_7 cds 14972 15097 + GCA003260325_00870 hypothetical protein contig_7 cds 16295 16570 + GCA003260325_00871 hypothetical protein contig_7 cds 16830 17000 - GCA003260325_00872 hypothetical protein contig_7 cds 17820 17942 + GCA003260325_00873 hypothetical protein contig_7 cds 19018 19329 + GCA003260325_00874 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MVH3, UniRef:UniRef90_A0A660MVH3 contig_7 cds 19656 19892 - GCA003260325_00875 hypothetical protein contig_7 cds 20009 20287 + GCA003260325_00876 hypothetical protein contig_7 cds 22874 23023 + GCA003260325_00877 hypothetical protein contig_7 cds 23176 23313 - GCA003260325_00878 hypothetical protein contig_7 cds 23950 24177 - GCA003260325_00879 hypothetical protein contig_7 cds 24248 24505 + GCA003260325_00880 hypothetical protein contig_7 cds 24603 24740 - GCA003260325_00881 gatC (pseudo) Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC GO:0006424, GO:0006450, GO:0030956, GO:0050567, SO:0001217, UniRef:UniRef50_A0A660MW54, UniRef:UniRef90_A0A660MW54 contig_7 cds 25209 25619 - GCA003260325_00882 hypothetical protein contig_7 cds 26947 27141 - GCA003260325_00883 hypothetical protein contig_7 cds 27274 27417 - GCA003260325_00884 hypothetical protein contig_7 cds 27714 27968 - GCA003260325_00885 hypothetical protein contig_7 cds 28003 28227 - GCA003260325_00886 hypothetical protein contig_7 cds 28286 28543 + GCA003260325_00887 hypothetical protein contig_7 cds 29418 29561 + GCA003260325_00888 hypothetical protein contig_7 cds 29608 29874 + GCA003260325_00889 hypothetical protein contig_7 crispr 32172 32651 ? CRISPR array with 8 repeats of length 36, consensus sequence TTTAACAACGTTATAAAATTTATACTTTTGTAGATA and spacer length 26 SO:0001459 contig_7 crispr-repeat 32172 32207 ? CRISPR repeat contig_7 crispr-spacer 32208 32233 ? CRISPR spacer, sequence ACCTGTTCAGGAGATTTTTCCCCCTC contig_7 crispr-repeat 32234 32269 ? CRISPR repeat contig_7 crispr-spacer 32270 32295 ? CRISPR spacer, sequence AAGTATTCCTTCATATTCTTTTGAAT contig_7 crispr-repeat 32296 32331 ? CRISPR repeat contig_7 crispr-spacer 32332 32357 ? CRISPR spacer, sequence ATTTTGTTTTTCAAAAAAAGAAAGAA contig_7 crispr-repeat 32358 32393 ? CRISPR repeat contig_7 crispr-spacer 32394 32419 ? CRISPR spacer, sequence ATAATCAAACTAAATTAGAAAATAAT contig_7 crispr-repeat 32420 32455 ? CRISPR repeat contig_7 crispr-spacer 32456 32481 ? CRISPR spacer, sequence TCAGCCGACTGGTTATAATAATATAA contig_7 crispr-repeat 32482 32517 ? CRISPR repeat contig_7 crispr-spacer 32518 32543 ? CRISPR spacer, sequence AGGTTTTGCTTTTTTTCGTTCCAATG contig_7 crispr-repeat 32544 32579 ? CRISPR repeat contig_7 crispr-spacer 32580 32605 ? CRISPR spacer, sequence GATGATTAGTTTTTATTTATTTGAAG contig_7 crispr-repeat 32606 32641 ? CRISPR repeat contig_7 crispr-spacer 32642 32651 ? CRISPR spacer, sequence ATTTTGTTTT contig_7 crispr 32731 33110 ? CRISPR array with 6 repeats of length 34, consensus sequence TTAACAACGTTATAAAATTTCTACTTTTGTAGAT and spacer length 29 SO:0001459 contig_7 crispr-repeat 32731 32764 ? CRISPR repeat contig_7 crispr-spacer 32765 32794 ? CRISPR spacer, sequence ATAAGTCAAATACTGAAGTTTTTGTCACTT contig_7 crispr-repeat 32795 32828 ? CRISPR repeat contig_7 crispr-spacer 32829 32858 ? CRISPR spacer, sequence ATAGAGGTCACACCGTAACTTCCTGAGATT contig_7 crispr-repeat 32859 32892 ? CRISPR repeat contig_7 crispr-spacer 32893 32920 ? CRISPR spacer, sequence