# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_2 cds 34 1173 - GCA009771115_00001 Recombinase family protein SO:0001217, UniRef:UniRef50_A0A1D9MIA9 contig_2 gap 642 651 . contig_2 cds 1220 1429 - GCA009771115_00002 blaI BlaI family transcriptional regulator RefSeq:WP_004007595.1, SO:0001217, UniParc:UPI00019F95DF, UniRef:UniRef100_A0A7Z0VU79, UniRef:UniRef50_K9EXL0, UniRef:UniRef90_A0A7Z0VU79 contig_2 cds 2142 2315 - GCA009771115_00003 Conjugal transfer protein RefSeq:WP_002779755.1, SO:0001217, UniParc:UPI000040063A, UniRef:UniRef100_A0A395UW48, UniRef:UniRef50_R9JGU8, UniRef:UniRef90_B0B4B4 contig_2 cds 2367 4286 - GCA009771115_00004 tet(O) tetracycline resistance ribosomal protection protein Tet(O) BlastRules:WP_012669445, COG:COG0480, COG:J, GO:0003924, GO:0005525, GO:0006412, GO:0032790, GO:0046677, KEGG:K18220, NCBIProtein:WP_014636291.1, SO:0001217, UniRef:UniRef50_Q47810, UniRef:UniRef90_P10952 contig_2 cds 4653 5027 - GCA009771115_00005 tnpV TnpV protein RefSeq:WP_001129923.1, SO:0001217, UniParc:UPI0002B9AF8C, UniRef:UniRef100_A0A395UU83, UniRef:UniRef50_D4JRA8, UniRef:UniRef90_R0BLJ1 contig_2 cds 5008 5280 - GCA009771115_00006 Helicase C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A127SUK5 contig_3 cds 95 184 - GCA009771115_00007 hypothetical protein contig_3 cds 308 1252 - GCA009771115_00008 Fido domain-containing protein SO:0001217, UniRef:UniRef50_C6LEY3, UniRef:UniRef90_R9ME95 contig_3 cds 1219 1413 - GCA009771115_00009 hypothetical protein contig_3 cds 2061 3983 - GCA009771115_00010 recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_A0A6V7RNM7, UniRef:UniRef90_UPI001D155AF6 contig_3 cds 3983 4129 - GCA009771115_00011 SHOCT-like domain-containing protein RefSeq:WP_001058407.1, SO:0001217, UniParc:UPI0002147D6E, UniRef:UniRef100_G4D2B8, UniRef:UniRef50_E0E3U0, UniRef:UniRef90_E0E3U0 contig_3 ncRNA-region 4195 4258 - pemK RNA RFAM:RF02913, SO:0005836 contig_3 cds 4585 5001 - GCA009771115_00012 RNA polymerase sigma-70 region 4 domain-containing protein SO:0001217, UniRef:UniRef50_G5GKT5, UniRef:UniRef90_D3LX00 contig_4 cds 1943 4081 - GCA009771115_00013 hypothetical protein PFAM:PF02743.24, PFAM:PF22673.2 contig_4 cds 4427 6307 + GCA009771115_00014 hypothetical protein PFAM:PF00563.25 contig_4 cds 6405 7076 - GCA009771115_00015 hypothetical protein contig_4 cds 7157 7972 - GCA009771115_00016 Metal ABC transporter permease SO:0001217, UniRef:UniRef50_E7GM62 contig_4 cds 7987 8661 - GCA009771115_00017 adcC Putative zinc transport system ATP-binding protein AdcC SO:0001217, UniRef:UniRef50_A0A1M4NAX5 contig_4 cds 8662 9645 - GCA009771115_00018 Zinc ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_G9WMW4 contig_4 cds 9685 10110 - GCA009771115_00019 Transcriptional repressor SO:0001217, UniRef:UniRef50_A0A417U4B0 contig_4 cds 10188 11564 - GCA009771115_00020 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A6S6XXA4 contig_4 cds 11885 12571 + GCA009771115_00021 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A1C6JR60 contig_4 cds 12636 14300 + GCA009771115_00022 hypothetical protein PFAM:PF00512.31, PFAM:PF02518.31 contig_4 cds 14542 16806 + GCA009771115_00023 Formate acetyltransferase SO:0001217, UniRef:UniRef50_K0IVJ3 contig_4 cds 16831 17562 + GCA009771115_00024 Pyruvate formate-lyase-activating enzyme SO:0001217, UniRef:UniRef50_A0A7X9S836 contig_4 cds 17688 18320 + GCA009771115_00025 Sce7726 family protein SO:0001217, UniRef:UniRef50_R9JPN9 contig_4 cds 18389 19054 + GCA009771115_00026 DUF1275 domain-containing protein SO:0001217, UniRef:UniRef50_D3R2K3 contig_4 cds 19067 20023 + GCA009771115_00027 hypothetical protein PFAM:PF10035.14 contig_4 cds 20056 22095 + GCA009771115_00028 Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein SO:0001217, UniRef:UniRef50_A0A3B9FZ54 contig_4 cds 22191 23954 + GCA009771115_00029 1-deoxy-D-xylulose-5-phosphate synthase SO:0001217, UniRef:UniRef50_Q97TJ5 contig_4 cds 23951 26074 + GCA009771115_00030 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_R7HE28 contig_4 cds 26162 27538 + GCA009771115_00031 Transporter SO:0001217, UniRef:UniRef50_F7UYC0 contig_4 cds 27576 28340 + GCA009771115_00032 hypothetical protein contig_4 cds 28482 28793 + GCA009771115_00033 Thioredoxin SO:0001217, UniRef:UniRef50_A0A1F2PJV6 contig_4 cds 28957 29538 + GCA009771115_00034 hypothetical protein PFAM:PF03729.18 contig_4 cds 29540 29770 + GCA009771115_00035 Phage protein SO:0001217, UniRef:UniRef50_A0A373LXW6 contig_4 cds 29767 30972 + GCA009771115_00036 hypothetical protein PFAM:PF08668.18, PFAM:PF13487.12 contig_4 cds 31185 31814 + GCA009771115_00037 Endonuclease III SO:0001217, UniRef:UniRef50_A0A965YMY9 contig_4 cds 31888 32520 - GCA009771115_00038 hypothetical protein contig_4 cds 32827 33354 + GCA009771115_00039 hypothetical protein contig_4 cds 33434 33925 + GCA009771115_00040 Transcription regulator AsnC/Lrp ligand binding domain-containing protein SO:0001217, UniRef:UniRef50_F3B1J3 contig_4 cds 33922 35094 + GCA009771115_00041 Aminotransferase SO:0001217, UniRef:UniRef50_A0A7C3F684 contig_4 cds 35118 35612 + GCA009771115_00042 Putative tRNA (cytidine(34)-2'-O)-methyltransferase SO:0001217, UniRef:UniRef50_B0NBN2 contig_4 cds 35618 36481 + GCA009771115_00043 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 SO:0001217, UniRef:UniRef50_A0PXX7 contig_4 cds 36481 37329 + GCA009771115_00044 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 SO:0001217, UniRef:UniRef50_A0A927Z4S4 contig_4 cds 37314 38114 + GCA009771115_00045 ecfT Energy-coupling factor transporter transmembrane protein EcfT SO:0001217, UniRef:UniRef50_A0A6S6QUQ3 contig_4 cds 38114 38896 + GCA009771115_00046 tRNA pseudouridine synthase A 2 SO:0001217, UniRef:UniRef50_Q890R5 contig_4 cds 39029 39460 + GCA009771115_00047 Large ribosomal subunit protein uL13 SO:0001217, UniRef:UniRef50_Q110D4 contig_4 cds 39484 39876 + GCA009771115_00048 Small ribosomal subunit protein uS9 SO:0001217, UniRef:UniRef50_P31782 contig_4 cds 40031 41746 - GCA009771115_00049 hypothetical protein PFAM:PF00990.26 contig_4 cds 41763 43475 - GCA009771115_00050 hypothetical protein PFAM:PF00990.26 contig_4 cds 44271 45161 + GCA009771115_00051 hypothetical protein PFAM:PF10035.14 contig_5 tRNA 186 273 - GCA009771115_00052 trnS tRNA-Ser(gga) SO:0000269 contig_5 tRNA 325 410 - GCA009771115_00053 trnS tRNA-Ser(tga) SO:0000269 contig_5 cds 569 1339 - GCA009771115_00054 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A1Q6Q6N6 contig_5 cds 1329 2228 - GCA009771115_00055 Branched-chain amino acid ABC transporter, permease protein SO:0001217, UniRef:UniRef50_A0A133YCJ6 contig_5 cds 2264 3304 - GCA009771115_00056 ABC transporter substrate binding protein SO:0001217, UniRef:UniRef50_C8NG67 contig_5 cds 3698 5218 - GCA009771115_00057 hypothetical protein PFAM:PF01170.24 contig_5 cds 5736 7538 - GCA009771115_00058 Aspartate--tRNA(Asp/Asn) ligase SO:0001217, UniRef:UniRef50_A9KIA6 contig_5 cds 7575 8843 - GCA009771115_00059 Histidine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A929XG45 contig_5 cds 8941 10635 - GCA009771115_00060 hemZ Coproporphyrinogen dehydrogenase HemZ SO:0001217, UniRef:UniRef50_A0A927TJJ8 contig_5 cds 10635 12968 - GCA009771115_00061 GTP pyrophosphokinase SO:0001217, UniRef:UniRef50_A0A7I8DD63 contig_5 cds 13228 14589 + GCA009771115_00062 Amino acid carrier protein SO:0001217, UniRef:UniRef50_V7IDB4 contig_5 cds 14860 16314 + GCA009771115_00063 Inosine-5'-monophosphate dehydrogenase SO:0001217, UniRef:UniRef50_A0A2T0B5I1 contig_5 cds 16458 16967 - GCA009771115_00064 PAP2 superfamily protein SO:0001217, UniRef:UniRef50_A0A1H3KFN8 contig_5 cds 16971 17447 - GCA009771115_00065 hypothetical protein PFAM:PF02559.22 contig_5 cds 17890 18777 + GCA009771115_00066 lysR DNA-binding transcriptional regulator, LysR family SO:0001217, UniRef:UniRef50_A0A1I6Z7Z3 contig_5 cds 18786 19313 - GCA009771115_00067 Adenine phosphoribosyltransferase SO:0001217, UniRef:UniRef50_Q8KFM9 contig_5 cds 19405 19962 - GCA009771115_00068 hypothetical protein contig_5 cds 19962 20408 - GCA009771115_00069 hypothetical protein contig_5 cds 20415 20552 - GCA009771115_00070 hypothetical protein contig_5 cds 20578 20682 - GCA009771115_00071 hypothetical protein contig_5 cds 20803 21138 - GCA009771115_00072 hypothetical protein contig_5 cds 21199 22587 - GCA009771115_00073 hypothetical protein contig_5 cds 22529 23854 - GCA009771115_00074 hypothetical protein PFAM:PF00437.27 contig_5 cds 23876 24055 - GCA009771115_00075 Flp family type IVb pilin SO:0001217, UniRef:UniRef50_A0A9D1E7E1 contig_5 cds 24383 26080 - GCA009771115_00076 hypothetical protein PFAM:PF17203.10 contig_5 cds 26255 27031 - GCA009771115_00077 Type III pantothenate kinase SO:0001217, UniRef:UniRef50_A0A1G9BKK8 contig_5 cds 27118 27759 - GCA009771115_00078 hypothetical protein contig_5 cds 27884 29224 - GCA009771115_00079 hypothetical protein PFAM:PF24568.1 contig_5 cds 29357 29860 - GCA009771115_00080 Dihydrofolate reductase SO:0001217, UniRef:UniRef50_A0A1E3AHC5 contig_5 tRNA 30103 30175 + GCA009771115_00081 trnG tRNA-Gly(gcc) SO:0000260 contig_5 cds 30387 31436 - GCA009771115_00082 hypothetical protein contig_5 cds 31755 31919 - GCA009771115_00083 hypothetical protein SO:0001217, UniRef:UniRef50_K0XSI1 contig_5 cds 32010 33896 - GCA009771115_00084 hypothetical protein contig_5 cds 34116 34856 - GCA009771115_00085 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A415SEF3 contig_5 cds 34853 36178 - GCA009771115_00086 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_5 cds 36232 36405 - GCA009771115_00087 hypothetical protein contig_5 cds 36431 37015 - GCA009771115_00088 hypothetical protein contig_5 cds 37037 39232 - GCA009771115_00089 lagD Lactococcin-G-processing and transport ATP-binding protein LagD SO:0001217, UniRef:UniRef50_U5MNA3 contig_5 cds 39352 39774 - GCA009771115_00090 hypothetical protein contig_5 cds 39862 40044 - GCA009771115_00091 hypothetical protein contig_5 cds 40076 40381 - GCA009771115_00092 hypothetical protein contig_5 cds 40858 41286 - GCA009771115_00093 hypothetical protein contig_5 cds 41602 41805 - GCA009771115_00094 hypothetical protein SO:0001217, UniRef:UniRef50_A0A9X4MK44 contig_5 cds 42072 42500 - GCA009771115_00095 hypothetical protein contig_5 cds 42618 42836 - GCA009771115_00096 hypothetical protein contig_5 cds 42915 43067 - GCA009771115_00097 hypothetical protein contig_5 cds 43460 43756 - GCA009771115_00098 Bacteriocin immunity protein SO:0001217, UniRef:UniRef50_R2QW78 contig_5 cds 43756 43956 - GCA009771115_00099 Bacteriocin ubericin-A SO:0001217, UniRef:UniRef50_A9Q0M7 contig_5 cds 44203 44994 - GCA009771115_00100 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_5 cds 44981 45409 - GCA009771115_00101 sufU Zinc-dependent sulfurtransferase SufU SO:0001217, UniRef:UniRef50_A0A097AUM6 contig_5 cds 45413 46633 - GCA009771115_00102 Cysteine desulfurase SO:0001217, UniRef:UniRef50_C9LRH9 contig_5 cds 46673 47683 - GCA009771115_00103 hypothetical protein PFAM:PF01458.23 contig_5 cds 47692 49104 - GCA009771115_00104 sufB Fe-S cluster assembly protein SufB SO:0001217, UniRef:UniRef50_A0A3G9KAX6 contig_5 cds 49114 49908 - GCA009771115_00105 sufC Fe-S cluster assembly ATPase SufC SO:0001217, UniRef:UniRef50_A0A975EZD7 contig_5 cds 50030 50461 - GCA009771115_00106 sarZ HTH-type transcriptional regulator SarZ SO:0001217, UniRef:UniRef50_A0A0P8WLA8 