# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_1 cds 247 441 + GCA009771085_00001 hypothetical protein contig_1 cds 679 2187 - GCA009771085_00002 ABC transporter ATP-binding protein/permease SO:0001217, UniRef:UniRef50_Q8DP90 contig_2 cds 358 1146 + GCA009771085_00003 Uridine phosphorylase SO:0001217, UniRef:UniRef50_O83990 contig_2 cds 1226 2266 + GCA009771085_00004 ABC transporter substrate-binding protein PnrA-like domain-containing protein SO:0001217, UniRef:UniRef50_F3B0Z1 contig_2 cds 2380 3927 + GCA009771085_00005 yjjI Glycine radical enzyme, YjjI family SO:0001217, UniRef:UniRef50_C6PX87 contig_2 cds 3924 4760 + GCA009771085_00006 Pyruvate formate-lyase 1-activating enzyme SO:0001217, UniRef:UniRef50_A0A1C6EZS9 contig_2 cds 4784 6331 + GCA009771085_00007 ABC transporter, ATP-binding protein SO:0001217, UniRef:UniRef50_C2KXY1 contig_2 cds 6321 7415 + GCA009771085_00008 ABC transporter permease SO:0001217, UniRef:UniRef50_F3B0Y7 contig_2 cds 7415 8356 + GCA009771085_00009 ABC transporter permease SO:0001217, UniRef:UniRef50_G1WIQ6 contig_2 cds 8445 8876 + GCA009771085_00010 Cytidine deaminase SO:0001217, UniRef:UniRef50_A0A2N2A4G2 contig_2 cds 8879 9514 + GCA009771085_00011 Deoxyribose-phosphate aldolase SO:0001217, UniRef:UniRef50_Q8DU34 contig_2 cds 9525 10289 + GCA009771085_00012 Crp/Fnr family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A6N7J0J5 contig_2 cds 10310 11131 + GCA009771085_00013 Purine nucleoside phosphorylase SO:0001217, UniRef:UniRef50_I3EA52 contig_2 cds 11135 12346 + GCA009771085_00014 hflX GTPase HflX SO:0001217, UniRef:UniRef50_D9R4W7 contig_2 ncRNA-region 12401 12476 + Fluoride riboswitch aptamer (crcB RNA motif) RFAM:RF01734, SO:0000035 contig_2 cds 12569 13753 + GCA009771085_00015 Cation/H+ exchanger transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_C4Z4J1 contig_2 cds 13835 14710 + GCA009771085_00016 DUF2179 domain-containing protein SO:0001217, UniRef:UniRef50_E0RVA2 contig_2 cds 14701 16044 - GCA009771085_00017 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A380LMJ1 contig_2 cds 16231 17067 + GCA009771085_00018 DNA-(apurinic or apyrimidinic site) lyase SO:0001217, UniRef:UniRef50_E0RZY2 contig_2 cds 17064 17453 + GCA009771085_00019 hypothetical protein PFAM:PF08984.16 contig_2 cds 17520 19202 - GCA009771085_00020 Phosphoglucomutase SO:0001217, UniRef:UniRef50_A0A174DTK3 contig_2 cds 19367 19963 + GCA009771085_00021 5'-deoxynucleotidase SO:0001217, UniRef:UniRef50_A0A7C6WJQ8 contig_2 cds 19998 20753 - GCA009771085_00022 Exodeoxyribonuclease III Xth SO:0001217, UniRef:UniRef50_F4GLK3 contig_2 cds 20800 22089 - GCA009771085_00023 hypothetical protein PFAM:PF07973.19 contig_2 cds 22239 22742 + GCA009771085_00024 N-acetyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_R9L7Q4 contig_2 cds 22788 23567 + GCA009771085_00025 33 kDa chaperonin SO:0001217, UniRef:UniRef50_A9KTE0 contig_2 cds 23630 23818 + GCA009771085_00026 Resolvase/invertase-type recombinase catalytic domain-containing protein SO:0001217, UniRef:UniRef50_A0A174BZT4 contig_2 cds 23828 24550 + GCA009771085_00027 (pseudo) recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_V9HQ21, UniRef:UniRef90_UPI0028EA78ED contig_2 cds 24795 25034 + GCA009771085_00028 DNA-binding helix-turn-helix protein SO:0001217, UniRef:UniRef50_V1D7W0 contig_2 cds 25169 25786 + GCA009771085_00029 hypothetical protein SO:0001217, UniRef:UniRef50_J5GI44, UniRef:UniRef90_J5GI44 contig_2 cds 25800 25964 + GCA009771085_00030 hypothetical protein SO:0001217, UniRef:UniRef50_UPI0012EAAB44 contig_2 cds 26541 26819 + GCA009771085_00031 hypothetical protein contig_2 cds 26822 26959 + GCA009771085_00032 hypothetical protein contig_2 cds 27089 27298 + GCA009771085_00033 hypothetical protein contig_2 cds 27499 27825 + GCA009771085_00034 hypothetical protein contig_2 cds 28204 28860 - GCA009771085_00035 Transposase SO:0001217, UniRef:UniRef50_F7UXD0 contig_2 cds 29340 30425 - GCA009771085_00036 hypothetical protein PFAM:PF13472.12 contig_2 cds 30440 31870 - GCA009771085_00037 MBOAT family protein SO:0001217, UniRef:UniRef50_R9N0A5 contig_2 cds 32058 32330 + GCA009771085_00038 Negative regulator of flagellin synthesis SO:0001217, UniRef:UniRef50_A0A3R6CCY0 contig_2 cds 32349 32861 + GCA009771085_00039 hypothetical protein contig_2 cds 32940 34676 + GCA009771085_00040 Flagellar hook-associated protein 1 SO:0001217, UniRef:UniRef50_A0A1C5VAE3 contig_2 cds 34695 36545 + GCA009771085_00041 Flagellar hook-associated protein 1 SO:0001217, UniRef:UniRef50_A0A1H6SNL3 contig_2 cds 36610 38226 + GCA009771085_00042 hypothetical protein contig_2 cds 38279 38743 + GCA009771085_00043 fliW Flagellar assembly factor FliW SO:0001217, UniRef:UniRef50_G2SZK0 contig_2 cds 38745 38969 + GCA009771085_00044 csrA Translational regulator CsrA SO:0001217, UniRef:UniRef50_B8I4D3 contig_2 cds 39261 39677 + GCA009771085_00045 flaG Flagellar biosynthesis protein FlaG SO:0001217, UniRef:UniRef50_A0A7U9XEF7 contig_2 cds 39689 41284 + GCA009771085_00046 hypothetical protein contig_2 cds 41329 41718 + GCA009771085_00047 fliS Flagellar secretion chaperone FliS SO:0001217, UniRef:UniRef50_A0A7U9XP08 contig_2 cds 41746 42225 + GCA009771085_00048 hypothetical protein contig_2 cds 42497 43816 + GCA009771085_00049 hypothetical protein contig_2 cds 44146 44346 + GCA009771085_00050 hypothetical protein contig_2 cds 44359 44871 + GCA009771085_00051 nusG Transcription termination/antitermination protein NusG SO:0001217, UniRef:UniRef50_A0A9D9HZS6 contig_2 cds 44888 45313 + GCA009771085_00052 Large ribosomal subunit protein uL11 SO:0001217, UniRef:UniRef50_P62432 contig_2 cds 45388 46089 + GCA009771085_00053 Large ribosomal subunit protein uL1 SO:0001217, UniRef:UniRef50_P29393 contig_2 ncRNA-region 46125 46255 + Ribosomal protein L10 leader RFAM:RF00557, SO:0000140 contig_2 cds 46269 46781 + GCA009771085_00054 Large ribosomal subunit protein uL10 SO:0001217, UniRef:UniRef50_A0A223B3A6 contig_2 cds 46875 47252 + GCA009771085_00055 Large ribosomal subunit protein bL12 SO:0001217, UniRef:UniRef50_A0A1G2DEI7 contig_2 cds 47471 51409 + GCA009771085_00056 DNA-directed RNA polymerase subunit beta SO:0001217, UniRef:UniRef50_A0PXT8 contig_2 cds 51426 55214 + GCA009771085_00057 DNA-directed RNA polymerase subunit beta' SO:0001217, UniRef:UniRef50_F3B5T4 contig_2 cds 55558 56820 + GCA009771085_00058 Maltooligosaccharide ABC transporter solute-binding lipoprotein SO:0001217, UniRef:UniRef50_P59213 contig_2 cds 57020 58360 + GCA009771085_00059 Maltooligosaccharide ABC transporter solute-binding lipoprotein SO:0001217, UniRef:UniRef50_P59213 contig_2 cds 58626 60332 + GCA009771085_00060 Cyclomaltodextrinase SO:0001217, UniRef:UniRef50_Q99ZB2 contig_2 cds 60400 61710 + GCA009771085_00061 mdxF Maltodextrin transport system permease protein MdxF SO:0001217, UniRef:UniRef50_O06990 contig_2 cds 61707 62573 + GCA009771085_00062 mdxG Maltodextrin transport system permease protein MdxG SO:0001217, UniRef:UniRef50_O06991 contig_2 cds 62642 63469 + GCA009771085_00063 malA Maltodextrose utilization protein MalA SO:0001217, UniRef:UniRef50_B4U3N3 contig_2 cds 63629 63763 + GCA009771085_00064 hypothetical protein contig_2 cds 63766 64224 + GCA009771085_00065 hypothetical protein PFAM:PF13408.12 contig_2 cds 64318 64569 + GCA009771085_00066 DNA-binding helix-turn-helix protein SO:0001217, UniRef:UniRef50_V1D7W0 contig_2 cds 64584 65234 + GCA009771085_00067 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_2 cds 65260 66000 + GCA009771085_00068 hypothetical protein contig_2 cds 66150 66335 + GCA009771085_00069 tnpW Transposon-encoded protein TnpW SO:0001217, UniRef:UniRef50_B6W6B4, UniRef:UniRef90_B6W6B4 contig_2 cds 66518 66937 + GCA009771085_00070 hypothetical protein PFAM:PF00164.32 contig_2 cds 67017 67553 + GCA009771085_00071 Small ribosomal subunit protein uS7 SO:0001217, UniRef:UniRef50_P38526 contig_3 cds 123 1046 - GCA009771085_00072 2-dehydropantoate 2-reductase SO:0001217, UniRef:UniRef50_P65666 contig_3 cds 1252 2085 - GCA009771085_00073 PTS system mannose-specific transporter subunit IID SO:0001217, UniRef:UniRef50_A0A0F3H9W7 contig_3 cds 2087 2941 - GCA009771085_00074 Phospotransferase system PTS, IIC component SO:0001217, UniRef:UniRef50_A0NHI9 contig_3 cds 2972 3466 - GCA009771085_00075 PTS mannose/fructose/sorbose transporter subunit IIB SO:0001217, UniRef:UniRef50_A0A2A7MEG4 contig_3 cds 3481 3909 - GCA009771085_00076 PTS fructose transporter subunit IIA SO:0001217, UniRef:UniRef50_A0A421BIG7 contig_3 cds 4107 5381 - GCA009771085_00077 hypothetical protein contig_3 cds 5378 6073 - GCA009771085_00078 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A143XVD4 contig_3 cds 6113 7411 - GCA009771085_00079 histidine kinase SO:0001217, UniRef:UniRef50_A0A421BIX0 contig_3 cds 7464 8504 - GCA009771085_00080 Sugar ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_A0A421BIH6 contig_3 cds 8577 9266 - GCA009771085_00081 hypothetical protein contig_3 cds 9274 10407 - GCA009771085_00082 hypothetical protein PFAM:PF18975.6 contig_3 cds 10437 13109 - GCA009771085_00083 hypothetical protein PFAM:PF02492.25 contig_3 cds 13153 14478 - GCA009771085_00084 hypothetical protein contig_3 cds 14510 15340 - GCA009771085_00085 hypothetical protein contig_3 ncRNA 15358 15518 - GCA009771085_00086 Bacteria_large_SRP Bacterial large signal recognition particle RNA RFAM:RF01854, SO:0000655 contig_3 ncRNA 15379 15478 - GCA009771085_00087 Bacteria_small_SRP Bacterial small signal recognition particle RNA RFAM:RF00169, SO:0000655 contig_3 cds 15739 17007 - GCA009771085_00088 hypothetical protein PFAM:PF16697.10, PFAM:PF19909.4 contig_3 cds 17042 17440 - GCA009771085_00089 hypothetical protein contig_3 cds 17437 17865 - GCA009771085_00090 hypothetical protein contig_3 cds 17870 18781 - GCA009771085_00091 hypothetical protein contig_3 cds 18883 20634 - GCA009771085_00092 hypothetical protein contig_3 cds 20634 20798 - GCA009771085_00093 Putative Flagellin Flp1-like domain-containing protein SO:0001217, UniRef:UniRef50_F7V1V9 contig_3 cds 20851 22107 - GCA009771085_00094 hypothetical protein PFAM:PF00482.28 contig_3 cds 22110 22868 - GCA009771085_00095 hypothetical protein contig_3 cds 22811 24010 - GCA009771085_00096 AAA+ ATPase domain-containing protein SO:0001217, UniRef:UniRef50_R9MGU2 contig_3 cds 24003 25046 - GCA009771085_00097 hypothetical protein contig_3 cds 24995 25504 - GCA009771085_00098 hypothetical protein contig_3 cds 25715 26191 - GCA009771085_00099 hypothetical protein contig_3 cds 26217 27626 - GCA009771085_00100 Flagellin SO:0001217, UniRef:UniRef50_A0A7U9RZ75 contig_3 cds 27616 30699 - GCA009771085_00101 hypothetical protein contig_3 cds 30870 31469 - GCA009771085_00102 recR Recombination protein RecR SO:0001217, UniRef:UniRef50_P24277 contig_3 cds 31476 31826 - GCA009771085_00103 Nucleoid-associated protein FMG_0513 SO:0001217, UniRef:UniRef50_B0S0K7 contig_3 cds 31835 33436 - GCA009771085_00104 DNA-directed DNA polymerase SO:0001217, UniRef:UniRef50_A0A938X298 contig_3 cds 33454 34899 - GCA009771085_00105 hypothetical protein PFAM:PF07687.19 contig_3 tRNA 35058 35144 + GCA009771085_00106 trnS tRNA-Ser(cga) SO:0000269 contig_3 cds 35273 35770 + GCA009771085_00107 greA Transcription elongation factor GreA SO:0001217, UniRef:UniRef50_A0A1C5U3W6 contig_3 cds 35940 36350 - GCA009771085_00108 ATP synthase epsilon chain SO:0001217, UniRef:UniRef50_A0A173UMR4 contig_3 cds 36357 37754 - GCA009771085_00109 ATP synthase subunit beta SO:0001217, UniRef:UniRef50_Q24MP1 contig_3 cds 37779 38630 - GCA009771085_00110 ATP synthase gamma chain SO:0001217, UniRef:UniRef50_A9KK93 contig_3 cds 38665 40179 - GCA009771085_00111 ATP synthase subunit alpha SO:0001217, UniRef:UniRef50_P37808 contig_3 cds 40176 40745 - GCA009771085_00112 ATP synthase subunit delta SO:0001217, UniRef:UniRef50_A0A1H6SL68 contig_3 cds 40733 41248 - GCA009771085_00113 ATP synthase subunit b SO:0001217, UniRef:UniRef50_A0A174DG31 contig_3 cds 41288 41545 - GCA009771085_00114 ATP synthase subunit c SO:0001217, UniRef:UniRef50_Q8RGD7 contig_3 cds 41612 42388 - GCA009771085_00115 ATP synthase subunit a SO:0001217, UniRef:UniRef50_A0A173S881 contig_3 cds 42533 42955 - GCA009771085_00116 ATP synthase subunit I SO:0001217, UniRef:UniRef50_G2T610 contig_3 cds 43203 43718 - GCA009771085_00117 hypothetical protein PFAM:PF00383.29 contig_3 cds 43711 44151 - GCA009771085_00118 ptpB Low molecular weight protein-tyrosine-phosphatase ptpB SO:0001217, UniRef:UniRef50_A0A173S6V1 contig_3 cds 44186 45247 - GCA009771085_00119 Threonylcarbamoyl-AMP synthase SO:0001217, UniRef:UniRef50_A0A173S7Y5 contig_3 cds 45366 47087 - GCA009771085_00120 hypothetical protein PFAM:PF00704.34, PFAM:PF08239.17 contig_3 cds 47765 48553 + GCA009771085_00121 hypothetical protein contig_3 cds 48766 50142 - GCA009771085_00122 Replicative DNA helicase SO:0001217, UniRef:UniRef50_A0A3C0VUV2 contig_3 cds 50152 50601 - GCA009771085_00123 Large ribosomal subunit protein bL9 SO:0001217, UniRef:UniRef50_C4Z4Q1 contig_3 cds 50598 52643 - GCA009771085_00124 Cyclic-di-AMP phosphodiesterase SO:0001217, UniRef:UniRef50_A0A1I6YPF9 contig_3 cds 52849 54228 + GCA009771085_00125 nhaC Na+/H+ antiporter NhaC SO:0001217, UniRef:UniRef50_D6GTK0 contig_3 cds 54293 54541 - GCA009771085_00126 Small ribosomal subunit protein bS18 SO:0001217, UniRef:UniRef50_G5GFZ1 contig_3 cds 54556 55014 - GCA009771085_00127 Single-stranded DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2N2EHE2 contig_3 cds 55032 55322 - GCA009771085_00128 Small ribosomal subunit protein bS6 SO:0001217, UniRef:UniRef50_D9R1Y0 contig_3 cds 55532 56272 - GCA009771085_00129 NAD-dependent protein deacetylase SO:0001217, UniRef:UniRef50_Q97MB4 contig_3 cds 56341 57219 - GCA009771085_00130 Ribosomal RNA small subunit methyltransferase I SO:0001217, UniRef:UniRef50_R9K7V2 contig_3 cds 57203 57949 - GCA009771085_00131 tRNA1(Val) (Adenine(37)-N6)-methyltransferase SO:0001217, UniRef:UniRef50_A0A564U0I4 contig_3 cds 57974 58996 - GCA009771085_00132 hypothetical protein contig_3 cds 58989 59999 - GCA009771085_00133 hypothetical protein PFAM:PF00004.35, PFAM:PF09115.15, PFAM:PF13177.12 contig_3 cds 60004 60447 - GCA009771085_00134 DUF327 domain-containing protein SO:0001217, UniRef:UniRef50_A0A4R1QXT3 contig_3 cds 60459 61016 - GCA009771085_00135 Guanylate kinase-like domain-containing protein SO:0001217, UniRef:UniRef50_C0FZX6 contig_3 cds 61150 61986 - GCA009771085_00136 hypothetical protein contig_3 cds 62055 62681 - GCA009771085_00137 AbiEi antitoxin C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_N2B2Q5 contig_3 cds 62829 63329 + GCA009771085_00138 Arginine repressor SO:0001217, UniRef:UniRef50_A0A923LP99 contig_3 cds 63344 64003 + GCA009771085_00139 tRNA (guanine-N(7)-)-methyltransferase SO:0001217, UniRef:UniRef50_A9KLV5 contig_3 cds 64141 64809 + GCA009771085_00140 L-serine deaminase SO:0001217, UniRef:UniRef50_D6GU18 contig_3 cds 64815 65705 + GCA009771085_00141 L-serine dehydratase SO:0001217, UniRef:UniRef50_A0A1E9AI08 contig_3 cds 65698 66930 + GCA009771085_00142 Sodium:proton antiporter SO:0001217, UniRef:UniRef50_A0A0M1VXJ6 contig_3 cds 67265 68500 + GCA009771085_00143 Sodium:proton antiporter SO:0001217, UniRef:UniRef50_A0A0M1VXJ6 contig_3 cds 68856 68972 - GCA009771085_00144 hypothetical protein contig_4 tRNA 271 341 + GCA009771085_00145 trnC tRNA-Cys(gca) SO:0000258 contig_4 ncRNA-region 384 651 + T-box leader RFAM:RF00230, SO:0000140 contig_4 cds 708 1925 + GCA009771085_00146 Tyrosine--tRNA ligase SO:0001217, UniRef:UniRef50_A5I748 contig_4 cds 2013 2546 + GCA009771085_00147 Undecaprenyl-diphosphatase SO:0001217, UniRef:UniRef50_A0A1H2UI41 contig_4 cds 2663 2950 + GCA009771085_00148 hypothetical protein contig_4 cds 2994 4970 + GCA009771085_00149 Methionine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A3S5CG73 contig_4 cds 5015 5791 + GCA009771085_00150 tatD TatD family hydrolase SO:0001217, UniRef:UniRef50_A0A174KK32 contig_4 cds 5899 6768 + GCA009771085_00151 Ribosomal RNA small subunit methyltransferase A SO:0001217, UniRef:UniRef50_A9KL97 contig_4 cds 6772 8391 + GCA009771085_00152 hypothetical protein PFAM:PF00990.26 contig_4 cds 8406 8945 - GCA009771085_00153 hypothetical protein PFAM:PF13302.13, PFAM:PF13420.13 contig_4 cds 9007 9513 - GCA009771085_00154 tRNA-specific adenosine deaminase SO:0001217, UniRef:UniRef50_A0A1G5AIM6 contig_4 cds 9767 10756 + GCA009771085_00155 SCP2 domain-containing protein SO:0001217, UniRef:UniRef50_R5EBX9 contig_4 cds 10860 11279 + GCA009771085_00156 HIT domain-containing protein SO:0001217, UniRef:UniRef50_S0IPI8 contig_4 cds 11332 12390 - GCA009771085_00157 UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase SO:0001217, UniRef:UniRef50_Q893R7 contig_4 cds 12576 14153 + GCA009771085_00158 Glucose-6-phosphate isomerase SO:0001217, UniRef:UniRef50_O83488 contig_4 cds 14267 15340 + GCA009771085_00159 hypothetical protein PFAM:PF08239.17 contig_4 cds 15500 15874 + GCA009771085_00160 DUF3846 domain-containing protein SO:0001217, UniRef:UniRef50_A0A395UV08 contig_4 cds 15861 16874 + GCA009771085_00161 tRNA-dihydrouridine synthase SO:0001217, UniRef:UniRef50_A0A174Z974 contig_4 cds 16969 17445 + GCA009771085_00162 greA Transcription elongation factor GreA SO:0001217, UniRef:UniRef50_A9KIP3 contig_4 cds 17476 19431 + GCA009771085_00163 Lysine--tRNA ligase SO:0001217, UniRef:UniRef50_C4GCV9 contig_4 cds 19570 21540 - GCA009771085_00164 ABC3 transporter permease C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_E7MR67 contig_4 cds 21537 22295 - GCA009771085_00165 Peptide ABC transporter ATPase SO:0001217, UniRef:UniRef50_A0A0Z8FM40 contig_4 cds 22255 22383 - GCA009771085_00166 hypothetical protein contig_4 cds 22416 23321 - GCA009771085_00167 histidine kinase SO:0001217, UniRef:UniRef50_A0A223AUC2 contig_4 cds 23329 24054 - GCA009771085_00168 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A173WZF8 contig_4 cds 24097 25089 - GCA009771085_00169 WYL domain-containing protein SO:0001217, UniRef:UniRef50_I5AX22 contig_4 cds 25347 27026 + GCA009771085_00170 hypothetical protein PFAM:PF00563.25, PFAM:PF00990.26, PFAM:PF08447.18 contig_4 cds 27078 28790 + GCA009771085_00171 hypothetical protein PFAM:PF00990.26 contig_4 cds 28877 30061 + GCA009771085_00172 Zinc ribbon domain-containing protein SO:0001217, UniRef:UniRef50_D3R0C2 contig_4 cds 30104 30529 - GCA009771085_00173 Flavodoxin SO:0001217, UniRef:UniRef50_A0AAI9K268 contig_4 cds 31090 32400 + GCA009771085_00174 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_I5ASQ5 contig_4 cds 32397 32711 + GCA009771085_00175 Glutaredoxin domain-containing protein SO:0001217, UniRef:UniRef50_D2MMS3 contig_4 cds 32782 34569 + GCA009771085_00176 Threonine--tRNA ligase SO:0001217, UniRef:UniRef50_C9LXY4 contig_4 cds 34747 36231 + GCA009771085_00177 hypothetical protein PFAM:PF01841.26, PFAM:PF16403.11 contig_4 cds 36464 38035 + GCA009771085_00178 hypothetical protein contig_4 cds 38019 38261 + GCA009771085_00179 hypothetical protein PFAM:PF00550.31 contig_4 cds 38261 39829 + GCA009771085_00180 hypothetical protein contig_4 cds 39833 40861 + GCA009771085_00181 GDSL-like lipase/acylhydrolase family protein SO:0001217, UniRef:UniRef50_A0A3D9I0E5 contig_4 cds 40863 41357 + GCA009771085_00182 hypothetical protein contig_4 cds 41372 41866 - GCA009771085_00183 Large-conductance mechanosensitive channel SO:0001217, UniRef:UniRef50_A0A401LBH7 contig_4 cds 42029 42901 + GCA009771085_00184 hypothetical protein PFAM:PF00398.26, PFAM:PF13489.12 contig_4 cds 42906 44054 + GCA009771085_00185 hypothetical protein contig_4 cds 44100 45974 + GCA009771085_00186 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_4 cds 45967 47886 + GCA009771085_00187 hypothetical protein PFAM:PF00535.33 contig_4 cds 47922 49460 + GCA009771085_00188 hypothetical protein contig_4 cds 49479 50708 + GCA009771085_00189 Polysaccharide biosynthesis protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_S0JID6 contig_4 cds 50711 51769 + GCA009771085_00190 hypothetical protein PFAM:PF01757.29 contig_4 cds 51753 52469 + GCA009771085_00191 Poly-beta-1,6-N-acetyl-D-glucosamine synthase SO:0001217, UniRef:UniRef50_A0A1C5LHJ8 contig_4 cds 52484 52834 + GCA009771085_00192 hypothetical protein contig_4 cds 52868 53638 + GCA009771085_00193 THIF-type NAD/FAD binding fold domain-containing protein SO:0001217, UniRef:UniRef50_R9JDK7 contig_4 cds 53650 54561 + GCA009771085_00194 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A348N824 contig_4 cds 54576 56309 + GCA009771085_00195 hypothetical protein PFAM:PF00535.33, PFAM:PF13506.12, PFAM:PF13641.12 contig_4 cds 56513 57562 + GCA009771085_00196 ATP-binding cassette domain-containing protein SO:0001217, UniRef:UniRef50_A0A174HFH9 contig_4 cds 