ATCCTGAGGTTTGAGAAATAAAAAATGT contig_7 crispr-repeat 32921 32954 ? CRISPR repeat contig_7 crispr-spacer 32955 32983 ? CRISPR spacer, sequence TATTTTGGTGTTCAATCTTCTTTCCTTAA contig_7 crispr-repeat 32984 33017 ? CRISPR repeat contig_7 crispr-spacer 33018 33047 ? CRISPR spacer, sequence GTAAAAATGGCAGACTAAGCCACAAAAAAA contig_7 crispr-repeat 33048 33081 ? CRISPR repeat contig_7 crispr-spacer 33082 33110 ? CRISPR spacer, sequence TTTCGTTGATCTTTCTTTTTAGGCTCAAT contig_7 tRNA 35008 35081 + GCA003260325_00890 trnC tRNA-Cys(gca) SO:0000258 contig_7 crispr 35263 35834 ? CRISPR array with 9 repeats of length 36, consensus sequence ATTTAACAACTTTATATAATTTCTACTTTTGTAGAT and spacer length 27 SO:0001459 contig_7 crispr-repeat 35263 35298 ? CRISPR repeat contig_7 crispr-spacer 35299 35325 ? CRISPR spacer, sequence GGTTTTAAATATTATTTTTGTTTTTAG contig_7 crispr-repeat 35326 35361 ? CRISPR repeat contig_7 crispr-spacer 35362 35388 ? CRISPR spacer, sequence CCTCCCAAATGGAATCGCAGGCTACAA contig_7 crispr-repeat 35389 35424 ? CRISPR repeat contig_7 crispr-spacer 35425 35453 ? CRISPR spacer, sequence TCTTCCCATCATCAGACAGTAAGATTATC contig_7 crispr-repeat 35454 35489 ? CRISPR repeat contig_7 crispr-spacer 35490 35515 ? CRISPR spacer, sequence AAGAAATTAAATATAACTCTAACAAA contig_7 crispr-repeat 35516 35551 ? CRISPR repeat contig_7 crispr-spacer 35552 35580 ? CRISPR spacer, sequence TCTTATATGTGTATATTATATTCTTTTTT contig_7 crispr-repeat 35581 35616 ? CRISPR repeat contig_7 crispr-spacer 35617 35645 ? CRISPR spacer, sequence AATTCTTCAGTATTATCTTCCTTAAGATT contig_7 crispr-repeat 35646 35681 ? CRISPR repeat contig_7 crispr-spacer 35682 35709 ? CRISPR spacer, sequence GTTTGAAAATTAGAGAAACAAATAAGGT contig_7 crispr-repeat 35710 35745 ? CRISPR repeat contig_7 crispr-spacer 35746 35772 ? CRISPR spacer, sequence TTTGAAGAAATAGTGTGTTTACCTCAC contig_7 crispr-repeat 35773 35808 ? CRISPR repeat contig_7 crispr-spacer 35809 35834 ? CRISPR spacer, sequence ATTCTTGTAGTTCATTATTGTTAATT contig_7 cds 37812 37976 - GCA003260325_00891 hypothetical protein contig_7 tRNA 38422 38497 - GCA003260325_00892 trnP tRNA-Pro(tgg) SO:0000268 contig_7 tRNA 38502 38578 - GCA003260325_00893 trnI tRNA-Ile(gat) SO:0000263 contig_7 tRNA 38664 38740 - GCA003260325_00894 trnG tRNA-Gly(tcc) SO:0000260 contig_7 cds 39390 39581 + GCA003260325_00895 (pseudo) Anti-sigma factor antagonist SO:0001217, UniRef:UniRef50_A0A1J5EYR4, UniRef:UniRef90_A0A660MU34 contig_7 cds 40355 40564 - GCA003260325_00896 hypothetical protein contig_7 cds 41268 41453 - GCA003260325_00897 hypothetical protein contig_7 cds 41604 41714 - GCA003260325_00898 hypothetical protein PFAM:PF00488.27 contig_7 cds 43244 43459 - GCA003260325_00899 hypothetical protein contig_7 cds 43466 43732 - GCA003260325_00900 hypothetical protein contig_7 cds 44186 44359 - GCA003260325_00901 hypothetical protein contig_7 tRNA 45625 45699 - GCA003260325_00902 trnW tRNA-Trp(cca) SO:0000271 contig_7 cds 45887 46063 - GCA003260325_00903 Elongation factor Ts SO:0001217, UniRef:UniRef50_A0A3C1S3Q0 contig_7 cds 46328 46507 - GCA003260325_00904 hypothetical protein PFAM:PF14555.12, PFAM:PF22566.2 contig_7 cds 46660 46815 - GCA003260325_00905 (pseudo) DUF4870 domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MUS6, UniRef:UniRef90_A0A660MXE8 contig_7 cds 46890 47216 - GCA003260325_00906 Small ribosomal subunit protein uS2 SO:0001217, UniRef:UniRef50_A0A929M7B1 contig_7 cds 47226 