contig_5 cds 50595 51824 - GCA009771115_00107 cdgJ Cyclic di-GMP phosphodiesterase CdgJ SO:0001217, UniRef:UniRef50_A0A645CFS3 contig_5 cds 52003 52470 - GCA009771115_00108 hypothetical protein PFAM:PF00226.36 contig_5 cds 52497 54032 - GCA009771115_00109 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_5 cds 53998 54837 - GCA009771115_00110 degV DegV family protein SO:0001217, UniRef:UniRef50_A0A0J1GEZ7 contig_5 cds 55041 55307 - GCA009771115_00111 cspB Cold shock protein CspB SO:0001217, UniRef:UniRef50_P42016 contig_5 cds 55344 55844 - GCA009771115_00112 hypothetical protein contig_5 cds 55850 57571 - GCA009771115_00113 clpX ATP-dependent Clp protease ATP-binding subunit ClpX SO:0001217, UniRef:UniRef50_A0A6N7USA0 contig_5 cds 57775 58257 - GCA009771115_00114 Cob(I)yrinic acid a,c-diamide adenosyltransferase SO:0001217, UniRef:UniRef50_R9KI28 contig_5 cds 58418 60250 + GCA009771115_00115 bipA Large ribosomal subunit assembly factor BipA SO:0001217, UniRef:UniRef50_C4G8A0 contig_5 cds 60339 61253 + GCA009771115_00116 hypothetical protein contig_5 cds 61349 62638 - GCA009771115_00117 hypothetical protein PFAM:PF00587.30, PFAM:PF02403.27 contig_5 cds 62808 65093 - GCA009771115_00118 Multifunctional fusion protein SO:0001217, UniRef:UniRef50_C4G9S4 contig_5 cds 65186 66307 - GCA009771115_00119 hypothetical protein PFAM:PF00254.34 contig_5 cds 66417 67235 - GCA009771115_00120 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_5 cds 67400 69385 - GCA009771115_00121 Transketolase SO:0001217, UniRef:UniRef50_P45694 contig_5 cds 69427 70074 - GCA009771115_00122 Transaldolase SO:0001217, UniRef:UniRef50_P19669 contig_5 cds 70100 70819 - GCA009771115_00123 L-ribulose-5-phosphate 4-epimerase SO:0001217, UniRef:UniRef50_F9D4Y6 contig_5 cds 70809 71666 - GCA009771115_00124 L-ribulose-5-phosphate 3-epimerase SO:0001217, UniRef:UniRef50_A0A2L1TZP5 contig_5 cds 71756 72394 - GCA009771115_00125 3-keto-L-gulonate-6-phosphate decarboxylase SO:0001217, UniRef:UniRef50_D2KVD0 contig_5 cds 72444 72800 - GCA009771115_00126 PTS EIIB type-2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0R1TZP7 contig_5 cds 72815 74293 - GCA009771115_00127 PTS ascorbate transporter subunit IIC GO:0009401, GO:0016020, KEGG:K03475, SO:0001217, UniRef:UniRef50_F2N7C4, UniRef:UniRef90_A0A133Y087 contig_5 cds 74313 74831 - GCA009771115_00128 Ascorbate-specific PTS system EIIA component SO:0001217, UniRef:UniRef50_A0A133Y097 contig_5 cds 74785 75861 - GCA009771115_00129 ulaG L-ascorbate 6-phosphate lactonase EC:3.1.1.-, GO:0019854, GO:0030145, GO:0035460, KEGG:K03476, SO:0001217, UniRef:UniRef50_P39300, UniRef:UniRef90_A0A0X8F7W1 contig_5 cds 76095 76910 + GCA009771115_00130 deoR Transcriptional regulator, DeoR family SO:0001217, UniRef:UniRef50_A0A133XU25 contig_5 cds 77112 77927 - GCA009771115_00131 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_5 cds 78240 79604 - GCA009771115_00132 Ascorbate-specific PTS system EIIC component SO:0001217, UniRef:UniRef50_A0A2T7T7R7 contig_5 cds 79658 79948 - GCA009771115_00133 PTS EIIB type-2 domain-containing protein SO:0001217, UniRef:UniRef50_Q8CY69 contig_5 cds 79969 80406 - GCA009771115_00134 Ascorbate-specific PTS system EIIA component SO:0001217, UniRef:UniRef50_A0A1E9PKR7 contig_5 cds 80427 82421 - GCA009771115_00135 Transketolase SO:0001217, UniRef:UniRef50_P45694 contig_5 cds 82446 84512 - GCA009771115_00136 hypothetical protein PFAM:PF00359.27, PFAM:PF00874.25 contig_5 cds 84772 86160 - GCA009771115_00137 hypothetical protein PFAM:PF01473.26, PFAM:PF04650.22, PFAM:PF19085.6, PFAM:PF19127.6 contig_5 cds 86388 86879 + GCA009771115_00138 hypothetical protein contig_5 cds 86941 88215 - GCA009771115_00139 hypothetical protein PFAM:PF08713.17 contig_5 cds 88442 90172 - GCA009771115_00140 hypothetical protein contig_5 cds 90218 91315 - GCA009771115_00141 Zinc transport system substrate-binding protein SO:0001217, UniRef:UniRef50_M2Q1V9 contig_5 cds 91518 92447 - GCA009771115_00142 mannose-6-phosphate isomerase SO:0001217, UniRef:UniRef50_C2CIY4 contig_5 cds 92554 93042 - GCA009771115_00143 YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein SO:0001217, UniRef:UniRef50_A0A4R5NB19 contig_5 cds 93169 94515 - GCA009771115_00144 Dicarboxylate/amino acid:cation symporter SO:0001217, UniRef:UniRef50_R9KV50 contig_5 cds 94729 96066 - GCA009771115_00145 Branched-chain amino acid transport system carrier protein SO:0001217, UniRef:UniRef50_A0A929ZND9 contig_5 cds 96400 97629 - GCA009771115_00146 Peptidase T SO:0001217, UniRef:UniRef50_P0C2T7 contig_5 cds 97703 98614 - GCA009771115_00147 eamA EamA domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D2AAF9 contig_5 cds 98823 100520 + GCA009771115_00148 hypothetical protein PFAM:PF00990.26 contig_5 cds 100645 101214 + GCA009771115_00149 hypothetical protein contig_5 cds 101294 102046 - GCA009771115_00150 Lactose phosphotransferase system repressor SO:0001217, UniRef:UniRef50_A0A173U0W5 contig_5 cds 102071 102979 - GCA009771115_00151 Glycyl-radical enzyme activating protein SO:0001217, UniRef:UniRef50_A0A4U9T9A0 contig_5 cds 103210 105624 + GCA009771115_00152 Pyruvate formate-lyase SO:0001217, UniRef:UniRef50_A0A7Z7K763 contig_5 cds 105713 106387 + GCA009771115_00153 Putative fructose-6-phosphate aldolase SO:0001217, UniRef:UniRef50_C2BF30 contig_5 cds 106937 107152 - GCA009771115_00154 2TM domain-containing protein SO:0001217, UniRef:UniRef50_UPI0015625D91 contig_5 cds 107197 107946 - GCA009771115_00155 ABC transporter permease SO:0001217, UniRef:UniRef50_UPI001933AC5C contig_5 cds 107947 108816 - GCA009771115_00156 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A9D0ZRM8 contig_5 cds 109041 109688 - GCA009771115_00157 trkA Potassium transporter TrkA SO:0001217, UniRef:UniRef50_W7UXB4 contig_5 cds 109749 111074 - GCA009771115_00158 Trk family potassium uptake protein SO:0001217, UniRef:UniRef50_F3AK67 contig_5 cds 111126 112469 - GCA009771115_00159 Aminopeptidase SO:0001217, UniRef:UniRef50_F2BX56 contig_5 cds 112551 113528 - GCA009771115_00160 hypothetical protein PFAM:PF13529.12 contig_5 cds 113849 115171 - GCA009771115_00161 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_5 cds 115269 116006 - GCA009771115_00162 Membrane protein, putative SO:0001217, UniRef:UniRef50_A8AZW5 contig_5 cds 115999 116835 - GCA009771115_00163 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_D0BN11 contig_5 cds 117120 117677 - GCA009771115_00164 TetR/AcrR family transcriptional regulator SO:0001217, UniRef:UniRef50_UPI0023F8FFC5 contig_5 cds 117691 118107 - GCA009771115_00165 DUF2871 domain-containing protein SO:0001217, UniRef:UniRef50_F7JPE9 contig_5 cds 118328 121399 - GCA009771115_00166 Efflux ABC transporter, permease protein SO:0001217, UniRef:UniRef50_A0A133Y114 contig_5 cds 121393 122094 - GCA009771115_00167 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A098Z685 contig_5 cds 122363 122743 + GCA009771115_00168 Lipoprotein SO:0001217, UniRef:UniRef50_A0A173QTF6 contig_5 cds 123159 123872 - GCA009771115_00169 DUF3800 domain-containing protein SO:0001217, UniRef:UniRef50_E6LN35 contig_5 cds 123932 124966 - GCA009771115_00170 non-specific serine/threonine protein kinase SO:0001217, UniRef:UniRef50_A0A1Q6V0R5 contig_5 cds 125021 125482 + GCA009771115_00171 XRE family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A6N7IX22 contig_5 cds 125675 127123 + GCA009771115_00172 cstA CstA N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_H1CZY9 contig_5 cds 127425 128819 + GCA009771115_00173 Transporter SO:0001217, UniRef:UniRef50_F7V3K4 contig_5 cds 129159 129986 - GCA009771115_00174 PTS system mannose/fructose/sorbose family transporter subunit IID SO:0001217, UniRef:UniRef50_A0A2X3SI27 contig_5 cds 129983 130798 - GCA009771115_00175 PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC SO:0001217, UniRef:UniRef50_A0A2X4CB52 contig_5 cds 130820 131311 - GCA009771115_00176 putative phosphotransferase enzyme IIB component M6_Spy0801 SO:0001217, UniRef:UniRef50_Q5XCC7 contig_5 cds 131329 131763 - GCA009771115_00177 PTS EIIA type-4 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0R2ICN3 contig_5 cds 131708 132799 - GCA009771115_00178 hypothetical protein contig_5 cds 132874 133623 - GCA009771115_00179 hypothetical protein PFAM:PF00072.30, PFAM:PF00165.29, PFAM:PF12833.13 contig_5 cds 133727 135340 - GCA009771115_00180 hypothetical protein PFAM:PF02518.31, PFAM:PF06580.19 contig_5 cds 135550 136617 + GCA009771115_00181 cysteine desulfurase family protein SO:0001217, UniRef:UniRef50_UPI00094E8613 contig_5 cds 136676 137770 + GCA009771115_00182 mnmA tRNA-specific 2-thiouridylase MnmA SO:0001217, UniRef:UniRef50_Q8ZPZ4 contig_5 cds 137906 139126 + GCA009771115_00183 Sodium/glutamate symporter SO:0001217, UniRef:UniRef50_A0A4P7QIR3 contig_5 cds 139312 140208 + GCA009771115_00184 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_K1LXJ0 contig_5 cds 140280 141188 + GCA009771115_00185 ABC-2 type transporter transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_K1M376 contig_5 cds 141220 143991 - GCA009771115_00186 Phosphoenolpyruvate carboxylase SO:0001217, UniRef:UniRef50_Q9A0U7 contig_5 cds 144237 145499 + GCA009771115_00187 Glutamate dehydrogenase SO:0001217, UniRef:UniRef50_A0A6N3C7I8 contig_5 cds 145681 146901 - GCA009771115_00188 DUF4147 domain-containing protein SO:0001217, UniRef:UniRef50_A0A928FHG9 contig_5 cds 146913 147314 - GCA009771115_00189 GNAT family N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A2N5NI28 contig_5 cds 147471 150878 - GCA009771115_00190 Type I restriction enzyme endonuclease subunit EC:3.1.21.3, KEGG:K01153, SO:0001217, UniRef:UniRef50_A0A2N6SSN7, UniRef:UniRef90_H3NJW2 contig_5 cds 150882 152012 - GCA009771115_00191 Type I restriction endonuclease subunit S EC:3.1.21.3, KEGG:K01154, RefSeq:WP_164823986.1, SO:0001217, UniParc:UPI0013E2067F, UniRef:UniRef100_A0A6G7B8Q3, UniRef:UniRef50_A0A1Y3XDX3, UniRef:UniRef90_A0A3E1J1Q8 contig_5 cds 151999 153606 - GCA009771115_00192 site-specific DNA-methyltransferase (adenine-specific) EC:2.1.1.72, KEGG:K03427, RefSeq:WP_164823985.1, SO:0001217, UniParc:UPI0013E1F35C, UniRef:UniRef100_A0A6G7B9Z5, UniRef:UniRef50_A0A3E3K032, UniRef:UniRef90_A0A3A1XIY0 contig_5 cds 153606 153818 - GCA009771115_00193 XRE family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A095X8I7, UniRef:UniRef90_A0A3A1XGA3 contig_5 cds 154211 155971 + GCA009771115_00194 ATP-binding cassette, subfamily B, bacterial SO:0001217, UniRef:UniRef50_R9ITG9 contig_6 cds 499 1815 - GCA009771115_00195 hypothetical protein contig_6 cds 1829 2806 - GCA009771115_00196 hypothetical protein contig_6 cds 2799 3668 - GCA009771115_00197 hypothetical protein PFAM:PF00881.29 contig_7 cds 55 1731 + GCA009771115_00198 mdlB ABC transporter COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_G5GKX1, UniRef:UniRef90_G5GKX1 contig_7 cds 1724 3433 + GCA009771115_00199 mdlB ABC transporter COG:COG1132, COG:V, RefSeq:WP_047199662.1, SO:0001217, UniParc:UPI0006402726, UniRef:UniRef100_UPI0006402726, UniRef:UniRef50_G5GB05, UniRef:UniRef90_G5GKX0 contig_7 cds 3409 4953 + GCA009771115_00200 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_F3AZ53, UniRef:UniRef90_UPI003008965D contig_7 cds 4943 5647 + GCA009771115_00201 ecfT Cobalt transport protein COG:COG0619, COG:H, KEGG:K16785, SO:0001217, UniRef:UniRef50_G5GKW8, UniRef:UniRef90_G5GKW8 