57559 58224 + GCA009771085_00197 metI D-methionine transport system permease protein MetI SO:0001217, UniRef:UniRef50_A0A1N6F0V7 contig_4 cds 58275 59159 + GCA009771085_00198 Lipoprotein SO:0001217, UniRef:UniRef50_G5GF38 contig_4 ncRNA-region 59189 59283 + TPP riboswitch aptamer (THI element) RFAM:RF00059, SO:0000035 contig_4 cds 59329 60003 + GCA009771085_00199 Thiamine transporter SO:0001217, UniRef:UniRef50_A0A255IJK7 contig_4 cds 60116 61924 + GCA009771085_00200 hypothetical protein contig_4 cds 62196 63542 + GCA009771085_00201 mgtE Magnesium transporter MgtE SO:0001217, UniRef:UniRef50_F5YDZ2 contig_4 cds 63616 64266 + GCA009771085_00202 Uridine kinase SO:0001217, UniRef:UniRef50_A0A449BBH0 contig_4 cds 64317 65300 + GCA009771085_00203 Sodium/calcium exchanger membrane region domain-containing protein SO:0001217, UniRef:UniRef50_G2SYK0 contig_4 cds 65553 66569 + GCA009771085_00204 Alcohol dehydrogenase 1 SO:0001217, UniRef:UniRef50_P20368 contig_5 cds 281 457 - GCA009771085_00205 DNA recombinase SO:0001217, UniRef:UniRef50_A0A3A1X580 contig_5 cds 411 545 - GCA009771085_00206 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_D6ZHI6, UniRef:UniRef90_D6ZHI6, UniRef:UniRef90_UPI001F093C67 contig_5 cds 753 1322 - GCA009771085_00207 DUF7010 domain-containing protein SO:0001217, UniRef:UniRef50_I4M0A9, UniRef:UniRef90_C8PC32 contig_5 cds 1371 1565 - GCA009771085_00208 hypothetical protein contig_5 cds 1600 2205 - GCA009771085_00209 Cadmium resistance transporter family protein SO:0001217, UniRef:UniRef50_A0A1S6IPE0, UniRef:UniRef90_A0A133XU39 contig_5 cds 2943 4385 - GCA009771085_00210 recG ATP-dependent DNA helicase RecG COG:COG2865, COG:K, SO:0001217, UniRef:UniRef50_A0A1X6WRS9, UniRef:UniRef90_A0A7Y0UGS1 contig_5 cds 4424 4720 - GCA009771085_00211 23S rRNA methyltransferase SO:0001217, UniRef:UniRef50_G5GKU6, UniRef:UniRef90_R0B264 contig_5 cds 5161 6525 - GCA009771085_00212 ccmA heme ABC exporter ATP-binding protein CcmA EC:7.6.2.5, GO:0015439, GO:0015886, GO:0017004, GO:0022857, GO:0043190, SO:0001217, UniRef:UniRef50_C2KXE6, UniRef:UniRef90_C2BCZ1 contig_5 cds 6519 7208 - GCA009771085_00213 ykoC HMP/thiamine permease protein YkoC KEGG:K16785, SO:0001217, UniRef:UniRef50_Q8DP88, UniRef:UniRef90_A0A8H2M6F1 contig_5 cds 7208 7792 - GCA009771085_00214 TIGR02185 family protein KEGG:K16926, SO:0001217, UniRef:UniRef50_Q8CYL9, UniRef:UniRef90_H3NR64 contig_5 cds 7803 8678 - GCA009771085_00215 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A0B4EH85, UniRef:UniRef90_UPI00290685DF contig_6 cds 216 1136 + GCA009771085_00216 Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase SO:0001217, UniRef:UniRef50_A0A9E1ETQ1 contig_6 cds 1213 1746 - GCA009771085_00217 hypothetical protein contig_6 ncRNA-region 1860 1980 - THF (Tetrahydrofolate) riboswitch aptamer RFAM:RF01831, SO:0000035 contig_6 cds 2122 3234 + GCA009771085_00218 Membrane protease subunit, stomatin/prohibitin family, contains C-terminal Zn-ribbon domain SO:0001217, UniRef:UniRef50_A0A1H3YEA0 contig_6 cds 3231 4658 + GCA009771085_00219 hypothetical protein contig_6 cds 4648 5490 + GCA009771085_00220 hypothetical protein PFAM:PF04536.20 contig_6 cds 5646 6383 + GCA009771085_00221 HTH deoR-type domain-containing protein SO:0001217, UniRef:UniRef50_V9HIK3 contig_6 cds 6385 7302 + GCA009771085_00222 Tagatose-6-phosphate kinase SO:0001217, UniRef:UniRef50_A0A2A7MHF1 contig_6 cds 7318 9351 + GCA009771085_00223 PTS fructose transporter subunit IIC SO:0001217, UniRef:UniRef50_A0A0B7GV04 contig_6 cds 9475 9732 + GCA009771085_00224 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_A0A174CI12 contig_6 cds 9970 10419 + GCA009771085_00225 hypothetical protein contig_6 cds 10581 11174 + GCA009771085_00226 Chromate transporter SO:0001217, UniRef:UniRef50_G4Q3L6 contig_6 cds 11171 11767 + GCA009771085_00227 Chromate transporter SO:0001217, UniRef:UniRef50_R9M6X7 contig_6 cds 11895 15113 + GCA009771085_00228 Isoleucine--tRNA ligase SO:0001217, UniRef:UniRef50_Q899C3 contig_6 cds 15130 15975 + GCA009771085_00229 hypothetical protein contig_6 cds 16235 18031 + GCA009771085_00230 hypothetical protein contig_6 cds 18142 21651 + GCA009771085_00231 DNA polymerase III subunit alpha SO:0001217, UniRef:UniRef50_A0A7U9QVC1 contig_6 cds 21704 22675 + GCA009771085_00232 ATP-dependent 6-phosphofructokinase SO:0001217, UniRef:UniRef50_A0A133Y6J0 contig_6 cds 22680 23540 + GCA009771085_00233 hypothetical protein PFAM:PF08032.17, PFAM:PF22435.1 contig_6 cds 23556 23819 + GCA009771085_00234 Phage protein SO:0001217, UniRef:UniRef50_R9J5D3 contig_6 cds 23869 24603 + GCA009771085_00235 ywaC GTP pyrophosphokinase ywaC SO:0001217, UniRef:UniRef50_A0A1C5TQT0 contig_6 cds 24694 26043 + GCA009771085_00236 mepA Multidrug export protein MepA SO:0001217, UniRef:UniRef50_A0A1C5MK14 contig_6 cds 26130 27614 + GCA009771085_00237 Dipeptidase SO:0001217, UniRef:UniRef50_Q8G6Z9 contig_6 cds 27835 30183 + GCA009771085_00238 ftsH ATP-dependent zinc metalloprotease FtsH SO:0001217, UniRef:UniRef50_C8W731 contig_6 cds 30238 32097 + GCA009771085_00239 UvrABC system protein C SO:0001217, UniRef:UniRef50_A6TVI7 contig_6 cds 32117 33055 + GCA009771085_00240 HPr kinase/phosphorylase SO:0001217, UniRef:UniRef50_A0A2J8B156 contig_6 cds 33102 34019 + GCA009771085_00241 UDP-N-acetylenolpyruvoylglucosamine reductase SO:0001217, UniRef:UniRef50_N2A8K8 contig_6 cds 34050 34925 + GCA009771085_00242 Nucleotide-binding protein Cthe_0113 SO:0001217, UniRef:UniRef50_A3DBM5 contig_6 cds 34925 35830 + GCA009771085_00243 hypothetical protein PFAM:PF02650.20, PFAM:PF14527.11 contig_6 cds 35836 36087 + GCA009771085_00244 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_A0A373W348 contig_6 cds 36100 37011 + GCA009771085_00245 DAGKc domain-containing protein SO:0001217, UniRef:UniRef50_D4M488 contig_6 cds 37130 37993 + GCA009771085_00246 putative fructose-bisphosphate aldolase SO:0001217, UniRef:UniRef50_P13243 contig_6 cds 38059 40173 + GCA009771085_00247 Glutamine synthetase SO:0001217, UniRef:UniRef50_D4N192 contig_6 cds 40284 41267 + GCA009771085_00248 hypothetical protein contig_6 cds 41276 44017 - GCA009771085_00249 Penicillin-binding protein 1A SO:0001217, UniRef:UniRef50_C0FS52 contig_6 cds 44130 44783 + GCA009771085_00250 hypothetical protein contig_6 tRNA 44995 45066 + GCA009771085_00251 trnQ tRNA-Gln(ctg) SO:0000261 contig_6 cds 45120 45932 + GCA009771085_00252 hypothetical protein PFAM:PF01643.23, PFAM:PF20791.3 contig_6 cds 46052 46972 + GCA009771085_00253 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_R9IRC0 contig_6 cds 47057 47254 - GCA009771085_00254 hypothetical protein contig_6 cds 47595 48518 + GCA009771085_00255 Thioredoxin reductase SO:0001217, UniRef:UniRef50_A0A174HYC0 contig_6 cds 48652 49944 + GCA009771085_00256 hypothetical protein PFAM:PF06347.19, PFAM:PF08239.17 contig_6 cds 50611 51699 + GCA009771085_00257 pucR PucR family transcriptional regulator SO:0001217, UniRef:UniRef50_G2SZZ4 contig_6 cds 51753 52427 + GCA009771085_00258 ftsE Cell division ATP-binding protein FtsE SO:0001217, UniRef:UniRef50_U4TPN4 contig_6 cds 52503 53348 + GCA009771085_00259 ftsX Cell division protein FtsX SO:0001217, UniRef:UniRef50_A0A1H3HY68 contig_6 cds 53366 54643 + GCA009771085_00260 hypothetical protein PFAM:PF00595.29, PFAM:PF13180.12, PFAM:PF17820.7 contig_6 cds 54701 55840 + GCA009771085_00261 Peptide chain release factor 2 SO:0001217, UniRef:UniRef50_A0A1C7IF91 contig_6 cds 55933 56502 + GCA009771085_00262 hypothetical protein PFAM:PF14317.12 contig_6 cds 56515 56961 + GCA009771085_00263 tsaE tRNA threonylcarbamoyladenosine biosynthesis protein TsaE SO:0001217, UniRef:UniRef50_A0A4U7JFV1 contig_6 cds 57034 57774 + GCA009771085_00264 N(6)-L-threonylcarbamoyladenine synthase SO:0001217, UniRef:UniRef50_B0NF98 contig_6 cds 57764 58237 + GCA009771085_00265 hypothetical protein PFAM:PF13420.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_6 cds 58319 59227 + GCA009771085_00266 Ribonuclease Z SO:0001217, UniRef:UniRef50_A9KSU3 contig_6 cds 59278 59865 + GCA009771085_00267 hypothetical protein PFAM:PF20462.4 contig_6 cds 59963 60964 + GCA009771085_00268 tRNA N6-adenosine threonylcarbamoyltransferase SO:0001217, UniRef:UniRef50_Q8RC98 contig_6 cds 60967 61662 + GCA009771085_00269 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase SO:0001217, UniRef:UniRef50_A0A1G5DQC6 contig_6 tRNA 61767 61851 - GCA009771085_00270 trnL tRNA-Leu(aag) SO:0000264 contig_6 tRNA 61895 61978 - GCA009771085_00271 trnL tRNA-Leu(cag) SO:0000264 contig_6 cds 62246 62842 - GCA009771085_00272 Abortive infection protein SO:0001217, UniRef:UniRef50_A0A8H2QY77 contig_6 cds 62989 63711 - GCA009771085_00273 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A0F0CCQ7 contig_6 cds 63916 65250 - GCA009771085_00274 hypothetical protein PFAM:PF16916.10 contig_7 cds 670 1173 + GCA009771085_00275 GIY-YIG nuclease family protein SO:0001217, UniRef:UniRef50_UPI0022E63107 contig_7 cds 1352 1867 + GCA009771085_00276 helix-turn-helix domain-containing protein SO:0001217, UniRef:UniRef50_G1WHM6, UniRef:UniRef90_UPI000407F854 contig_7 cds 2647 3924 + GCA009771085_00277 Efflux ABC transporter, permease protein SO:0001217, UniRef:UniRef50_A0A173UUV1, UniRef:UniRef90_A0A133YGH8 contig_7 cds 3934 4590 + GCA009771085_00278 lolD ABC transporter domain-containing protein COG:COG1136, COG:M, SO:0001217, UniRef:UniRef50_B9W4V0, UniRef:UniRef90_C4Z2D0 contig_7 cds 4590 5966 + GCA009771085_00279 lolE ABC3 transporter permease C-terminal domain-containing protein COG:COG4591, COG:M, SO:0001217, UniRef:UniRef50_K1MBZ2, UniRef:UniRef90_D7BNM0 contig_7 cds 6019 6672 + GCA009771085_00280 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A174ZMR3 contig_7 cds 6669 7979 + GCA009771085_00281 histidine kinase SO:0001217, UniRef:UniRef50_A0A9Q2CYI7, UniRef:UniRef90_A0A133YGG3 contig_8 cds 82 648 + GCA009771085_00282 yqaJ YqaJ viral recombinase domain-containing protein SO:0001217, UniRef:UniRef50_A0A916VF52 contig_8 cds 680 1555 + GCA009771085_00283 hypothetical protein contig_8 cds 1583 2491 + GCA009771085_00284 P33 SO:0001217, UniRef:UniRef50_A0AAI9K4K2 contig_8 cds 2484 2882 + GCA009771085_00285 rusA RusA family crossover junction endodeoxyribonuclease SO:0001217, UniRef:UniRef50_A0A926DYK5 contig_8 cds 2902 3114 + GCA009771085_00286 hypothetical protein contig_8 cds 3114 4004 + GCA009771085_00287 hypothetical protein contig_8 cds 4376 4642 + GCA009771085_00288 Phage protein SO:0001217, UniRef:UniRef50_G9XBV4 contig_8 cds 4644 5309 + GCA009771085_00289 HNH nuclease domain-containing protein SO:0001217, UniRef:UniRef50_R9MLW8 contig_8 cds 5335 5574 + GCA009771085_00290 hypothetical protein contig_8 cds 5586 5780 + GCA009771085_00291 hypothetical protein contig_10 cds 40 753 + GCA009771085_00292 hypothetical protein PFAM:PF13635.12 contig_10 cds 1040 1252 + GCA009771085_00293 DNA-binding transcriptional regulator RefSeq:WP_304141082.1, SO:0001217, UniParc:UPI0026ED7ABA, UniRef:UniRef100_UPI0026ED7ABA, UniRef:UniRef50_H3NJV9, UniRef:UniRef90_UPI0026ED7ABA contig_10 cds 1273 1992 + GCA009771085_00294 hypothetical protein PFAM:PF12161.14 contig_11 cds 256 3498 + GCA009771085_00295 Type I restriction enzyme endonuclease subunit SO:0001217, UniRef:UniRef50_A0A1C5KIW2 contig_11 cds 3540 4949 + GCA009771085_00296 hypothetical protein PFAM:PF01202.28, PFAM:PF01487.21 contig_11 tRNA 5042 5115 + GCA009771085_00297 trnR tRNA-Arg(ccg) SO:0001036 contig_11 cds 5199 6494 + GCA009771085_00298 hypothetical protein PFAM:PF08239.17 contig_11 cds 6699 7397 + GCA009771085_00299 Pseudouridine synthase SO:0001217, UniRef:UniRef50_A0A419T2U4 contig_11 cds 7452 9476 + GCA009771085_00300 DNA ligase SO:0001217, UniRef:UniRef50_A0A3A9GIL5 contig_11 cds 9464 10174 - GCA009771085_00301 Amino acid racemase SO:0001217, UniRef:UniRef50_A0A174MPV2 contig_11 cds 10288 11496 - GCA009771085_00302 ATP-grasp domain-containing protein SO:0001217, UniRef:UniRef50_E7MQY4 contig_11 cds 11819 13342 + GCA009771085_00303 Sodium/proline symporter SO:0001217, UniRef:UniRef50_A0A9D5Y721 contig_11 cds 13357 14751 - GCA009771085_00304 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_F3AHV6 contig_11 cds 15117 16610 + GCA009771085_00305 aldA Putative aldehyde dehydrogenase AldA SO:0001217, UniRef:UniRef50_Q2G1J0 contig_11 cds 16765 18186 - GCA009771085_00306 Serine/threonine exchange transporter, LAT family SO:0001217, UniRef:UniRef50_A0A1W1Z7E1 contig_11 cds 18363 18821 + GCA009771085_00307 D-aminoacyl-tRNA deacylase SO:0001217, UniRef:UniRef50_F7UZ95 contig_11 cds 18921 19310 - GCA009771085_00308 arsR DNA-binding transcriptional regulator, ArsR family SO:0001217, UniRef:UniRef50_A0A1H6VEL5 contig_11 cds 19659 21560 + GCA009771085_00309 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_A0A9E1AEE7 contig_11 cds 21573 22052 - GCA009771085_00310 Ribosomal RNA large subunit methyltransferase H SO:0001217, UniRef:UniRef50_Q899K8 contig_11 cds 22238 23839 + GCA009771085_00311 D-alanyl-lipoteichoic acid acyltransferase DltB, MBOAT superfamily SO:0001217, UniRef:UniRef50_A0A1H2SWZ2 contig_11 cds 23920 24915 + GCA009771085_00312 hypothetical protein contig_11 cds 24930 26471 + GCA009771085_00313 D-alanine--poly(Phosphoribitol) ligase SO:0001217, UniRef:UniRef50_A0A3C0J6Q9 contig_11 cds 26468 27670 + GCA009771085_00314 Diaminopimelate decarboxylase SO:0001217, UniRef:UniRef50_A0A425WGE7 contig_11 cds 27710 27940 + GCA009771085_00315 Phosphopantetheine attachment site SO:0001217, UniRef:UniRef50_D4M1K0 contig_11 cds 28007 28711 + GCA009771085_00316 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A4P6M2X9 contig_11 cds 28827 30443 + GCA009771085_00317 hypothetical protein PFAM:PF00512.31, PFAM:PF02518.31 contig_11 cds 30552 32309 + GCA009771085_00318 Phosphate:Na+ symporter SO:0001217, UniRef:UniRef50_A0A1H3GIQ2 contig_11 cds 32350 34470 + GCA009771085_00319 hypothetical protein contig_11 cds 34542 35237 + GCA009771085_00320 hypothetical protein PFAM:PF00633.29, PFAM:PF10531.15, PFAM:PF12836.13 contig_11 cds 35238 35927 + GCA009771085_00321 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A6N2TBA9 contig_11 cds 35927 37660 + GCA009771085_00322 histidine kinase SO:0001217, UniRef:UniRef50_C4G960 contig_11 cds 37657 38583 + GCA009771085_00323 hypothetical protein PFAM:PF10646.14 contig_11 cds 38624 40624 + GCA009771085_00324 hypothetical protein PFAM:PF13567.11 contig_11 cds 40921 41184 + GCA009771085_00325 Small ribosomal subunit protein bS20 SO:0001217, UniRef:UniRef50_A0A1V4X3C7 contig_11 cds 41272 42270 - GCA009771085_00326 hypothetical protein PFAM:PF06144.19, PFAM:PF21694.2 contig_11 cds 42433 44244 + GCA009771085_00327 Elongation factor 4 SO:0001217, UniRef:UniRef50_Q9ZHZ8 contig_11 cds 44253 45410 + GCA009771085_00328 hypothetical protein PFAM:PF04055.27, PFAM:PF06969.22 contig_11 cds 45670 46743 + GCA009771085_00329 hrcA Heat-inducible transcription repressor HrcA SO:0001217, UniRef:UniRef50_A0A9D5RV16 contig_11 cds 46751 47410 + GCA009771085_00330 hypothetical protein contig_11 cds 47502 49388 + GCA009771085_00331 dnaK Chaperone protein DnaK SO:0001217, UniRef:UniRef50_A9KKU0 contig_11 cds 49522 49788 - GCA009771085_00332 hypothetical protein contig_12 tRNA 303 375 - GCA009771085_00333 trnA tRNA-Ala(tgc) SO:0000254 contig_12 tRNA 436 509 - GCA009771085_00334 trnI tRNA-Ile(gat) SO:0000263 contig_12 rRNA 523 640 - GCA009771085_00335 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_12 rRNA 717 2247 - GCA009771085_00336 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_12 tRNA 2524 2611 - GCA009771085_00337 trnS tRNA-Ser(gga) SO:0000269 contig_12 tRNA 2663 2748 - GCA009771085_00338 trnS tRNA-Ser(tga) SO:0000269 contig_12 cds 2907 3677 - GCA009771085_00339 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A1Q6Q6N6 contig_12 cds 3667 4566 - GCA009771085_00340 Branched-chain amino acid ABC transporter, permease protein SO:0001217, UniRef:UniRef50_A0A133YCJ6 contig_12 cds 4602 5642 - GCA009771085_00341 ABC transporter substrate binding protein SO:0001217, UniRef:UniRef50_C8NG67 contig_12 cds 6036 7562 - GCA009771085_00342 hypothetical protein PFAM:PF01170.24 contig_12 cds 8073 9875 - GCA009771085_00343 Aspartate--tRNA(Asp/Asn) ligase SO:0001217, UniRef:UniRef50_A9KIA6 contig_12 cds 9912 11180 - GCA009771085_00344 Histidine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A929XG45 contig_12 cds 11278 12972 - GCA009771085_00345 hemZ Coproporphyrinogen dehydrogenase HemZ SO:0001217, UniRef:UniRef50_A0A927TJJ8 contig_12 cds 12972 15305 - GCA009771085_00346 GTP pyrophosphokinase SO:0001217, UniRef:UniRef50_A0A7I8DD63 contig_12 cds 15566 16927 + GCA009771085_00347 Amino acid carrier protein SO:0001217, UniRef:UniRef50_V7IDB4 contig_12 cds 17216 18670 + GCA009771085_00348 Inosine-5'-monophosphate dehydrogenase SO:0001217, UniRef:UniRef50_A0A2T0B5I1 contig_12 cds 18814 19323 - GCA009771085_00349 PAP2 superfamily protein SO:0001217, UniRef:UniRef50_A0A1H3KFN8 contig_12 cds 19327 19803 - GCA009771085_00350 hypothetical protein PFAM:PF02559.22 contig_12 cds 20245 21132 + GCA009771085_00351 lysR DNA-binding transcriptional regulator, LysR family SO:0001217, UniRef:UniRef50_A0A1I6Z7Z3 contig_12 cds 21141 21668 - GCA009771085_00352 Adenine phosphoribosyltransferase SO:0001217, UniRef:UniRef50_Q8KFM9 contig_12 cds 21760 22317 - GCA009771085_00353 hypothetical protein contig_12 cds 22317 22763 - GCA009771085_00354 hypothetical protein contig_12 cds 22770 22907 - GCA009771085_00355 hypothetical protein contig_12 cds 22933 23037 - GCA009771085_00356 hypothetical protein contig_12 cds 23152 23487 - GCA009771085_00357 hypothetical protein contig_12 cds 23550 24938 - GCA009771085_00358 hypothetical protein contig_12 cds 24880 26205 - GCA009771085_00359 hypothetical protein PFAM:PF00437.27 contig_12 cds 26227 26406 - GCA009771085_00360 Flp family type IVb pilin SO:0001217, UniRef:UniRef50_A0A9D1E7E1 contig_12 cds 26733 28430 - GCA009771085_00361 hypothetical protein PFAM:PF17203.10 contig_12 cds 28605 29381 - GCA009771085_00362 Type III pantothenate kinase SO:0001217, UniRef:UniRef50_A0A1G9BKK8 contig_12 cds 29468 30109 - GCA009771085_00363 hypothetical protein contig_12 cds 30331 31671 - GCA009771085_00364 hypothetical protein PFAM:PF24568.1 contig_12 cds 31805 32308 - GCA009771085_00365 Dihydrofolate reductase SO:0001217, UniRef:UniRef50_A0A1E3AHC5 contig_12 tRNA 32551 32623 + GCA009771085_00366 trnG tRNA-Gly(gcc) SO:0000260 contig_12 cds 32835 33884 - GCA009771085_00367 hypothetical protein contig_12 cds 34203 34367 - GCA009771085_00368 hypothetical protein SO:0001217, UniRef:UniRef50_K0XSI1 contig_12 cds 34458 36344 - GCA009771085_00369 hypothetical protein contig_12 cds 36560 37300 - GCA009771085_00370 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A415SEF3 contig_12 cds 37297 38622 - GCA009771085_00371 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_12 cds 38676 38849 - GCA009771085_00372 hypothetical protein contig_12 cds 38875 39459 - GCA009771085_00373 hypothetical protein contig_12 cds 39481 41676 - GCA009771085_00374 lagD Lactococcin-G-processing and transport ATP-binding protein LagD SO:0001217, UniRef:UniRef50_U5MNA3 contig_12 cds 41796 42218 - GCA009771085_00375 hypothetical protein contig_12 cds 43065 43268 - GCA009771085_00376 hypothetical protein SO:0001217, UniRef:UniRef50_A0A9X4MK44 contig_12 cds 43857 44285 - GCA009771085_00377 hypothetical protein contig_12 cds 44409 44621 - GCA009771085_00378 hypothetical protein contig_12 cds 44700 44852 - GCA009771085_00379 hypothetical protein contig_12 cds 45245 45541 - GCA009771085_00380 Bacteriocin immunity protein SO:0001217, UniRef:UniRef50_A0A345VLC3 contig_12 cds 45541 45741 - GCA009771085_00381 Bacteriocin ubericin-A SO:0001217, UniRef:UniRef50_A9Q0M7 contig_12 cds 45988 46779 - GCA009771085_00382 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_12 cds 46766 47194 - GCA009771085_00383 sufU Zinc-dependent sulfurtransferase SufU SO:0001217, UniRef:UniRef50_A0A097AUM6 contig_12 cds 47198 48418 - GCA009771085_00384 Cysteine desulfurase SO:0001217, UniRef:UniRef50_C9LRH9 contig_12 cds 48458 49468 - GCA009771085_00385 hypothetical protein PFAM:PF01458.23 contig_12 cds 49477 50889 - GCA009771085_00386 sufB Fe-S cluster assembly protein SufB SO:0001217, UniRef:UniRef50_A0A3G9KAX6 contig_12 cds 50899 51693 - GCA009771085_00387 sufC Fe-S cluster assembly ATPase SufC SO:0001217, UniRef:UniRef50_A0A975EZD7 contig_12 cds 51815 52246 - GCA009771085_00388 sarZ HTH-type transcriptional regulator SarZ SO:0001217, UniRef:UniRef50_A0A0P8WLA8 contig_12 cds 52380 53609 - GCA009771085_00389 cdgJ Cyclic di-GMP phosphodiesterase CdgJ SO:0001217, UniRef:UniRef50_A0A645CFS3 contig_12 cds 53788 54255 - GCA009771085_00390 hypothetical protein PFAM:PF00226.36 contig_12 cds 54282 55817 - GCA009771085_00391 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_12 cds 55783 56622 - GCA009771085_00392 degV DegV family protein SO:0001217, UniRef:UniRef50_A0A0J1GEZ7 contig_12 cds 56827 57093 - GCA009771085_00393 cspB Cold shock protein CspB SO:0001217, UniRef:UniRef50_P42016 contig_12 cds 57130 57630 - GCA009771085_00394 hypothetical protein contig_12 cds 57636 59378 - GCA009771085_00395 clpX ATP-dependent Clp protease ATP-binding subunit ClpX SO:0001217, UniRef:UniRef50_A0A6N7USA0 contig_12 cds 59582 60064 - GCA009771085_00396 Cob(I)yrinic acid a,c-diamide adenosyltransferase SO:0001217, UniRef:UniRef50_R9KI28 contig_12 cds 60225 62057 + GCA009771085_00397 bipA Large ribosomal subunit assembly factor BipA SO:0001217, UniRef:UniRef50_C4G8A0 contig_12 cds 62146 63060 + GCA009771085_00398 hypothetical protein contig_12 cds 63158 64447 - GCA009771085_00399 hypothetical protein PFAM:PF00587.30, PFAM:PF02403.27 contig_12 cds 64618 66903 - GCA009771085_00400 Multifunctional fusion protein SO:0001217, UniRef:UniRef50_C4G9S4 contig_12 cds 66996 68117 - GCA009771085_00401 hypothetical protein PFAM:PF00254.34 contig_12 cds 68227 69045 - GCA009771085_00402 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_12 cds 69210 71195 - GCA009771085_00403 Transketolase SO:0001217, UniRef:UniRef50_P45694 contig_12 cds 71237 71884 - GCA009771085_00404 Transaldolase SO:0001217, UniRef:UniRef50_P19669 contig_12 cds 71910 72629 - GCA009771085_00405 L-ribulose-5-phosphate 4-epimerase SO:0001217, UniRef:UniRef50_F9D4Y6 contig_12 cds 72619 73476 - GCA009771085_00406 L-ribulose-5-phosphate 3-epimerase SO:0001217, UniRef:UniRef50_A0A2L1TZP5 contig_12 cds 73566 74204 - GCA009771085_00407 3-keto-L-gulonate-6-phosphate decarboxylase SO:0001217, UniRef:UniRef50_D2KVD0 contig_12 cds 74254 74553 - GCA009771085_00408 PTS EIIB type-2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0R1TZP7 contig_12 cds 74627 76105 - GCA009771085_00409 PTS ascorbate transporter subunit IIC GO:0009401, GO:0016020, KEGG:K03475, SO:0001217, UniRef:UniRef50_F2N7C4, UniRef:UniRef90_A0A133Y087 contig_12 cds 76125 76643 - GCA009771085_00410 Ascorbate-specific PTS system EIIA component SO:0001217, UniRef:UniRef50_A0A133Y097 contig_12 cds 76597 77673 - GCA009771085_00411 ulaG L-ascorbate 6-phosphate lactonase EC:3.1.1.