47423 - GCA003260325_00907 hypothetical protein contig_7 cds 47463 47675 - GCA003260325_00908 hypothetical protein contig_7 cds 48017 48268 - GCA003260325_00909 (pseudo) S1 RNA-binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A944UXZ8, UniRef:UniRef90_A0A944UXZ8 contig_7 cds 48392 48601 - GCA003260325_00910 hypothetical protein contig_7 cds 48653 49018 - GCA003260325_00911 hypothetical protein PFAM:PF00575.29 contig_7 tRNA 49303 49379 - GCA003260325_00912 trnH tRNA-His(gtg) SO:0000262 contig_7 cds 49723 49998 + GCA003260325_00913 hypothetical protein PFAM:PF02518.31 contig_7 cds 50479 50685 + GCA003260325_00914 (pseudo) Response regulatory domain-containing protein SO:0001217, UniRef:UniRef50_A0A2U7P0W4, UniRef:UniRef90_A0A328ED83 contig_7 cds 51596 51697 - GCA003260325_00915 hypothetical protein contig_7 cds 52190 52294 - GCA003260325_00916 hypothetical protein contig_7 cds 53749 54084 - GCA003260325_00917 hypothetical protein contig_7 cds 55901 56371 + GCA003260325_00918 hypothetical protein contig_7 cds 56281 56505 - GCA003260325_00919 hypothetical protein PFAM:PF00398.26 contig_7 cds 56970 57089 - GCA003260325_00920 hypothetical protein contig_7 cds 58004 58135 - GCA003260325_00921 hypothetical protein contig_7 cds 58245 58406 - GCA003260325_00922 hypothetical protein contig_7 cds 58696 58920 + GCA003260325_00923 hypothetical protein contig_7 cds 59807 59992 - GCA003260325_00924 hypothetical protein contig_7 cds 60286 60534 + GCA003260325_00925 hypothetical protein contig_7 cds 64168 64293 - GCA003260325_00926 hypothetical protein contig_7 cds 65490 65621 + GCA003260325_00927 hypothetical protein contig_7 cds 66078 66500 + GCA003260325_00928 hypothetical protein PFAM:PF13428.12 contig_7 cds 66514 66816 - GCA003260325_00929 hypothetical protein contig_7 cds 66884 67186 + GCA003260325_00930 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328EGN1, UniRef:UniRef90_A0A328EGN1 contig_8 cds 717 1307 - GCA003260325_00931 hypothetical protein contig_8 cds 1672 1779 + GCA003260325_00932 hypothetical protein contig_8 cds 3374 3613 - GCA003260325_00933 hypothetical protein contig_8 cds 4327 4470 + GCA003260325_00934 hypothetical protein contig_8 cds 4483 4686 + GCA003260325_00935 (pseudo) DUF304 domain-containing protein SO:0001217, UniRef:UniRef50_A0A7W4E8K9, UniRef:UniRef90_A0A328ECJ0 contig_8 cds 5164 5430 + GCA003260325_00936 hypothetical protein contig_8 cds 5524 5709 + GCA003260325_00937 hypothetical protein contig_8 cds 5737 5949 + GCA003260325_00938 hypothetical protein contig_8 cds 6567 6779 - GCA003260325_00939 hypothetical protein contig_8 cds 7033 7239 + GCA003260325_00940 hypothetical protein contig_8 cds 7988 8233 + GCA003260325_00941 hypothetical protein PFAM:PF03054.22 contig_8 cds 10546 10839 + GCA003260325_00942 hypothetical protein SO:0001217, UniParc:UPI000DBF6B4C, UniRef:UniRef100_A0A328EDZ2, UniRef:UniRef50_A0A328EDZ2, UniRef:UniRef90_A0A660MRQ1 contig_8 cds 10868 11128 + GCA003260325_00943 hypothetical protein SO:0001217, UniParc:UPI000DC0481B, UniRef:UniRef100_A0A660MR12, UniRef:UniRef50_A0A2U7P1T6, UniRef:UniRef90_A0A660MR12 contig_8 cds 12922 13212 - GCA003260325_00944 hypothetical protein SO:0001217, UniRef:UniRef50_UPI002605D23B, UniRef:UniRef90_UPI002605D23B contig_8 cds 13458 13667 + GCA003260325_00945 secE preprotein translocase subunit SecE