contig_7 cds 5658 6242 + GCA009771115_00202 Trep-Strep domain-containing protein KEGG:K16926, RefSeq:WP_143877062.1, SO:0001217, UniParc:UPI0010EED372, UniRef:UniRef100_UPI0010EED372, UniRef:UniRef50_D3QZY5, UniRef:UniRef90_D3QZY5 contig_7 cds 6284 6391 + GCA009771115_00203 hypothetical protein SO:0001217, UniParc:UPI00032FB4F9, UniRef:UniRef100_A0AAD2WYV7, UniRef:UniRef50_A0AAD2WYV7, UniRef:UniRef90_A0AAD2WYV7 contig_7 cds 6508 6924 + GCA009771115_00204 RNA polymerase sigma-70 region 4 domain-containing protein RefSeq:WP_001074478.1, SO:0001217, UniParc:UPI00019C143A, UniRef:UniRef100_C2BCL6, UniRef:UniRef50_G5GKT5, UniRef:UniRef90_C2BCL6 contig_7 cds 7009 7338 + GCA009771115_00205 DUF3847 domain-containing protein RefSeq:WP_000712033.1, SO:0001217, UniParc:UPI00019C143B, UniRef:UniRef100_C2BCL7, UniRef:UniRef50_G5GKK2, UniRef:UniRef90_C2BCL7 contig_7 cds 7583 9235 + GCA009771115_00206 mobQ MobQ family relaxase RefSeq:WP_143877063.1, SO:0001217, UniParc:UPI0010D6EC22, UniRef:UniRef100_UPI0010D6EC22, UniRef:UniRef50_M2PK66, UniRef:UniRef90_G5GKK1 contig_7 cds 9238 9990 + GCA009771115_00207 Phage replisome organiser N-terminal domain-containing protein RefSeq:WP_000774837.1, SO:0001217, UniParc:UPI00019C2E9C, UniRef:UniRef100_A0A6G4MYV0, UniRef:UniRef50_A0A1W1VC44, UniRef:UniRef90_H1PMK9 contig_7 cds 10164 10487 + GCA009771115_00208 copG CopG family transcriptional regulator RefSeq:WP_001222544.1, SO:0001217, UniParc:UPI0002B9734D, UniRef:UniRef100_UPI0002B9734D, UniRef:UniRef50_A0A929V365, UniRef:UniRef90_G5GKJ8 contig_7 cds 10559 10897 + GCA009771115_00209 KilA-N DNA-binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D4JJI5 contig_7 cds 10943 11566 + GCA009771115_00210 (pseudo) KilA-N DNA-binding domain-containing protein SO:0001217, UniRef:UniRef50_M2P6T4, UniRef:UniRef50_UPI000AC4A1AA, UniRef:UniRef90_D3MU29, UniRef:UniRef90_UPI002583169D contig_7 cds 11676 11861 + GCA009771115_00211 tnpW Transposon-encoded protein TnpW RefSeq:WP_143877064.1, SO:0001217, UniParc:UPI0010DC7A79, UniRef:UniRef100_UPI0010DC7A79, UniRef:UniRef50_B6W6B4, UniRef:UniRef90_E0NMA9 contig_7 cds 12044 12463 + GCA009771115_00212 hypothetical protein PFAM:PF00164.32 contig_7 cds 12543 13079 + GCA009771115_00213 Small ribosomal subunit protein uS7 SO:0001217, UniRef:UniRef50_P38526 contig_7 cds 13101 15218 + GCA009771115_00214 Elongation factor G SO:0001217, UniRef:UniRef50_A9KRZ3 contig_7 cds 15327 16556 + GCA009771115_00215 Elongation factor Tu 1 SO:0001217, UniRef:UniRef50_P0CE47 contig_7 cds 16752 18344 + GCA009771115_00216 hypothetical protein PFAM:PF00117.34, PFAM:PF06418.20, PFAM:PF07722.19 contig_7 cds 18357 18626 + GCA009771115_00217 Fatty acid kinase subunit A-like middle domain-containing protein SO:0001217, UniRef:UniRef50_C7RFI5 contig_7 cds 18669 19646 + GCA009771115_00218 BD-FAE-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A3C1WVT3 contig_7 cds 19713 20852 + GCA009771115_00219 hypothetical protein PFAM:PF00149.33 contig_7 cds 20981 22252 + GCA009771115_00220 Peptidase C14 SO:0001217, UniRef:UniRef50_A0A0B7LC30 contig_7 cds 22262 23623 + GCA009771115_00221 hypothetical protein PFAM:PF01473.26, PFAM:PF19085.6 contig_7 cds 23954 25762 + GCA009771115_00222 glmU Bifunctional protein GlmU SO:0001217, UniRef:UniRef50_A0A7U9SJZ4 contig_7 cds 25875 26777 + GCA009771115_00223 MobA-like NTP transferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A133Z028 contig_7 cds 26767 28404 + GCA009771115_00224 Betaine/carnitine/choline transporter SO:0001217, UniRef:UniRef50_G9WPU0 contig_7 cds 28472 29428 + GCA009771115_00225 licD1 Lipopolysaccharide cholinephosphotransferase LicD1 SO:0001217, UniRef:UniRef50_A0A0M2NG51 contig_7 cds 29475 30071 - GCA009771115_00226 Cytidylate kinase SO:0001217, UniRef:UniRef50_C4G8K5 contig_7 cds 30249 30929 + GCA009771115_00227 hypothetical protein PFAM:PF00491.26 contig_7 cds 31021 31659 - GCA009771115_00228 hypothetical protein PFAM:PF00156.33, PFAM:PF14681.12 contig_7 cds 31860 33251 + GCA009771115_00229 Uracil-xanthine permease SO:0001217, UniRef:UniRef50_F7V1K5 contig_7 cds 33371 33886 - GCA009771115_00230 hypothetical protein contig_7 cds 34721 35092 - GCA009771115_00231 hypothetical protein contig_8 cds 19 1341 - GCA009771115_00232 GHKL domain-containing protein SO:0001217, UniRef:UniRef50_A0A376H6J3 contig_8 cds 1974 2732 - GCA009771115_00233 ABC transporter permease SO:0001217, UniRef:UniRef50_UPI0009D99F6F contig_8 cds 2735 3601 - GCA009771115_00234 hypothetical protein PFAM:PF00004.35, PFAM:PF00005.33, PFAM:PF13304.12 contig_10 tRNA 511 583 + GCA009771115_00235 trnW tRNA-Trp(cca) SO:0000271 contig_10 cds 830 1645 + GCA009771115_00236 hypothetical protein contig_10 tRNA 1731 1803 + GCA009771115_00237 trnV tRNA-Val(tac) SO:0000273 contig_10 tRNA 1812 1885 + GCA009771115_00238 trnM tRNA-Met(cat) SO:0000266 contig_10 cds 2195 2737 + GCA009771115_00239 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase SO:0001217, UniRef:UniRef50_A0A5N9E8I1 contig_10 cds 2820 4238 + GCA009771115_00240 Cysteine--tRNA ligase SO:0001217, UniRef:UniRef50_C4Z3N5 contig_10 cds 4223 4672 + GCA009771115_00241 Mini-ribonuclease 3 SO:0001217, UniRef:UniRef50_G2SXJ2 contig_10 cds 4662 5411 + GCA009771115_00242 trmH TrmH family tRNA/rRNA methyltransferase SO:0001217, UniRef:UniRef50_A0A8A0RMX8 contig_10 cds 5423 6004 + GCA009771115_00243 hypothetical protein PFAM:PF00196.25, PFAM:PF04542.20, PFAM:PF12645.13 contig_10 cds 6070 7500 - GCA009771115_00244 Amino acid permease SO:0001217, UniRef:UniRef50_A0A140DSE7 contig_10 cds 7719 8459 - GCA009771115_00245 Glucosamine-6-phosphate deaminase SO:0001217, UniRef:UniRef50_Q8DV70 contig_10 cds 8768 9916 + GCA009771115_00246 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_10 cds 10053 11072 + GCA009771115_00247 Glyceraldehyde-3-phosphate dehydrogenase SO:0001217, UniRef:UniRef50_P0C0G6 contig_10 cds 11094 12365 + GCA009771115_00248 Phosphoglycerate kinase SO:0001217, UniRef:UniRef50_O52632 contig_10 cds 12386 13132 + GCA009771115_00249 Triosephosphate isomerase SO:0001217, UniRef:UniRef50_P50918 contig_10 cds 13207 14346 + GCA009771115_00250 hypothetical protein PFAM:PF08238.18 contig_10 cds 14390 15856 + GCA009771115_00251 Adenylosuccinate lyase SO:0001217, UniRef:UniRef50_A0A7U9MUE4 contig_10 cds 16014 16445 - GCA009771115_00252 hypothetical protein PFAM:PF00210.30 contig_10 cds 16719 18191 + GCA009771115_00253 Dipeptidase SO:0001217, UniRef:UniRef50_Q8G6Z9 contig_10 cds 18219 20294 + GCA009771115_00254 hypothetical protein PFAM:PF02743.24 contig_10 cds 20540 21247 - GCA009771115_00255 D/L-lactic acid transporter SO:0001217, UniRef:UniRef50_F9UST3 contig_10 cds 21428 22297 + GCA009771115_00256 pyridoxal kinase SO:0001217, UniRef:UniRef50_A0A379EYM2 contig_10 cds 22408 22662 + GCA009771115_00257 secG Protein-export membrane protein SecG SO:0001217, UniRef:UniRef50_A0A6S6R876 contig_10 cds 22734 24821 + GCA009771115_00258 Ribonuclease R SO:0001217, UniRef:UniRef50_A0A7X5HT53 contig_10 cds 24906 25379 + GCA009771115_00259 SsrA-binding protein SO:0001217, UniRef:UniRef50_A1ANL4 contig_10 cds 25720 26481 + GCA009771115_00260 Uridine phosphorylase SO:0001217, UniRef:UniRef50_A0A0B7LLH2 contig_10 tmRNA 26845 27189 - GCA009771115_00261 ssrA transfer-messenger RNA, SsrA SO:0000584 contig_10 cds 27432 27896 + GCA009771115_00262 Nucleoside 2-deoxyribosyltransferase SO:0001217, UniRef:UniRef50_A0AA87AL80 contig_10 cds 27924 28475 + GCA009771115_00263 Catalase SO:0001217, UniRef:UniRef50_W6S1L2 contig_10 cds 28576 29610 + GCA009771115_00264 Tryptophan--tRNA ligase SO:0001217, UniRef:UniRef50_Q8XMQ5 contig_10 cds 29717 30862 - GCA009771115_00265 hypothetical protein contig_10 cds 30958 32532 - GCA009771115_00266 hypothetical protein PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF05362.19, PFAM:PF07728.20, PFAM:PF13541.12 contig_10 cds 32790 34874 + GCA009771115_00267 DNA topoisomerase 1 SO:0001217, UniRef:UniRef50_V1CS44 contig_10 cds 34944 35726 + GCA009771115_00268 codY Global transcriptional regulator CodY SO:0001217, UniRef:UniRef50_A6LSN9 contig_10 cds 35952 36347 + GCA009771115_00269 flgB Flagellar basal body rod protein FlgB SO:0001217, UniRef:UniRef50_C0FQD5 contig_10 cds 36367 36816 + GCA009771115_00270 flgC Flagellar basal-body rod protein FlgC SO:0001217, UniRef:UniRef50_A0A9D6HW66 contig_10 cds 36865 37194 + GCA009771115_00271 fliE Flagellar hook-basal body complex protein FliE SO:0001217, UniRef:UniRef50_A0A1G8BTF6 contig_10 cds 37222 38838 + GCA009771115_00272 fliF Flagellar M-ring protein FliF SO:0001217, UniRef:UniRef50_A0A6N7J0R0 contig_10 cds 38842 39849 + GCA009771115_00273 fliG Flagellar motor switch protein FliG SO:0001217, UniRef:UniRef50_A0A970LQE4 contig_10 cds 39842 40711 + GCA009771115_00274 hypothetical protein contig_10 cds 40729 42054 + GCA009771115_00275 Type 3 secretion system ATPase SO:0001217, UniRef:UniRef50_A0A0V8QJE1 contig_10 cds 42084 42527 + GCA009771115_00276 fliJ Flagellar FliJ protein SO:0001217, UniRef:UniRef50_A0A5P6VUN9 contig_10 cds 42572 43447 + GCA009771115_00277 hypothetical protein contig_10 cds 43473 45086 + GCA009771115_00278 hypothetical protein PFAM:PF02120.21 contig_10 cds 45143 45895 + GCA009771115_00279 hypothetical protein contig_10 cds 45973 46380 + GCA009771115_00280 Flagellar operon protein SO:0001217, UniRef:UniRef50_R7IU54 contig_10 cds 46462 48144 + GCA009771115_00281 flgE Flagellar hook protein FlgE SO:0001217, UniRef:UniRef50_A0A3R6IIK3 contig_10 cds 48325 49119 + GCA009771115_00282 MotA/TolQ/ExbB proton channel domain-containing protein SO:0001217, UniRef:UniRef50_R9JEM3 contig_10 cds 49119 50066 + GCA009771115_00283 OmpA-like domain-containing protein SO:0001217, UniRef:UniRef50_N2BQ54 contig_10 cds 50105 50626 + GCA009771115_00284 hypothetical protein contig_10 cds 50672 51664 + GCA009771115_00285 fliM Flagellar motor switch protein FliM SO:0001217, UniRef:UniRef50_E0RUS0 contig_10 cds 51648 52832 + GCA009771115_00286 fliN Flagellar motor switch protein FliN SO:0001217, UniRef:UniRef50_A0A140L5D3 contig_10 cds 52848 53210 + GCA009771115_00287 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A1D7X954, UniRef:UniRef90_A0A1I6XWC5 contig_10 cds 53215 53592 + GCA009771115_00288 hypothetical protein contig_10 cds 53589 54434 + GCA009771115_00289 fliP Flagellar biosynthetic protein FliP SO:0001217, UniRef:UniRef50_R9KJ72 contig_10 cds 54505 54774 + GCA009771115_00290 fliQ Flagellar biosynthetic protein FliQ SO:0001217, UniRef:UniRef50_F2JGQ6 contig_10 cds 54794 55579 + GCA009771115_00291 fliR Flagellar biosynthetic protein FliR SO:0001217, UniRef:UniRef50_A0A7X5CAE4 contig_10 cds 55671 56810 + GCA009771115_00292 flhB Flagellar biosynthetic protein FlhB SO:0001217, UniRef:UniRef50_A0A7U9RPP3 contig_10 cds 57017 59077 + GCA009771115_00293 flhA Flagellar biosynthesis protein FlhA SO:0001217, UniRef:UniRef50_P35620 contig_10 cds 59067 60686 + GCA009771115_00294 hypothetical protein PFAM:PF00004.35, PFAM:PF00448.28 contig_10 cds 60689 61537 + GCA009771115_00295 MinD/ParA family protein SO:0001217, UniRef:UniRef50_A0A940ZTQ8 contig_10 cds 61856 62611 + GCA009771115_00296 hypothetical protein PFAM:PF07238.19 contig_10 cds 62608 63663 + GCA009771115_00297 hypothetical protein PFAM:PF00072.30, PFAM:PF01339.22 contig_10 cds 63666 65774 + GCA009771115_00298 cheA Chemotaxis protein CheA SO:0001217, UniRef:UniRef50_A0A1G6ARM0 