-, GO:0019854, GO:0030145, GO:0035460, KEGG:K03476, SO:0001217, UniRef:UniRef50_P39300, UniRef:UniRef90_A0A0X8F7W1 contig_12 cds 77907 78722 + GCA009771085_00412 deoR Transcriptional regulator, DeoR family SO:0001217, UniRef:UniRef50_A0A133XU25 contig_12 cds 78931 79746 - GCA009771085_00413 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_12 cds 79967 81331 - GCA009771085_00414 Ascorbate-specific PTS system EIIC component SO:0001217, UniRef:UniRef50_A0A2T7T7R7 contig_12 cds 81385 81675 - GCA009771085_00415 PTS EIIB type-2 domain-containing protein SO:0001217, UniRef:UniRef50_Q8CY69 contig_12 cds 81696 82133 - GCA009771085_00416 Ascorbate-specific PTS system EIIA component SO:0001217, UniRef:UniRef50_A0A1E9PKR7 contig_12 cds 82154 84148 - GCA009771085_00417 Transketolase SO:0001217, UniRef:UniRef50_P45694 contig_12 cds 84173 86239 - GCA009771085_00418 hypothetical protein PFAM:PF00359.27, PFAM:PF00874.25 contig_12 cds 86499 87926 - GCA009771085_00419 hypothetical protein PFAM:PF01473.26, PFAM:PF04650.22, PFAM:PF19085.6, PFAM:PF19127.6 contig_12 cds 88154 88645 + GCA009771085_00420 hypothetical protein contig_12 cds 88707 89981 - GCA009771085_00421 hypothetical protein PFAM:PF08713.17 contig_12 cds 90207 91937 - GCA009771085_00422 hypothetical protein contig_12 cds 91983 93077 - GCA009771085_00423 Zinc transport system substrate-binding protein SO:0001217, UniRef:UniRef50_M2Q1V9 contig_12 cds 93258 94187 - GCA009771085_00424 mannose-6-phosphate isomerase SO:0001217, UniRef:UniRef50_C2CIY4 contig_12 cds 94294 94782 - GCA009771085_00425 YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein SO:0001217, UniRef:UniRef50_A0A4R5NB19 contig_12 cds 94912 96258 - GCA009771085_00426 Dicarboxylate/amino acid:cation symporter SO:0001217, UniRef:UniRef50_R9KV50 contig_12 cds 96472 97809 - GCA009771085_00427 Branched-chain amino acid transport system carrier protein SO:0001217, UniRef:UniRef50_A0A929ZND9 contig_12 cds 98143 99372 - GCA009771085_00428 Peptidase T SO:0001217, UniRef:UniRef50_P0C2T7 contig_12 cds 99446 100357 - GCA009771085_00429 eamA EamA domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D2AAF9 contig_12 cds 100566 102263 + GCA009771085_00430 hypothetical protein PFAM:PF00990.26 contig_12 cds 102388 102957 + GCA009771085_00431 hypothetical protein contig_12 cds 103037 103789 - GCA009771085_00432 Lactose phosphotransferase system repressor SO:0001217, UniRef:UniRef50_A0A173U0W5 contig_12 cds 103814 104722 - GCA009771085_00433 Glycyl-radical enzyme activating protein SO:0001217, UniRef:UniRef50_A0A4U9T9A0 contig_12 cds 104953 107367 + GCA009771085_00434 Pyruvate formate-lyase SO:0001217, UniRef:UniRef50_A0A7Z7K763 contig_12 cds 107456 108130 + GCA009771085_00435 Putative fructose-6-phosphate aldolase SO:0001217, UniRef:UniRef50_C2BF30 contig_12 cds 108257 108904 - GCA009771085_00436 trkA Potassium transporter TrkA SO:0001217, UniRef:UniRef50_W7UXB4 contig_12 cds 108965 110290 - GCA009771085_00437 Trk family potassium uptake protein SO:0001217, UniRef:UniRef50_F3AK67 contig_12 cds 110342 111685 - GCA009771085_00438 Aminopeptidase SO:0001217, UniRef:UniRef50_F2BX56 contig_12 cds 111767 112744 - GCA009771085_00439 hypothetical protein PFAM:PF13529.12 contig_12 cds 113087 114409 - GCA009771085_00440 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_12 cds 114507 115244 - GCA009771085_00441 Membrane protein, putative SO:0001217, UniRef:UniRef50_A8AZW5 contig_12 cds 115237 116073 - GCA009771085_00442 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_D0BN11 contig_12 cds 116358 116915 - GCA009771085_00443 TetR/AcrR family transcriptional regulator SO:0001217, UniRef:UniRef50_UPI0023F8FFC5 contig_12 cds 116929 117345 - GCA009771085_00444 DUF2871 domain-containing protein SO:0001217, UniRef:UniRef50_F7JPE9 contig_12 cds 117566 120637 - GCA009771085_00445 Efflux ABC transporter, permease protein SO:0001217, UniRef:UniRef50_A0A133Y114 contig_12 cds 120631 121332 - GCA009771085_00446 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A098Z685 contig_12 cds 121601 121981 + GCA009771085_00447 Lipoprotein SO:0001217, UniRef:UniRef50_A0A173QTF6 contig_12 cds 122397 123110 - GCA009771085_00448 DUF3800 domain-containing protein SO:0001217, UniRef:UniRef50_E6LN35 contig_12 cds 123170 124204 - GCA009771085_00449 non-specific serine/threonine protein kinase SO:0001217, UniRef:UniRef50_A0A1Q6V0R5 contig_12 cds 124259 124720 + GCA009771085_00450 XRE family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A6N7IX22 contig_12 cds 124913 126361 + GCA009771085_00451 cstA CstA N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_H1CZY9 contig_12 cds 126663 128057 + GCA009771085_00452 Transporter SO:0001217, UniRef:UniRef50_F7V3K4 contig_12 cds 128220 129287 + GCA009771085_00453 cysteine desulfurase family protein SO:0001217, UniRef:UniRef50_UPI00094E8613 contig_12 cds 129346 130440 + GCA009771085_00454 mnmA tRNA-specific 2-thiouridylase MnmA SO:0001217, UniRef:UniRef50_Q8ZPZ4 contig_12 cds 130576 131796 + GCA009771085_00455 Sodium/glutamate symporter SO:0001217, UniRef:UniRef50_A0A4P7QIR3 contig_12 cds 131982 132878 + GCA009771085_00456 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_K1LXJ0 contig_12 cds 132950 133858 + GCA009771085_00457 ABC-2 type transporter transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_K1M376 contig_12 cds 133890 136691 - GCA009771085_00458 Phosphoenolpyruvate carboxylase SO:0001217, UniRef:UniRef50_Q9A0U7 contig_12 cds 136937 138199 + GCA009771085_00459 Glutamate dehydrogenase SO:0001217, UniRef:UniRef50_A0A6N3C7I8 contig_12 cds 138416 139672 - GCA009771085_00460 DUF4147 domain-containing protein SO:0001217, UniRef:UniRef50_A0A928FHG9 contig_12 cds 139648 140049 - GCA009771085_00461 GNAT family N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A2N5NI28 contig_12 cds 140395 142275 + GCA009771085_00462 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A3A1YC93 contig_12 cds 142278 144914 + GCA009771085_00463 Type III restriction-modification enzyme SO:0001217, UniRef:UniRef50_F2BWU2 contig_12 cds 144824 144997 - GCA009771085_00464 hypothetical protein contig_12 cds 145209 146969 + GCA009771085_00465 ATP-binding cassette, subfamily B, bacterial SO:0001217, UniRef:UniRef50_R9ITG9 contig_12 cds 146962 148701 + GCA009771085_00466 msbA Lipid A export ATP-binding/permease protein MsbA SO:0001217, UniRef:UniRef50_A0A564TWV5 contig_12 cds 148755 149399 + GCA009771085_00467 TIGR02185 family protein SO:0001217, UniRef:UniRef50_V1D581 contig_12 cds 149399 150133 + GCA009771085_00468 Cobalt transport protein SO:0001217, UniRef:UniRef50_A0A0F6MRY7 contig_12 cds 150130 151536 + GCA009771085_00469 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_A0A0F6MRK2 contig_12 cds 151641 152543 + GCA009771085_00470 eamA EamA domain-containing protein SO:0001217, UniRef:UniRef50_G9WP07 contig_12 cds 152706 153026 + GCA009771085_00471 hypothetical protein PFAM:PF07883.17 contig_12 cds 153141 153893 + GCA009771085_00472 SAM-dependent methyltransferase SO:0001217, UniRef:UniRef50_A0A131JTX0 contig_12 cds 153974 155323 - GCA009771085_00473 Isoleucine 2-epimerase SO:0001217, UniRef:UniRef50_M1GRN3 contig_12 cds 155381 156550 - GCA009771085_00474 hypothetical protein contig_12 cds 156926 158140 - GCA009771085_00475 ATPase COG:COG1373, COG:R, KEGG:K07133, SO:0001217, UniRef:UniRef50_A0A1C5QPH8, UniRef:UniRef90_D3R006 contig_12 cds 158292 158771 - GCA009771085_00476 hypothetical protein contig_12 cds 158758 159369 - GCA009771085_00477 hypothetical protein PFAM:PF00005.33 contig_12 cds 159400 160377 - GCA009771085_00478 hypothetical protein contig_12 cds 160603 160728 - GCA009771085_00479 hypothetical protein contig_12 cds 160858 161118 - GCA009771085_00480 hypothetical protein contig_12 cds 161200 162615 - GCA009771085_00481 ATPase SO:0001217, UniRef:UniRef50_E1QYA9 contig_13 cds 364 786 + GCA009771085_00482 Terminase small subunit SO:0001217, UniRef:UniRef50_A0A810PZ50 contig_13 cds 773 2137 + GCA009771085_00483 PBSX family phage terminase large subunit SO:0001217, UniRef:UniRef50_A0A350VVC2 contig_13 cds 2155 3582 + GCA009771085_00484 Phage portal protein SO:0001217, UniRef:UniRef50_A0A416HMV5 contig_13 cds 3594 3953 - GCA009771085_00485 hypothetical protein contig_14 cds 56 1204 - GCA009771085_00486 mobV MobV family relaxase GO:0003677, GO:0006310, SO:0001217, UniRef:UniRef50_R9M3Z2, UniRef:UniRef90_R9JV30 contig_14 cds 1548 2573 - GCA009771085_00487 repA ATPase COG:COG3598, COG:L, RefSeq:WP_007392025.1, SO:0001217, UniParc:UPI00021A221F, UniRef:UniRef100_A0A4P8IAF9, UniRef:UniRef50_B1C6Y6, UniRef:UniRef90_A0A6G6ATF8 contig_14 cds 2728 3201 - GCA009771085_00488 rpoE RNA polymerase sigma-70 factor, ECF subfamily COG:COG1595, COG:K, RefSeq:WP_007392105.1, SO:0001217, UniParc:UPI00021A2221, UniRef:UniRef100_A0A4P8ICH9, UniRef:UniRef50_F3AUS2, UniRef:UniRef90_R0BXH2 contig_14 cds 3286 3711 - GCA009771085_00489 Sigma-70 family RNA polymerase sigma factor RefSeq:WP_036257229.1, SO:0001217, UniParc:UPI00055FF2EF, UniRef:UniRef100_A0A4P8IF53, UniRef:UniRef50_R9KH83, UniRef:UniRef90_A0A4P8IF53 contig_14 cds 3807 4319 - GCA009771085_00490 fliA RNA polymerase sigma-70 region 4 domain-containing protein COG:COG1191, COG:K, RefSeq:WP_007392094.1, SO:0001217, UniParc:UPI00021A2222, UniRef:UniRef100_A0A7X4Z749, UniRef:UniRef50_A8RVQ1, UniRef:UniRef90_A8RVQ1 contig_15 tRNA 217 289 + GCA009771085_00491 trnW tRNA-Trp(cca) SO:0000271 contig_15 cds 536 1342 + GCA009771085_00492 hypothetical protein contig_15 tRNA 1428 1500 + GCA009771085_00493 trnV tRNA-Val(tac) SO:0000273 contig_15 tRNA 1509 1582 + GCA009771085_00494 trnM tRNA-Met(cat) SO:0000266 contig_15 cds 1892 2434 + GCA009771085_00495 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase SO:0001217, UniRef:UniRef50_A0A5N9E8I1 contig_15 cds 2517 3935 + GCA009771085_00496 Cysteine--tRNA ligase SO:0001217, UniRef:UniRef50_C4Z3N5 contig_15 cds 3920 4369 + GCA009771085_00497 Mini-ribonuclease 3 SO:0001217, UniRef:UniRef50_G2SXJ2 contig_15 cds 4359 5108 + GCA009771085_00498 trmH TrmH family tRNA/rRNA methyltransferase SO:0001217, UniRef:UniRef50_A0A8A0RMX8 contig_15 cds 5120 5701 + GCA009771085_00499 hypothetical protein PFAM:PF00196.25, PFAM:PF04542.20, PFAM:PF12645.13 contig_15 cds 5767 7197 - GCA009771085_00500 Amino acid permease SO:0001217, UniRef:UniRef50_A0A140DSE7 contig_15 cds 7416 8156 - GCA009771085_00501 Glucosamine-6-phosphate deaminase SO:0001217, UniRef:UniRef50_Q8DV70 contig_15 cds 8465 9613 + GCA009771085_00502 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_15 cds 9749 10768 + GCA009771085_00503 Glyceraldehyde-3-phosphate dehydrogenase SO:0001217, UniRef:UniRef50_P0C0G6 contig_15 cds 10790 12061 + GCA009771085_00504 Phosphoglycerate kinase SO:0001217, UniRef:UniRef50_O52632 contig_15 cds 12082 12828 + GCA009771085_00505 Triosephosphate isomerase SO:0001217, UniRef:UniRef50_P50918 contig_15 cds 12903 14042 + GCA009771085_00506 hypothetical protein PFAM:PF08238.18 contig_15 cds 14086 15552 + GCA009771085_00507 Adenylosuccinate lyase SO:0001217, UniRef:UniRef50_A0A7U9MUE4 contig_15 cds 15705 16136 - GCA009771085_00508 hypothetical protein PFAM:PF00210.30 contig_15 cds 16409 17881 + GCA009771085_00509 Dipeptidase SO:0001217, UniRef:UniRef50_Q8G6Z9 contig_15 cds 17909 19984 + GCA009771085_00510 hypothetical protein PFAM:PF02743.24 contig_15 cds 20249 20956 - GCA009771085_00511 D/L-lactic acid transporter SO:0001217, UniRef:UniRef50_F9UST3 contig_15 cds 21137 22006 + GCA009771085_00512 pyridoxal kinase SO:0001217, UniRef:UniRef50_A0A379EYM2 contig_15 cds 22117 22371 + GCA009771085_00513 secG Protein-export membrane protein SecG SO:0001217, UniRef:UniRef50_A0A6S6R876 contig_15 cds 22443 24530 + GCA009771085_00514 Ribonuclease R SO:0001217, UniRef:UniRef50_A0A7X5HT53 contig_15 cds 24639 25109 + GCA009771085_00515 SsrA-binding protein SO:0001217, UniRef:UniRef50_A1ANL4 contig_15 cds 25450 26211 + GCA009771085_00516 Uridine phosphorylase SO:0001217, UniRef:UniRef50_A0A0B7LLH2 contig_15 tmRNA 26575 26919 - GCA009771085_00517 ssrA transfer-messenger RNA, SsrA SO:0000584 contig_15 cds 27162 27626 + GCA009771085_00518 Nucleoside 2-deoxyribosyltransferase SO:0001217, UniRef:UniRef50_A0AA87AL80 contig_15 cds 27654 28205 + GCA009771085_00519 Catalase SO:0001217, UniRef:UniRef50_W6S1L2 contig_15 cds 28318 29376 + GCA009771085_00520 Tryptophan--tRNA ligase SO:0001217, UniRef:UniRef50_Q8XMQ5 contig_15 cds 29483 30628 - GCA009771085_00521 hypothetical protein contig_15 cds 30724 32298 - GCA009771085_00522 hypothetical protein PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF05362.19, PFAM:PF07728.20, PFAM:PF13541.12 contig_15 cds 32556 34640 + GCA009771085_00523 DNA topoisomerase 1 SO:0001217, UniRef:UniRef50_V1CS44 contig_15 cds 34710 35492 + GCA009771085_00524 codY Global transcriptional regulator CodY SO:0001217, UniRef:UniRef50_A6LSN9 contig_15 cds 35718 36113 + GCA009771085_00525 flgB Flagellar basal body rod protein FlgB SO:0001217, UniRef:UniRef50_C0FQD5 contig_15 cds 36133 36582 + GCA009771085_00526 flgC Flagellar basal-body rod protein FlgC SO:0001217, UniRef:UniRef50_A0A9D6HW66 contig_15 cds 36631 36960 + GCA009771085_00527 fliE Flagellar hook-basal body complex protein FliE SO:0001217, UniRef:UniRef50_A0A1G8BTF6 contig_15 cds 36988 38604 + GCA009771085_00528 fliF Flagellar M-ring protein FliF SO:0001217, UniRef:UniRef50_A0A6N7J0R0 contig_15 cds 38608 39615 + GCA009771085_00529 fliG Flagellar motor switch protein FliG SO:0001217, UniRef:UniRef50_A0A970LQE4 contig_15 cds 39608 40477 + GCA009771085_00530 hypothetical protein contig_15 cds 40495 41820 + GCA009771085_00531 Type 3 secretion system ATPase SO:0001217, UniRef:UniRef50_A0A0V8QJE1 contig_15 cds 41850 42293 + GCA009771085_00532 fliJ Flagellar FliJ protein SO:0001217, UniRef:UniRef50_A0A5P6VUN9 contig_15 cds 42338 43213 + GCA009771085_00533 hypothetical protein contig_15 cds 43239 44852 + GCA009771085_00534 hypothetical protein PFAM:PF02120.21 contig_15 cds 44909 45652 + GCA009771085_00535 hypothetical protein contig_15 cds 45730 46137 + GCA009771085_00536 Flagellar operon protein SO:0001217, UniRef:UniRef50_R7IU54 contig_15 cds 46219 47898 + GCA009771085_00537 flgE Flagellar hook protein FlgE SO:0001217, UniRef:UniRef50_A0A3R6IIK3 contig_15 cds 48079 48873 + GCA009771085_00538 MotA/TolQ/ExbB proton channel domain-containing protein SO:0001217, UniRef:UniRef50_R9JEM3 contig_15 cds 48873 49820 + GCA009771085_00539 OmpA-like domain-containing protein SO:0001217, UniRef:UniRef50_N2BQ54 contig_15 cds 49859 50380 + GCA009771085_00540 hypothetical protein contig_15 cds 50426 51418 + GCA009771085_00541 fliM Flagellar motor switch protein FliM SO:0001217, UniRef:UniRef50_E0RUS0 contig_15 cds 51402 52586 + GCA009771085_00542 fliN Flagellar motor switch protein FliN SO:0001217, UniRef:UniRef50_A0A140L5D3 contig_15 cds 52602 52964 + GCA009771085_00543 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A1D7X954, UniRef:UniRef90_A0A1I6XWC5 contig_15 cds 52969 53346 + GCA009771085_00544 hypothetical protein contig_15 cds 53343 54188 + GCA009771085_00545 fliP Flagellar biosynthetic protein FliP SO:0001217, UniRef:UniRef50_R9KJ72 contig_15 cds 54259 54528 + GCA009771085_00546 fliQ Flagellar biosynthetic protein FliQ SO:0001217, UniRef:UniRef50_F2JGQ6 contig_15 cds 54548 55333 + GCA009771085_00547 fliR Flagellar biosynthetic protein FliR SO:0001217, UniRef:UniRef50_A0A7X5CAE4 contig_15 cds 55425 56564 + GCA009771085_00548 flhB Flagellar biosynthetic protein FlhB SO:0001217, UniRef:UniRef50_A0A7U9RPP3 contig_15 cds 56771 58831 + GCA009771085_00549 flhA Flagellar biosynthesis protein FlhA SO:0001217, UniRef:UniRef50_P35620 contig_15 cds 58821 60458 + GCA009771085_00550 hypothetical protein PFAM:PF00004.35, PFAM:PF00448.28 contig_15 cds 60461 61309 + GCA009771085_00551 MinD/ParA family protein SO:0001217, UniRef:UniRef50_A0A940ZTQ8 contig_15 cds 61622 62377 + GCA009771085_00552 hypothetical protein PFAM:PF07238.19 contig_15 cds 62374 63429 + GCA009771085_00553 hypothetical protein PFAM:PF00072.30, PFAM:PF01339.22 contig_15 cds 63432 65540 + GCA009771085_00554 cheA Chemotaxis protein CheA SO:0001217, UniRef:UniRef50_A0A1G6ARM0 contig_15 cds 65555 66022 + GCA009771085_00555 CheW-like domain-containing protein SO:0001217, UniRef:UniRef50_N2BKQ8 contig_15 cds 66061 66675 + GCA009771085_00556 CheC-like protein domain-containing protein SO:0001217, UniRef:UniRef50_S0J192 contig_15 cds 66705 67193 + GCA009771085_00557 cheD putative chemoreceptor glutamine deamidase CheD SO:0001217, UniRef:UniRef50_A0A0U1KVM9 contig_15 cds 67190 67657 + GCA009771085_00558 hypothetical protein contig_15 cds 67702 68463 + GCA009771085_00559 RNA polymerase sigma factor SO:0001217, UniRef:UniRef50_L7VI65 contig_15 cds 68486 70084 + GCA009771085_00560 hypothetical protein PFAM:PF03961.19 contig_15 cds 70169 70483 + GCA009771085_00561 hypothetical protein contig_15 cds 70521 71396 + GCA009771085_00562 hypothetical protein contig_15 cds 71400 72002 + GCA009771085_00563 hypothetical protein contig_15 cds 72271 72990 + GCA009771085_00564 Small ribosomal subunit protein uS2 SO:0001217, UniRef:UniRef50_Q8DIA2 contig_15 cds 73016 73951 + GCA009771085_00565 Elongation factor Ts SO:0001217, UniRef:UniRef50_Q895L1 contig_15 cds 74014 74922 + GCA009771085_00566 Polysaccharide deacetylase SO:0001217, UniRef:UniRef50_C0FQI4 contig_15 cds 74945 75757 + GCA009771085_00567 Polymer-forming protein SO:0001217, UniRef:UniRef50_A0A1H3FTN7 contig_15 cds 75764 76456 + GCA009771085_00568 Uridylate kinase SO:0001217, UniRef:UniRef50_A0AAE3JDU6 contig_15 cds 76434 77030 + GCA009771085_00569 Ribosome-recycling factor SO:0001217, UniRef:UniRef50_F1T541 contig_15 cds 77288 77998 + GCA009771085_00570 Isoprenyl transferase SO:0001217, UniRef:UniRef50_A0A7U9QWK3 contig_15 cds 78083 78895 + GCA009771085_00571 Phosphatidate cytidylyltransferase SO:0001217, UniRef:UniRef50_B0G362 contig_15 cds 78925 80079 + GCA009771085_00572 1-deoxy-D-xylulose 5-phosphate reductoisomerase SO:0001217, UniRef:UniRef50_A9KMX2 contig_15 cds 80091 81128 + GCA009771085_00573 Zinc metalloprotease SO:0001217, UniRef:UniRef50_A0A1G4P6K1 contig_15 cds 81237 82310 + GCA009771085_00574 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) SO:0001217, UniRef:UniRef50_P58667 contig_15 cds 82435 86826 + GCA009771085_00575 DNA polymerase III PolC-type SO:0001217, UniRef:UniRef50_A0A1H9QIZ1 contig_15 cds 86880 87173 + GCA009771085_00576 hypothetical