GO:0005886, GO:0009306, GO:0015450, GO:0043952, RefSeq:WP_366112449.1, SO:0001217, UniParc:UPI000DC01274, UniRef:UniRef100_A0A660MP65, UniRef:UniRef50_A0A660MP65, UniRef:UniRef90_A0A660MP65 contig_8 cds 14233 14388 + GCA003260325_00946 hypothetical protein contig_8 cds 14551 14760 + GCA003260325_00947 hypothetical protein contig_8 cds 16721 16885 + GCA003260325_00948 hypothetical protein contig_8 cds 16925 17122 + GCA003260325_00949 hypothetical protein contig_8 cds 18028 18312 + GCA003260325_00950 hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ECK7, UniRef:UniRef90_A0A328ECK7 contig_8 tRNA 19363 19438 + GCA003260325_00951 trnQ tRNA-Gln(ttg) SO:0000261 contig_8 cds 19801 19980 + GCA003260325_00952 ftsL Cell division protein FtsL SO:0001217, UniRef:UniRef50_A0A660MV06, UniRef:UniRef90_A0A660MV06 contig_8 cds 20381 20767 - GCA003260325_00953 hypothetical protein contig_8 cds 22176 22400 - GCA003260325_00954 hypothetical protein contig_8 cds 23921 24109 - GCA003260325_00955 hypothetical protein contig_8 cds 25762 25947 - GCA003260325_00956 hypothetical protein contig_8 cds 26641 26796 + GCA003260325_00957 hypothetical protein contig_8 cds 27111 27374 - GCA003260325_00958 hypothetical protein contig_8 cds 28103 28201 - GCA003260325_00959 hypothetical protein contig_8 cds 28355 28540 - GCA003260325_00960 hypothetical protein contig_8 cds 29095 29382 + GCA003260325_00961 hypothetical protein contig_8 cds 29443 29589 + GCA003260325_00962 hypothetical protein contig_8 tRNA 30010 30095 - GCA003260325_00963 trnL tRNA-Leu(caa) SO:0000264 contig_8 cds 30940 31179 - GCA003260325_00964 hypothetical protein contig_8 cds 31889 32011 + GCA003260325_00965 hypothetical protein contig_8 cds 32720 32911 + GCA003260325_00966 hypothetical protein contig_8 cds 33151 33516 - GCA003260325_00967 hypothetical protein contig_8 cds 34831 34986 + GCA003260325_00968 hypothetical protein contig_8 cds 35071 35277 + GCA003260325_00969 hypothetical protein contig_8 cds 35271 35489 - GCA003260325_00970 hypothetical protein contig_8 cds 37094 37267 + GCA003260325_00971 hypothetical protein contig_8 cds 37450 37599 - GCA003260325_00972 hypothetical protein contig_8 cds 39010 39132 + GCA003260325_00973 Aminoacyl-tRNA synthetase class II (G/ P/ S/T) domain-containing protein SO:0001217, UniRef:UniRef50_A0A944V1H5, UniRef:UniRef90_A0A944V1H5 contig_8 cds 41462 41869 + GCA003260325_00974 (pseudo) Polyphosphate kinase-2-related domain-containing protein SO:0001217, UniRef:UniRef50_A0A660MTT9, UniRef:UniRef90_A0A2U7PA33 contig_8 cds 43430 43639 + GCA003260325_00975 hypothetical protein contig_8 cds 44742 44966 + GCA003260325_00976 Aldehyde dehydrogenase family protein SO:0001217, UniRef:UniRef50_A0A946J5D3 contig_8 cds 45871 46077 - GCA003260325_00977 hypothetical protein contig_8 cds 47856 48038 + GCA003260325_00978 hypothetical protein contig_8 cds 50591 50722 + GCA003260325_00979 hypothetical protein contig_8 cds 51359 51670 + GCA003260325_00980 (pseudo) L-threonylcarbamoyladenylate synthase SO:0001217, UniRef:UniRef50_A0A2U7PA42, UniRef:UniRef90_A0A660MT35 contig_8 cds 51715 51978 - GCA003260325_00981 hypothetical protein contig_8 cds 52191 52391 + GCA003260325_00982 hypothetical protein contig_8 cds 52739 52849 + GCA003260325_00983 hypothetical protein contig_9 cds 235 333 + GCA003260325_00984 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A328ECK9, UniRef:UniRef90_A0A328ECK9 contig_9 cds 662 967 + GCA003260325_00985 hypothetical protein contig_9 cds 1661 1921 + GCA003260325_00986 hypothetical protein contig_9 cds 3372 3815 + GCA003260325_00987 hypothetical protein contig_9 cds 4190 4408 - GCA003260325_00988 DNA polymerase III gamma subunit domain-containing protein SO:0001217, UniRef:UniRef50_A0A351TA52 contig_9 cds 5824 6660 + GCA003260325_00989 Phosphodiester glycosidase domain-containing protein SO:0001217, UniParc:UPI000DBF8B6E, UniRef:UniRef100_A0A328EFD0, UniRef:UniRef50_A0A328EFD0, UniRef:UniRef90_A0A328EFD0 contig_9 cds 9166 9426 + GCA003260325_00990 hypothetical protein contig_9 cds 9839 10219 - GCA003260325_00991 hypothetical protein contig_9 cds 10426 10704 + GCA003260325_00992 Auto-transporter adhesin head GIN domain-containing protein SO:0001217, UniRef:UniRef50_A0A328EAS2, UniRef:UniRef90_A0A328EAS2 contig_9 cds 10837 11133 + GCA003260325_00993 hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MTR6 contig_9 cds 11812 12123 + GCA003260325_00994 Bypass of forespore C C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A929M2G0, UniRef:UniRef90_A0A328EAQ2 contig_9 cds 13242 13439 - GCA003260325_00995 hypothetical protein contig_9 cds 13455 13652 - GCA003260325_00996 hypothetical protein contig_9 ncRNA 13866 14278 + GCA003260325_00997 RNaseP_bact_a Bacterial RNase P class A RFAM:RF00010, SO:0000386 contig_9 cds 14003 14272 - GCA003260325_00998 hypothetical protein contig_9 cds 16604 16807 - GCA003260325_00999 hypothetical protein contig_9 cds 17075 17335 - GCA003260325_01000 hypothetical protein contig_9 cds 18158 18265 - GCA003260325_01001 hypothetical protein contig_9 cds 18299 18655 - GCA003260325_01002 hypothetical protein contig_9 cds 18785 18901 - GCA003260325_01003 hypothetical protein contig_9 cds 19169 19318 - GCA003260325_01004 hypothetical protein contig_9 cds 19729 19947 - GCA003260325_01005 hypothetical protein PFAM:PF00881.29 contig_9 cds 20567 20710 - GCA003260325_01006 hypothetical protein contig_9 cds 20990 21349 + GCA003260325_01007 hypothetical protein contig_9 cds 21346 21489 + GCA003260325_01008 hypothetical protein contig_9 cds 22254 22502 + GCA003260325_01009 hypothetical protein SO:0001217, UniParc:UPI000DBFFF23, UniRef:UniRef100_A0A328EAR1, UniRef:UniRef50_A0A328EAR1, UniRef:UniRef90_A0A328EAR1 contig_9 cds 23466 23666 - GCA003260325_01010 hypothetical protein SO:0001217, UniRef:UniRef50_A0A946J615 contig_9 cds 23688 23885 - GCA003260325_01011 hypothetical protein PFAM:PF04055.27 contig_10 cds 129 494 + GCA003260325_01012 hypothetical protein contig_10 cds 1568 1699 - GCA003260325_01013 hypothetical protein contig_10 cds 2562 2732 + GCA003260325_01014 hypothetical protein contig_10 tRNA 5046 5121 + GCA003260325_01015 trnK tRNA-Lys(ctt) SO:0000265 contig_10 cds 5789 6001 + GCA003260325_01016 hypothetical protein contig_10 cds 6880 7014 - GCA003260325_01017 hypothetical protein contig_10 cds 7318 7503 - GCA003260325_01018 hypothetical protein contig_10 cds 7513 7701 - GCA003260325_01019 hypothetical protein contig_10 cds 7806 8054 + GCA003260325_01020 hypothetical protein contig_10 cds 9639 9833 + GCA003260325_01021 hypothetical protein contig_10 cds 11870 12253 - GCA003260325_01022 ClpA/ClpB AAA lid domain-containing protein SO:0001217, UniRef:UniRef50_A0A359N2S8 contig_10 cds 14521 14778 - GCA003260325_01023 (pseudo) Peroxiredoxin EC:1.11.1.26, KEGG:K24119, SO:0001217, UniRef:UniRef50_A0A328EBA6, UniRef:UniRef90_A0A2W4IUV7 