contig_10 cds 65789 66256 + GCA009771115_00299 CheW-like domain-containing protein SO:0001217, UniRef:UniRef50_N2BKQ8 contig_10 cds 66295 66909 + GCA009771115_00300 CheC-like protein domain-containing protein SO:0001217, UniRef:UniRef50_S0J192 contig_10 cds 66939 67427 + GCA009771115_00301 cheD putative chemoreceptor glutamine deamidase CheD SO:0001217, UniRef:UniRef50_A0A0U1KVM9 contig_10 cds 67424 67891 + GCA009771115_00302 hypothetical protein contig_10 cds 67936 68697 + GCA009771115_00303 RNA polymerase sigma factor SO:0001217, UniRef:UniRef50_L7VI65 contig_10 cds 68720 70318 + GCA009771115_00304 hypothetical protein PFAM:PF03961.19 contig_10 cds 70404 70718 + GCA009771115_00305 hypothetical protein contig_10 cds 70756 71631 + GCA009771115_00306 hypothetical protein contig_10 cds 71635 72237 + GCA009771115_00307 hypothetical protein contig_10 cds 72506 73225 + GCA009771115_00308 Small ribosomal subunit protein uS2 SO:0001217, UniRef:UniRef50_Q8DIA2 contig_10 cds 73251 74186 + GCA009771115_00309 Elongation factor Ts SO:0001217, UniRef:UniRef50_Q895L1 contig_10 cds 74249 75157 + GCA009771115_00310 Polysaccharide deacetylase SO:0001217, UniRef:UniRef50_C0FQI4 contig_10 cds 75180 75992 + GCA009771115_00311 Polymer-forming protein SO:0001217, UniRef:UniRef50_A0A1H3FTN7 contig_10 cds 75999 76691 + GCA009771115_00312 Uridylate kinase SO:0001217, UniRef:UniRef50_A0AAE3JDU6 contig_10 cds 76669 77265 + GCA009771115_00313 Ribosome-recycling factor SO:0001217, UniRef:UniRef50_F1T541 contig_10 cds 77523 78233 + GCA009771115_00314 Isoprenyl transferase SO:0001217, UniRef:UniRef50_A0A7U9QWK3 contig_10 cds 78318 79130 + GCA009771115_00315 Phosphatidate cytidylyltransferase SO:0001217, UniRef:UniRef50_B0G362 contig_10 cds 79160 80314 + GCA009771115_00316 1-deoxy-D-xylulose 5-phosphate reductoisomerase SO:0001217, UniRef:UniRef50_A9KMX2 contig_10 cds 80326 81363 + GCA009771115_00317 Zinc metalloprotease SO:0001217, UniRef:UniRef50_A0A1G4P6K1 contig_10 cds 81472 82545 + GCA009771115_00318 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) SO:0001217, UniRef:UniRef50_P58667 contig_10 cds 82670 87061 + GCA009771115_00319 DNA polymerase III PolC-type SO:0001217, UniRef:UniRef50_A0A1H9QIZ1 contig_10 cds 87112 87405 + GCA009771115_00320 hypothetical protein PFAM:PF01817.26 contig_10 cds 87426 88247 + GCA009771115_00321 hypothetical protein PFAM:PF08282.18 contig_10 cds 88350 89906 + GCA009771115_00322 hypothetical protein contig_10 cds 90233 90727 + GCA009771115_00323 Translation initiation factor IF-3 SO:0001217, UniRef:UniRef50_Q728R6 contig_10 cds 90741 90938 + GCA009771115_00324 Large ribosomal subunit protein bL35 SO:0001217, UniRef:UniRef50_P66269 contig_10 cds 90960 91316 + GCA009771115_00325 Large ribosomal subunit protein bL20 SO:0001217, UniRef:UniRef50_P57228 contig_10 cds 91445 92461 + GCA009771115_00326 UDP-glucose 4-epimerase SO:0001217, UniRef:UniRef50_P24325 contig_10 tRNA 92550 92621 + GCA009771115_00327 trnE tRNA-Glu(ctc) SO:0000259 contig_10 cds 92710 93165 + GCA009771115_00328 rimP Ribosome maturation factor RimP SO:0001217, UniRef:UniRef50_C4ZBF8 contig_10 cds 93181 94389 + GCA009771115_00329 nusA Transcription termination/antitermination protein NusA SO:0001217, UniRef:UniRef50_A0A1I7F474 contig_10 cds 94548 94817 + GCA009771115_00330 hypothetical protein contig_10 cds 94810 95109 + GCA009771115_00331 Ribosomal protein eL8/eL30/eS12/Gadd45 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1L4BZT0 contig_10 cds 95130 97838 + GCA009771115_00332 hypothetical protein PFAM:PF00009.33, PFAM:PF00071.28, PFAM:PF03144.31, PFAM:PF04760.21, PFAM:PF11987.13, PFAM:PF22042.2 contig_10 cds 97886 98326 + GCA009771115_00333 hypothetical protein contig_10 cds 98433 99377 + GCA009771115_00334 recJ Phosphoesterase RecJ domain-containing protein SO:0001217, UniRef:UniRef50_S0IXZ4 contig_10 cds 99499 100428 + GCA009771115_00335 hypothetical protein contig_10 cds 100448 101359 + GCA009771115_00336 hypothetical protein PFAM:PF01467.32, PFAM:PF01687.23 contig_10 cds 101572 101838 + GCA009771115_00337 Small ribosomal subunit protein uS15 SO:0001217, UniRef:UniRef50_Q1GVQ9 contig_10 cds 102004 104091 + GCA009771115_00338 Polyribonucleotide nucleotidyltransferase SO:0001217, UniRef:UniRef50_A9KNK6 contig_10 cds 104095 104838 + GCA009771115_00339 Segregation and condensation protein A SO:0001217, UniRef:UniRef50_A0A3E2XNL3 contig_10 cds 104954 105523 + GCA009771115_00340 Segregation and condensation protein B SO:0001217, UniRef:UniRef50_A0A1Y4S222 contig_10 cds 105586 106488 + GCA009771115_00341 N-acetylmannosamine kinase SO:0001217, UniRef:UniRef50_A0A1Y3TNH9 contig_10 cds 106549 107826 + GCA009771115_00342 BaiN-like insert domain-containing protein SO:0001217, UniRef:UniRef50_A0A1G9G8K8 contig_10 cds 107889 108542 + GCA009771115_00343 Cytidylate kinase SO:0001217, UniRef:UniRef50_M8E2Z0 contig_10 cds 108653 109519 + GCA009771115_00344 4-hydroxy-3-methylbut-2-enyl diphosphate reductase SO:0001217, UniRef:UniRef50_A0A3D2IPA4 contig_10 cds 109489 110580 + GCA009771115_00345 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_C0CI71 contig_10 cds 110645 111433 + GCA009771115_00346 protein-glutamate O-methyltransferase SO:0001217, UniRef:UniRef50_A0A069RDM0 contig_10 cds 112022 113884 + GCA009771115_00347 Efflux ABC transporter, permease protein SO:0001217, UniRef:UniRef50_C0FZ08 contig_10 cds 113911 114597 + GCA009771115_00348 Antimicrobial peptide ABC transporter ATPase SO:0001217, UniRef:UniRef50_A0A4U9RN82 contig_10 cds 114660 115637 - GCA009771115_00349 hypothetical protein PFAM:PF13482.12 contig_10 cds 115820 117265 + GCA009771115_00350 tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase SO:0001217, UniRef:UniRef50_A9KMU9 contig_10 cds 117300 117917 + GCA009771115_00351 hypothetical protein PFAM:PF00633.29, PFAM:PF01330.27, PFAM:PF07499.19, PFAM:PF14520.12 contig_10 cds 118051 119064 + GCA009771115_00352 ruvB Holliday junction branch migration complex subunit RuvB SO:0001217, UniRef:UniRef50_Q5WHR5 contig_10 cds 119162 119602 + GCA009771115_00353 zapA Cell division protein ZapA SO:0001217, UniRef:UniRef50_A0A7X4Z6E1 contig_10 cds 119622 121820 + GCA009771115_00354 hypothetical protein contig_10 cds 121820 123142 + GCA009771115_00355 hypothetical protein contig_10 cds 123135 124574 + GCA009771115_00356 hypothetical protein PFAM:PF00905.27, PFAM:PF21922.1 contig_10 cds 124655 125368 + GCA009771115_00357 hypothetical protein contig_10 cds 125355 125714 + GCA009771115_00358 ytfJ Sporulation protein YtfJ SO:0001217, UniRef:UniRef50_F7KAD2 contig_10 cds 125830 126015 + GCA009771115_00359 Large ribosomal subunit protein bL28 SO:0001217, UniRef:UniRef50_B8I388 contig_10 cds 126167 126526 + GCA009771115_00360 Asp23/Gls24 family envelope stress response protein SO:0001217, UniRef:UniRef50_G5GGR0 contig_10 cds 126498 128222 + GCA009771115_00361 dhaL DhaL domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I0B1E4 contig_10 cds 128331 130394 + GCA009771115_00362 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17191.10, PFAM:PF19833.4 contig_10 cds 130462 132213 - GCA009771115_00363 rqcH Rqc2-like protein RqcH SO:0001217, UniRef:UniRef50_A5ZQ83 contig_10 cds 132390 133268 + GCA009771115_00364 hypothetical protein PFAM:PF03755.18, PFAM:PF08340.16 contig_10 cds 133433 133687 + GCA009771115_00365 Putative regulatory protein Cphy_2880 SO:0001217, UniRef:UniRef50_A9KPG4 contig_10 cds 133680 134318 + GCA009771115_00366 Guanylate kinase SO:0001217, UniRef:UniRef50_A0A173RNL5 contig_10 cds 134318 134653 + GCA009771115_00367 DNA-directed RNA polymerase subunit omega SO:0001217, UniRef:UniRef50_R9KG79 contig_10 cds 134650 135969 + GCA009771115_00368 rimO Ribosomal protein uS12 methylthiotransferase RimO SO:0001217, UniRef:UniRef50_A9KLS2 contig_10 cds 135966 136508 + GCA009771115_00369 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase SO:0001217, UniRef:UniRef50_A0A6L5X787 contig_10 cds 136635 137192 + GCA009771115_00370 rsmD RsmD family RNA methyltransferase SO:0001217, UniRef:UniRef50_R7IT40 contig_10 cds 137189 137692 + GCA009771115_00371 Phosphopantetheine adenylyltransferase SO:0001217, UniRef:UniRef50_A9KNU8 contig_10 cds 137682 138419 + GCA009771115_00372 hypothetical protein contig_10 cds 138587 139255 + GCA009771115_00373 hypothetical protein PFAM:PF00702.32 contig_10 cds 139382 140377 + GCA009771115_00374 hypothetical protein contig_10 cds 140349 140885 + GCA009771115_00375 recU Holliday junction resolvase RecU SO:0001217, UniRef:UniRef50_A0A1C5PRP2 contig_10 cds 140888 142132 + GCA009771115_00376 hypothetical protein contig_10 cds 142315 142623 + GCA009771115_00377 Large ribosomal subunit protein bL21 SO:0001217, UniRef:UniRef50_Q9K8J5 contig_10 cds 142629 142958 + GCA009771115_00378 hypothetical protein contig_10 cds 142962 143246 + GCA009771115_00379 rpmA 50S ribosomal protein L27 GO:0000315, GO:0003735, GO:0006412, GO:0022625, KEGG:K02899, SO:0001217, UniRef:UniRef50_P60493, UniRef:UniRef90_A0A6N7J027 contig_10 cds 143310 144593 + GCA009771115_00380 GTPase Obg SO:0001217, UniRef:UniRef50_A9KMF5 contig_10 cds 144658 144954 + GCA009771115_00381 yhbY Ribosome assembly RNA-binding protein YhbY SO:0001217, UniRef:UniRef50_A0A9D5RLV6 contig_10 cds 144970 146175 + GCA009771115_00382 hypothetical protein PFAM:PF01467.32 contig_10 cds 146193 146525 + GCA009771115_00383 rsfS Ribosomal silencing factor RsfS SO:0001217, UniRef:UniRef50_A0A0M6WCB1 contig_10 cds 146762 147382 - GCA009771115_00384 lexA LexA repressor SO:0001217, UniRef:UniRef50_B8I2Q1 contig_10 cds 147543 147881 + GCA009771115_00385 hypothetical protein PFAM:PF01476.26 contig_10 cds 148189 149271 + GCA009771115_00386 xerD Site-specific recombinase XerD SO:0001217, UniRef:UniRef50_R7QV60 contig_10 cds 149364 150464 - GCA009771115_00387 ylyB putative RNA pseudouridine synthase YlyB SO:0001217, UniRef:UniRef50_Q45480 contig_10 cds 150487 151008 - GCA009771115_00388 hypothetical protein contig_10 cds 151062 152147 - GCA009771115_00389 hypothetical protein PFAM:PF00465.25, PFAM:PF01761.26, PFAM:PF24621.2 contig_10 cds 152151 152783 - GCA009771115_00390 hypothetical protein contig_10 cds 153062 154438 - GCA009771115_00391 hypothetical protein contig_10 cds 154492 154914 - GCA009771115_00392 pilT Twitching motility protein PilT SO:0001217, UniRef:UniRef50_G5GGY0 contig_10 cds 155022 155960 - GCA009771115_00393 hypothetical protein PFAM:PF00768.25, PFAM:PF13354.11 contig_10 cds 156010 156405 - GCA009771115_00394 Methylglyoxal synthase SO:0001217, UniRef:UniRef50_A0A143XRR1 contig_10 cds 156418 157536 - GCA009771115_00395 ftsW putative peptidoglycan glycosyltransferase FtsW SO:0001217, UniRef:UniRef50_A0A9D2IK95 contig_10 cds 157542 158219 - GCA009771115_00396 hypothetical protein PFAM:PF03775.22, PFAM:PF05209.18, PFAM:PF22642.1 contig_10 cds 158221 161061 - GCA009771115_00397 mrdA Peptidoglycan D,D-transpeptidase MrdA SO:0001217, UniRef:UniRef50_A0A7U9X8W1 contig_10 cds 161058 161591 - GCA009771115_00398 hypothetical protein contig_10 cds 161591 162445 - GCA009771115_00399 mreC Cell shape-determining protein MreC SO:0001217, UniRef:UniRef50_A0A416I517 contig_10 cds 162455 163474 - GCA009771115_00400 mreB Cell shape-determining protein MreB SO:0001217, UniRef:UniRef50_N2B9T2 contig_10 cds 163488 164186 - GCA009771115_00401 hypothetical protein PFAM:PF20582.4 contig_10 cds 164232 165524 - GCA009771115_00402 Cystathionine beta-lyase family protein involved in aluminum resistance SO:0001217, UniRef:UniRef50_A0A7X5E7P1 contig_10 cds 165530 166465 - GCA009771115_00403 tRNA dimethylallyltransferase SO:0001217, UniRef:UniRef50_A0A285PU51 contig_10 cds 166487 168466 - GCA009771115_00404 hypothetical protein PFAM:PF02518.31, PFAM:PF08676.16, PFAM:PF13589.12 contig_10 cds 168460 171123 - GCA009771115_00405 mutS DNA mismatch repair protein MutS SO:0001217, UniRef:UniRef50_Q2RJG2 contig_10 cds 171113 172735 - GCA009771115_00406 FAD-dependent protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A5Z6B1 contig_10 cds 172921 174162 - GCA009771115_00407 hypothetical protein PFAM:PF01266.30, PFAM:PF03486.20, PFAM:PF13450.12 contig_10 cds 174237 175889 - GCA009771115_00408 Polysaccharide biosynthesis protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_F7V620 contig_10 cds 175896 176957 - GCA009771115_00409 DUF3048 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H2QEC7 contig_10 cds 176959 177453 - GCA009771115_00410 ybeY Endoribonuclease YbeY SO:0001217, UniRef:UniRef50_A0A0K9NG25 contig_10 cds 177450 178679 - GCA009771115_00411 hypothetical protein contig_10 cds 178676 179674 - GCA009771115_00412 PhoH-like protein SO:0001217, UniRef:UniRef50_A0A1C5N7G7 contig_10 cds 179687 180829 - GCA009771115_00413 hypothetical protein PFAM:PF07719.23, PFAM:PF13240.11, PFAM:PF13287.12, PFAM:PF13290.12 contig_10 cds 180810 181679 - GCA009771115_00414 folD Bifunctional protein FolD SO:0001217, UniRef:UniRef50_P54382 contig_10 cds 181773 183458 - GCA009771115_00415 Formate--tetrahydrofolate ligase SO:0001217, UniRef:UniRef50_Q83WS0 contig_10 cds 183531 186701 - GCA009771115_00416 hypothetical protein PFAM:PF01580.24, PFAM:PF09397.16, PFAM:PF13491.11, PFAM:PF17854.6 contig_10 cds 186715 187452 - GCA009771115_00417 putative transcriptional regulatory protein CD630_07950 SO:0001217, UniRef:UniRef50_Q189Y9 contig_10 cds 187510 188346 - GCA009771115_00418 hypothetical protein PFAM:PF00571.33, PFAM:PF03471.22 contig_10 cds 188363 189535 - GCA009771115_00419 Alanine racemase SO:0001217, UniRef:UniRef50_A0A6N7SR08 contig_10 cds 189620 191428 - GCA009771115_00420 hypothetical protein PFAM:PF01256.23, PFAM:PF03853.21 contig_10 cds 191403 192098 - GCA009771115_00421 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1H2QDU1 contig_10 cds 192110 192736 - GCA009771115_00422 Redox-sensing transcriptional repressor Rex SO:0001217, UniRef:UniRef50_Q8RC93 contig_10 cds 192885 194822 - GCA009771115_00423 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_F7JIQ2 contig_10 cds 194933 195916 - GCA009771115_00424 hypothetical protein contig_10 cds 196298 198709 - GCA009771115_00425 Leucine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A949E1K8 contig_10 cds 198850 199083 - GCA009771115_00426 hypothetical protein contig_10 cds 199073 200113 - GCA009771115_00427 histidine kinase SO:0001217, UniRef:UniRef50_F0GXT5 contig_10 cds 200098 200769 - GCA009771115_00428 Response regulator receiver domain protein SO:0001217, UniRef:UniRef50_C2BI60 contig_10 cds 200854 201159 - GCA009771115_00429 hypothetical protein SO:0001217, UniRef:UniRef50_F0GXT3 contig_10 cds 201200 201313 - GCA009771115_00430 hypothetical protein contig_10 cds 201310 201612 - GCA009771115_00431 hypothetical protein contig_10 cds 201762 203846 - GCA009771115_00432 Elongation factor G SO:0001217, UniRef:UniRef50_A0A3P7P1P3 contig_10 cds 203972 204649 - GCA009771115_00433 hypothetical protein PFAM:PF00075.30, PFAM:PF01693.22, PFAM:PF13456.12 contig_10 cds 204804 206084 + GCA009771115_00434 3-phosphoshikimate 1-carboxyvinyltransferase SO:0001217, UniRef:UniRef50_A0A140L7T1 contig_10 cds 206088 207425 - GCA009771115_00435 NADH oxidase SO:0001217, UniRef:UniRef50_Q5XC60 contig_10 cds 207626 209005 - GCA009771115_00436 Argininosuccinate lyase SO:0001217, UniRef:UniRef50_Q74GT9 contig_10 cds 209005 210213 - GCA009771115_00437 Argininosuccinate synthase SO:0001217, UniRef:UniRef50_C0R1H5 contig_10 cds 210464 211981 - GCA009771115_00438 histidine kinase SO:0001217, UniRef:UniRef50_A0A371IKN7 contig_10 cds 212137 212643 - GCA009771115_00439 SEC-C domain-containing protein SO:0001217, UniRef:UniRef50_U2W5R5 contig_10 cds 212772 213026 + GCA009771115_00440 hypothetical protein contig_10 cds 213188 214477 - GCA009771115_00441 Adenylosuccinate synthetase SO:0001217, UniRef:UniRef50_V2YFN8 contig_10 cds 214504 215406 - GCA009771115_00442 degV DegV family protein SO:0001217, UniRef:UniRef50_E7GJ56 contig_10 cds 215509 217128 - GCA009771115_00443 Chaperonin GroEL SO:0001217, UniRef:UniRef50_Q9KKF0 contig_10 cds 217153 217437 - GCA009771115_00444 Co-chaperonin GroES SO:0001217, UniRef:UniRef50_P30719 contig_10 cds 217709 219943 - GCA009771115_00445 DNA topoisomerase (ATP-hydrolyzing) SO:0001217, UniRef:UniRef50_A0A1C6G258 contig_10 cds 220003 221955 - GCA009771115_00446 DNA topoisomerase (ATP-hydrolyzing) SO:0001217, UniRef:UniRef50_F7V7Y3 contig_10 cds 221991 222431 - GCA009771115_00447 dUTP diphosphatase SO:0001217, UniRef:UniRef50_D4CM17 contig_10 cds 222435 223445 - GCA009771115_00448 Glycerol-3-phosphate dehydrogenase [NAD(P)+] SO:0001217, UniRef:UniRef50_C4ZD61 contig_10 cds 223445 224098 - GCA009771115_00449 hypothetical protein contig_10 cds 224098 225423 - GCA009771115_00450 GTPase Der SO:0001217, UniRef:UniRef50_C4ZD63 contig_10 cds 225504 225803 - GCA009771115_00451 Flagellar biosynthesis protein SO:0001217, UniRef:UniRef50_A0A1M7Y2C6 contig_10 cds 225818 226174 - GCA009771115_00452 UPF0102 protein A2Y22_02445 SO:0001217, UniRef:UniRef50_A0A1F8UPC3 contig_10 cds 226329 228206 - GCA009771115_00453 hypothetical protein PFAM:PF02120.21 contig_10 cds 228259 228897 - GCA009771115_00454 Ribonuclease HII SO:0001217, UniRef:UniRef50_A9KLL7 contig_10 cds 228920 229591 - GCA009771115_00455 Signal peptidase I SO:0001217, UniRef:UniRef50_A0A927TVY3 contig_10 cds 229603 230487 - GCA009771115_00456 Ribosome biogenesis GTPase A SO:0001217, UniRef:UniRef50_A0A413FKR9 contig_10 cds 230610 231221 - GCA009771115_00457 Signal peptidase I SO:0001217, UniRef:UniRef50_A0A1H3GTK0 contig_10 cds 231298 231651 - GCA009771115_00458 Large ribosomal subunit protein bL19 SO:0001217, UniRef:UniRef50_A0A7V5EAH5 contig_10 cds 231749 232513 - GCA009771115_00459 tRNA (guanine-N(1)-)-methyltransferase SO:0001217, UniRef:UniRef50_A4J665 contig_10 cds 232510 233028 - GCA009771115_00460 hypothetical protein PFAM:PF01782.24, PFAM:PF05239.21, PFAM:PF24986.1 contig_10 cds 233085 233315 - GCA009771115_00461 khpA RNA-binding protein KhpA SO:0001217, UniRef:UniRef50_Q8XJP5 contig_10 cds 233343 233588 - GCA009771115_00462 Small ribosomal subunit protein bS16 SO:0001217, UniRef:UniRef50_A2RJS1 contig_10 cds 233628 234974 - GCA009771115_00463 Signal recognition particle protein SO:0001217, UniRef:UniRef50_A0AAP4EZC8 contig_10 cds 234974 235303 - GCA009771115_00464 UPF0122 protein C819_02534 SO:0001217, UniRef:UniRef50_R9MVN2 contig_10 cds 235443 236354 - GCA009771115_00465 ftsY Signal recognition particle receptor FtsY SO:0001217, UniRef:UniRef50_A0A7U9RTS7 contig_10 cds 236420 239977 - GCA009771115_00466 Chromosome partition protein Smc SO:0001217, UniRef:UniRef50_A0A8T4JRW7 contig_10 cds 239981 240673 - GCA009771115_00467 Ribonuclease 3 SO:0001217, UniRef:UniRef50_A0A9D2KZZ8 contig_10 cds 240748 240981 - GCA009771115_00468 Acyl carrier protein SO:0001217, UniRef:UniRef50_A0A143XVE8 contig_10 cds 240993 241988 - GCA009771115_00469 Phosphate acyltransferase SO:0001217, UniRef:UniRef50_A0A174YZZ7 contig_10 cds 242163 242354 - GCA009771115_00470 Large ribosomal subunit protein bL32 SO:0001217, UniRef:UniRef50_A6TRU4 contig_10 cds 242358 242876 - GCA009771115_00471 hypothetical protein contig_10 cds 243018 244280 + GCA009771115_00472 hypothetical protein PFAM:PF01467.32 contig_10 cds 244533 245369 - GCA009771115_00473 hypothetical protein contig_10 cds 245458 246132 - GCA009771115_00474 Uracil-DNA glycosylase SO:0001217, UniRef:UniRef50_P39615 contig_10 cds 246139 248322 - GCA009771115_00475 hypothetical protein contig_10 cds 248382 249326 - GCA009771115_00476 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_E0S2K9 contig_10 cds 249347 250171 - GCA009771115_00477 hypothetical protein contig_10 cds 250134 251642 - GCA009771115_00478 hypothetical protein PFAM:PF00512.31, PFAM:PF00672.30, PFAM:PF02518.31, PFAM:PF14501.12 contig_10 cds 251629 252309 - GCA009771115_00479 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A173U145 contig_10 cds 252342 252950 - GCA009771115_00480 hypothetical protein contig_10 cds 253061 254881 - GCA009771115_00481 hypothetical protein PFAM:PF00580.27, PFAM:PF13086.12, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_10 cds 254883 256352 - GCA009771115_00482 Glutamate--tRNA ligase SO:0001217, UniRef:UniRef50_A9KRX7 contig_10 cds 256365 257570 - GCA009771115_00483 hypothetical protein contig_10 cds 257588 258403 - GCA009771115_00484 hypothetical protein contig_10 cds 258537 259775 - GCA009771115_00485 hypothetical protein PFAM:PF18980.5 contig_10 cds 259791 263405 - GCA009771115_00486 hypothetical protein PFAM:PF18983.5 contig_10 cds 263507 265276 - GCA009771115_00487 Arginine--tRNA ligase SO:0001217, UniRef:UniRef50_C4ZD15 contig_10 cds 265281 265784 - GCA009771115_00488 queT QueT transporter family protein SO:0001217, UniRef:UniRef50_G2SX24 contig_10 cds 265868 266737 - GCA009771115_00489 DUF2225 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0M6WXR7 contig_10 cds 266747 268414 - GCA009771115_00490 Glutamine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A947YWN6 contig_10 cds 268522 269385 - GCA009771115_00491 Peptidase S54 rhomboid domain-containing protein SO:0001217, UniRef:UniRef50_A0A6L5X4M3 contig_10 cds 269582 271594 + GCA009771115_00492 htpG Chaperone protein HtpG SO:0001217, UniRef:UniRef50_A0A1D7XM16 contig_10 cds 271691 271954 - GCA009771115_00493 Glyoxalase SO:0001217, UniRef:UniRef50_R9K5I9 contig_10 cds 272034 275951 - GCA009771115_00494 hypothetical protein PFAM:PF00270.35, PFAM:PF00580.27, PFAM:PF12705.13, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_10 cds 275935 279312 - GCA009771115_00495 hypothetical protein PFAM:PF12705.13, PFAM:PF21445.3 contig_10 cds 279380 280456 - GCA009771115_00496 Peptide chain release factor 1 SO:0001217, UniRef:UniRef50_B4SAR5 contig_10 cds 280614 281573 - GCA009771115_00497 Release factor glutamine methyltransferase SO:0001217, UniRef:UniRef50_A0A1M6Z0I6 contig_10 cds 281536 281739 - GCA009771115_00498 rpmE 50S ribosomal protein L31 GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_Q3A926, UniRef:UniRef90_C4GAL3 contig_10 cds 281902 282054 - GCA009771115_00499 hypothetical protein contig_10 cds 282057 283238 - GCA009771115_00500 Major facilitator superfamily (MFS) profile domain-containing protein SO:0001217, UniRef:UniRef50_A0A133YLP9 contig_10 cds 283280 283453 - GCA009771115_00501 hypothetical protein contig_10 cds 283515 285506 - GCA009771115_00502 hypothetical protein PFAM:PF00006.31, PFAM:PF07497.18 contig_10 cds 285609 286124 - GCA009771115_00503 hypothetical protein contig_10 cds 286368 287066 - GCA009771115_00504 hypothetical protein contig_10 cds 287265 287906 - GCA009771115_00505 Glyoxylase, beta-lactamase superfamily II SO:0001217, UniRef:UniRef50_A0A1H2SDU2 contig_10 cds 287903 291427 - GCA009771115_00506 Pyruvate:ferredoxin