protein PFAM:PF01817.26 contig_15 cds 87195 88016 + GCA009771085_00577 hypothetical protein PFAM:PF08282.18 contig_15 cds 88119 89675 + GCA009771085_00578 hypothetical protein contig_15 cds 90002 90496 + GCA009771085_00579 Translation initiation factor IF-3 SO:0001217, UniRef:UniRef50_Q728R6 contig_15 cds 90510 90707 + GCA009771085_00580 Large ribosomal subunit protein bL35 SO:0001217, UniRef:UniRef50_P66269 contig_15 cds 90729 91085 + GCA009771085_00581 Large ribosomal subunit protein bL20 SO:0001217, UniRef:UniRef50_P57228 contig_15 cds 91214 92230 + GCA009771085_00582 UDP-glucose 4-epimerase SO:0001217, UniRef:UniRef50_P24325 contig_15 tRNA 92319 92390 + GCA009771085_00583 trnE tRNA-Glu(ctc) SO:0000259 contig_15 cds 92479 92934 + GCA009771085_00584 rimP Ribosome maturation factor RimP SO:0001217, UniRef:UniRef50_C4ZBF8 contig_15 cds 92950 94158 + GCA009771085_00585 nusA Transcription termination/antitermination protein NusA SO:0001217, UniRef:UniRef50_A0A1I7F474 contig_15 cds 94317 94586 + GCA009771085_00586 hypothetical protein contig_15 cds 94579 94878 + GCA009771085_00587 Ribosomal protein eL8/eL30/eS12/Gadd45 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1L4BZT0 contig_15 cds 94899 97607 + GCA009771085_00588 hypothetical protein PFAM:PF00009.33, PFAM:PF00071.28, PFAM:PF03144.31, PFAM:PF04760.21, PFAM:PF11987.13, PFAM:PF22042.2 contig_15 cds 97655 98095 + GCA009771085_00589 hypothetical protein contig_15 cds 98202 99146 + GCA009771085_00590 recJ Phosphoesterase RecJ domain-containing protein SO:0001217, UniRef:UniRef50_S0IXZ4 contig_15 cds 99268 100197 + GCA009771085_00591 hypothetical protein contig_15 cds 100217 101128 + GCA009771085_00592 hypothetical protein PFAM:PF01467.32, PFAM:PF01687.23 contig_15 cds 101341 101607 + GCA009771085_00593 Small ribosomal subunit protein uS15 SO:0001217, UniRef:UniRef50_Q1GVQ9 contig_15 cds 101773 103860 + GCA009771085_00594 Polyribonucleotide nucleotidyltransferase SO:0001217, UniRef:UniRef50_A9KNK6 contig_15 cds 103864 104607 + GCA009771085_00595 Segregation and condensation protein A SO:0001217, UniRef:UniRef50_A0A3E2XNL3 contig_15 cds 104723 105292 + GCA009771085_00596 Segregation and condensation protein B SO:0001217, UniRef:UniRef50_A0A1Y4S222 contig_15 cds 105355 106257 + GCA009771085_00597 N-acetylmannosamine kinase SO:0001217, UniRef:UniRef50_A0A1Y3TNH9 contig_15 cds 106318 107595 + GCA009771085_00598 BaiN-like insert domain-containing protein SO:0001217, UniRef:UniRef50_A0A1G9G8K8 contig_15 cds 107658 108311 + GCA009771085_00599 Cytidylate kinase SO:0001217, UniRef:UniRef50_M8E2Z0 contig_15 cds 108422 109288 + GCA009771085_00600 4-hydroxy-3-methylbut-2-enyl diphosphate reductase SO:0001217, UniRef:UniRef50_A0A3D2IPA4 contig_15 cds 109258 110349 + GCA009771085_00601 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_C0CI71 contig_15 cds 110414 111202 + GCA009771085_00602 protein-glutamate O-methyltransferase SO:0001217, UniRef:UniRef50_A0A069RDM0 contig_15 cds 111791 113653 + GCA009771085_00603 Efflux ABC transporter, permease protein SO:0001217, UniRef:UniRef50_C0FZ08 contig_15 cds 113680 114366 + GCA009771085_00604 Antimicrobial peptide ABC transporter ATPase SO:0001217, UniRef:UniRef50_A0A4U9RN82 contig_15 cds 114429 115406 - GCA009771085_00605 hypothetical protein PFAM:PF13482.12 contig_15 cds 115589 117034 + GCA009771085_00606 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase SO:0001217, UniRef:UniRef50_A9KMU9 contig_15 cds 117069 117686 + GCA009771085_00607 hypothetical protein PFAM:PF00633.29, PFAM:PF01330.27, PFAM:PF07499.19, PFAM:PF14520.12 contig_15 cds 117820 118833 + GCA009771085_00608 ruvB Holliday junction branch migration complex subunit RuvB SO:0001217, UniRef:UniRef50_Q5WHR5 contig_15 cds 118930 119370 + GCA009771085_00609 zapA Cell division protein ZapA SO:0001217, UniRef:UniRef50_A0A7X4Z6E1 contig_15 cds 119390 121588 + GCA009771085_00610 hypothetical protein contig_15 cds 121588 122910 + GCA009771085_00611 hypothetical protein contig_15 cds 122903 124342 + GCA009771085_00612 hypothetical protein PFAM:PF00905.27, PFAM:PF21922.1 contig_15 cds 124423 125136 + GCA009771085_00613 hypothetical protein contig_15 cds 125123 125482 + GCA009771085_00614 ytfJ Sporulation protein YtfJ SO:0001217, UniRef:UniRef50_F7KAD2 contig_15 cds 125598 125783 + GCA009771085_00615 Large ribosomal subunit protein bL28 SO:0001217, UniRef:UniRef50_B8I388 contig_15 cds 125935 126294 + GCA009771085_00616 Asp23/Gls24 family envelope stress response protein SO:0001217, UniRef:UniRef50_G5GGR0 contig_15 cds 126266 127990 + GCA009771085_00617 dhaL DhaL domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I0B1E4 contig_15 cds 128099 130162 + GCA009771085_00618 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17191.10, PFAM:PF19833.4 contig_15 cds 130230 131981 - GCA009771085_00619 rqcH Rqc2-like protein RqcH SO:0001217, UniRef:UniRef50_A5ZQ83 contig_15 cds 132158 133036 + GCA009771085_00620 hypothetical protein PFAM:PF03755.18, PFAM:PF08340.16 contig_15 cds 133201 133455 + GCA009771085_00621 Putative regulatory protein Cphy_2880 SO:0001217, UniRef:UniRef50_A9KPG4 contig_15 cds 133448 134086 + GCA009771085_00622 Guanylate kinase SO:0001217, UniRef:UniRef50_A0A173RNL5 contig_15 cds 134086 134427 + GCA009771085_00623 DNA-directed RNA polymerase subunit omega SO:0001217, UniRef:UniRef50_R9KG79 contig_15 cds 134424 135743 + GCA009771085_00624 rimO Ribosomal protein uS12 methylthiotransferase RimO SO:0001217, UniRef:UniRef50_A9KLS2 contig_15 cds 135740 136282 + GCA009771085_00625 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase SO:0001217, UniRef:UniRef50_A0A6L5X787 contig_15 cds 136409 136966 + GCA009771085_00626 rsmD 16S rRNA (Guanine(966)-N(2))-methyltransferase RsmD SO:0001217, UniRef:UniRef50_A0A927TC49 contig_15 cds 136963 137466 + GCA009771085_00627 Phosphopantetheine adenylyltransferase SO:0001217, UniRef:UniRef50_A9KNU8 contig_15 cds 137456 138193 + GCA009771085_00628 hypothetical protein contig_15 cds 138361 139029 + GCA009771085_00629 hypothetical protein PFAM:PF00702.32 contig_15 cds 139156 140151 + GCA009771085_00630 hypothetical protein contig_15 cds 140123 140659 + GCA009771085_00631 recU Holliday junction resolvase RecU SO:0001217, UniRef:UniRef50_A0A1C5PRP2 contig_15 cds 140662 141906 + GCA009771085_00632 hypothetical protein contig_15 cds 142089 142397 + GCA009771085_00633 Large ribosomal subunit protein bL21 SO:0001217, UniRef:UniRef50_Q9K8J5 contig_15 cds 142403 142732 + GCA009771085_00634 hypothetical protein contig_15 cds 142736 143020 + GCA009771085_00635 rpmA 50S ribosomal protein L27 GO:0000315, GO:0003735, GO:0006412, GO:0022625, KEGG:K02899, SO:0001217, UniRef:UniRef50_P60493, UniRef:UniRef90_A0A6N7J027 contig_15 cds 143084 144367 + GCA009771085_00636 GTPase Obg SO:0001217, UniRef:UniRef50_A9KMF5 contig_15 cds 144432 144746 + GCA009771085_00637 yhbY Ribosome assembly RNA-binding protein YhbY SO:0001217, UniRef:UniRef50_A0A9D5RLV6 contig_15 cds 144743 145948 + GCA009771085_00638 hypothetical protein PFAM:PF01467.32 contig_15 cds 145966 146298 + GCA009771085_00639 rsfS Ribosomal silencing factor RsfS SO:0001217, UniRef:UniRef50_A0A0M6WCB1 contig_15 cds 146392 146631 + GCA009771085_00640 hypothetical protein contig_15 cds 146536 147156 - GCA009771085_00641 lexA LexA repressor SO:0001217, UniRef:UniRef50_B8I2Q1 contig_15 cds 147317 147655 + GCA009771085_00642 hypothetical protein PFAM:PF01476.26 contig_15 cds 147961 149043 + GCA009771085_00643 xerD Site-specific recombinase XerD SO:0001217, UniRef:UniRef50_R7QV60 contig_15 cds 149136 150236 - GCA009771085_00644 ylyB putative RNA pseudouridine synthase YlyB SO:0001217, UniRef:UniRef50_Q45480 contig_15 cds 150259 150780 - GCA009771085_00645 hypothetical protein contig_15 cds 150834 151919 - GCA009771085_00646 hypothetical protein PFAM:PF00465.25, PFAM:PF01761.26, PFAM:PF24621.2 contig_15 cds 151923 152552 - GCA009771085_00647 hypothetical protein contig_15 cds 152832 154208 - GCA009771085_00648 hypothetical protein contig_15 cds 154262 154684 - GCA009771085_00649 pilT Twitching motility protein PilT SO:0001217, UniRef:UniRef50_G5GGY0 contig_15 cds 154792 155730 - GCA009771085_00650 hypothetical protein PFAM:PF00768.25, PFAM:PF13354.11 contig_15 cds 155780 156175 - GCA009771085_00651 Methylglyoxal synthase SO:0001217, UniRef:UniRef50_A0A143XRR1 contig_15 cds 156188 157306 - GCA009771085_00652 ftsW putative peptidoglycan glycosyltransferase FtsW SO:0001217, UniRef:UniRef50_A0A9D2IK95 contig_15 cds 157312 157989 - GCA009771085_00653 hypothetical protein PFAM:PF03775.22, PFAM:PF05209.18, PFAM:PF22642.1 contig_15 cds 157991 160831 - GCA009771085_00654 mrdA Peptidoglycan D,D-transpeptidase MrdA SO:0001217, UniRef:UniRef50_A0A7U9X8W1 contig_15 cds 160828 161361 - GCA009771085_00655 hypothetical protein contig_15 cds 161361 162215 - GCA009771085_00656 mreC Cell shape-determining protein MreC SO:0001217, UniRef:UniRef50_A0A416I517 contig_15 cds 162225 163244 - GCA009771085_00657 mreB Cell shape-determining protein MreB SO:0001217, UniRef:UniRef50_N2B9T2 contig_15 cds 163258 163956 - GCA009771085_00658 hypothetical protein PFAM:PF20582.4 contig_15 cds 164002 165294 - GCA009771085_00659 Cystathionine beta-lyase family protein involved in aluminum resistance SO:0001217, UniRef:UniRef50_A0A7X5E7P1 contig_15 cds 165300 166235 - GCA009771085_00660 tRNA dimethylallyltransferase SO:0001217, UniRef:UniRef50_A0A285PU51 contig_15 cds 166257 168236 - GCA009771085_00661 hypothetical protein PFAM:PF02518.31, PFAM:PF08676.16, PFAM:PF13589.12 contig_15 cds 168230 170893 - GCA009771085_00662 mutS DNA mismatch repair protein MutS SO:0001217, UniRef:UniRef50_Q2RJG2 contig_15 cds 170883 172505 - GCA009771085_00663 FAD-dependent protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A5Z6B1 contig_15 cds 172691 173932 - GCA009771085_00664 hypothetical protein PFAM:PF01266.30, PFAM:PF03486.20, PFAM:PF13450.12 contig_15 cds 174007 175659 - GCA009771085_00665 Polysaccharide biosynthesis protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_F7V620 contig_15 cds 175666 176727 - GCA009771085_00666 DUF3048 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H2QEC7 contig_15 cds 176729 177223 - GCA009771085_00667 ybeY Endoribonuclease YbeY SO:0001217, UniRef:UniRef50_C4ZA59 contig_15 cds 177220 178449 - GCA009771085_00668 hypothetical protein contig_15 cds 178446 179444 - GCA009771085_00669 PhoH-like protein SO:0001217, UniRef:UniRef50_A0A1C5N7G7 contig_15 cds 179457 180599 - GCA009771085_00670 hypothetical protein PFAM:PF07719.23, PFAM:PF13240.11, PFAM:PF13287.12, PFAM:PF13290.12 contig_15 cds 180580 181449 - GCA009771085_00671 folD Bifunctional protein FolD SO:0001217, UniRef:UniRef50_P54382 contig_15 cds 181543 183228 - GCA009771085_00672 Formate--tetrahydrofolate ligase SO:0001217, UniRef:UniRef50_Q83WS0 contig_15 cds 183301 186471 - GCA009771085_00673 hypothetical protein PFAM:PF01580.24, PFAM:PF09397.16, PFAM:PF13491.11, PFAM:PF17854.6 contig_15 cds 186485 187222 - GCA009771085_00674 putative transcriptional regulatory protein CD630_07950 SO:0001217, UniRef:UniRef50_Q189Y9 contig_15 cds 187280 188116 - GCA009771085_00675 hypothetical protein PFAM:PF00571.33, PFAM:PF03471.22 contig_15 cds 188133 189305 - GCA009771085_00676 Alanine racemase SO:0001217, UniRef:UniRef50_A0A6N7SR08 contig_15 cds 189390 191198 - GCA009771085_00677 hypothetical protein PFAM:PF01256.23, PFAM:PF03853.21 contig_15 cds 191173 191868 - GCA009771085_00678 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1H2QDU1 contig_15 cds 191880 192506 - GCA009771085_00679 Redox-sensing transcriptional repressor Rex SO:0001217, UniRef:UniRef50_Q8RC93 contig_15 cds 192655 194592 - GCA009771085_00680 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_F7JIQ2 contig_15 cds 194703 195686 - GCA009771085_00681 hypothetical protein contig_15 cds 196068 198479 - GCA009771085_00682 Leucine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A949E1K8 contig_15 cds 198620 198853 - GCA009771085_00683 hypothetical protein contig_15 cds 198843 199883 - GCA009771085_00684 histidine kinase SO:0001217, UniRef:UniRef50_F0GXT5 contig_15 cds 199868 200539 - GCA009771085_00685 Response regulator receiver domain protein SO:0001217, UniRef:UniRef50_C2BI60 contig_15 cds 200624 200929 - GCA009771085_00686 hypothetical protein SO:0001217, UniRef:UniRef50_F0GXT3 contig_15 cds 200970 201083 - GCA009771085_00687 hypothetical protein contig_15 cds 201080 201382 - GCA009771085_00688 hypothetical protein contig_15 cds 201532 203616 - GCA009771085_00689 Elongation factor G SO:0001217, UniRef:UniRef50_A0A3P7P1P3 contig_15 cds 203742 204419 - GCA009771085_00690 hypothetical protein PFAM:PF00075.30, PFAM:PF01693.22, PFAM:PF13456.12 contig_15 cds 204574 205854 + GCA009771085_00691 3-phosphoshikimate 1-carboxyvinyltransferase SO:0001217, UniRef:UniRef50_A0A140L7T1 contig_15 cds 205858 207195 - GCA009771085_00692 NADH oxidase SO:0001217, UniRef:UniRef50_Q5XC60 contig_15 cds 207396 208775 - GCA009771085_00693 Argininosuccinate lyase SO:0001217, UniRef:UniRef50_Q74GT9 contig_15 cds 208775 209983 - GCA009771085_00694 Argininosuccinate synthase SO:0001217, UniRef:UniRef50_C0R1H5 contig_15 cds 210234 211751 - GCA009771085_00695 histidine kinase SO:0001217, UniRef:UniRef50_A0A371IKN7 contig_15 cds 211907 212413 - GCA009771085_00696 SEC-C domain-containing protein SO:0001217, UniRef:UniRef50_U2W5R5 contig_15 cds 212542 212796 + GCA009771085_00697 hypothetical protein contig_15 cds 212950 214239 - GCA009771085_00698 Adenylosuccinate synthetase SO:0001217, UniRef:UniRef50_V2YFN8 contig_15 cds 214266 215168 - GCA009771085_00699 degV DegV family protein SO:0001217, UniRef:UniRef50_E7GJ56 contig_15 cds 215288 216907 - GCA009771085_00700 Chaperonin GroEL SO:0001217, UniRef:UniRef50_Q9KKF0 contig_15 cds 216932 217216 - GCA009771085_00701 Co-chaperonin GroES SO:0001217, UniRef:UniRef50_P30719 contig_15 cds 217488 219722 - GCA009771085_00702 DNA topoisomerase (ATP-hydrolyzing) SO:0001217, UniRef:UniRef50_A0A1C6G258 contig_15 cds 219782 221734 - GCA009771085_00703 DNA topoisomerase (ATP-hydrolyzing) SO:0001217, UniRef:UniRef50_F7V7Y3 contig_15 cds 221770 222210 - GCA009771085_00704 dUTP diphosphatase SO:0001217, UniRef:UniRef50_D4CM17 contig_15 cds 222214 223224 - GCA009771085_00705 Glycerol-3-phosphate dehydrogenase [NAD(P)+] SO:0001217, UniRef:UniRef50_C4ZD61 contig_15 cds 223224 223877 - GCA009771085_00706 hypothetical protein contig_15 cds 223877 225202 - GCA009771085_00707 GTPase Der SO:0001217, UniRef:UniRef50_C4ZD63 contig_15 cds 225283 225582 - GCA009771085_00708 Flagellar biosynthesis protein SO:0001217, UniRef:UniRef50_A0A1M7Y2C6 contig_15 cds 225597 225953 - GCA009771085_00709 UPF0102 protein A2Y22_02445 SO:0001217, UniRef:UniRef50_A0A1F8UPC3 contig_15 cds 226082 227959 - GCA009771085_00710 hypothetical protein PFAM:PF02120.21 contig_15 cds 228012 228650 - GCA009771085_00711 Ribonuclease HII SO:0001217, UniRef:UniRef50_A9KLL7 contig_15 cds 228673 229344 - GCA009771085_00712 Signal peptidase I SO:0001217, UniRef:UniRef50_A0A927TVY3 contig_15 cds 229356 230240 - GCA009771085_00713 Ribosome biogenesis GTPase A SO:0001217, UniRef:UniRef50_A0A413FKR9 contig_15 cds 230363 230974 - GCA009771085_00714 Signal peptidase I SO:0001217, UniRef:UniRef50_A0A1H3GTK0 contig_15 cds 231051 231404 - GCA009771085_00715 Large ribosomal subunit protein bL19 SO:0001217, UniRef:UniRef50_A0A7V5EAH5 contig_15 cds 231502 232266 - GCA009771085_00716 tRNA (guanine-N(1)-)-methyltransferase SO:0001217, UniRef:UniRef50_A4J665 contig_15 cds 232263 232781 - GCA009771085_00717 hypothetical protein PFAM:PF01782.24, PFAM:PF05239.21, PFAM:PF24986.1 contig_15 cds 232838 233068 - GCA009771085_00718 khpA RNA-binding protein KhpA SO:0001217, UniRef:UniRef50_Q8XJP5 contig_15 cds 233096 233341 - GCA009771085_00719 Small ribosomal subunit protein bS16 SO:0001217, UniRef:UniRef50_A2RJS1 contig_15 cds 233381 234727 - GCA009771085_00720 Signal recognition particle protein SO:0001217, UniRef:UniRef50_A0AAP4EZC8 contig_15 cds 234727 235056 - GCA009771085_00721 UPF0122 protein C819_02534 SO:0001217, UniRef:UniRef50_R9MVN2 contig_15 cds 235196 236107 - GCA009771085_00722 ftsY Signal recognition particle receptor FtsY SO:0001217, UniRef:UniRef50_A0A7U9RTS7 contig_15 cds 236173 239730 - GCA009771085_00723 Chromosome partition protein Smc SO:0001217, UniRef:UniRef50_A0A8T4JRW7 contig_15 cds 239734 240426 - GCA009771085_00724 Ribonuclease 3 SO:0001217, UniRef:UniRef50_A0A9D2KZZ8 contig_15 cds 240501 240734 - GCA009771085_00725 Acyl carrier protein SO:0001217, UniRef:UniRef50_A0A143XVE8 contig_15 cds 240746 241741 - GCA009771085_00726 Phosphate acyltransferase SO:0001217, UniRef:UniRef50_A0A174YZZ7 contig_15 cds 241916 242107 - GCA009771085_00727 Large ribosomal subunit protein bL32 SO:0001217, UniRef:UniRef50_A6TRU4 contig_15 cds 242111 242629 - GCA009771085_00728 hypothetical protein contig_15 cds 242771 244033 + GCA009771085_00729 hypothetical protein PFAM:PF01467.32 contig_15 cds 244278 245114 - GCA009771085_00730 hypothetical protein contig_15 cds 245205 245879 - GCA009771085_00731 Uracil-DNA glycosylase SO:0001217, UniRef:UniRef50_P39615 contig_15 cds 245886 248069 - GCA009771085_00732 hypothetical protein contig_15 cds 248129 249073 - GCA009771085_00733 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_E0S2K9 contig_15 cds 249094 249918 - GCA009771085_00734 hypothetical protein contig_15 cds 249881 251389 - GCA009771085_00735 hypothetical protein PFAM:PF00512.31, PFAM:PF00672.30, PFAM:PF02518.31, PFAM:PF14501.12 contig_15 cds 251376 252056 - GCA009771085_00736 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A173U145 contig_15 cds 252076 252684 - GCA009771085_00737 hypothetical protein contig_15 cds 252797 254617 - GCA009771085_00738 hypothetical protein PFAM:PF00580.27, PFAM:PF13086.12, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_15 cds 254619 256088 - GCA009771085_00739 Glutamate--tRNA ligase SO:0001217, UniRef:UniRef50_A9KRX7 contig_15 cds 256101 257306 - GCA009771085_00740 hypothetical protein contig_15 cds 257324 258139 - GCA009771085_00741 hypothetical protein contig_15 cds 258265 259503 - GCA009771085_00742 hypothetical protein PFAM:PF18980.5 contig_15 cds 259519 263133 - GCA009771085_00743 hypothetical protein PFAM:PF18983.5 contig_15 cds 263235 265004 - GCA009771085_00744 Arginine--tRNA ligase SO:0001217, UniRef:UniRef50_C4ZD15 contig_15 cds 265009 265512 - GCA009771085_00745 queT QueT transporter family protein SO:0001217, UniRef:UniRef50_G2SX24 contig_15 cds 265596 266465 - GCA009771085_00746 DUF2225 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0M6WXR7 contig_15 cds 266475 268142 - GCA009771085_00747 Glutamine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A947YWN6 contig_15 cds 268250 269113 - GCA009771085_00748 Peptidase S54 rhomboid domain-containing protein SO:0001217, UniRef:UniRef50_A0A6L5X4M3 contig_15 cds 269310 271394 + GCA009771085_00749 htpG Chaperone protein HtpG SO:0001217, UniRef:UniRef50_A0A1D7XM16 contig_15 cds 271491 271754 - GCA009771085_00750 Glyoxalase SO:0001217, UniRef:UniRef50_R9K5I9 contig_15 cds 271834 275751 - GCA009771085_00751 hypothetical protein PFAM:PF00270.35, PFAM:PF00580.27, PFAM:PF12705.13, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_15 cds 275735 279112 - GCA009771085_00752 hypothetical protein PFAM:PF12705.13, PFAM:PF21445.3 contig_15 cds 279180 280256 - GCA009771085_00753 Peptide chain release factor 1 SO:0001217, UniRef:UniRef50_B4SAR5 contig_15 cds 280363 281319 - GCA009771085_00754 Release factor glutamine methyltransferase SO:0001217, UniRef:UniRef50_A0A1M6Z0I6 contig_15 cds 281282 281485 - GCA009771085_00755 rpmE 50S ribosomal protein L31 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_Q3A926, UniRef:UniRef90_C4GAL3 contig_15 cds 281648 281800 - GCA009771085_00756 hypothetical protein contig_15 cds 281803 282984 - GCA009771085_00757 Major facilitator superfamily (MFS) profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A133YLP9 contig_15 cds 283026 283199 - GCA009771085_00758 hypothetical protein contig_15 cds 283261 285252 - GCA009771085_00759 hypothetical protein PFAM:PF00006.31, PFAM:PF07497.18 contig_15 cds 285355 285870 - GCA009771085_00760 hypothetical protein contig_15 cds 286114 286812 - GCA009771085_00761 hypothetical protein contig_15 cds 287045 287686 - GCA009771085_00762 Glyoxylase, beta-lactamase superfamily II SO:0001217, UniRef:UniRef50_A0A1H2SDU2 contig_15 cds 287683 291207 - GCA009771085_00763 Pyruvate:ferredoxin oxidoreductase SO:0001217, UniRef:UniRef50_A0A3A4Q9Z1 contig_15 cds 291454 293094 + GCA009771085_00764 ABC transport system ATP-binding protein SO:0001217, UniRef:UniRef50_R5Y8E8 contig_15 cds 293227 295425 - GCA009771085_00765 