contig_10 cds 14791 14943 - GCA003260325_01024 hypothetical protein contig_11 cds 25 414 + GCA003260325_01025 hypothetical protein contig_11 cds 1579 1836 + GCA003260325_01026 hypothetical protein contig_11 cds 1964 2179 + GCA003260325_01027 hypothetical protein contig_11 cds 2718 2969 - GCA003260325_01028 hypothetical protein PFAM:PF00560.39, PFAM:PF12799.13, PFAM:PF13855.12 contig_11 cds 5081 5281 - GCA003260325_01029 hypothetical protein contig_11 cds 7222 7329 + GCA003260325_01030 hypothetical protein contig_11 cds 7810 8118 - GCA003260325_01031 hypothetical protein contig_11 cds 8575 8796 + GCA003260325_01032 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A0A660MT73, UniRef:UniRef90_A0A660MT73 contig_11 cds 8827 9048 - GCA003260325_01033 hypothetical protein contig_11 cds 9265 9471 - GCA003260325_01034 traM TraM recognition domain-containing protein SO:0001217, UniRef:UniRef50_A0A944YQS2, UniRef:UniRef90_A0A944YQS2 contig_11 cds 11837 11989 + GCA003260325_01035 hypothetical protein contig_11 cds 12182 12400 + GCA003260325_01036 hypothetical protein contig_11 cds 12624 12776 + GCA003260325_01037 hypothetical protein contig_11 cds 13494 13664 - GCA003260325_01038 hypothetical protein contig_11 cds 14010 14198 - GCA003260325_01039 hypothetical protein PFAM:PF01595.25 contig_11 cds 15224 15400 + GCA003260325_01040 hypothetical protein contig_11 cds 15442 15648 - GCA003260325_01041 hypothetical protein contig_11 cds 16637 16816 + GCA003260325_01042 hypothetical protein contig_11 cds 17506 17661 + GCA003260325_01043 hypothetical protein contig_11 cds 17783 18100 - GCA003260325_01044 hypothetical protein contig_11 cds 18648 18761 + GCA003260325_01045 hypothetical protein contig_11 cds 18722 18838 - GCA003260325_01046 hypothetical protein contig_11 cds 18988 19158 - GCA003260325_01047 hypothetical protein contig_11 cds 19896 20255 + GCA003260325_01048 hypothetical protein contig_11 cds 23272 23538 - GCA003260325_01049 hypothetical protein contig_11 cds 23893 24012 - GCA003260325_01050 hypothetical protein contig_11 cds 24106 24246 - GCA003260325_01051 traG (pseudo) TraG P-loop domain-containing protein SO:0001217, UniRef:UniRef50_A0A946J4M1, UniRef:UniRef90_A0A946J4M1 contig_11 cds 25147 25452 - GCA003260325_01052 hypothetical protein contig_11 cds 27289 27723 - GCA003260325_01053 hypothetical protein contig_11 cds 27871 28347 - GCA003260325_01054 hypothetical protein contig_11 cds 28675 28830 - GCA003260325_01055 hypothetical protein contig_11 cds 30384 30611 - GCA003260325_01056 hypothetical protein contig_11 cds 31446 31730 - GCA003260325_01057 hypothetical protein contig_11 cds 31935 32129 - GCA003260325_01058 ruvX (pseudo) Holliday junction resolvase RuvX EC:3.1.21.10, GO:0006364, SO:0001217, UniRef:UniRef50_A0A5P8NEP0, UniRef:UniRef90_A0A660MUJ9 contig_11 cds 32420 32557 - GCA003260325_01059 hypothetical protein contig_11 cds 32983 33288 + GCA003260325_01060 hypothetical protein contig_11 cds 35534 35902 + GCA003260325_01061 hypothetical protein contig_11 cds 36125 36286 + GCA003260325_01062 hypothetical protein contig_11 cds 36705 37010 + GCA003260325_01063 hypothetical protein PFAM:PF00712.24 contig_11 cds 37838 37993 + GCA003260325_01064 Tetratricopeptide repeat protein SO:0001217, UniRef:UniRef50_A0A946J5V3 contig_11 cds 38182 38418 - GCA003260325_01065 hypothetical protein