oxidoreductase SO:0001217, UniRef:UniRef50_A0A3A4Q9Z1 contig_10 cds 291674 293314 + GCA009771115_00507 ABC transport system ATP-binding protein SO:0001217, UniRef:UniRef50_R5Y8E8 contig_10 cds 293447 295645 - GCA009771115_00508 SHS2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Q6QJI0 contig_10 cds 295638 296255 - GCA009771115_00509 Dephospho-CoA kinase SO:0001217, UniRef:UniRef50_A0A0J1J6W3 contig_10 cds 296344 299010 - GCA009771115_00510 DNA polymerase I SO:0001217, UniRef:UniRef50_A0A2K4ZH41 contig_10 cds 299129 300919 - GCA009771115_00511 Xaa-Pro dipeptidase SO:0001217, UniRef:UniRef50_A0A173RI28 contig_10 cds 301148 302566 - GCA009771115_00512 ftsZ Cell division protein FtsZ SO:0001217, UniRef:UniRef50_F0Z3W8 contig_10 cds 302632 303543 - GCA009771115_00513 hypothetical protein contig_10 cds 303553 304677 - GCA009771115_00514 ftsW putative peptidoglycan glycosyltransferase FtsW SO:0001217, UniRef:UniRef50_A0A1H3GVE2 contig_10 cds 304674 306029 - GCA009771115_00515 UDP-N-acetylmuramoylalanine--D-glutamate ligase SO:0001217, UniRef:UniRef50_A9KLU2 contig_10 cds 306161 307108 - GCA009771115_00516 Phospho-N-acetylmuramoyl-pentapeptide-transferase SO:0001217, UniRef:UniRef50_B9MQ98 contig_10 cds 307227 309119 - GCA009771115_00517 Peptidoglycan glycosyltransferase SO:0001217, UniRef:UniRef50_A0A2G3E9F6 contig_10 cds 309169 309636 - GCA009771115_00518 hypothetical protein contig_10 cds 309665 310609 - GCA009771115_00519 Ribosomal RNA small subunit methyltransferase H SO:0001217, UniRef:UniRef50_B0K8J9 contig_10 cds 310620 311057 - GCA009771115_00520 mraZ Transcriptional regulator MraZ SO:0001217, UniRef:UniRef50_B2TS31 contig_10 cds 311632 311967 + GCA009771115_00521 TM2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A8T3U5N3 contig_10 cds 311969 312331 + GCA009771115_00522 DUF2752 domain-containing protein SO:0001217, UniRef:UniRef50_UPI00338FC362 contig_10 cds 312349 312723 - GCA009771115_00523 DUF4186 domain-containing protein SO:0001217, UniRef:UniRef50_A0A173VXF6 contig_10 cds 312734 312913 - GCA009771115_00524 hypothetical protein contig_10 cds 312971 313729 - GCA009771115_00525 Transport permease protein SO:0001217, UniRef:UniRef50_A0A097AP53 contig_10 cds 313726 314622 - GCA009771115_00526 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A9E8S0U8 contig_10 cds 315199 315579 - GCA009771115_00527 hypothetical protein SO:0001217, UniRef:UniRef50_A5ZWT9 contig_10 cds 316087 316245 - GCA009771115_00528 hypothetical protein contig_10 cds 316284 316706 - GCA009771115_00529 Histidine kinase SO:0001217, UniRef:UniRef50_E0NKF6 contig_10 cds 316721 316924 - GCA009771115_00530 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_K1LEN8 contig_10 cds 317203 318072 - GCA009771115_00531 Phosphatidylglycerol--prolipoprotein diacylglyceryl transferase SO:0001217, UniRef:UniRef50_C4GAB8 contig_10 cds 318087 319202 - GCA009771115_00532 S-adenosylmethionine:tRNA ribosyltransferase-isomerase SO:0001217, UniRef:UniRef50_Q8XJ15 contig_10 cds 319242 321665 - GCA009771115_00533 Phenylalanine--tRNA ligase beta subunit SO:0001217, UniRef:UniRef50_A0A136WFE0 contig_10 cds 321788 322816 - GCA009771115_00534 Phenylalanine--tRNA ligase alpha subunit SO:0001217, UniRef:UniRef50_A6TNP8 contig_10 cds 323020 324198 - GCA009771115_00535 hypothetical protein PFAM:PF11799.13 contig_10 cds 324344 325546 - GCA009771115_00536 hypothetical protein contig_10 cds 325701 326762 - GCA009771115_00537 Cytidylate kinase-like family protein SO:0001217, UniRef:UniRef50_A0A1I0IRF1 contig_10 cds 326784 328127 - GCA009771115_00538 Transporter UIT6 family (TC 9-B53) SO:0001217, UniRef:UniRef50_R6Z6A5 contig_10 cds 328255 329592 - GCA009771115_00539 hypothetical protein contig_10 cds 329653 330453 - GCA009771115_00540 hypothetical protein contig_10 cds 330447 331142 - GCA009771115_00541 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_Q8DNT3 contig_10 cds 331145 331513 - GCA009771115_00542 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_G2T2T7 contig_10 cds 331709 332557 - GCA009771115_00543 ABC 3 transport family protein SO:0001217, UniRef:UniRef50_G9XCB4 contig_10 cds 332554 333432 - GCA009771115_00544 ABC 3 transport family protein SO:0001217, UniRef:UniRef50_V9HUG0 contig_10 cds 333422 334141 - GCA009771115_00545 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_H3NM45 contig_10 cds 334163 335101 - GCA009771115_00546 ABC transporter, substrate-binding protein SO:0001217, UniRef:UniRef50_K9CM99 contig_10 cds 335354 336661 - GCA009771115_00547 Aminopeptidase SO:0001217, UniRef:UniRef50_A0A1G5WRQ1 contig_10 cds 336823 339207 - GCA009771115_00548 hypothetical protein PFAM:PF02687.27 contig_10 cds 339214 339924 - GCA009771115_00549 bceA Bacitracin export ATP-binding protein BceA SO:0001217, UniRef:UniRef50_A0A174HJT3 contig_10 cds 339947 340738 - GCA009771115_00550 Metal ABC transporter permease SO:0001217, UniRef:UniRef50_Q251Z8 contig_10 cds 340755 341399 - GCA009771115_00551 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_N2BU76 contig_10 cds 341582 341758 - GCA009771115_00552 hypothetical protein contig_10 cds 341881 344229 - GCA009771115_00553 ATP-dependent DNA helicase SO:0001217, UniRef:UniRef50_A0A3R6A119 contig_10 cds 344371 345381 - GCA009771115_00554 Aspartate--ammonia ligase SO:0001217, UniRef:UniRef50_Q81F55 contig_10 cds 345482 346873 - GCA009771115_00555 Asparagine--tRNA ligase SO:0001217, UniRef:UniRef50_Q81L32 contig_10 cds 346989 347135 - GCA009771115_00556 hypothetical protein contig_10 cds 347464 348681 + GCA009771115_00557 hypothetical protein contig_10 cds 348735 349610 - GCA009771115_00558 tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_C9RLB2 contig_10 cds 349735 350232 - GCA009771115_00559 Small multi-drug export protein SO:0001217, UniRef:UniRef50_F3B6F1 contig_10 cds 350347 351054 + GCA009771115_00560 hypothetical protein contig_10 cds 351116 353083 - GCA009771115_00561 Glutamine-dependent NAD(+) synthetase SO:0001217, UniRef:UniRef50_D7NAM1 contig_10 cds 353136 354179 + GCA009771115_00562 hypothetical protein contig_10 cds 354230 355186 - GCA009771115_00563 hypothetical protein PFAM:PF00561.26, PFAM:PF12146.15 contig_10 cds 355266 356198 - GCA009771115_00564 hypothetical protein contig_10 cds 356303 358318 - GCA009771115_00565 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF17768.7 contig_10 cds 358499 358987 - GCA009771115_00566 Restriction endonuclease subunit S EC:3.1.21.3, KEGG:K01154, SO:0001217, UniRef:UniRef50_E1PK59, UniRef:UniRef90_A0A374BMN2 contig_10 cds 359119 360345 - GCA009771115_00567 Type I restriction modification DNA specificity domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Y4S5E2 contig_10 cds 360523 361878 - GCA009771115_00568 ATPase SO:0001217, UniRef:UniRef50_D2Q690 contig_11 cds 262 930 - GCA009771115_00569 MotA/TolQ/ExbB proton channel domain-containing protein SO:0001217, UniRef:UniRef50_B0G6H5, UniRef:UniRef90_A0A2J8B2J0 contig_11 cds 983 1585 - GCA009771115_00570 helix-turn-helix transcriptional regulator SO:0001217, UniRef:UniRef50_K0XV34, UniRef:UniRef90_UPI0030D21A58 contig_11 cds 1746 1937 + GCA009771115_00571 DNA-binding protein SO:0001217, UniRef:UniRef50_K0Y654, UniRef:UniRef90_K0Y654 contig_11 cds 1949 2599 + GCA009771115_00572 Core-binding (CB) domain-containing protein SO:0001217, UniRef:UniRef50_U2S473 contig_11 cds 2804 3019 + GCA009771115_00573 tyrosine-type recombinase/integrase SO:0001217, UniRef:UniRef50_A0A547E8M7, UniRef:UniRef90_UPI0020885104 contig_11 cds 3030 3413 + GCA009771115_00574 Mobilization protein SO:0001217, UniRef:UniRef50_V1CMM6, UniRef:UniRef90_V1CMM6 contig_11 cds 3506 4426 + GCA009771115_00575 DNA primase SO:0001217, UniRef:UniRef50_G5GEN2, UniRef:UniRef90_V1CJ50 contig_11 cds 4423 5385 + GCA009771115_00576 AAA family ATPase SO:0001217, UniRef:UniRef50_V1DCI3, UniRef:UniRef90_V1DCI3 contig_11 cds 5654 6034 + GCA009771115_00577 Bacterial mobilisation domain-containing protein SO:0001217, UniRef:UniRef50_M2Q4B8, UniRef:UniRef90_U7UCM8 contig_11 cds 6034 6750 + GCA009771115_00578 Relaxase/mobilization nuclease family protein SO:0001217, UniRef:UniRef50_A6TV37 contig_11 cds 6910 7473 + GCA009771115_00579 flgN FlgN protein SO:0001217, UniRef:UniRef50_C7GZD4 contig_11 cds 7621 7842 + GCA009771115_00580 putative transcriptional regulator SO:0001217, UniRef:UniRef50_B0S1X9, UniRef:UniRef90_A0A1V4AYL6 contig_11 cds 7844 8866 + GCA009771115_00581 Cytosine-specific methyltransferase EC:2.1.1.37, KEGG:K00558, SO:0001217, UniRef:UniRef50_A0A084F1C5, UniRef:UniRef90_A0A084F1C5 contig_11 cds 8880 9836 + GCA009771115_00582 HaeIII family restriction endonuclease SO:0001217, UniRef:UniRef50_O68584, UniRef:UniRef90_UPI000D303FB0 contig_11 cds 9919 10566 + GCA009771115_00583 DUF5343 domain-containing protein SO:0001217, UniRef:UniRef50_A0A078KUW4 contig_11 cds 10576 11151 + GCA009771115_00584 Swt1-like HEPN domain-containing protein SO:0001217, UniRef:UniRef50_A0A1H4T9K7 contig_11 ncRNA 11406 11536 + GCA009771115_00585 SpR18_sRNA Streptococcus sRNA SpR18 RFAM:RF02446, SO:0000655 contig_11 cds 11558 12997 - GCA009771115_00586 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2C6C822, UniRef:UniRef90_UPI00241F6F38 contig_11 cds 13019 13450 - GCA009771115_00587 hipB DNA-binding helix-turn-helix protein COG:COG1396, COG:K, RefSeq:WP_004835567.1, SO:0001217, UniParc:UPI0001FD946E, UniRef:UniRef100_F0GXH2, UniRef:UniRef50_H1PKZ0, UniRef:UniRef90_A0A133KFK6 contig_11 cds 13710 13904 + GCA009771115_00588 ICEBs1 excisionase SO:0001217, UniRef:UniRef50_H1PKZ1, UniRef:UniRef90_C2BEP8 contig_11 cds 13906 14340 + GCA009771115_00589 Arm DNA-binding domain-containing protein SO:0001217, UniRef:UniRef50_UPI0028EDAA2E contig_11 cds 14530 14745 + GCA009771115_00590 helix-turn-helix transcriptional regulator SO:0001217, UniRef:UniRef50_K1LCM6, UniRef:UniRef90_UPI0007830B3C contig_11 cds 15046 15261 + GCA009771115_00591 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_UPI0007919650, UniRef:UniRef90_UPI002803AC0B contig_11 cds 15258 15590 + GCA009771115_00592 Acetyltransferase, GNAT family SO:0001217, UniRef:UniRef50_A0A135YV47, UniRef:UniRef90_A0A135YV47 contig_11 cds 15866 16702 + GCA009771115_00593 KilA-N domain-containing protein SO:0001217, UniRef:UniRef50_A0A841QZA8, UniRef:UniRef90_UPI0029079D84 contig_11 cds 16707 18149 + GCA009771115_00594 Eco57I restriction-modification methylase domain-containing protein SO:0001217, UniRef:UniRef50_A0A174RTD3, UniRef:UniRef90_UPI002909F423 contig_11 cds 18162 20300 + GCA009771115_00595 ATP-binding protein SO:0001217, UniRef:UniRef50_A0A6N2W737, UniRef:UniRef90_UPI0029076B69 contig_11 cds 20317 20898 + GCA009771115_00596 Response regulator receiver domain protein SO:0001217, UniRef:UniRef50_D7N900 contig_11 cds 20888 21514 + GCA009771115_00597 HNH endonuclease SO:0001217, UniRef:UniRef50_D7N901, UniRef:UniRef90_UPI00290ED7AF contig_11 cds 21820 22314 + GCA009771115_00598 Type 1 glutamine amidotransferase-like domain-containing protein SO:0001217, UniRef:UniRef50_UPI0004AF1238, UniRef:UniRef90_UPI0004AF1238 contig_11 ncRNA 22571 22701 + GCA009771115_00599 SpR18_sRNA Streptococcus sRNA SpR18 RFAM:RF02446, SO:0000655 contig_11 cds 22934 23047 + GCA009771115_00600 hypothetical protein contig_11 cds 23089 24468 - GCA009771115_00601 kdpD histidine kinase COG:COG2205, COG:T, SO:0001217, UniRef:UniRef50_H3NJ93, UniRef:UniRef90_A0A133KG47 