SHS2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Q6QJI0 contig_15 cds 295418 296035 - GCA009771085_00766 Dephospho-CoA kinase SO:0001217, UniRef:UniRef50_A0A174JYD7 contig_15 cds 296124 298790 - GCA009771085_00767 DNA polymerase I SO:0001217, UniRef:UniRef50_A0A2K4ZH41 contig_15 cds 298909 300699 - GCA009771085_00768 Xaa-Pro dipeptidase SO:0001217, UniRef:UniRef50_A0A173RI28 contig_15 cds 300928 302346 - GCA009771085_00769 ftsZ Cell division protein FtsZ SO:0001217, UniRef:UniRef50_F0Z3W8 contig_15 cds 302412 303323 - GCA009771085_00770 hypothetical protein contig_15 cds 303333 304457 - GCA009771085_00771 ftsW putative peptidoglycan glycosyltransferase FtsW SO:0001217, UniRef:UniRef50_A0A1H3GVE2 contig_15 cds 304454 305809 - GCA009771085_00772 UDP-N-acetylmuramoylalanine--D-glutamate ligase SO:0001217, UniRef:UniRef50_A9KLU2 contig_15 cds 305941 306888 - GCA009771085_00773 Phospho-N-acetylmuramoyl-pentapeptide-transferase SO:0001217, UniRef:UniRef50_B9MQ98 contig_15 cds 307006 308898 - GCA009771085_00774 Peptidoglycan glycosyltransferase SO:0001217, UniRef:UniRef50_A0A2G3E9F6 contig_15 cds 308948 309415 - GCA009771085_00775 hypothetical protein contig_15 cds 309444 310388 - GCA009771085_00776 Ribosomal RNA small subunit methyltransferase H SO:0001217, UniRef:UniRef50_B0K8J9 contig_15 cds 310399 310836 - GCA009771085_00777 mraZ Transcriptional regulator MraZ SO:0001217, UniRef:UniRef50_B2TS31 contig_15 cds 311409 311744 + GCA009771085_00778 TM2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A8T3U5N3 contig_15 cds 311746 312108 + GCA009771085_00779 DUF2752 domain-containing protein SO:0001217, UniRef:UniRef50_UPI00338FC362 contig_15 cds 312126 312500 - GCA009771085_00780 DUF4186 domain-containing protein SO:0001217, UniRef:UniRef50_A0A173VXF6 contig_15 cds 312511 312690 - GCA009771085_00781 hypothetical protein contig_15 cds 312748 313506 - GCA009771085_00782 Transport permease protein SO:0001217, UniRef:UniRef50_A0A097AP53 contig_15 cds 313503 314399 - GCA009771085_00783 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A9E8S0U8 contig_15 cds 314976 315356 - GCA009771085_00784 hypothetical protein SO:0001217, UniRef:UniRef50_A5ZWT9 contig_15 cds 315864 316022 - GCA009771085_00785 hypothetical protein contig_15 cds 316061 316483 - GCA009771085_00786 Histidine kinase SO:0001217, UniRef:UniRef50_E0NKF6 contig_15 cds 316498 316701 - GCA009771085_00787 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_K1LEN8 contig_15 cds 316979 317848 - GCA009771085_00788 Phosphatidylglycerol--prolipoprotein diacylglyceryl transferase SO:0001217, UniRef:UniRef50_C4GAB8 contig_15 cds 317863 318924 - GCA009771085_00789 S-adenosylmethionine:tRNA ribosyltransferase-isomerase SO:0001217, UniRef:UniRef50_Q8XJ15 contig_15 cds 318964 321387 - GCA009771085_00790 Phenylalanine--tRNA ligase beta subunit SO:0001217, UniRef:UniRef50_A0A136WFE0 contig_15 cds 321510 322538 - GCA009771085_00791 Phenylalanine--tRNA ligase alpha subunit SO:0001217, UniRef:UniRef50_A6TNP8 contig_15 cds 322741 323919 - GCA009771085_00792 hypothetical protein PFAM:PF11799.13 contig_15 cds 324065 325267 - GCA009771085_00793 hypothetical protein contig_15 cds 325422 326483 - GCA009771085_00794 Cytidylate kinase-like family protein SO:0001217, UniRef:UniRef50_A0A1I0IRF1 contig_15 cds 326505 327848 - GCA009771085_00795 Transporter UIT6 family (TC 9-B53) SO:0001217, UniRef:UniRef50_R6Z6A5 contig_15 cds 328026 328427 - GCA009771085_00796 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1I2C6S6 contig_15 cds 328563 329900 - GCA009771085_00797 hypothetical protein contig_15 cds 329961 330761 - GCA009771085_00798 hypothetical protein contig_15 cds 330755 331450 - GCA009771085_00799 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_Q8DNT3 contig_15 cds 331453 331821 - GCA009771085_00800 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_G2T2T7 contig_15 cds 332016 332864 - GCA009771085_00801 ABC 3 transport family protein SO:0001217, UniRef:UniRef50_G9XCB4 contig_15 cds 332861 333739 - GCA009771085_00802 ABC 3 transport family protein SO:0001217, UniRef:UniRef50_V9HUG0 contig_15 cds 333729 334448 - GCA009771085_00803 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_H3NM45 contig_15 cds 334470 335408 - GCA009771085_00804 ABC transporter, substrate-binding protein SO:0001217, UniRef:UniRef50_K9CM99 contig_15 cds 335661 336968 - GCA009771085_00805 Aminopeptidase SO:0001217, UniRef:UniRef50_A0A1G5WRQ1 contig_15 cds 337130 339514 - GCA009771085_00806 hypothetical protein PFAM:PF02687.27 contig_15 cds 339521 340231 - GCA009771085_00807 bceA Bacitracin export ATP-binding protein BceA SO:0001217, UniRef:UniRef50_A0A174HJT3 contig_15 cds 340254 341045 - GCA009771085_00808 Metal ABC transporter permease SO:0001217, UniRef:UniRef50_Q251Z8 contig_15 cds 341062 341706 - GCA009771085_00809 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_N2BU76 contig_15 cds 341889 342065 - GCA009771085_00810 hypothetical protein contig_15 cds 342188 344536 - GCA009771085_00811 ATP-dependent DNA helicase SO:0001217, UniRef:UniRef50_A0A3R6A119 contig_15 cds 344678 345688 - GCA009771085_00812 Aspartate--ammonia ligase SO:0001217, UniRef:UniRef50_Q81F55 contig_15 cds 345789 347180 - GCA009771085_00813 Asparagine--tRNA ligase SO:0001217, UniRef:UniRef50_Q81L32 contig_15 cds 347295 347441 - GCA009771085_00814 hypothetical protein contig_15 cds 347754 348971 + GCA009771085_00815 hypothetical protein contig_15 cds 349026 349901 - GCA009771085_00816 tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_C9RLB2 contig_15 cds 350026 350523 - GCA009771085_00817 Small multi-drug export protein SO:0001217, UniRef:UniRef50_F3B6F1 contig_15 cds 350638 351345 + GCA009771085_00818 Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein SO:0001217, UniRef:UniRef50_F3BAX8 contig_15 cds 351407 353374 - GCA009771085_00819 Glutamine-dependent NAD(+) synthetase SO:0001217, UniRef:UniRef50_D7NAM1 contig_15 cds 353427 354470 + GCA009771085_00820 hypothetical protein contig_15 cds 354521 355477 - GCA009771085_00821 hypothetical protein PFAM:PF00561.26, PFAM:PF12146.15 contig_15 cds 355481 356413 - GCA009771085_00822 hypothetical protein contig_15 cds 356518 358464 - GCA009771085_00823 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF17768.7 contig_15 cds 358692 360449 - GCA009771085_00824 restriction endonuclease subunit S SO:0001217, UniRef:UniRef50_UPI0032C0FBE3 contig_15 cds 360625 361980 - GCA009771085_00825 ATPase SO:0001217, UniRef:UniRef50_D2Q690 contig_17 cds 499 1581 - GCA009771085_00826 hypothetical protein contig_18 cds 107 871 + GCA009771085_00827 yxlF ABC transporter ATP-binding protein YxlF SO:0001217, UniRef:UniRef50_A0A1V5RLS2 contig_18 cds 902 2671 + GCA009771085_00828 hypothetical protein contig_18 cds 2910 4502 + GCA009771085_00829 Flagellin SO:0001217, UniRef:UniRef50_A0A413QUQ1 contig_18 cds 4681 6210 + GCA009771085_00830 yfcC YfcC family protein SO:0001217, UniRef:UniRef50_Q8XLQ6 contig_18 cds 6494 8323 + GCA009771085_00831 asparagine synthase (glutamine-hydrolyzing) SO:0001217, UniRef:UniRef50_A0A1C6FL69 contig_18 cds 8428 9453 + GCA009771085_00832 Deoxyguanosinetriphosphate triphosphohydrolase-like protein SO:0001217, UniRef:UniRef50_A0A971P007 contig_18 cds 9535 11337 + GCA009771085_00833 hypothetical protein PFAM:PF00772.26, PFAM:PF01807.25, PFAM:PF08275.17, PFAM:PF10410.14, PFAM:PF13662.12 contig_18 cds 11373 12614 + GCA009771085_00834 sigA RNA polymerase sigma factor SigA SO:0001217, UniRef:UniRef50_P06224 contig_18 cds 12607 13422 + GCA009771085_00835 hypothetical protein PFAM:PF12847.13 contig_18 cds 13436 14311 + GCA009771085_00836 hypothetical protein contig_18 cds 14342 16009 + GCA009771085_00837 Nucleoside kinase SO:0001217, UniRef:UniRef50_A0A173ZJQ5 contig_18 ncRNA 16070 16417 + GCA009771085_00838 RNaseP_bact_a Bacterial RNase P class A RFAM:RF00010, SO:0000386 contig_18 cds 16583 17497 + GCA009771085_00839 hypothetical protein contig_18 cds 17497 19851 + GCA009771085_00840 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17764.6, PFAM:PF18074.6 contig_18 cds 19965 20456 + GCA009771085_00841 Peptide deformylase SO:0001217, UniRef:UniRef50_B9MR36 contig_18 cds 20458 21396 + GCA009771085_00842 Methionyl-tRNA formyltransferase SO:0001217, UniRef:UniRef50_C4ZEV8 contig_18 cds 21475 22188 + GCA009771085_00843 Zn-dependent protease SO:0001217, UniRef:UniRef50_A0A2T5IPL0 contig_18 cds 22188 23462 + GCA009771085_00844 hypothetical protein PFAM:PF01029.23, PFAM:PF13649.12, PFAM:PF13847.12 contig_18 cds 23470 24501 + GCA009771085_00845 rlmN putative dual-specificity RNA methyltransferase RlmN SO:0001217, UniRef:UniRef50_A4J582 contig_18 cds 24501 25223 + GCA009771085_00846 Serine/threonine phosphatase stp SO:0001217, UniRef:UniRef50_A0A7U9S5R6 contig_18 cds 25282 27177 + GCA009771085_00847 non-specific serine/threonine protein kinase SO:0001217, UniRef:UniRef50_A0A1I5WB45 contig_18 cds 27185 28051 + GCA009771085_00848 rsgA Small ribosomal subunit biogenesis GTPase RsgA SO:0001217, UniRef:UniRef50_C4ZEV1 contig_18 cds 28073 28723 + GCA009771085_00849 Ribulose-phosphate 3-epimerase SO:0001217, UniRef:UniRef50_A0A931T8B0 contig_18 cds 28798 29484 + GCA009771085_00850 hypothetical protein PFAM:PF04263.21, PFAM:PF04265.19 contig_18 cds 29515 30612 + GCA009771085_00851 hypothetical protein PFAM:PF02421.24, PFAM:PF06071.19 contig_18 cds 30659 31108 + GCA009771085_00852 hypothetical protein PFAM:PF03477.21, PFAM:PF22811.2 contig_18 cds 31286 31684 + GCA009771085_00853 hypothetical protein contig_18 cds 32047 32577 + GCA009771085_00854 yqeG YqeG family HAD IIIA-type phosphatase SO:0001217, UniRef:UniRef50_G2T171 contig_18 cds 32593 33045 + GCA009771085_00855 Ribose 5-phosphate isomerase B/allose 6-phosphate isomerase SO:0001217, UniRef:UniRef50_B7LM09 contig_18 cds 33085 33642 + GCA009771085_00856 Elongation factor P SO:0001217, UniRef:UniRef50_Q894F6 contig_18 cds 33784 34734 + GCA009771085_00857 Putative gluconeogenesis factor SO:0001217, UniRef:UniRef50_R7NHP4 contig_18 cds 34764 35474 + GCA009771085_00858 hypothetical protein PFAM:PF01648.25 contig_18 cds 35471 36292 + GCA009771085_00859 hypothetical protein contig_18 cds 36395 36769 + GCA009771085_00860 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A0M6WR64 contig_18 cds 36773 37654 + GCA009771085_00861 cheX Chemotaxis protein CheX SO:0001217, UniRef:UniRef50_A0A1Q9JX58 contig_22 cds 398 2182 - GCA009771085_00862 tet(O) tetracycline resistance ribosomal protection protein Tet(O) BlastRules:WP_012669445, COG:COG0480, COG:J, GO:0003924, GO:0005525, GO:0006412, GO:0032790, GO:0046677, KEGG:K18220, NCBIProtein:WP_014636291.1, SO:0001217, UniRef:UniRef50_Q47810, UniRef:UniRef90_P10952 contig_23 cds 261 1853 + GCA009771085_00863 hypothetical protein PFAM:PF00117.34, PFAM:PF06418.20, PFAM:PF07722.19 contig_23 cds 1866 2135 + GCA009771085_00864 Fatty acid kinase subunit A-like middle domain-containing protein SO:0001217, UniRef:UniRef50_C7RFI5 contig_23 cds 2178 3155 + GCA009771085_00865 BD-FAE-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A3C1WVT3 contig_23 cds 3218 4333 + GCA009771085_00866 hypothetical protein PFAM:PF00149.33 contig_23 cds 4462 5733 + GCA009771085_00867 Peptidase C14 SO:0001217, UniRef:UniRef50_A0A0B7LC30 contig_23 cds 5743 7104 + GCA009771085_00868 hypothetical protein PFAM:PF01473.26, PFAM:PF19085.6 contig_23 cds 7431 9239 + GCA009771085_00869 glmU Bifunctional protein GlmU SO:0001217, UniRef:UniRef50_A0A7U9SJZ4 contig_23 cds 9352 10254 + GCA009771085_00870 MobA-like NTP transferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A133Z028 contig_23 cds 10244 11881 + GCA009771085_00871 Betaine/carnitine/choline transporter SO:0001217, UniRef:UniRef50_G9WPU0 contig_23 cds 11949 12905 + GCA009771085_00872 licD1 Lipopolysaccharide cholinephosphotransferase LicD1 SO:0001217, UniRef:UniRef50_A0A0M2NG51 contig_23 cds 12944 13540 - GCA009771085_00873 Cytidylate kinase SO:0001217, UniRef:UniRef50_C4G8K5 contig_23 cds 13743 14423 + GCA009771085_00874 hypothetical protein PFAM:PF00491.26 contig_23 cds 14515 15153 - GCA009771085_00875 hypothetical protein PFAM:PF00156.33, PFAM:PF14681.12 contig_23 cds 15354 16745 + GCA009771085_00876 Uracil-xanthine permease SO:0001217, UniRef:UniRef50_F7V1K5 contig_23 cds 16864 17379 - GCA009771085_00877 hypothetical protein contig_23 cds 17670 19232 + GCA009771085_00878 GMP synthase [glutamine-hydrolyzing] SO:0001217, UniRef:UniRef50_A3DCD4 contig_23 cds 19415 20083 - GCA009771085_00879 MotA/TolQ/ExbB proton channel domain-containing protein SO:0001217, UniRef:UniRef50_B0G6H5, UniRef:UniRef90_A0A2J8B2J0 contig_23 cds 20136 20633 - GCA009771085_00880 helix-turn-helix domain-containing protein SO:0001217, UniRef:UniRef50_K0XV34, UniRef:UniRef90_UPI003626D8D7 contig_23 cds 20898 21089 + GCA009771085_00881 DNA-binding protein SO:0001217, UniRef:UniRef50_K0Y654, UniRef:UniRef90_K0Y654 contig_23 cds 21101 21826 + GCA009771085_00882 site-specific integrase SO:0001217, UniRef:UniRef50_UPI0024309D02 contig_23 cds 22183 22341 + GCA009771085_00883 (pseudo) Mobilization protein SO:0001217, UniRef:UniRef50_V1CMM6, UniRef:UniRef90_V1CMM6 contig_23 cds 22348 22566 + GCA009771085_00884 nikA (pseudo) Mobilization protein NikA SO:0001217, UniRef:UniRef50_A0A377HRA7, UniRef:UniRef90_A0A377HRA7 contig_23 cds 22659 23579 + GCA009771085_00885 DNA primase SO:0001217, UniRef:UniRef50_G5GEN2, UniRef:UniRef90_V1CJ50 contig_23 cds 23576 24538 + GCA009771085_00886 AAA family ATPase SO:0001217, UniRef:UniRef50_V1DCI3, UniRef:UniRef90_V1DCI3 contig_23 cds 24807 25187 + GCA009771085_00887 Bacterial mobilisation domain-containing protein SO:0001217, UniRef:UniRef50_M2Q4B8, UniRef:UniRef90_U7UCM8 contig_23 cds 25187 26623 + GCA009771085_00888 MobA/VirD2-like nuclease domain-containing protein SO:0001217, UniRef:UniRef50_A0AAE4AJR3, UniRef:UniRef90_M2P9R0 contig_23 cds 26770 26991 + GCA009771085_00889 putative transcriptional regulator SO:0001217, UniRef:UniRef50_B0S1X9, UniRef:UniRef90_A0A1V4AYL6 contig_23 cds 26993 28015 + GCA009771085_00890 Cytosine-specific methyltransferase EC:2.1.1.37, KEGG:K00558, SO:0001217, UniRef:UniRef50_A0A084F1C5, UniRef:UniRef90_A0A084F1C5 contig_23 cds 28029 28985 + GCA009771085_00891 HaeIII family restriction endonuclease SO:0001217, UniRef:UniRef50_O68584, UniRef:UniRef90_UPI000D303FB0 contig_23 cds 29068 29715 + GCA009771085_00892 DUF5343 domain-containing protein SO:0001217, UniRef:UniRef50_A0A078KUW4 contig_23 cds 29725 30300 + GCA009771085_00893 Swt1-like HEPN domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H4T9K7 contig_23 ncRNA 30555 30685 + GCA009771085_00894 SpR18_sRNA Streptococcus sRNA SpR18 RFAM:RF02446, SO:0000655 contig_23 cds 30707 32146 - GCA009771085_00895 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2C6C822, UniRef:UniRef90_UPI00241F6F38 contig_24 cds 160 591 + GCA009771085_00896 hypothetical protein SO:0001217, UniRef:UniRef50_C2BG51 contig_24 cds 625 828 + GCA009771085_00897 hypothetical protein contig_24 cds 905 1141 + GCA009771085_00898 hypothetical protein contig_24 cds 1093 1767 + GCA009771085_00899 hypothetical protein PFAM:PF01464.25 contig_24 cds 1771 1998 + GCA009771085_00900 hypothetical protein contig_24 cds 2038 2253 + GCA009771085_00901 hypothetical protein contig_25 cds 352 498 - GCA009771085_00902 mobC (pseudo) plasmid mobilization relaxosome protein MobC SO:0001217, UniRef:UniRef50_C2CJ58, UniRef:UniRef90_UPI0036F1E93C contig_25 ncRNA 519 649 - GCA009771085_00903 SpR18_sRNA Streptococcus sRNA SpR18 RFAM:RF02446, SO:0000655 contig_25 cds 530 649 - GCA009771085_00904 hypothetical protein contig_25 cds 824 2128 - GCA009771085_00905 FRG domain-containing protein SO:0001217, UniRef:UniRef50_UPI001E5C0C0F, UniRef:UniRef90_UPI001E5C0C0F contig_25 cds 2590 2913 - GCA009771085_00906 hypothetical protein PFAM:PF04326.19 contig_25 cds 2876 3001 - GCA009771085_00907 hypothetical protein contig_25 cds 3227 3391 - GCA009771085_00908 hypothetical protein SO:0001217, UniRef:UniRef50_UPI00291435B2 contig_25 cds 3469 3702 - GCA009771085_00909 hypothetical protein contig_25 cds 3858 4013 - GCA009771085_00910 Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein SO:0001217, UniRef:UniRef50_G4D6L9 contig_25 cds 4310 4552 - GCA009771085_00911 (pseudo) Recombinase family protein SO:0001217, UniRef:UniRef50_A0A3D1X8Q7, UniRef:UniRef90_UPI002598C415 contig_25 ncRNA-region 4640 4705 - pemK RNA RFAM:RF02913, SO:0005836 contig_25 cds 5136 5693 - GCA009771085_00912 DUF2971 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2T3FQ51 contig_25 cds 5825 6130 - GCA009771085_00913 RNA polymerase sigma-70 region 4 domain-containing protein SO:0001217, UniRef:UniRef50_U2ZSG4 contig_25 cds 6553 7710 - GCA009771085_00914 Iron dependent repressor DNA binding domain protein SO:0001217, UniParc:UPI0001C4F1B2, UniRef:UniRef100_D3R2R2, UniRef:UniRef50_D3R2R2, UniRef:UniRef90_D3R2R2 contig_25 cds 7722 9431 - GCA009771085_00915 mdlB Multidrug export ATP-binding/permease protein COG:COG1132, COG:V, RefSeq:WP_012993135.1, SO:0001217, UniParc:UPI0001C4ED17, UniRef:UniRef100_D3R2R3, UniRef:UniRef50_G9WP67, UniRef:UniRef90_A0A564TV41 contig_25 cds 9431 11221 - GCA009771085_00916 mdlB ABC transporter COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_F9EF83, UniRef:UniRef90_G1VJG7 contig_25 cds 11190 12659 - GCA009771085_00917 ccmA heme ABC exporter ATP-binding protein CcmA COG:COG1122, COG:PR, EC:7.6.2.5, GO:0015439, GO:0015886, GO:0017004, GO:0022857, GO:0043190, SO:0001217, UniRef:UniRef50_G9WS00, UniRef:UniRef90_A0A564TV53 contig_25 cds 12656 13387 - GCA009771085_00918 ecfT Energy-coupling factor transporter transmembrane protein EcfT COG:COG0619, COG:H, SO:0001217, UniRef:UniRef50_Q24RE1, UniRef:UniRef90_A0A564TV89 contig_25 cds 13384 13983 - GCA009771085_00919 TIGR02185 family protein KEGG:K16926, RefSeq:WP_023055085.1, SO:0001217, UniParc:UPI0003059784, UniRef:UniRef100_D3R2R7, UniRef:UniRef50_D3R2R7, UniRef:UniRef90_D3R2R7 contig_25 cds 14169 15149 + GCA009771085_00920 araC HTH araC/xylS-type domain-containing protein COG:COG2207, COG:K, RefSeq:WP_012993131.1, SO:0001217, UniParc:UPI0001C4EDF8, UniRef:UniRef100_D3R2R8, UniRef:UniRef50_A0A0P9AD15, UniRef:UniRef90_G1VJH1 contig_25 cds 15195 16403 - GCA009771085_00921 araC Transcriptional regulator, AraC family RefSeq:WP_012993130.1, SO:0001217, UniParc:UPI0001C4F276, UniRef:UniRef100_D3R2R9, UniRef:UniRef50_G5GI44, UniRef:UniRef90_D3R2R9 contig_25 cds 16677 17033 + GCA009771085_00922 mobC Plasmid mobilization relaxosome protein MobC RefSeq:WP_000013383.1, SO:0001217, UniParc:UPI0001C4F14A, UniRef:UniRef100_D3R2S0, UniRef:UniRef50_B6W673, UniRef:UniRef90_A0A137STH9 contig_25 cds 17036 18394 + GCA009771085_00923 Relaxase/mobilization nuclease domain protein SO:0001217, UniRef:UniRef50_G5GKN0, UniRef:UniRef90_F9MMS0 contig_25 cds 18386 22162 - GCA009771085_00924 YobI-like P-loop NTPase domain-containing protein RefSeq:WP_007392071.1, SO:0001217, UniParc:UPI00021A2478, UniRef:UniRef100_F9MMS1, UniRef:UniRef50_A0A7W9W1E9, UniRef:UniRef90_F9MMS1 contig_25 cds 22172 22378 - GCA009771085_00925 HTH cro/C1-type domain-containing protein RefSeq:WP_007392052.1, SO:0001217, UniParc:UPI00021A2479, UniRef:UniRef100_F9MMS2, UniRef:UniRef50_A0A1S6ILX3, UniRef:UniRef90_F9MMS2 contig_25 cds 22504 22809 - GCA009771085_00926 (pseudo) Single-strand binding family protein SO:0001217, UniRef:UniRef50_F9MMS3, UniRef:UniRef90_F9MMS3 contig_25 cds 22903 23136 - GCA009771085_00927 Conserved domain protein SO:0001217, UniParc:UPI00021A247B, UniRef:UniRef100_F9MMS4, UniRef:UniRef50_A0A134CMB7, UniRef:UniRef90_F9MMS4 contig_25 cds 23179 23322 - GCA009771085_00928 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_G9WZB9, UniRef:UniRef50_U7UM64, UniRef:UniRef90_E1NRY5 contig_25 cds 23610 23921 + GCA009771085_00929 Conserved domain protein RefSeq:WP_007392112.1, SO:0001217, UniParc:UPI00021A247C, UniRef:UniRef100_F9MMS5, UniRef:UniRef50_A0A971VK70, UniRef:UniRef90_F9MMS5 contig_26 cds 118 1200 - GCA009771085_00930 rhuM Toxin-antitoxin system, toxin component, Fic family COG:COG3943, COG:S, SO:0001217, UniRef:UniRef50_A3CVL6, UniRef:UniRef90_C2CF14 contig_26 cds 1193 1381 - GCA009771085_00931 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_UPI00321C1DE2, UniRef:UniRef90_UPI00321C1DE2 contig_27 cds 392 679 + GCA009771085_00932 hypothetical protein contig_27 tRNA 762 834 - GCA009771085_00933 trnK tRNA-Lys(ttt) SO:0000265 contig_27 tRNA 863 934 - GCA009771085_00934 trnQ tRNA-Gln(ttg) SO:0000261 contig_27 tRNA 962 1035 - GCA009771085_00935 trnH tRNA-His(gtg) SO:0000262 contig_27 tRNA 1041 1114 - GCA009771085_00936 trnR tRNA-Arg(tct) SO:0001036 contig_27 tRNA 1120 1190 - GCA009771085_00937 trnG tRNA-Gly(tcc) SO:0000260 contig_27 tRNA 1206 1280 - GCA009771085_00938 trnP tRNA-Pro(tgg) SO:0000268 contig_27 cds 1510 1989 - GCA009771085_00939 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_27 cds 2197 2802 - GCA009771085_00940 dITP/XTP pyrophosphatase SO:0001217, UniRef:UniRef50_A0A3E3K434 contig_27 cds 2825 3850 - GCA009771085_00941 hypothetical protein PFAM:PF01520.23 contig_27 cds 3834 5519 - GCA009771085_00942 hypothetical protein PFAM:PF00112.29, PFAM:PF07833.16, PFAM:PF18560.7 contig_27 cds 5604 6752 - GCA009771085_00943 THUMP domain-containing protein SO:0001217, UniRef:UniRef50_R9J645 contig_27 cds 6881 7366 - GCA009771085_00944 Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase SO:0001217, UniRef:UniRef50_A0A0A8B419 contig_27 cds 7553 8191 - GCA009771085_00945 hypothetical protein contig_27 cds 8327 9280 + GCA009771085_00946 Proline iminopeptidase SO:0001217, UniRef:UniRef50_A0A0R1MGT7, UniRef:UniRef90_C8PB32 contig_27 cds 9272 10891 - GCA009771085_00947 Site-specific recombinase KEGG:K06400, SO:0001217, UniRef:UniRef50_G9WZC1, UniRef:UniRef90_A0A0Z8JC25 contig_27 cds 10970 11131 - GCA009771085_00948 recR Recombinase RecR RefSeq:WP_398590558.1, SO:0001217, UniParc:UPI002A7B5841, UniRef:UniRef100_UPI002A7B5841, UniRef:UniRef50_A0A1W1VBD7, UniRef:UniRef90_A0A0Z8JC34 contig_27 cds 11192 12037 - GCA009771085_00949 Putative DNA replication protein SO:0001217, UniRef:UniRef50_A0A9X9SQC3, UniRef:UniRef90_A0A822VK04 contig_27 cds 12169 12891 - GCA009771085_00950 Replisome organizer SO:0001217, UniRef:UniRef50_D6GRG9 contig_27 cds 12979 14028 - GCA009771085_00951 KilA-N DNA-binding domain-containing protein SO:0001217, UniRef:UniRef50_M2P6T4, UniRef:UniRef90_E0NMJ8 contig_27 cds 14129 15835 - GCA009771085_00952 mobQ MobQ family relaxase SO:0001217, UniRef:UniRef50_G5GKH6, UniRef:UniRef90_A0A223ATT6 contig_27 cds 16243 16653 - GCA009771085_00953 PF12958 family protein SO:0001217, UniRef:UniRef50_G9WYY7 contig_27 cds 16744 16971 - GCA009771085_00954 hypothetical protein SO:0001217, UniRef:UniRef50_UPI0015540AC7, UniRef:UniRef90_UPI0015540AC7 contig_27 cds 17932 18738 + GCA009771085_00955 hipB ICESt1 APR2 Cro/CI family transcriptional regulator COG:COG1396, COG:K, RefSeq:WP_311679162.1, SO:0001217, UniParc:UPI00288B3910, UniRef:UniRef100_UPI00288B3910, UniRef:UniRef50_R9JYU9, UniRef:UniRef90_A0A116MJM8 contig_28 cds 97 420 + GCA009771085_00956 Terminase large subunit-like endonuclease domain-containing protein SO:0001217, UniRef:UniRef50_C8PC14, UniRef:UniRef90_A0A7T3W1I6 contig_28 cds 432 1664 + GCA009771085_00957 Phage portal protein, HK97 family SO:0001217, UniRef:UniRef50_C0CKU9 contig_28 cds 1657 2400 + GCA009771085_00958 ATP-dependent Clp protease proteolytic subunit SO:0001217, UniRef:UniRef50_A0A0K8J6U3 contig_28 cds 2490 3677 + GCA009771085_00959 HK97 family phage major capsid protein SO:0001217, UniRef:UniRef50_U5F8F8 contig_28 cds 3695 3970 + GCA009771085_00960 Phage gp6-like head-tail connector protein SO:0001217, UniRef:UniRef50_S0J1S9 contig_28 cds 3970 4302 + GCA009771085_00961 Phage head-tail adaptor SO:0001217, UniRef:UniRef50_N2AWJ1 contig_28 cds 4302 4679 + GCA009771085_00962 HK97 gp10 family phage protein SO:0001217, UniRef:UniRef50_R9KP88 contig_28 cds 4679 5026 + GCA009771085_00963 Prophage pi2 protein 38 SO:0001217, UniRef:UniRef50_U2LF79 contig_28 cds 5044 5652 + GCA009771085_00964 Phage major tail protein, phi13 family SO:0001217, UniRef:UniRef50_A0A916VEM1 contig_28 cds 5674 6048 + GCA009771085_00965 Tail assembly chaperone SO:0001217, UniRef:UniRef50_A0A4R3JBH1 contig_28 cds 6045 6209 + GCA009771085_00966 Toxin-antitoxin system, antitoxin component, ribbon-helix-helix domain protein SO:0001217, UniRef:UniRef50_U2JPC5 contig_28 cds 6272 8833 + GCA009771085_00967 TP901 family phage tail tape measure protein SO:0001217, UniRef:UniRef50_A0A4R3Z8U1 contig_28 gap 8950 9045 . contig_28 cds 9143 10699 + GCA009771085_00968 inlB InlB B-repeat-containing protein SO:0001217, UniRef:UniRef50_A0A9E5KS96 contig_28 cds 10683 12695 + GCA009771085_00969 Alpha-L-rhamnosidase six-hairpin glycosidase domain-containing protein SO:0001217, UniRef:UniRef50_A0A969ZW23 contig_28 cds 12791 13195 + GCA009771085_00970 Holin SO:0001217, UniRef:UniRef50_S6ESX1 contig_28 cds 13199 13969 + GCA009771085_00971 lysozyme SO:0001217, UniRef:UniRef50_A0A7T7ZAG9 contig_28 cds 14108 14509 + GCA009771085_00972 RNA polymerase subunit sigma-70 SO:0001217, UniRef:UniRef50_A0A3E2CS56, UniRef:UniRef90_A0A3E2CS56 contig_28 cds 14502 14678 + GCA009771085_00973 SHOCT domain-containing protein SO:0001217, UniRef:UniRef50_A0A1W1UFP2, UniRef:UniRef90_UPI0015E11788 contig_28 cds 14723 16489 + GCA009771085_00974 Recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_R9IZR9, UniRef:UniRef90_A0A3E2CSJ6 contig_28 cds 16479 18056 + GCA009771085_00975 Recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_R9J467, UniRef:UniRef90_A0A3E2CSV8 contig_28 cds 18363 20744 + GCA009771085_00976 LPXTG-motif protein cell wall anchor domain protein SO:0001217, UniRef:UniRef50_A0A2K1SVK0 contig_28 cds 20854 22962 + GCA009771085_00977 Eco57I restriction-modification methylase domain-containing protein SO:0001217, UniRef:UniRef50_UPI000BB16FC5, UniRef:UniRef90_UPI000B919BF0 contig_28 cds 22962 23648 + GCA009771085_00978 hypothetical protein RefSeq:WP_276881537.1, SO:0001217, UniParc:UPI0023EFA5CB, UniRef:UniRef100_UPI0023EFA5CB, UniRef:UniRef50_A0A3P2AA93, UniRef:UniRef90_UPI0023EFA5CB contig_29 cds 719 928 + GCA009771085_00979 hypothetical protein SO:0001217, UniRef:UniRef50_A0A133YGE4, UniRef:UniRef90_A0A133YGE4 contig_29 cds 888 2534 + GCA009771085_00980 recombinase family protein SO:0001217, UniRef:UniRef50_UPI001E65B759 contig_29 cds 2555 2725 + GCA009771085_00981 hypothetical protein contig_29 cds 2685 2891 + GCA009771085_00982 type II toxin-antitoxin system Phd/YefM family antitoxin SO:0001217, UniRef:UniRef50_A0A0R2KR78, UniRef:UniRef90_UPI00254E4D7F contig_29 cds 2912 3553 + GCA009771085_00983 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A3D1BIG0 contig_29 cds 3920 4147 + GCA009771085_00984 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_W6RTY0 contig_29 cds 4150 5367 + GCA009771085_00985 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_A0A1B1S8V7 contig_29 cds 5364 6863 + GCA009771085_00986 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_A0A1C5RKF4 contig_29 cds 6875 7522 + GCA009771085_00987 hypothetical protein SO:0001217, UniRef:UniRef50_UPI000DCFA7FB contig_29 cds 7515 8942 + GCA009771085_00988 hypothetical protein PFAM:PF07728.20 contig_29 cds 8935 10239 + GCA009771085_00989 LlaJI restriction endonuclease SO:0001217, UniRef:UniRef50_B0MB39, UniRef:UniRef90_B0MB39 contig_29 cds 10278 11465 - GCA009771085_00990 CGNR zinc finger domain-containing protein SO:0001217, UniRef:UniRef50_B0MB38 contig_29 cds 11694 11831 + GCA009771085_00991 SMP domain-containing protein SO:0001217, UniRef:UniRef50_K1LNA5, UniRef:UniRef90_A0A133Y3U7 contig_29 cds 12099 12731 + GCA009771085_00992 RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A4D6AR69 contig_29 cds 12830 13009 + GCA009771085_00993 hypothetical protein SO:0001217, UniRef:UniRef50_A0A133XQK1 contig_29 cds 13021 13308 + GCA009771085_00994 rRNA biogenesis protein rrp5 SO:0001217, UniRef:UniRef50_S4H101 contig_29 cds 13316 14443 + GCA009771085_00995 Nuclease SO:0001217, UniRef:UniRef50_A0A366SHJ7 contig_29 cds 14445 14993 + GCA009771085_00996 Phage-associated protein SO:0001217, UniRef:UniRef50_C2EVF5 contig_29 cds 15056 17023 + GCA009771085_00997 DNA-directed DNA polymerase SO:0001217, UniRef:UniRef50_S6EYH9 contig_29 cds 17123 17914 + GCA009771085_00998 Bro-N domain-containing protein SO:0001217, UniRef:UniRef50_A0A140L201 contig_29 cds 17907 18269 + GCA009771085_00999 DUF4406 domain-containing protein SO:0001217, UniRef:UniRef50_A0A134CHB4 contig_29 cds 18274 20487 + GCA009771085_01000 SF3 helicase domain-containing protein SO:0001217, UniRef:UniRef50_A0A6N2UMX0 contig_29 cds 20570 20749 + GCA009771085_01001 hypothetical protein contig_29 cds 20862 21152 + GCA009771085_01002 VRR-NUC domain-containing protein SO:0001217, UniRef:UniRef50_S6EYH4 contig_29 cds 21133 22473 + GCA009771085_01003 DNA repair and recombination protein SO:0001217, UniRef:UniRef50_F8E029 contig_29 cds 22576 22977 + GCA009771085_01004 DUF1492 domain-containing protein SO:0001217, UniRef:UniRef50_D6S6T9 contig_29 cds 23181 23549 + GCA009771085_01005 yajD Putative HNH nuclease YajD SO:0001217, UniRef:UniRef50_A0A841KRL3 contig_30 cds 221 583 + GCA009771085_01006 Gp49-like PF05973 family protein SO:0001217, UniRef:UniRef50_J4TBT6 contig_30 cds 576 860 + GCA009771085_01007 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_G9WK30 contig_30 cds 1392 1604 + GCA009771085_01008 hypothetical protein contig_30 tRNA 1713 1785 - GCA009771085_01009 trnK tRNA-Lys(ctt) SO:0000265 contig_30 cds 1857 3713 - GCA009771085_01010 hypothetical protein contig_30 tRNA 3897 3970 - GCA009771085_01011 trnR tRNA-Arg(cct) SO:0001036 contig_30 cds 4003 4869 - GCA009771085_01012 hypothetical protein contig_30 cds 4944 5447 - GCA009771085_01013 DUF4446 domain-containing protein SO:0001217, UniRef:UniRef50_UPI001568EA97 contig_30 cds 5505 6428 - GCA009771085_01014 ParB/Sulfiredoxin domain-containing protein SO:0001217, UniRef:UniRef50_F7JRP3 contig_30 cds 6428 7198 - GCA009771085_01015 AAA domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Z9IRV3 contig_30 cds 7509 8243 - GCA009771085_01016 Ribosomal RNA small subunit methyltransferase G SO:0001217, UniRef:UniRef50_B0MH47 contig_30 cds 8358 10259 - GCA009771085_01017 hypothetical protein PFAM:PF07992.20, PFAM:PF13932.14, PFAM:PF21680.2 contig_30 cds 10446 11843 - GCA009771085_01018 mnmE tRNA modification GTPase MnmE SO:0001217, UniRef:UniRef50_A9KLX9 contig_30 cds 11905 12666 - GCA009771085_01019 khpB RNA-binding protein KhpB SO:0001217, UniRef:UniRef50_A0A927T347 contig_30 cds 12683 13951 - GCA009771085_01020 yidC Membrane protein YidC 1 SO:0001217, UniRef:UniRef50_A0A0M6WLW6 contig_30 cds 13957 14202 - GCA009771085_01021 Putative membrane protein insertion efficiency factor SO:0001217, UniRef:UniRef50_A5I819 contig_30 cds 14206 14544 - GCA009771085_01022 Ribonuclease P protein component SO:0001217, UniRef:UniRef50_C0CSB4 contig_30 cds 14617 14751 - GCA009771085_01023 Large ribosomal subunit protein bL34 SO:0001217, UniRef:UniRef50_P80340 contig_30 cds 15005 16345 + GCA009771085_01024 dnaA Chromosomal replication initiator protein DnaA SO:0001217, UniRef:UniRef50_A0A1M6ISA2 contig_30 cds 16509 17612 + GCA009771085_01025 Beta sliding clamp SO:0001217, UniRef:UniRef50_A0A354I316 contig_30 cds 17629 17847 + GCA009771085_01026 RNA-binding S4 domain-containing protein SO:0001217, UniRef:UniRef50_A0A829NL56 contig_30 cds 17844 18935 + GCA009771085_01027 recF DNA replication and repair protein RecF SO:0001217, UniRef:UniRef50_C4Z176 contig_30 cds 18953 20875 + GCA009771085_01028 DNA gyrase subunit B SO:0001217, UniRef:UniRef50_R6C6R9 contig_30 cds 20890 23334 + GCA009771085_01029 DNA gyrase subunit A SO:0001217, UniRef:UniRef50_A0A174GCP3 contig_30 tRNA 23477 23564 + GCA009771085_01030 trnS tRNA-Ser(gct) SO:0000269 contig_31 cds 627 1781 + GCA009771085_01031 cysteine desulfurase SO:0001217, UniRef:UniRef50_C0FQM5 contig_31 cds 1827 3017 + GCA009771085_01032 putative tRNA sulfurtransferase SO:0001217, UniRef:UniRef50_C4Z0P7 contig_31 cds 3288 3521 - GCA009771085_01033 HPr domain-containing protein SO:0001217, UniRef:UniRef50_S0IY06 contig_31 cds 3607 4935 + GCA009771085_01034 miaB (Dimethylallyl)adenosine tRNA methylthiotransferase MiaB SO:0001217, UniRef:UniRef50_A0A174L320 contig_31 cds 4969 5235 + GCA009771085_01035 UPF0297 protein Cthe_0151 SO:0001217, UniRef:UniRef50_A3DBR3 contig_31 cds 5235 5666 + GCA009771085_01036 Putative pre-16S rRNA nuclease SO:0001217, UniRef:UniRef50_A9KKS6 contig_31 cds 5669 5920 + GCA009771085_01037 hypothetical protein contig_31 cds 5948 7612 + GCA009771085_01038 Ribonuclease J SO:0001217, UniRef:UniRef50_A0A173RL01 contig_31 cds 7614 8255 + GCA009771085_01039 hypothetical protein PFAM:PF01596.23, PFAM:PF13578.12, PFAM:PF13847.12 contig_31 cds 8340 9566 + GCA009771085_01040 yhbU putative protease yhbU SO:0001217, UniRef:UniRef50_A0A174KF40 contig_31 cds 9576 10661 + GCA009771085_01041 hypothetical protein contig_31 cds 10812 11966 + GCA009771085_01042 Queuine tRNA-ribosyltransferase SO:0001217, UniRef:UniRef50_A5I6E9 contig_31 cds 12067 12414 + GCA009771085_01043 yajC Preprotein translocase, YajC subunit SO:0001217, UniRef:UniRef50_C4GA78 contig_31 cds 12535 13905 + GCA009771085_01044 Permease SO:0001217, UniRef:UniRef50_G4Q3D6 contig_31 cds 14083 16293 + GCA009771085_01045 hypothetical protein contig_31 cds 16309 18801 + GCA009771085_01046 clpC ATP-dependent Clp protease ATP-binding subunit ClpC SO:0001217, UniRef:UniRef50_A0A1I2T500 contig_31 cds 18850 19257 + GCA009771085_01047 Peptidase S11 D-Ala-D-Ala carboxypeptidase A C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A9KHW4 contig_31 cds 19257 20621 + GCA009771085_01048 radA DNA repair protein RadA SO:0001217, UniRef:UniRef50_A5GDK5 contig_32 rRNA 28 1544 + GCA009771085_01049 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_33 cds 172 1209 + GCA009771085_01050 Flagellin SO:0001217, UniRef:UniRef50_A0A173VQK7 contig_33 cds 1490 2944 + GCA009771085_01051 Flagellin SO:0001217, UniRef:UniRef50_A0A415I3E4 contig_33 cds 3261 4268 + GCA009771085_01052 hypothetical protein PFAM:PF00356.27, PFAM:PF00532.27, PFAM:PF13377.12 contig_33 cds 4317 5603 + GCA009771085_01053 Carbohydrate ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_A0A8J8MJS1 contig_33 cds 5738 6613 + GCA009771085_01054 amyD putative starch degradation products transport system permease protein AmyD SO:0001217, UniRef:UniRef50_P37730 contig_33 cds 6613 7431 + GCA009771085_01055 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_R2SC62 contig_33 cds 7466 9793 + GCA009771085_01056 Family 65 glycosyl hydrolase SO:0001217, UniRef:UniRef50_A0AAD2KP46 contig_33 cds 9831 11507 + GCA009771085_01057 Oligo-1,6-glucosidase 1 SO:0001217, UniRef:UniRef50_O06994 contig_33 cds 11537 12181 + GCA009771085_01058 Beta-phosphoglucomutase SO:0001217, UniRef:UniRef50_A0A6N7XHW8 contig_33 cds 12209 13330 + GCA009771085_01059 ugpC Sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC SO:0001217, UniRef:UniRef50_A0A9D1DK52 contig_33 cds 13632 14087 + GCA009771085_01060 hypothetical protein contig_33 cds 14201 15526 + GCA009771085_01061 AAA+ ATPase domain-containing protein SO:0001217, UniRef:UniRef50_A0A0R1GTJ2 contig_33 tRNA 15600 15682 + GCA009771085_01062 trnL tRNA-Leu(caa) SO:0000264 contig_33 cds 15967 16470 + GCA009771085_01063 DUF5626 domain-containing protein SO:0001217, UniRef:UniRef50_A0A374I4L5 contig_33 cds 16507 17301 + GCA009771085_01064 hypothetical protein contig_33 cds 17644 18480 + GCA009771085_01065 hypothetical protein contig_33 cds 18749 18994 + GCA009771085_01066 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_N2A978 contig_33 cds 19013 19312 + GCA009771085_01067 hypothetical protein contig_33 cds 19384 22308 + GCA009771085_01068 Peptidase M16C associated domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I3FUN9 contig_33 cds 22474 23490 + GCA009771085_01069 GTPase Era SO:0001217, UniRef:UniRef50_Q5FJT7 contig_33 cds 23506 24240 + GCA009771085_01070 hypothetical protein PFAM:PF11967.14 contig_33 cds 24271 25668 + GCA009771085_01071 Glycine--tRNA ligase SO:0001217, UniRef:UniRef50_Q81XT3 contig_33 cds 25756 26787 + GCA009771085_01072 hypothetical protein PFAM:PF05175.20 contig_33 cds 26913 27635 - GCA009771085_01073 putative ABC transporter ATP-binding protein PEB1C SO:0001217, UniRef:UniRef50_A1VZQ5 contig_33 cds 27637 28401 - GCA009771085_01074 yecS Inner membrane amino-acid ABC transporter permease protein YecS SO:0001217, UniRef:UniRef50_A0A1U7M5P1 contig_33 cds 28403 29272 - GCA009771085_01075 Solute-binding protein family 3/N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_D0BJA1 contig_33 ncRNA-region 29379 29546 - Lysine riboswitch aptamer RFAM:RF00168, SO:0000035 contig_33 cds 29778 32444 + GCA009771085_01076 Pyruvate, phosphate dikinase SO:0001217, UniRef:UniRef50_E7MQ92 contig_33 cds 32561 32824 + GCA009771085_01077 N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A9E5G8R4 contig_33 cds 32843 34669 + GCA009771085_01078 Oligopeptidase F SO:0001217, UniRef:UniRef50_R5CKE9 contig_33 cds 34879 37137 + GCA009771085_01079 ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_A0A1Y3YHP0 contig_33 cds 37305 38291 + GCA009771085_01080 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_S0JC01 contig_33 cds 38300 39901 + GCA009771085_01081 Binding-protein-dependent transport systems inner membrane component SO:0001217, UniRef:UniRef50_A9KKN0 contig_33 cds 39920 41104 + GCA009771085_01082 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_G9WP23 contig_33 cds 41104 42135 + GCA009771085_01083 appF Oligopeptide transport ATP-binding protein AppF SO:0001217, UniRef:UniRef50_P42065 contig_33 cds 42128 42448 + GCA009771085_01084 hypothetical protein contig_33 cds 42535 43959 + GCA009771085_01085 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A0D0SDZ9 contig_33 cds 44146 45639 + GCA009771085_01086 Nicotinate phosphoribosyltransferase SO:0001217, UniRef:UniRef50_C9KKG3 contig_33 cds 45703 47010 + GCA009771085_01087 5-methylthioadenosine/S-adenosylhomocysteine deaminase SO:0001217, UniRef:UniRef50_A0A1C6DJM2 contig_33 cds 47048 47203 + GCA009771085_01088 hypothetical protein contig_33 cds 47223 49874 + GCA009771085_01089 Alanine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A9W5YA16 contig_33 cds 49950 50537 + GCA009771085_01090 hypothetical protein PFAM:PF16729.10 contig_33 cds 50815 51867 + GCA009771085_01091 Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_M2PLV0 contig_33 cds 52030 53595 + GCA009771085_01092 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_C9MZF6 contig_33 cds 53602 54408 - GCA009771085_01093 Restriction endonuclease SO:0001217, UniRef:UniRef50_C9MZF5 contig_33 cds 54570 54797 + GCA009771085_01094 hypothetical protein contig_33 cds 54974 55150 + GCA009771085_01095 rpsU 30S ribosomal protein S21 COG:COG0828, COG:J, GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_Q8RB59, UniRef:UniRef90_R9KGW1 contig_33 cds 55222 56817 + GCA009771085_01096 Peptide chain release factor 3 SO:0001217, UniRef:UniRef50_B0C6Z1 contig_33 cds 57006 58304 + GCA009771085_01097 Enolase SO:0001217, UniRef:UniRef50_O51312 contig_33 cds 58889 59935 + GCA009771085_01098 recA Protein RecA SO:0001217, UniRef:UniRef50_P49985 contig_33 cds 59993 60646 + GCA009771085_01099 hypothetical protein PFAM:PF21981.2, PFAM:PF21982.2 contig_33 cds 60790 62337 + GCA009771085_01100 Ribonuclease Y SO:0001217, UniRef:UniRef50_O31774 contig_33 cds 62415 63227 - GCA009771085_01101 hypothetical protein PFAM:PF08501.16 contig_33 cds 63531 64610 + GCA009771085_01102 hypothetical protein PFAM:PF00990.26 contig_33 cds 64635 65393 + GCA009771085_01103 Type VII secretion system protein EssD-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A927UQX9 contig_33 cds 65480 66247 + GCA009771085_01104 Short-chain dehydrogenase SO:0001217, UniRef:UniRef50_A0A1H3FIS0 contig_33 cds 66255 67025 + GCA009771085_01105 hypothetical protein PFAM:PF03734.19 contig_33 cds 67197 67757 + GCA009771085_01106 Thymidine kinase SO:0001217, UniRef:UniRef50_A6NQR2 contig_33 cds 67838 68830 - GCA009771085_01107 hypothetical protein contig_33 cds 68850 69941 - GCA009771085_01108 Extracellular solute-binding protein SO:0001217, UniRef:UniRef50_A0A173TXX7 contig_33 cds 69941 70744 - GCA009771085_01109 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_R9K2Q3 contig_33 cds 70741 71562 - GCA009771085_01110 potB Spermidine/putrescine transport system permease protein PotB SO:0001217, UniRef:UniRef50_L7VJH0 contig_33 cds 71555 72628 - GCA009771085_01111 potA Spermidine/putrescine import ATP-binding protein PotA SO:0001217, UniRef:UniRef50_Q24XJ2 contig_33 cds 72667 73356 - GCA009771085_01112 Pseudouridine synthase SO:0001217, UniRef:UniRef50_A0A174EHE6 contig_33 cds 73660 75189 + GCA009771085_01113 UDP-N-acetylmuramyl-tripeptide synthetase SO:0001217, UniRef:UniRef50_C4GA02 contig_33 cds 75231 77738 + GCA009771085_01114 hypothetical protein PFAM:PF00128.31 contig_33 cds 77848 80853 + GCA009771085_01115 hypothetical protein PFAM:PF00128.31, PFAM:PF02922.24, PFAM:PF21653.3 contig_33 cds 80955 81491 - GCA009771085_01116 hypothetical protein PFAM:PF13508.13, PFAM:PF13673.13 contig_33 cds 81571 82023 + GCA009771085_01117 hypothetical protein PFAM:PF00359.27 contig_33 cds 82052 82360 + GCA009771085_01118 fructose PTS transporter subunit IIB SO:0001217, UniRef:UniRef50_UPI00288A5545 contig_33 cds 82384 83448 + GCA009771085_01119 