contig_11 cds 24459 25118 - GCA009771115_00602 ompR Stage 0 sporulation A-like protein COG:COG0745, COG:TK, SO:0001217, UniRef:UniRef50_P33112, UniRef:UniRef90_A0A9E7DJ84 contig_11 cds 25169 25981 - GCA009771115_00603 NisI/SpaI family lantibiotic immunity lipoprotein KEGG:K20489, SO:0001217, UniRef:UniRef50_UPI0013753333, UniRef:UniRef90_UPI0013753333 contig_11 cds 25997 26737 - GCA009771115_00604 mutG lantibiotic immunity ABC transporter MutG family permease subunit KEGG:K20492, SO:0001217, UniRef:UniRef50_V8BHH8, UniRef:UniRef90_UPI002433B446 contig_11 cds 26737 27477 - GCA009771115_00605 mutE Mutacin ABC transporter protein, MutE KEGG:K20491, SO:0001217, UniRef:UniRef50_V8BI88, UniRef:UniRef90_D6S8K2 contig_11 cds 27481 28182 - GCA009771115_00606 mutF Mutacin ABC transporter, ATP-binding protein MutF COG:COG1131, COG:JV, SO:0001217, UniRef:UniRef50_A0A0H3J1C5, UniRef:UniRef90_D6S8K1 contig_12 cds 153 1421 + GCA009771115_00607 Methyltransferase SO:0001217, UniRef:UniRef50_F0GWF7, UniRef:UniRef90_A0A135ZC12 contig_12 cds 1414 2994 + GCA009771115_00608 DNA (cytosine-5-)-methyltransferase SO:0001217, UniRef:UniRef50_G4Q972 contig_12 cds 3068 3724 + GCA009771115_00609 virulence protein SO:0001217, UniRef:UniRef50_A0A1I1ZSE6, UniRef:UniRef90_UPI00290B8793 contig_12 cds 3708 3938 + GCA009771115_00610 DUF4314 domain-containing protein SO:0001217, UniRef:UniRef50_D2RK45 contig_12 cds 3898 4101 + GCA009771115_00611 DUF5049 domain-containing protein SO:0001217, UniRef:UniRef50_G8QWK9 contig_12 cds 4202 4504 + GCA009771115_00612 transcriptional regulator SO:0001217, UniRef:UniRef50_A0A134CHB8, UniRef:UniRef90_UPI0012486326 contig_12 cds 4594 7215 + GCA009771115_00613 Putative phage terminase, large subunit SO:0001217, UniRef:UniRef50_A0A6A0B4G3, UniRef:UniRef90_A0A134CH99 contig_12 cds 7227 8459 + GCA009771115_00614 Phage portal protein, HK97 family SO:0001217, UniRef:UniRef50_C0CKU9 contig_12 cds 8452 9195 + GCA009771115_00615 ATP-dependent Clp protease proteolytic subunit SO:0001217, UniRef:UniRef50_A0A0K8J6U3 contig_12 cds 9285 10472 + GCA009771115_00616 HK97 family phage major capsid protein SO:0001217, UniRef:UniRef50_U5F8F8 contig_12 cds 10491 10766 + GCA009771115_00617 Phage gp6-like head-tail connector protein SO:0001217, UniRef:UniRef50_S0J1S9 contig_12 cds 10766 11098 + GCA009771115_00618 Phage head-tail adaptor SO:0001217, UniRef:UniRef50_N2AWJ1 contig_12 cds 11098 11475 + GCA009771115_00619 HK97 gp10 family phage protein SO:0001217, UniRef:UniRef50_R9KP88 contig_12 cds 11475 11822 + GCA009771115_00620 Prophage pi2 protein 38 SO:0001217, UniRef:UniRef50_U2LF79 contig_12 cds 11840 12448 + GCA009771115_00621 Phage major tail protein, phi13 family SO:0001217, UniRef:UniRef50_A0A916VEM1 contig_12 cds 12470 12844 + GCA009771115_00622 Tail assembly chaperone SO:0001217, UniRef:UniRef50_A0A4R3JBH1 contig_12 cds 12841 13005 + GCA009771115_00623 Toxin-antitoxin system, antitoxin component, ribbon-helix-helix domain protein SO:0001217, UniRef:UniRef50_U2JPC5 contig_12 cds 13068 15629 + GCA009771115_00624 TP901 family phage tail tape measure protein SO:0001217, UniRef:UniRef50_A0A4R3Z8U1 contig_12 cds 15645 17549 + GCA009771115_00625 inlB InlB B-repeat-containing protein SO:0001217, UniRef:UniRef50_A0A9E5KS96 contig_12 cds 17533 19545 + GCA009771115_00626 Alpha-L-rhamnosidase six-hairpin glycosidase domain-containing protein SO:0001217, UniRef:UniRef50_A0A969ZW23 contig_12 cds 19641 20045 + GCA009771115_00627 Holin SO:0001217, UniRef:UniRef50_S6ESX1 contig_12 cds 20049 20966 + GCA009771115_00628 lysozyme SO:0001217, UniRef:UniRef50_A0A7T7ZAG9 contig_12 cds 21105 21506 + GCA009771115_00629 RNA polymerase subunit sigma-70 SO:0001217, UniRef:UniRef50_A0A3E2CS56 contig_12 cds 21499 21675 + GCA009771115_00630 SHOCT domain-containing protein SO:0001217, UniRef:UniRef50_A0A1W1UFP2, UniRef:UniRef90_UPI0015E11788 contig_12 cds 21720 23411 + GCA009771115_00631 Recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_R9IZR9, UniRef:UniRef90_A0A3E2CSJ6 contig_13 cds 421 774 + GCA009771115_00632 Abortive infection protein AbiGII SO:0001217, UniRef:UniRef50_F9MMX7 contig_13 cds 1133 2443 + GCA009771115_00633 AbiJ-NTD3 domain-containing protein SO:0001217, UniRef:UniRef50_D1AXV8, UniRef:UniRef90_C2BIN2 contig_13 cds 2451 3281 + GCA009771115_00634 Anti-bacteriophage protein A/HamA C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_D1AXV9, UniRef:UniRef90_C2BIN3 contig_13 cds 3275 6373 + GCA009771115_00635 DEAD/DEAH box helicase RefSeq:WP_304141089.1, SO:0001217, UniParc:UPI0026F251BB, UniRef:UniRef100_UPI0026F251BB, UniRef:UniRef50_S1NEH6, UniRef:UniRef90_C2BIN4 contig_13 cds 6435 6740 - GCA009771115_00636 relaxase/mobilization nuclease domain-containing protein SO:0001217, UniRef:UniRef50_F9MMM3, UniRef:UniRef90_UPI003744A727 contig_13 cds 6742 7098 - GCA009771115_00637 mobC Plasmid mobilization relaxosome protein MobC SO:0001217, UniRef:UniRef50_A0A133NJG7, UniRef:UniRef90_A0A8H2QS74 contig_13 cds 7268 8341 - GCA009771115_00638 rhuM Toxin-antitoxin system, toxin component, Fic family COG:COG3943, COG:S, SO:0001217, UniRef:UniRef50_A3CVL6, UniRef:UniRef90_C2CF14 contig_13 cds 8334 8522 - GCA009771115_00639 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_UPI00321C1DE2, UniRef:UniRef90_UPI00321C1DE2 contig_13 cds 8923 9198 + GCA009771115_00640 hypothetical protein PFAM:PF08220.18, PFAM:PF08279.18, PFAM:PF13412.12 contig_13 cds 9223 9396 + GCA009771115_00641 Type I restriction-modification system subunit M SO:0001217, UniRef:UniRef50_A0A7X6YRF6 contig_13 cds 9368 9523 + GCA009771115_00642 hypothetical protein contig_13 cds 9538 9657 + GCA009771115_00643 hypothetical protein contig_13 cds 9699 11108 + GCA009771115_00644 hypothetical protein PFAM:PF01202.28, PFAM:PF01487.21 contig_13 tRNA 11201 11274 + GCA009771115_00645 trnR tRNA-Arg(ccg) SO:0001036 contig_13 cds 11359 12654 + GCA009771115_00646 hypothetical protein PFAM:PF08239.17 contig_13 cds 12859 13557 + GCA009771115_00647 Pseudouridine synthase SO:0001217, UniRef:UniRef50_A0A419T2U4 contig_13 cds 13612 15636 + GCA009771115_00648 DNA ligase SO:0001217, UniRef:UniRef50_A0A3A9GIL5 contig_13 cds 15624 16334 - GCA009771115_00649 Amino acid racemase SO:0001217, UniRef:UniRef50_A0A174MPV2 contig_13 cds 16478 17686 - GCA009771115_00650 ATP-grasp domain-containing protein SO:0001217, UniRef:UniRef50_E7MQY4 contig_13 cds 18010 19533 + GCA009771115_00651 Sodium/proline symporter SO:0001217, UniRef:UniRef50_A0A9D5Y721 contig_13 cds 19548 20942 - GCA009771115_00652 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_F3AHV6 contig_13 cds 21691 22158 - GCA009771115_00653 hypothetical protein contig_14 cds 323 826 + GCA009771115_00654 DUF5626 domain-containing protein SO:0001217, UniRef:UniRef50_A0A374I4L5 contig_14 cds 863 1657 + GCA009771115_00655 hypothetical protein contig_14 cds 2000 2833 + GCA009771115_00656 hypothetical protein contig_14 cds 3102 3347 + GCA009771115_00657 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_N2A978 contig_14 cds 3366 3665 + GCA009771115_00658 hypothetical protein contig_14 cds 3737 6661 + GCA009771115_00659 Peptidase M16C associated domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I3FUN9 contig_14 cds 6827 7843 + GCA009771115_00660 GTPase Era SO:0001217, UniRef:UniRef50_Q5FJT7 contig_14 cds 7859 8593 + GCA009771115_00661 hypothetical protein PFAM:PF11967.14 contig_14 cds 8624 10021 + GCA009771115_00662 Glycine--tRNA ligase SO:0001217, UniRef:UniRef50_Q81XT3 contig_14 cds 10073 11050 + GCA009771115_00663 hypothetical protein PFAM:PF05175.20 contig_14 cds 11183 11905 - GCA009771115_00664 putative ABC transporter ATP-binding protein PEB1C SO:0001217, UniRef:UniRef50_A1VZQ5 contig_14 cds 11907 12671 - GCA009771115_00665 yecS Inner membrane amino-acid ABC transporter permease protein YecS SO:0001217, UniRef:UniRef50_A0A1U7M5P1 contig_14 cds 12673 13542 - GCA009771115_00666 Solute-binding protein family 3/N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_D0BJA1 contig_14 ncRNA-region 13649 13816 - Lysine riboswitch aptamer RFAM:RF00168, SO:0000035 contig_14 cds 14048 16714 + GCA009771115_00667 Pyruvate, phosphate dikinase SO:0001217, UniRef:UniRef50_E7MQ92 contig_14 cds 16830 17093 + GCA009771115_00668 N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A9E5G8R4 contig_14 cds 17112 18938 + GCA009771115_00669 Oligopeptidase F SO:0001217, UniRef:UniRef50_R5CKE9 contig_14 cds 19148 21406 + GCA009771115_00670 ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_A0A1Y3YHP0 contig_14 cds 21574 22560 + GCA009771115_00671 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_S0JC01 contig_14 cds 22569 24170 + GCA009771115_00672 Binding-protein-dependent transport systems inner membrane component SO:0001217, UniRef:UniRef50_A9KKN0 contig_14 cds 24189 25373 + GCA009771115_00673 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_G9WP23 contig_14 cds 25373 26404 + GCA009771115_00674 appF Oligopeptide transport ATP-binding protein AppF SO:0001217, UniRef:UniRef50_P42065 contig_14 cds 26397 26717 + GCA009771115_00675 hypothetical protein contig_14 cds 26804 28228 + GCA009771115_00676 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A0D0SDZ9 contig_14 cds 28435 29928 + GCA009771115_00677 Nicotinate phosphoribosyltransferase SO:0001217, UniRef:UniRef50_C9KKG3 contig_14 cds 29991 31298 + GCA009771115_00678 5-methylthioadenosine/S-adenosylhomocysteine deaminase SO:0001217, UniRef:UniRef50_A0A1C6DJM2 contig_14 cds 31336 31491 + GCA009771115_00679 hypothetical protein contig_14 cds 31511 34162 + GCA009771115_00680 Alanine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A9W5YA16 contig_14 cds 34302 34889 + GCA009771115_00681 hypothetical protein PFAM:PF16729.10 contig_14 cds 35167 36219 + GCA009771115_00682 Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_M2PLV0 contig_14 cds 36382 37947 + GCA009771115_00683 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_C9MZF6 contig_14 cds 37954 38760 - GCA009771115_00684 Restriction endonuclease SO:0001217, UniRef:UniRef50_C9MZF5 contig_14 cds 38921 39148 + GCA009771115_00685 hypothetical protein contig_14 cds 39325 39501 + GCA009771115_00686 rpsU 30S ribosomal protein S21 COG:COG0828, COG:J, GO:0003735, GO:0005840, GO:0006412, SO:0001217, UniRef:UniRef50_Q8RB59, UniRef:UniRef90_R9KGW1 contig_14 cds 39573 41168 + GCA009771115_00687 Peptide chain release factor 3 SO:0001217, UniRef:UniRef50_B0C6Z1 contig_14 cds 41357 42655 + GCA009771115_00688 Enolase SO:0001217, UniRef:UniRef50_O51312 contig_14 cds 43208 44254 + GCA009771115_00689 recA Protein RecA SO:0001217, UniRef:UniRef50_P49985 contig_14 cds 44312 44965 + GCA009771115_00690 hypothetical protein PFAM:PF21981.2, PFAM:PF21982.2 contig_14 cds 45109 46656 + GCA009771115_00691 Ribonuclease Y SO:0001217, UniRef:UniRef50_O31774 contig_14 cds 46734 47546 - GCA009771115_00692 hypothetical protein PFAM:PF08501.16 contig_14 cds 47850 48929 + GCA009771115_00693 hypothetical protein PFAM:PF00990.26 contig_14 cds 48954 49712 + GCA009771115_00694 Type VII secretion system protein EssD-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A927UQX9 contig_14 cds 49799 50566 + GCA009771115_00695 Short-chain dehydrogenase SO:0001217, UniRef:UniRef50_A0A1H3FIS0 contig_14 cds 50574 51344 + GCA009771115_00696 hypothetical protein PFAM:PF03734.19 contig_14 cds 51516 52076 + GCA009771115_00697 