EIIBCA-Man SO:0001217, UniRef:UniRef50_A0A1C6EKI8 contig_33 cds 83528 85423 + GCA009771085_01120 hypothetical protein PFAM:PF00359.27, PFAM:PF00874.25, PFAM:PF08279.18 contig_33 cds 85558 86391 - GCA009771085_01121 Cobalt transport protein SO:0001217, UniRef:UniRef50_V9H391 contig_33 cds 86381 86845 - GCA009771085_01122 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_34 cds 240 1373 + GCA009771085_01123 hypothetical protein contig_34 cds 1420 3660 - GCA009771085_01124 recD2 ATP-dependent RecD2 DNA helicase SO:0001217, UniRef:UniRef50_A0A1G9F7W5 contig_34 cds 3647 4123 - GCA009771085_01125 hypothetical protein contig_34 cds 4163 4981 - GCA009771085_01126 flgG Flagellar basal-body rod protein FlgG SO:0001217, UniRef:UniRef50_A0A6L5XZJ3 contig_34 cds 5008 5808 - GCA009771085_01127 Distal rod protein SO:0001217, UniRef:UniRef50_A0A173UTN2 contig_34 cds 5882 6922 - GCA009771085_01128 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_34 cds 7000 8025 - GCA009771085_01129 mreB Cell shape-determining protein MreB SO:0001217, UniRef:UniRef50_A0A174LUE9 contig_34 cds 8175 9014 - GCA009771085_01130 hypothetical protein PFAM:PF00535.33 contig_34 cds 9251 12094 - GCA009771085_01131 UvrABC system protein A SO:0001217, UniRef:UniRef50_A0A3D2IPK4 contig_34 cds 12094 14121 - GCA009771085_01132 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17757.6 contig_34 cds 14158 16731 - GCA009771085_01133 secA Protein translocase subunit SecA SO:0001217, UniRef:UniRef50_Q8RCB4 contig_34 cds 16978 17187 - GCA009771085_01134 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1U7LZN1, UniRef:UniRef90_A0A1U7LZN1 contig_34 cds 17218 17850 - GCA009771085_01135 hypothetical protein SO:0001217, UniRef:UniRef50_R7ZHH9 contig_34 cds 19232 20107 - GCA009771085_01136 Methionine aminopeptidase SO:0001217, UniRef:UniRef50_A0A0M6WCJ8 contig_34 cds 20125 20838 - GCA009771085_01137 hypothetical protein PFAM:PF13624.11 contig_34 cds 20842 21990 - GCA009771085_01138 hypothetical protein PFAM:PF24568.1 contig_34 cds 22020 22262 - GCA009771085_01139 Veg protein SO:0001217, UniRef:UniRef50_G2T4C6 contig_34 cds 22546 23274 + GCA009771085_01140 hypothetical protein contig_34 cds 23242 24423 - GCA009771085_01141 D-alanine--D-alanine ligase SO:0001217, UniRef:UniRef50_A0A7V7QHS5 contig_34 cds 24501 26120 - GCA009771085_01142 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase SO:0001217, UniRef:UniRef50_A0A1C5UCH3 contig_34 cds 26199 26963 - GCA009771085_01143 AB hydrolase-1 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Q9JJD9 contig_34 cds 27050 28009 - GCA009771085_01144 hypothetical protein PFAM:PF01381.28, PFAM:PF13443.12, PFAM:PF13560.12 contig_34 cds 28129 28665 - GCA009771085_01145 Ribosome hibernation promoting factor SO:0001217, UniRef:UniRef50_A0A4Q8U5I6 contig_34 cds 28899 29693 + GCA009771085_01146 3-oxoacyl-[acyl-carrier protein] reductase SO:0001217, UniRef:UniRef50_R9N1H3 contig_34 tRNA 29870 29940 + GCA009771085_01147 trnG tRNA-Gly(ccc) SO:0000260 contig_34 cds 30030 30809 + GCA009771085_01148 Glutamate racemase SO:0001217, UniRef:UniRef50_A0A1V4IYF3 contig_34 cds 30862 33564 - GCA009771085_01149 hypothetical protein PFAM:PF13476.12 contig_34 cds 33564 34676 - GCA009771085_01150 Ser/Thr phosphatase family protein SO:0001217, UniRef:UniRef50_C4GDX3 contig_34 cds 34956 35969 + GCA009771085_01151 Ribonucleoside-diphosphate reductase subunit beta SO:0001217, UniRef:UniRef50_P75461 contig_34 cds 36044 36472 + GCA009771085_01152 nrdI Protein NrdI SO:0001217, UniRef:UniRef50_Q6F0T6 contig_34 cds 36475 38679 + GCA009771085_01153 Ribonucleoside-diphosphate reductase subunit alpha SO:0001217, UniRef:UniRef50_P47473 contig_34 cds 38685 39776 - GCA009771085_01154 Glycosyl transferase SO:0001217, UniRef:UniRef50_A0A3D2EEU7 contig_34 cds 39966 41678 - GCA009771085_01155 Na+/H+ antiporter NhaC-like C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_R9JZ56 contig_34 tRNA 41931 42014 - GCA009771085_01156 trnL tRNA-Leu(taa) SO:0000264 contig_34 cds 42355 44163 - GCA009771085_01157 ftsH ATP-dependent zinc metalloprotease FtsH SO:0001217, UniRef:UniRef50_A0A1E3A963 contig_34 cds 44192 44716 - GCA009771085_01158 Hypoxanthine phosphoribosyltransferase SO:0001217, UniRef:UniRef50_A0A6N7Y1A1 contig_34 cds 44709 46121 - GCA009771085_01159 hypothetical protein PFAM:PF11734.13 contig_34 cds 46171 46464 - GCA009771085_01160 hypothetical protein contig_34 cds 46479 46718 - GCA009771085_01161 RNA-binding S4 domain-containing protein SO:0001217, UniRef:UniRef50_A0A9C7BFF6 contig_34 cds 46863 47138 - GCA009771085_01162 DNA-binding protein HU-beta SO:0001217, UniRef:UniRef50_A0A4P7L0U8 contig_34 cds 47381 48667 - GCA009771085_01163 hypothetical protein PFAM:PF08308.17 contig_34 cds 48654 50000 - GCA009771085_01164 putative domain HDIG SO:0001217, UniRef:UniRef50_D4M059 contig_34 cds 50000 51439 - GCA009771085_01165 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25, PFAM:PF09180.16 contig_34 cds 51443 52276 - GCA009771085_01166 hypothetical protein contig_34 cds 52356 53045 - GCA009771085_01167 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_D4MUY4 contig_34 cds 53017 54528 - GCA009771085_01168 histidine kinase SO:0001217, UniRef:UniRef50_A0A9D1JAE2 contig_34 cds 54591 55772 - GCA009771085_01169 S-adenosylmethionine synthase SO:0001217, UniRef:UniRef50_P9WGV1 contig_34 ncRNA-region 55834 55935 - SAM riboswitch aptamer (S box leader) RFAM:RF00162, SO:0000140 contig_34 cds 56090 57223 - GCA009771085_01170 hypothetical protein PFAM:PF13487.12 contig_34 cds 57267 58559 - GCA009771085_01171 UDP-N-acetylglucosamine 1-carboxyvinyltransferase SO:0001217, UniRef:UniRef50_A0A9D1AG40 contig_34 cds 58646 62185 - GCA009771085_01172 Transcription-repair-coupling factor SO:0001217, UniRef:UniRef50_A0A1H7JX48 contig_34 cds 62209 62781 - GCA009771085_01173 Peptidyl-tRNA hydrolase SO:0001217, UniRef:UniRef50_C4ZBV8 contig_34 cds 62928 63185 - GCA009771085_01174 Putative septation protein SpoVG SO:0001217, UniRef:UniRef50_A0A7U9X998 contig_34 cds 63482 64861 + GCA009771085_01175 UDP-N-acetylmuramate--L-alanine ligase SO:0001217, UniRef:UniRef50_A9KQI8 contig_34 cds 65073 66194 + GCA009771085_01176 hypothetical protein contig_34 cds 66194 67183 + GCA009771085_01177 hypothetical protein PFAM:PF00004.35, PFAM:PF00308.24, PFAM:PF01695.23 contig_34 cds 67220 68401 + GCA009771085_01178 ribose-phosphate diphosphokinase SO:0001217, UniRef:UniRef50_A0A1V4IQK0 contig_34 cds 68499 70898 - GCA009771085_01179 hypothetical protein contig_34 cds 71041 73281 + GCA009771085_01180 mdoB Phosphoglycerol transferase MdoB SO:0001217, UniRef:UniRef50_A0A1H2WZ97 contig_34 cds 73367 74491 - GCA009771085_01181 hypothetical protein PFAM:PF13306.12 contig_34 cds 74588 75298 - GCA009771085_01182 hypothetical protein PFAM:PF04203.18 contig_34 cds 75370 75987 - GCA009771085_01183 hypothetical protein contig_34 cds 76206 85079 - GCA009771085_01184 hypothetical protein PFAM:PF00041.27 contig_34 tRNA 85371 85444 - GCA009771085_01185 trnP tRNA-Pro(cgg) SO:0000268 contig_34 cds 85586 87607 - GCA009771085_01186 Penicillin-binding protein 1A SO:0001217, UniRef:UniRef50_A0A173SZ42 contig_34 cds 87625 89055 - GCA009771085_01187 hypothetical protein PFAM:PF01022.26, PFAM:PF01637.24, PFAM:PF13401.12 contig_34 tRNA 89353 89425 - GCA009771085_01188 trnF tRNA-Phe(gaa) SO:0000267 contig_34 tRNA 89434 89507 - GCA009771085_01189 trnfM tRNA-fMet(cat) SO:0000266 contig_34 tRNA 89585 89666 - GCA009771085_01190 trnY tRNA-Tyr(gta) SO:0000272 contig_34 tRNA 89688 89760 - GCA009771085_01191 trnT tRNA-Thr(tgt) SO:0000270 contig_34 tRNA 89783 89855 - GCA009771085_01192 trnV tRNA-Val(tac) SO:0000273 contig_34 tRNA 89864 89937 - GCA009771085_01193 trnD tRNA-Asp(gtc) SO:0000256 contig_34 rRNA 90055 91055 - GCA009771085_01194 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_35 cds 1150 3528 - GCA009771085_01195 VirB4-like conjugal transfer ATPase, CD1110 family KEGG:K12063, SO:0001217, UniRef:UniRef50_G5GK77, UniRef:UniRef90_UPI0032662D89 contig_35 cds 3491 3880 - GCA009771085_01196 Conjugative transposon membrane protein RefSeq:WP_036257240.1, SO:0001217, UniParc:UPI000568A356, UniRef:UniRef100_UPI000568A356, UniRef:UniRef50_E0NMB7, UniRef:UniRef90_E6J244 contig_35 cds 3884 4147 - GCA009771085_01197 Conjugal transfer protein RefSeq:WP_000595839.1, SO:0001217, UniParc:UPI0001EB394B, UniRef:UniRef100_A0A095XG64, UniRef:UniRef50_A0A1I2KVJ6, UniRef:UniRef90_U7UJT5 contig_35 cds 4165 5028 - GCA009771085_01198 VirB6/TrbL-like conjugal transfer protein, CD1112 family SO:0001217, UniRef:UniRef50_G5GK80, UniRef:UniRef90_UPI0012A95613 contig_35 cds 5048 5263 - GCA009771085_01199 Maff2 family protein RefSeq:WP_007392018.1, SO:0001217, UniParc:UPI00021A2466, UniRef:UniRef100_F9MMQ3, UniRef:UniRef50_D4JXQ1, UniRef:UniRef90_U2L728 contig_35 cds 5267 5578 - GCA009771085_01200 Single-strand binding family protein RefSeq:WP_007392107.1, SO:0001217, UniParc:UPI00021A2467, UniRef:UniRef100_F9MMQ4, UniRef:UniRef50_D6GPP4, UniRef:UniRef90_U7UDI0 contig_35 cds 5779 7386 - GCA009771085_01201 Rad50/SbcC-type AAA domain-containing protein RefSeq:WP_007392103.1, SO:0001217, UniParc:UPI00021A2468, UniRef:UniRef100_F9MMQ5, UniRef:UniRef50_B3PM66, UniRef:UniRef90_F9MMQ5 contig_35 cds 7383 8414 - GCA009771085_01202 CD-NTase associated protein 4-like DNA endonuclease domain-containing protein RefSeq:WP_007392037.1, SO:0001217, UniParc:UPI00021A2469, UniRef:UniRef100_F9MMQ6, UniRef:UniRef50_F9MMQ6, UniRef:UniRef90_F9MMQ6 contig_35 cds 8494 9213 - GCA009771085_01203 VirD4-like conjugal transfer protein, CD1115 family SO:0001217, UniParc:UPI00021A246A, UniRef:UniRef100_F9MMQ7, UniRef:UniRef50_D6GRH2, UniRef:UniRef90_F5T8S4 contig_36 cds 6961 7371 - GCA009771085_01204 tnpV TnpV protein SO:0001217, UniRef:UniRef50_UPI003531D89D contig_36 cds 8236 9705 - GCA009771085_01205 DNA binding protein COG:COG2865, COG:K, SO:0001217, UniRef:UniRef50_R9MRR4, UniRef:UniRef90_T1ZF52 contig_36 cds 9695 9874 - GCA009771085_01206 abrB Transcriptional regulator, AbrB family RefSeq:WP_000655432.1, SO:0001217, UniParc:UPI00019C125D, UniRef:UniRef100_A0A8H2M7Q3, UniRef:UniRef50_E5BFP4, UniRef:UniRef90_E5BFP4 contig_36 cds 9969 11675 - GCA009771085_01207 topA DNA topoisomerase COG:COG0550, COG:L, EC:5.6.2.1, KEGG:K03169, RefSeq:WP_055327120.1, SO:0001217, UniParc:UPI0006DC6910, UniRef:UniRef100_A0A134CKZ9, UniRef:UniRef50_W8TD96, UniRef:UniRef90_G4D262 contig_36 cds 11774 13963 - GCA009771085_01208 Mobile element protein CD1107-like domain-containing protein RefSeq:WP_062404930.1, SO:0001217, UniParc:UPI000784521A, UniRef:UniRef100_A0A134CL87, UniRef:UniRef90_D3MRJ5 contig_36 cds 13941 14177 - GCA009771085_01209 Conjugal transfer protein RefSeq:WP_000711923.1, SO:0001217, UniParc:UPI0001DCA2AC, UniRef:UniRef100_A0A8H2M8N9, UniRef:UniRef50_G4D2A2, UniRef:UniRef90_D1AXU9 contig_36 cds 14190 15158 - GCA009771085_01210 NlpC/P60 family protein SO:0001217, UniRef:UniRef50_A0A3S4MIN8, UniRef:UniRef90_A0A3S4MIN8 contig_37 cds 168 404 + GCA009771085_01211 hypothetical protein contig_37 cds 628 1380 - GCA009771085_01212 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A415SEF3 contig_37 cds 1377 2699 - GCA009771085_01213 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_37 cds 3335 4093 - GCA009771085_01214 ABC transporter permease SO:0001217, UniRef:UniRef50_UPI0009D99F6F contig_37 cds 4096 4971 - GCA009771085_01215 hypothetical protein PFAM:PF00004.35, PFAM:PF00005.33, PFAM:PF13304.12 contig_37 cds 5196 5519 - GCA009771085_01216 hypothetical protein contig_37 cds 5512 6078 - GCA009771085_01217 hypothetical protein contig_37 cds 6333 7520 - GCA009771085_01218 cysteine-S-conjugate beta-lyase SO:0001217, UniRef:UniRef50_A0A0F0CJ58 contig_37 cds 7537 8361 - GCA009771085_01219 hypothetical protein contig_37 cds 8379 8891 - GCA009771085_01220 Nitroreductase domain-containing protein SO:0001217, UniRef:UniRef50_G5F0X5 contig_37 cds 9196 9480 + GCA009771085_01221 relB Damage-inducible protein COG:COG3077, COG:V, KEGG:K07473, SO:0001217, UniRef:UniRef50_A0A2J8B2A3, UniRef:UniRef90_A0A2J8B2A3 contig_37 cds 9684 9797 - GCA009771085_01222 hypothetical protein contig_37 cds 9831 10718 - GCA009771085_01223 hypothetical protein PFAM:PF00070.33, PFAM:PF01266.30, PFAM:PF07992.20, PFAM:PF13450.12 contig_37 cds 10843 12627 - GCA009771085_01224 Methyl-accepting chemotaxis protein SO:0001217, UniRef:UniRef50_R6LRW1 contig_37 cds 12866 13384 + GCA009771085_01225 nadR Transcription repressor NadR SO:0001217, UniRef:UniRef50_A0A2V2FX16 contig_37 cds 13527 14618 + GCA009771085_01226 Phosphotransferase system EIIC domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H9DCG1 contig_37 cds 14789 15868 - GCA009771085_01227 hypothetical protein contig_37 cds 16186 16941 - GCA009771085_01228 Phosphotransferase enzyme family protein SO:0001217, UniRef:UniRef50_A0A239RFL3 contig_37 cds 16960 19578 - GCA009771085_01229 Aldehyde-alcohol dehydrogenase SO:0001217, UniRef:UniRef50_A0A9D1Q2U1 contig_37 cds 19795 21201 - GCA009771085_01230 Thioether cross-link-forming SCIFF peptide maturase SO:0001217, UniRef:UniRef50_A0A844GI33 contig_37 cds 21301 21450 - GCA009771085_01231 Six-cysteine ranthipeptide SCIFF SO:0001217, UniRef:UniRef50_A0A9D2IMH2 contig_37 cds 21501 23024 - GCA009771085_01232 hypothetical protein PFAM:PF01276.26, PFAM:PF03711.20 contig_37 cds 23297 24589 + GCA009771085_01233 RCK C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0AA87AX98 contig_37 cds 24743 25345 - GCA009771085_01234 NADPH-dependent FMN reductase SO:0001217, UniRef:UniRef50_A0AAP4BR25 contig_37 cds 25367 25498 - GCA009771085_01235 hypothetical protein contig_37 cds 25449 26435 - GCA009771085_01236 Phosphate acetyltransferase SO:0001217, UniRef:UniRef50_A0A174WSE9 contig_37 cds 26465 26992 - GCA009771085_01237 Anaerobic ribonucleoside-triphosphate reductase-activating protein SO:0001217, UniRef:UniRef50_E0RVW5 contig_37 cds 27012 29261 - GCA009771085_01238 Anaerobic ribonucleoside-triphosphate reductase SO:0001217, UniRef:UniRef50_C9LNN5 contig_37 cds 29667 29984 - GCA009771085_01239 hypothetical protein contig_37 cds 30122 31444 + GCA009771085_01240 Hemolysin SO:0001217, UniRef:UniRef50_F7JKG8 contig_37 cds 31490 32095 - GCA009771085_01241 engB putative GTP-binding protein EngB SO:0001217, UniRef:UniRef50_Q2FXQ8 contig_37 cds 32173 33465 - GCA009771085_01242 clpX ATP-dependent Clp protease ATP-binding subunit ClpX SO:0001217, UniRef:UniRef50_Q8KFC3 contig_37 cds 33465 34076 - GCA009771085_01243 ATP-dependent Clp protease proteolytic subunit 1 SO:0001217, UniRef:UniRef50_Q9K709 contig_37 cds 34161 35531 - GCA009771085_01244 Trigger factor SO:0001217, UniRef:UniRef50_I5ASS7 contig_37 cds 35630 36178 - GCA009771085_01245 hypothetical protein PFAM:PF01965.30 contig_37 cds 36333 36821 + GCA009771085_01246 CYTH domain-containing protein SO:0001217, UniRef:UniRef50_S0J1W3 contig_37 cds 36835 37452 - GCA009771085_01247 DUF1653 domain-containing protein SO:0001217, UniRef:UniRef50_R7QXL3 contig_37 cds 37675 37917 + GCA009771085_01248 hypothetical protein contig_37 cds 37922 38608 - GCA009771085_01249 hypothetical protein contig_37 cds 38762 39997 - GCA009771085_01250 hypothetical protein contig_37 tRNA 40139 40221 - GCA009771085_01251 trnL tRNA-Leu(tag) SO:0000264 contig_37 cds 40321 40938 - GCA009771085_01252 Cytidylate kinase SO:0001217, UniRef:UniRef50_A0A1I5YRZ4 contig_37 cds 40948 41622 - GCA009771085_01253 UDP-N-acetylglucosamine pyrophosphorylase SO:0001217, UniRef:UniRef50_F3B9I2 contig_37 cds 41647 43626 - GCA009771085_01254 DNA topoisomerase SO:0001217, UniRef:UniRef50_A0A174QXE8 contig_37 cds 43626 44993 - GCA009771085_01255 hypothetical protein contig_37 cds 45052 45720 - GCA009771085_01256 queH Epoxyqueuosine reductase QueH SO:0001217, UniRef:UniRef50_C9L892 contig_37 cds 45768 46118 - GCA009771085_01257 hypothetical protein contig_37 tRNA 46216 46288 + GCA009771085_01258 trnT tRNA-Thr(cgt) SO:0000270 contig_37 cds 46304 47977 - GCA009771085_01259 hypothetical protein PFAM:PF02463.25, PFAM:PF13476.12 contig_37 cds 48039 48938 - GCA009771085_01260 hypothetical protein PFAM:PF01513.26, PFAM:PF20143.4 contig_37 cds 48935 49738 - GCA009771085_01261 RNA-binding S4 domain-containing protein SO:0001217, UniRef:UniRef50_A8RS14 contig_37 cds 49816 51687 - GCA009771085_01262 1-deoxy-D-xylulose-5-phosphate synthase SO:0001217, UniRef:UniRef50_B2TRM5 contig_37 cds 51694 52620 - GCA009771085_01263 Octaprenyl-diphosphate synthase / Dimethylallyltransferase / Geranyltranstransferase (Farnesyldiphosphate synthase) / Geranylgeranyl pyrophosphate synthetase SO:0001217, UniRef:UniRef50_A0A0D0SBB9 contig_37 cds 52623 52901 - GCA009771085_01264 hypothetical protein contig_37 cds 52994 54283 - GCA009771085_01265 hypothetical protein PFAM:PF01336.31, PFAM:PF13742.12 contig_37 cds 54270 54704 - GCA009771085_01266 nusB Transcription antitermination protein NusB SO:0001217, UniRef:UniRef50_A0A3D1M7Z3 contig_37 cds 54742 55095 - GCA009771085_01267 hypothetical protein contig_37 cds 55245 56882 - GCA009771085_01268 hypothetical protein PFAM:PF01183.26, PFAM:PF01473.26, PFAM:PF19127.6 contig_37 cds 57014 59419 + GCA009771085_01269 hypothetical protein PFAM:PF00403.32, PFAM:PF00702.32 contig_37 cds 59382 59603 + GCA009771085_01270 hypothetical protein PFAM:PF00403.32 contig_37 cds 59714 60520 - GCA009771085_01271 hypothetical protein PFAM:PF01464.25, PFAM:PF13406.11 contig_37 tRNA 60720 60792 + GCA009771085_01272 trnT tRNA-Thr(ggt) SO:0000270 contig_37 cds 60820 61752 - GCA009771085_01273 1-deoxy-D-xylulose-5-phosphate synthase SO:0001217, UniRef:UniRef50_A0A9D3AYI3 contig_37 cds 61752 62579 - GCA009771085_01274 Transketolase 1 SO:0001217, UniRef:UniRef50_A0A1C6DRC0 contig_37 cds 62651 63262 - GCA009771085_01275 hypothetical protein PFAM:PF00702.32 contig_37 cds 63462 64277 - GCA009771085_01276 hypothetical protein contig_37 cds 64367 66934 - GCA009771085_01277 hypothetical protein contig_37 cds 66934 67914 - GCA009771085_01278 hypothetical protein PFAM:PF01242.24 contig_37 cds 67907 69232 - GCA009771085_01279 hypothetical protein contig_37 cds 69291 70667 - GCA009771085_01280 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_C4Z6K0 contig_37 cds 70664 71296 - GCA009771085_01281 xrtG Exosortase family protein XrtG SO:0001217, UniRef:UniRef50_A0A927TZG0 contig_37 cds 71686 73491 - GCA009771085_01282 hypothetical protein PFAM:PF08269.17 contig_37 cds 73581 74234 - GCA009771085_01283 Glutamate racemase SO:0001217, UniRef:UniRef50_A0A379C1N2 contig_37 cds 74406 75923 - GCA009771085_01284 Flagellin SO:0001217, UniRef:UniRef50_A0A415I3E4 contig_37 cds 76269 76826 + GCA009771085_01285 Nicotinamidase SO:0001217, UniRef:UniRef50_Q1GBT1 contig_37 cds 77337 77489 - GCA009771085_01286 hypothetical protein contig_37 crispr 77703 78145 ? CRISPR array with 7 repeats of length 36, consensus sequence GTTTTAGTCCTATTCAAAACAACACAGTTATAAAAC and spacer length 30 SO:0001459 contig_37 crispr-repeat 77703 77738 ? CRISPR repeat contig_37 crispr-spacer 77739 77768 ? CRISPR spacer, sequence TCATTGATTGTAACACTATGAGAGTGTCTA contig_37 crispr-repeat 77769 77804 ? CRISPR repeat contig_37 crispr-spacer 77805 77835 ? CRISPR spacer, sequence ACAACACAAAAAAACTTTTGCTAAATATCGT contig_37 crispr-repeat 77836 77871 ? CRISPR repeat contig_37 crispr-spacer 77872 77901 ? CRISPR spacer, sequence TTTAATCTGCCTATCAGTGTTTTTTTACCA contig_37 crispr-repeat 77902 77937 ? CRISPR repeat contig_37 crispr-spacer 77938 77967 ? CRISPR spacer, sequence GTATTTGTCCATTGTCCCAGTCCAAAACCG contig_37 crispr-repeat 77968 78003 ? CRISPR repeat contig_37 crispr-spacer 78004 78033 ? CRISPR spacer, sequence GACAAGTTTTATATTGACAAAGTTTCAATA contig_37 crispr-repeat 78034 78069 ? CRISPR repeat contig_37 crispr-spacer 78070 78099 ? CRISPR spacer, sequence TTACGGTAGACGATACAAGTTAGCACAGTA contig_37 crispr-repeat 78100 78135 ? CRISPR repeat contig_37 crispr-spacer 78136 78145 ? CRISPR spacer, sequence CTCGTGATGC contig_37 cds 78240 78905 - GCA009771085_01287 hypothetical protein contig_37 cds 78898 79218 - GCA009771085_01288 CRISPR-associated endoribonuclease Cas2 SO:0001217, UniRef:UniRef50_G3ECR3 contig_37 cds 79230 80096 - GCA009771085_01289 CRISPR-associated endonuclease Cas1 SO:0001217, UniRef:UniRef50_G3ECR2 contig_37 cds 80097 84137 - GCA009771085_01290 CRISPR-associated endonuclease Cas9 SO:0001217, UniRef:UniRef50_H3NFH0 contig_37 ncRNA 84199 84292 + GCA009771085_01291 tracrRNA Trans-activating crRNA RFAM:RF02348, SO:0000655 contig_38 cds 713 2095 - GCA009771085_01292 23S rRNA m(5)U-1939 methyltransferase SO:0001217, UniRef:UniRef50_A0A174MN88 contig_38 cds 2148 3107 - GCA009771085_01293 HD domain-containing protein SO:0001217, UniRef:UniRef50_G9WK47 contig_38 cds 3333 5723 + GCA009771085_01294 mutS2 Endonuclease MutS2 SO:0001217, UniRef:UniRef50_A9KR74 contig_38 cds 6001 7572 + GCA009771085_01295 ATP-binding protein SO:0001217, UniRef:UniRef50_A0A239SR60 contig_38 cds 7790 8311 - GCA009771085_01296 Large ribosomal subunit protein bL17 SO:0001217, UniRef:UniRef50_C4Z2V8 contig_38 cds 8443 9411 - GCA009771085_01297 DNA-directed RNA polymerase subunit alpha SO:0001217, UniRef:UniRef50_P66709 contig_38 cds 9457 10050 - GCA009771085_01298 Small ribosomal subunit protein uS4 SO:0001217, UniRef:UniRef50_Q8RE43 contig_38 cds 10068 10457 - GCA009771085_01299 rpsK 30S ribosomal protein S11 COG:COG0100, COG:J, GO:0003735, GO:0005840, GO:0006412, KEGG:K02948, SO:0001217, UniRef:UniRef50_P9WH65, UniRef:UniRef90_A0A416E184 contig_38 cds 10502 10873 - GCA009771085_01300 Small ribosomal subunit protein uS13 SO:0001217, UniRef:UniRef50_Q9KP05 contig_38 cds 11254 11472 - GCA009771085_01301 infA translation initiation factor IF-1 COG:COG0361, COG:J, GO:0003743, GO:0006413, KEGG:K02518, SO:0001217, UniRef:UniRef50_Q5SHR1, UniRef:UniRef90_R9J7F9 contig_38 cds 11494 12141 - GCA009771085_01302 Adenylate kinase SO:0001217, UniRef:UniRef50_A5I7I5 contig_38 cds 12158 13471 - GCA009771085_01303 secY Protein translocase subunit SecY SO:0001217, UniRef:UniRef50_F7V4U6 contig_38 cds 13471 13914 - GCA009771085_01304 Large ribosomal subunit protein uL15 SO:0001217, UniRef:UniRef50_Q18CH7 contig_38 cds 13938 14126 - GCA009771085_01305 Large ribosomal subunit protein uL30 SO:0001217, UniRef:UniRef50_C4ZBT6 contig_38 cds 14137 14646 - GCA009771085_01306 Small ribosomal subunit protein uS5 SO:0001217, UniRef:UniRef50_B3E847 contig_38 cds 14662 15030 - GCA009771085_01307 Large ribosomal subunit protein uL18 SO:0001217, UniRef:UniRef50_Q2JIL2 contig_38 cds 15049 15588 - GCA009771085_01308 Large ribosomal subunit protein uL6 SO:0001217, UniRef:UniRef50_B8I7Z4 contig_38 cds 15651 16052 - GCA009771085_01309 Small ribosomal subunit protein uS8 SO:0001217, UniRef:UniRef50_Q46IS2 contig_38 cds 16075 16260 - GCA009771085_01310 type Z 30S ribosomal protein S14 GO:0003735, GO:0005840, GO:0006412, KEGG:K02954, SO:0001217, UniRef:UniRef50_P12878, UniRef:UniRef90_A0A173TNA0 contig_38 cds 16276 16815 - GCA009771085_01311 Large ribosomal subunit protein uL5 SO:0001217, UniRef:UniRef50_P73308 contig_38 cds 16836 17147 - GCA009771085_01312 Large ribosomal subunit protein uL24 SO:0001217, UniRef:UniRef50_C4Z2U1 contig_38 cds 17159 17527 - GCA009771085_01313 Large ribosomal subunit protein uL14 SO:0001217, UniRef:UniRef50_Q5SHP8 contig_38 cds 17546 17803 - GCA009771085_01314 Small ribosomal subunit protein uS17 SO:0001217, UniRef:UniRef50_Q8G409 contig_38 cds 17830 18036 - GCA009771085_01315 Large ribosomal subunit protein uL29 SO:0001217, UniRef:UniRef50_A9KJI6 contig_38 cds 18026 18463 - GCA009771085_01316 Large ribosomal subunit protein uL16 SO:0001217, UniRef:UniRef50_A3DJH9 contig_38 cds 18450 19121 - GCA009771085_01317 Small ribosomal subunit protein uS3 SO:0001217, UniRef:UniRef50_Q38UR8 contig_38 cds 19136 19522 - GCA009771085_01318 Large ribosomal subunit protein uL22 SO:0001217, UniRef:UniRef50_C4Z2T5 contig_38 cds 19549 19836 - GCA009771085_01319 Small ribosomal subunit protein uS19 SO:0001217, UniRef:UniRef50_P21476 contig_38 cds 19848 20690 - GCA009771085_01320 Large ribosomal subunit protein uL2 SO:0001217, UniRef:UniRef50_P94270 contig_38 cds 20751 21050 - GCA009771085_01321 Large ribosomal subunit protein uL23 SO:0001217, UniRef:UniRef50_B0TC58 contig_38 cds 21050 21673 - GCA009771085_01322 Large ribosomal subunit protein uL4 SO:0001217, UniRef:UniRef50_A9KJJ3 contig_38 cds 21698 22375 - GCA009771085_01323 Large ribosomal subunit protein uL3 SO:0001217, UniRef:UniRef50_Q2FW06 contig_38 cds 22483 22833 - GCA009771085_01324 Small ribosomal subunit protein uS10 SO:0001217, UniRef:UniRef50_H6LGV1 contig_38 ncRNA-region 22970 23064 - S10-Clostridia ribosomal protein leader RFAM:RF03136, SO:0000140 contig_38 cds 23263 24165 - GCA009771085_01325 S-adenosylmethionine-dependent methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_C0C677 contig_38 cds 24182 24829 - GCA009771085_01326 hypothetical protein PFAM:PF00702.32, PFAM:PF13242.12 contig_38 cds 24816 26432 - GCA009771085_01327 Phosphoenolpyruvate-protein phosphotransferase SO:0001217, UniRef:UniRef50_A0A9D2IUS6 contig_38 cds 26529 27275 + GCA009771085_01328 tRNA pseudouridine synthase A SO:0001217, UniRef:UniRef50_A0A9D1A2J3 contig_38 cds 27278 28528 - GCA009771085_01329 hypothetical protein PFAM:PF00165.29, PFAM:PF02311.25, PFAM:PF12833.13 contig_38 cds 28699 30138 - GCA009771085_01330 C4-dicarboxylate anaerobic carrier SO:0001217, UniRef:UniRef50_R9KYF4 contig_38 cds 30154 31089 - GCA009771085_01331 Carbamate kinase SO:0001217, UniRef:UniRef50_Q4L9V7 contig_38 cds 31095 32087 - GCA009771085_01332 Ornithine carbamoyltransferase, catabolic SO:0001217, UniRef:UniRef50_Q81II0 contig_38 cds 32224 33459 - GCA009771085_01333 Arginine deiminase SO:0001217, UniRef:UniRef50_A8AYL1 contig_38 cds 33858 34946 + GCA009771085_01334 hypothetical protein PFAM:PF07687.19 contig_38 cds 35044 35730 - GCA009771085_01335 hypothetical protein PFAM:PF00300.27 contig_38 cds 35848 36306 - GCA009771085_01336 hypothetical protein contig_38 cds 36421 38238 - GCA009771085_01337 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] SO:0001217, UniRef:UniRef50_R7HTQ1 contig_38 cds 38435 39451 - GCA009771085_01338 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_R9JWJ8 contig_38 cds 39791 41002 - GCA009771085_01339 Dicarboxylate/amino acid:cation symporter SO:0001217, UniRef:UniRef50_E5Y6X4 contig_38 cds 41045 42100 - GCA009771085_01340 hypothetical protein contig_38 cds 42307 43662 - GCA009771085_01341 Aspartate aminotransferase SO:0001217, UniRef:UniRef50_R7QXX3 contig_38 cds 43814 46393 - GCA009771085_01342 clpB Chaperone protein ClpB SO:0001217, UniRef:UniRef50_A0A1I2R6A5 contig_38 cds 46581 47351 - GCA009771085_01343 hypothetical protein contig_38 cds 47621 47779 + GCA009771085_01344 hypothetical protein contig_38 cds 47985 49364 - GCA009771085_01345 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF23914.1 contig_38 cds 49366 49533 - GCA009771085_01346 hypothetical protein contig_38 cds 49530 50963 - GCA009771085_01347 hypothetical protein PFAM:PF03961.19 contig_38 cds 51042 53702 - GCA009771085_01348 Valine--tRNA ligase SO:0001217, UniRef:UniRef50_R6HGS7 contig_38 cds 53728 53880 - GCA009771085_01349 hypothetical protein contig_38 cds 54018 54230 - GCA009771085_01350 hypothetical protein contig_38 cds 54254 56416 - GCA009771085_01351 Ferrous iron transport protein B SO:0001217, UniRef:UniRef50_W2BXP1 contig_38 cds 56426 56650 - GCA009771085_01352 Ferrous iron transporter FeoA-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A096BD67 contig_38 cds 56675 56893 - GCA009771085_01353 hypothetical protein PFAM:PF04023.20 contig_38 cds 57189 57629 + GCA009771085_01354 Iron dependent repressor DNA binding domain protein SO:0001217, UniRef:UniRef50_C7H0U9 contig_38 cds 57719 59143 - GCA009771085_01355 Pyruvate kinase SO:0001217, UniRef:UniRef50_A0A0U5JHB3 contig_38 cds 59149 60612 - GCA009771085_01356 degQ Periplasmic pH-dependent serine endoprotease DegQ SO:0001217, UniRef:UniRef50_A0A1C6DGY2 contig_38 cds 60693 62138 - GCA009771085_01357 hypothetical protein PFAM:PF00535.33 contig_38 cds 62143 63372 - GCA009771085_01358 galU UTP-glucose-1-phosphate uridylyltransferase GalU SO:0001217, UniRef:UniRef50_E0RW75 contig_38 cds 63384 64628 - GCA009771085_01359 wbuB Glycosyltransferase WbuB SO:0001217, UniRef:UniRef50_A0A2G3E4H7 contig_38 cds 64618 66048 - GCA009771085_01360 Sugar transferase SO:0001217, UniRef:UniRef50_A0A9D5YJ75 contig_38 cds 66093 67304 - GCA009771085_01361 hypothetical protein contig_38 cds 67319 68497 - GCA009771085_01362 UDP-galactopyranose mutase SO:0001217, UniRef:UniRef50_E0NTD3 contig_38 cds 68513 69841 - GCA009771085_01363 tagH Teichoic acids export ATP-binding protein TagH SO:0001217, UniRef:UniRef50_A0A1C5NEL8 contig_38 cds 69850 70677 - GCA009771085_01364 Transport permease protein SO:0001217, UniRef:UniRef50_A0A3R5W0I4 contig_38 cds 70691 71263 - GCA009771085_01365 hypothetical protein PFAM:PF00908.23 contig_38 cds 71263 72144 - GCA009771085_01366 Glucose-1-phosphate thymidylyltransferase SO:0001217, UniRef:UniRef50_A0A2N1HBY2 contig_38 cds 72296 73387 - GCA009771085_01367 dTDP-glucose 4,6-dehydratase SO:0001217, UniRef:UniRef50_A0A2T0BC77 contig_38 cds 73423 74298 - GCA009771085_01368 dTDP-4-dehydrorhamnose reductase SO:0001217, UniRef:UniRef50_C7G9K2 contig_38 cds 74314 75663 - GCA009771085_01369 Phosphoglucosamine mutase SO:0001217, UniRef:UniRef50_Q18CL0 contig_38 cds 75683 76930 - GCA009771085_01370 hypothetical protein contig_38 cds 76923 77882 - GCA009771085_01371 Diadenylate cyclase SO:0001217, UniRef:UniRef50_C4GCM8 contig_38 cds 77883 78824 - GCA009771085_01372 hypothetical protein contig_38 cds 78828 79238 - GCA009771085_01373 hypothetical protein contig_38 cds 79326 79730 - GCA009771085_01374 Methionyl/Leucyl tRNA synthetase domain-containing protein SO:0001217, UniRef:UniRef50_R7QYR0 contig_38 cds 79744 80475 - GCA009771085_01375 hypothetical protein PFAM:PF00156.33, PFAM:PF18912.6 contig_39 cds 126 2366 + GCA009771085_01376 Subtilase family protein SO:0001217, UniRef:UniRef50_A0A1H3AGP2 contig_39 cds 2647 4899 + GCA009771085_01377 hypothetical protein PFAM:PF01473.26, PFAM:PF04650.22, PFAM:PF19085.6 contig_39 cds 5075 6928 + GCA009771085_01378 hypothetical protein PFAM:PF00359.27, PFAM:PF00874.25, PFAM:PF05043.19, PFAM:PF08220.18, PFAM:PF08279.18 contig_39 cds 6974 7450 + GCA009771085_01379 hypothetical protein PFAM:PF00359.27 contig_39 cds 7532 7849 + GCA009771085_01380 PTS system fructose-like EIIB component 1 SO:0001217, UniRef:UniRef50_P69808 contig_39 cds 7869 9095 + GCA009771085_01381 Fructose-like permease IIC component 1 SO:0001217, UniRef:UniRef50_P77579 contig_39 cds 9263 11974 + GCA009771085_01382 hypothetical protein PFAM:PF01074.27, PFAM:PF07748.19, PFAM:PF09261.16, PFAM:PF17677.7 contig_40 cds 688 900 + GCA009771085_01383 N-6 DNA methylase SO:0001217, UniRef:UniRef50_UPI00338F5619, UniRef:UniRef90_UPI00338F5619 contig_40 cds 872 1114 + GCA009771085_01384 MobA/MobL family protein SO:0001217, UniRef:UniRef50_U2JWI2, UniRef:UniRef90_UPI0037445A65 contig_40 cds 1949 2506 + GCA009771085_01385 Type III toxin-antitoxin system ToxN/AbiQ family toxin KEGG:K19167, SO:0001217, UniRef:UniRef50_G5GKH5, UniRef:UniRef90_G5GKH5 contig_40 cds 2768 3010 + GCA009771085_01386 hypothetical protein contig_40 cds 3047 3688 + GCA009771085_01387 tetR Transcriptional regulator, TetR family SO:0001217, UniRef:UniRef50_F3AZ58, UniRef:UniRef90_A0A133PNI4 contig_40 cds 3746 5497 + GCA009771085_01388 mdlB ABC transporter COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_G5GKM7, UniRef:UniRef90_G5GKM7 contig_40 cds 5498 7222 + GCA009771085_01389 mdlB ABC transporter COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_G5GKT7, UniRef:UniRef90_G5GKT7 contig_40 cds 7231 8739 + GCA009771085_01390 ccmA heme ABC exporter ATP-binding protein CcmA COG:COG4172, COG:Q, EC:7.6.2.5, GO:0015439, GO:0015886, GO:0017004, GO:0022857, GO:0043190, SO:0001217, UniRef:UniRef50_G5GL55, UniRef:UniRef90_H1PMG8 contig_40 cds 8736 9437 + GCA009771085_01391 Cobalt transport protein SO:0001217, UniRef:UniRef50_G5GL57, UniRef:UniRef90_I3DJN7 contig_40 cds 9455 10036 + GCA009771085_01392 TIGR02185 family protein KEGG:K16926, SO:0001217, UniRef:UniRef50_G5GKT6, UniRef:UniRef90_H1PMH0 contig_41 cds 262 930 + GCA009771085_01393 DUF4417 domain-containing protein SO:0001217, UniRef:UniRef50_F9MNW2 contig_41 cds 930 1340 + GCA009771085_01394 toxin SO:0001217, UniRef:UniRef50_UPI0012B0ADEC contig_41 cds 1355 1666 + GCA009771085_01395 hypothetical protein SO:0001217, UniRef:UniRef50_A0A233VLZ5 contig_41 cds 1738 1878 + GCA009771085_01396 (pseudo) RNA helicase SO:0001217, UniRef:UniRef50_UPI0023F681F4, UniRef:UniRef90_UPI0001E5E24E contig_41 cds 2252 3118 + GCA009771085_01397 Phosphate-binding protein SO:0001217, UniRef:UniRef50_R0BSF0 contig_41 cds 3129 4025 + GCA009771085_01398 Phosphate transport system permease protein SO:0001217, UniRef:UniRef50_R6BVA8 contig_41 cds 4022 4885 + GCA009771085_01399 pstA Phosphate transport system permease protein PstA SO:0001217, UniRef:UniRef50_A0A944GLX7 contig_41 cds 4889 5647 + GCA009771085_01400 pstB Phosphate import ATP-binding protein PstB 1 SO:0001217, UniRef:UniRef50_P63375 contig_41 cds 5742 6395 + GCA009771085_01401 phoU Phosphate-specific transport system accessory protein PhoU SO:0001217, UniRef:UniRef50_A0A373VZ90 contig_41 cds 6494 7228 + GCA009771085_01402 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A174Z049 contig_41 cds 7225 8550 + GCA009771085_01403 histidine kinase SO:0001217, UniRef:UniRef50_A0A1H2W5M6 contig_41 cds 8745 9545 + GCA009771085_01404 Cof subfamily of IIB subfamily of haloacid dehalogenase superfamily/HAD-superfamily hydrolase, subfamily IIB SO:0001217, UniRef:UniRef50_A0A1H2UW55 contig_41 cds 9696 11378 + GCA009771085_01405 Phosphoglucomutase SO:0001217, UniRef:UniRef50_A0A0U5JF54 contig_41 cds 11521 13680 - GCA009771085_01406 hypothetical protein PFAM:PF22673.2 contig_41 cds 14042 15007 + GCA009771085_01407 PTS system mannose-specific EIIAB component SO:0001217, UniRef:UniRef50_Q5XAF5 contig_41 cds 15035 15838 + GCA009771085_01408 PTS system mannose-specific transporter subunit IIC SO:0001217, UniRef:UniRef50_A0A9X8XG99 contig_41 cds 15857 16768 + GCA009771085_01409 Mannose permease IID component SO:0001217, UniRef:UniRef50_A0A081Q4C1 contig_41 cds 16800 17174 + GCA009771085_01410 DUF956 domain-containing protein SO:0001217, UniRef:UniRef50_A0A150K1J2 contig_41 cds 17325 19463 - GCA009771085_01411 hypothetical protein PFAM:PF02743.24, PFAM:PF22673.2 contig_41 cds 19809 21689 + GCA009771085_01412 hypothetical protein PFAM:PF00563.25 contig_41 cds 21757 22428 - GCA009771085_01413 hypothetical protein contig_41 cds 22485 23300 - GCA009771085_01414 Metal ABC transporter permease SO:0001217, UniRef:UniRef50_E7GM62 contig_41 cds 23315 23989 - GCA009771085_01415 adcC Putative zinc transport system ATP-binding protein AdcC SO:0001217, UniRef:UniRef50_A0A1M4NAX5 contig_41 cds 23990 24982 - GCA009771085_01416 Zinc ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_G9WMW4 contig_41 cds 25020 25445 - GCA009771085_01417 Transcriptional repressor SO:0001217, UniRef:UniRef50_A0A417U4B0 contig_41 cds 25523 26899 - GCA009771085_01418 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A6S6XXA4 contig_41 cds 27220 27906 + GCA009771085_01419 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A1C6JR60 contig_41 cds 27971 29635 + GCA009771085_01420 hypothetical protein PFAM:PF00512.31, PFAM:PF02518.31 contig_41 cds 29877 32141 + GCA009771085_01421 Formate acetyltransferase SO:0001217, UniRef:UniRef50_K0IVJ3 contig_41 cds 32174 32905 + GCA009771085_01422 Pyruvate formate-lyase-activating enzyme SO:0001217, UniRef:UniRef50_P0A442 contig_41 cds 33032 33664 + GCA009771085_01423 Sce7726 family protein SO:0001217, UniRef:UniRef50_R9JPN9 contig_41 cds 33733 34398 + GCA009771085_01424 DUF1275 domain-containing protein SO:0001217, UniRef:UniRef50_D3R2K3 contig_41 cds 34411 35367 + GCA009771085_01425 hypothetical protein PFAM:PF10035.14 contig_41 cds 35400 37439 + GCA009771085_01426 Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein SO:0001217, UniRef:UniRef50_A0A3B9FZ54 contig_41 cds 37535 39298 + GCA009771085_01427 1-deoxy-D-xylulose-5-phosphate synthase SO:0001217, UniRef:UniRef50_Q97TJ5 contig_41 cds 39295 41418 + GCA009771085_01428 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_R7HE28 contig_41 cds 41506 42882 + GCA009771085_01429 Transporter SO:0001217, UniRef:UniRef50_F7UYC0 contig_41 cds 42920 43684 + GCA009771085_01430 hypothetical protein contig_41 cds 43826 44137 + GCA009771085_01431 Thioredoxin SO:0001217, UniRef:UniRef50_A0A1F2PJV6 contig_41 cds 44301 44882 + GCA009771085_01432 hypothetical protein PFAM:PF03729.18 contig_41 cds 44884 45114 + GCA009771085_01433 Phage protein SO:0001217, UniRef:UniRef50_A0A373LXW6 contig_41 cds 45111 46316 + GCA009771085_01434 hypothetical protein PFAM:PF08668.18, PFAM:PF13487.12 contig_41 cds 46493 47122 + GCA009771085_01435 Endonuclease III SO:0001217, UniRef:UniRef50_A0A965YMY9 contig_41 cds 47196 47828 - GCA009771085_01436 hypothetical protein contig_41 cds 48136 48663 + GCA009771085_01437 hypothetical protein contig_41 cds 48743 49234 + GCA009771085_01438 Transcription regulator AsnC/Lrp ligand binding domain-containing protein SO:0001217, UniRef:UniRef50_F3B1J3 contig_41 cds 49231 50403 + GCA009771085_01439 Aminotransferase SO:0001217, UniRef:UniRef50_A0A7C3F684 contig_41 cds 50417 50911 + GCA009771085_01440 Putative tRNA (cytidine(34)-2'-O)-methyltransferase SO:0001217, UniRef:UniRef50_B0NBN2 contig_41 cds 50917 51780 + GCA009771085_01441 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 SO:0001217, UniRef:UniRef50_A0PXX7 contig_41 cds 51780 52628 + GCA009771085_01442 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 SO:0001217, UniRef:UniRef50_A0A927Z4S4 contig_41 cds 52613 53413 + GCA009771085_01443 ecfT Energy-coupling factor transporter transmembrane protein EcfT SO:0001217, UniRef:UniRef50_A0A6S6QUQ3 contig_41 cds 53413 54195 + GCA009771085_01444 tRNA pseudouridine synthase A 2 SO:0001217, UniRef:UniRef50_Q890R5 contig_41 cds 54328 54759 + GCA009771085_01445 Large ribosomal subunit protein uL13 SO:0001217, UniRef:UniRef50_Q110D4 contig_41 cds 54783 55175 + GCA009771085_01446 Small ribosomal subunit protein uS9 SO:0001217, UniRef:UniRef50_P31782 contig_41 cds 55330 57045 - GCA009771085_01447 hypothetical protein PFAM:PF00990.26 contig_41 cds 57062 58702 - GCA009771085_01448 hypothetical protein PFAM:PF00990.26 contig_41 cds 59568 60458 + GCA009771085_01449 hypothetical protein PFAM:PF10035.14 contig_41 gap 61157 61251 . contig_41 cds 61281 62261 + GCA009771085_01450 Flagellar hook protein SO:0001217, UniRef:UniRef50_A0A395UXQ4 contig_41 cds 62494 63936 + GCA009771085_01451 Na+/H+ antiporter family protein SO:0001217, UniRef:UniRef50_G9X3E8 contig_41 cds 64043 65080 + GCA009771085_01452 Band 7 domain-containing protein SO:0001217, UniRef:UniRef50_A0A329U0N7 contig_41 cds 65061 65276 + GCA009771085_01453 PTS ascorbate transporter subunit IIC SO:0001217, UniRef:UniRef50_B9YDT8 contig_41 ncRNA-region 65377 65563 + FMN riboswitch aptamer (RFN element) RFAM:RF00050, SO:0000035 contig_41 cds 65663 66253 + GCA009771085_01454 Riboflavin transporter SO:0001217, UniRef:UniRef50_U2UVQ5 contig_41 cds 66259 67407 + GCA009771085_01455 hypothetical protein PFAM:PF00288.32, PFAM:PF08544.19 contig_41 cds 67432 68115 + GCA009771085_01456 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_R9J344 contig_41 cds 68234 69139 - GCA009771085_01457 HTH araC/xylS-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A1S9BWK3 contig_41 cds 69364 69945 + GCA009771085_01458 Alkyl hydroperoxide reductase C SO:0001217, UniRef:UniRef50_P0AE08 contig_41 cds 69949 71634 + GCA009771085_01459 Alkyl hydroperoxide reductase subunit F SO:0001217, UniRef:UniRef50_A0A2X0VJ61 contig_41 cds 71834 73072 + GCA009771085_01460 hypothetical protein contig_41 cds 73069 73824 + GCA009771085_01461 hypothetical protein contig_41 cds 73846 76365 + GCA009771085_01462 hypothetical protein PFAM:PF00005.33, PFAM:PF02687.27, PFAM:PF13304.12 contig_41 cds 76445 77428 + GCA009771085_01463 hypothetical protein contig_41 cds 77556 79553 + GCA009771085_01464 Putative K(+)-stimulated pyrophosphate-energized sodium pump SO:0001217, UniRef:UniRef50_F7Q188 contig_42 cds 328 948 + GCA009771085_01465 Phage minor structural protein GP20 SO:0001217, UniRef:UniRef50_A0A6L5YN07 contig_42 cds 978 1448 + GCA009771085_01466 hypothetical protein contig_42 cds 1509 1844 + GCA009771085_01467 hypothetical protein contig_42 cds 1931 2056 + GCA009771085_01468 hypothetical protein contig_42 cds 2071 2418 + GCA009771085_01469 hypothetical protein contig_42 cds 2420 2845 + GCA009771085_01470 hypothetical protein contig_42 cds 2849 3199 + GCA009771085_01471 Minor capsid protein SO:0001217, UniRef:UniRef50_A0A173RLZ2 contig_42 cds 3208 3642 + GCA009771085_01472 hypothetical protein contig_42 cds 3647 4183 + GCA009771085_01473 Phage major tail protein, TP901-1 family SO:0001217, UniRef:UniRef50_C4Z839 contig_42 cds 4203 4637 + GCA009771085_01474 hypothetical protein contig_42 cds 4645 5211 + GCA009771085_01475 Bacteriophage Gp15 protein SO:0001217, UniRef:UniRef50_A0A844E726 contig_42 cds 5272 7374 + GCA009771085_01476 hypothetical protein contig_42 cds 7378 8235 + GCA009771085_01477 hypothetical protein PFAM:PF05709.17 contig_42 cds 8238 9287 + GCA009771085_01478 hypothetical protein contig_42 cds 9293 10960 + GCA009771085_01479 hypothetical protein