Thymidine kinase SO:0001217, UniRef:UniRef50_A6NQR2 contig_14 cds 52090 53082 - GCA009771115_00698 hypothetical protein contig_14 cds 53102 54193 - GCA009771115_00699 Extracellular solute-binding protein SO:0001217, UniRef:UniRef50_A0A173TXX7 contig_14 cds 54193 54996 - GCA009771115_00700 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_R9K2Q3 contig_14 cds 54993 55814 - GCA009771115_00701 potB Spermidine/putrescine transport system permease protein PotB SO:0001217, UniRef:UniRef50_L7VJH0 contig_14 cds 55807 56880 - GCA009771115_00702 potA Spermidine/putrescine import ATP-binding protein PotA SO:0001217, UniRef:UniRef50_Q24XJ2 contig_14 cds 56919 57608 - GCA009771115_00703 Pseudouridine synthase SO:0001217, UniRef:UniRef50_A0A174EHE6 contig_14 cds 57913 59442 + GCA009771115_00704 UDP-N-acetylmuramyl-tripeptide synthetase SO:0001217, UniRef:UniRef50_C4GA02 contig_14 cds 59484 61991 + GCA009771115_00705 hypothetical protein PFAM:PF00128.31 contig_14 cds 62101 65106 + GCA009771115_00706 hypothetical protein PFAM:PF00128.31, PFAM:PF02922.24, PFAM:PF21653.3 contig_14 cds 65208 65660 - GCA009771115_00707 hypothetical protein PFAM:PF13508.13, PFAM:PF13673.13 contig_14 cds 65731 66564 - GCA009771115_00708 Cobalt transport protein SO:0001217, UniRef:UniRef50_V9H391 contig_14 cds 66554 68266 - GCA009771115_00709 Putative ABC transporter ATP-binding protein BC_2655 SO:0001217, UniRef:UniRef50_Q81CT8 contig_14 cds 68289 68840 - GCA009771115_00710 UPF0397 protein LJ_1703 SO:0001217, UniRef:UniRef50_Q74I63 contig_14 cds 68840 69691 - GCA009771115_00711 Adenosyl-chloride synthase SO:0001217, UniRef:UniRef50_A0A2L0D2I0 contig_14 cds 69927 70103 + GCA009771115_00712 hypothetical protein contig_14 cds 70090 70278 + GCA009771115_00713 hypothetical protein contig_14 cds 70507 70983 + GCA009771115_00714 hypothetical protein SO:0001217, UniRef:UniRef50_UPI000AC4A1AA, UniRef:UniRef90_UPI002583169D contig_14 cds 71413 71583 + GCA009771115_00715 hypothetical protein contig_14 cds 71948 72073 + GCA009771115_00716 (pseudo) type III toxin-antitoxin system ToxN/AbiQ family toxin KEGG:K19167, SO:0001217, UniRef:UniRef50_E4KYV2, UniRef:UniRef90_UPI0023F31648 contig_14 cds 72170 72505 + GCA009771115_00717 (pseudo) Type III toxin-antitoxin system ToxN/AbiQ family toxin KEGG:K19167, SO:0001217, UniRef:UniRef50_A0A2X1ZXE4, UniRef:UniRef50_G5GKH5, UniRef:UniRef90_G5GKH5 contig_14 cds 72767 73009 + GCA009771115_00718 hypothetical protein contig_14 cds 73046 73684 + GCA009771115_00719 tetR Transcriptional regulator, TetR family SO:0001217, UniRef:UniRef50_F3AZ58, UniRef:UniRef90_A0A137SRC7 contig_14 cds 73745 75496 + GCA009771115_00720 Multidrug ABC transporter permease SO:0001217, UniRef:UniRef50_G5GKM7, UniRef:UniRef90_A0A095YBU3 contig_14 cds 75497 77221 + GCA009771115_00721 mdlB ABC transporter COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_G5GKT7, UniRef:UniRef90_G5GKT7 contig_14 cds 77230 78738 + GCA009771115_00722 ccmA heme ABC exporter ATP-binding protein CcmA COG:COG4172, COG:Q, EC:7.6.2.5, GO:0015439, GO:0015886, GO:0017004, GO:0022857, GO:0043190, SO:0001217, UniRef:UniRef50_G5GL55, UniRef:UniRef90_H1PMG8 contig_14 cds 78735 79436 + GCA009771115_00723 ecfT Cobalt transport protein COG:COG0619, COG:H, RefSeq:WP_066537904.1, SO:0001217, UniParc:UPI00079525A3, UniRef:UniRef100_A0A137SRF1, UniRef:UniRef50_G5GL57, UniRef:UniRef90_G5GL57 contig_14 cds 79454 80035 + GCA009771115_00724 TIGR02185 family protein KEGG:K16926, SO:0001217, UniRef:UniRef50_G5GKT6, UniRef:UniRef90_H1PMH0 contig_14 cds 81246 82193 + GCA009771115_00725 dacC Serine-type D-Ala-D-Ala carboxypeptidase COG:COG1686, COG:M, SO:0001217, UniRef:UniRef50_R5MU29, UniRef:UniRef90_F1T5H3 contig_14 cds 82595 82870 + GCA009771115_00726 hypothetical protein contig_14 cds 83094 83990 - GCA009771115_00727 AbiTii domain-containing protein RefSeq:WP_004122116.1, SO:0001217, UniParc:UPI0001C21DA8, UniRef:UniRef100_A0A2K0X6H9, UniRef:UniRef50_A0A133Y7N9, UniRef:UniRef90_A0A133Y7N9 contig_14 cds 84083 85981 - GCA009771115_00728 SWI2/SNF2 ATPase EC:3.1.21.3, KEGG:K01153, SO:0001217, UniParc:UPI0001C21DA9, UniRef:UniRef100_A0A2K0X6G5, UniRef:UniRef50_A0A2K0X6G5, UniRef:UniRef90_A0A2K0X6G5 contig_14 cds 86609 86779 + GCA009771115_00729 DNA recombinase RefSeq:WP_000873143.1, SO:0001217, UniParc:UPI00016C28F7, UniRef:UniRef100_A0A2K0X6C7, UniRef:UniRef50_A0A7G3ML78, UniRef:UniRef90_A0A7G3ML78 contig_14 ncRNA 86874 87104 + GCA009771115_00730 sRNA_1300 Enterococcus sRNA 1300 RFAM:RF02862, SO:0000655 contig_14 cds 87165 87314 + GCA009771115_00731 (pseudo) ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_T0N7E2, UniRef:UniRef90_UPI00189D1797 contig_14 cds 87393 88382 + GCA009771115_00732 mef(A) macrolide efflux MFS transporter Mef(A) COG:COG2814, COG:G, KEGG:K08217, NCBIProtein:WP_000417519.1, SO:0001217, UniRef:UniRef50_Q5XBB2, UniRef:UniRef90_V8BGI9 contig_14 cds 88502 89965 + GCA009771115_00733 msr(D) ABC-F type ribosomal protection protein Msr(D) BlastRules:WP_000420317, COG:COG0488, COG:R, GO:0000049, GO:0005524, GO:0005737, GO:0006412, GO:0006417, GO:0016887, GO:0046677, NCBIProtein:WP_000420313.1, RefSeq:WP_000420313.1, SO:0001217, UniParc:UPI00000B29D9, UniRef:UniRef100_P0DX93, UniRef:UniRef50_P0DX93, UniRef:UniRef90_P0DX93 contig_14 cds 90083 90373 - GCA009771115_00734 DNA methylase N-4/N-6 RefSeq:WP_004121959.1, SO:0001217, UniParc:UPI00026343D7, UniRef:UniRef100_A0A2K0X6D4, UniRef:UniRef50_A0A2K0X6D4, UniRef:UniRef90_A0A2K0X6D4 contig_14 cds 90373 90585 - GCA009771115_00735 HTH cro/C1-type domain-containing protein RefSeq:WP_004121956.1, SO:0001217, UniParc:UPI00026343D6, UniRef:UniRef100_A0A2K0X6H4, UniRef:UniRef50_A0A133Y7M2, UniRef:UniRef90_A0A133Y7M2 contig_14 cds 90712 90906 + GCA009771115_00736 hypothetical protein SO:0001217, UniParc:UPI00026343D5, UniRef:UniRef100_A0A2K0X6D8, UniRef:UniRef50_A0A2K0X6D8, UniRef:UniRef90_A0A2K0X6D8 contig_14 cds 90897 93221 + GCA009771115_00737 Nucleoside triphosphatase, D5 family RefSeq:WP_004121944.1, SO:0001217, UniParc:UPI0001C21DAA, UniRef:UniRef100_S4HDI1, UniRef:UniRef50_V8BYI7, UniRef:UniRef90_S4HDI1 contig_14 cds 93640 94587 + GCA009771115_00738 Capsid protein RefSeq:WP_004121942.1, SO:0001217, UniParc:UPI0001C21E0B, UniRef:UniRef100_A0A2K0X6D9, UniRef:UniRef90_A0A3P7WIJ9 contig_14 cds 94606 94773 + GCA009771115_00739 zapA Cell division protein ZapA RefSeq:WP_004121940.1, SO:0001217, UniParc:UPI00026343D4, UniRef:UniRef100_S4H1M8, UniRef:UniRef50_A0A133NSV6, UniRef:UniRef90_A0A133NSV6 contig_15 cds 88 1011 - GCA009771115_00740 2-dehydropantoate 2-reductase SO:0001217, UniRef:UniRef50_P65666 contig_15 cds 1217 2050 - GCA009771115_00741 PTS system mannose-specific transporter subunit IID SO:0001217, UniRef:UniRef50_A0A0F3H9W7 contig_15 cds 2052 2906 - GCA009771115_00742 Phospotransferase system PTS, IIC component SO:0001217, UniRef:UniRef50_A0NHI9 contig_15 cds 2937 3431 - GCA009771115_00743 PTS mannose/fructose/sorbose transporter subunit IIB SO:0001217, UniRef:UniRef50_A0A2A7MEG4 contig_15 cds 3446 3874 - GCA009771115_00744 PTS fructose transporter subunit IIA SO:0001217, UniRef:UniRef50_A0A421BIG7 contig_15 cds 4072 5346 - GCA009771115_00745 hypothetical protein contig_15 cds 5343 6038 - GCA009771115_00746 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A143XVD4 contig_15 cds 6078 7376 - GCA009771115_00747 histidine kinase SO:0001217, UniRef:UniRef50_A0A421BIX0 contig_15 cds 7429 8469 - GCA009771115_00748 Sugar ABC transporter substrate-binding protein SO:0001217, UniRef:UniRef50_A0A421BIH6 contig_15 cds 8538 9227 - GCA009771115_00749 hypothetical protein contig_15 cds 9235 10368 - GCA009771115_00750 hypothetical protein PFAM:PF18975.6 contig_15 cds 10398 13064 - GCA009771115_00751 hypothetical protein PFAM:PF02492.25 contig_15 cds 13108 14433 - GCA009771115_00752 hypothetical protein contig_15 cds 14465 15295 - GCA009771115_00753 hypothetical protein contig_15 ncRNA 15313 15473 - GCA009771115_00754 Bacteria_large_SRP Bacterial large signal recognition particle RNA RFAM:RF01854, SO:0000655 contig_15 ncRNA 15334 15433 - GCA009771115_00755 Bacteria_small_SRP Bacterial small signal recognition particle RNA RFAM:RF00169, SO:0000655 contig_15 cds 15694 16962 - GCA009771115_00756 hypothetical protein PFAM:PF16697.10, PFAM:PF19909.4 contig_15 cds 16997 17395 - GCA009771115_00757 hypothetical protein contig_15 cds 17392 17820 - GCA009771115_00758 hypothetical protein contig_15 cds 17825 18736 - GCA009771115_00759 hypothetical protein contig_15 cds 18975 20726 - GCA009771115_00760 hypothetical protein contig_15 cds 20726 20890 - GCA009771115_00761 Putative Flagellin Flp1-like domain-containing protein SO:0001217, UniRef:UniRef50_F7V1V9 contig_15 cds 20943 22199 - GCA009771115_00762 hypothetical protein PFAM:PF00482.28 contig_15 cds 22202 22960 - GCA009771115_00763 hypothetical protein contig_15 cds 22903 24102 - GCA009771115_00764 AAA+ ATPase domain-containing protein SO:0001217, UniRef:UniRef50_R9MGU2 contig_15 cds 24095 25138 - GCA009771115_00765 hypothetical protein contig_15 cds 25087 25596 - GCA009771115_00766 hypothetical protein contig_15 cds 25807 26283 - GCA009771115_00767 hypothetical protein contig_15 cds 26309 27718 - GCA009771115_00768 Flagellin SO:0001217, UniRef:UniRef50_A0A7U9RZ75 contig_15 cds 27708 30791 - GCA009771115_00769 hypothetical protein contig_15 cds 30962 31561 - GCA009771115_00770 recR Recombination protein RecR SO:0001217, UniRef:UniRef50_P24277 contig_15 cds 31568 31918 - GCA009771115_00771 Nucleoid-associated protein FMG_0513 SO:0001217, UniRef:UniRef50_B0S0K7 contig_15 cds 31927 33528 - GCA009771115_00772 DNA-directed DNA polymerase SO:0001217, UniRef:UniRef50_A0A938X298 contig_15 cds 33546 34991 - GCA009771115_00773 hypothetical protein PFAM:PF07687.19 contig_15 tRNA 35150 35236 + GCA009771115_00774 trnS tRNA-Ser(cga) SO:0000269 contig_15 cds 35365 35862 + GCA009771115_00775 greA Transcription elongation factor GreA SO:0001217, UniRef:UniRef50_A0A1C5U3W6 contig_15 cds 36032 36442 - GCA009771115_00776 ATP synthase epsilon chain SO:0001217, UniRef:UniRef50_A0A173UMR4 contig_15 cds 36449 37846 - GCA009771115_00777 ATP synthase subunit beta SO:0001217, UniRef:UniRef50_Q24MP1 contig_15 cds 37871 38722 - GCA009771115_00778 ATP synthase gamma chain SO:0001217, UniRef:UniRef50_A9KK93 contig_15 cds 38757 40271 - GCA009771115_00779 ATP synthase subunit alpha SO:0001217, UniRef:UniRef50_P37808 contig_15 cds 40268 40837 - GCA009771115_00780 ATP synthase subunit delta SO:0001217, UniRef:UniRef50_A0A1H6SL68 contig_15 cds 40825 41340 - GCA009771115_00781 ATP synthase subunit b SO:0001217, UniRef:UniRef50_A0A174DG31 contig_15 cds 41380 41637 - GCA009771115_00782 ATP synthase subunit c SO:0001217, UniRef:UniRef50_Q8RGD7 contig_15 cds 41704 42480 - GCA009771115_00783 ATP synthase subunit a SO:0001217, UniRef:UniRef50_A0A173S881 contig_15 cds 42625 43047 - GCA009771115_00784 ATP synthase subunit I SO:0001217, UniRef:UniRef50_G2T610 contig_15 cds 43295 43810 - GCA009771115_00785 hypothetical protein PFAM:PF00383.29 contig_15 cds 43803 44243 - GCA009771115_00786 ptpB Low molecular weight protein-tyrosine-phosphatase ptpB SO:0001217, UniRef:UniRef50_A0A173S6V1 contig_15 cds 44278 45339 - GCA009771115_00787 Threonylcarbamoyl-AMP synthase SO:0001217, UniRef:UniRef50_A0A173S7Y5 contig_15 cds 45458 47179 - GCA009771115_00788 hypothetical protein PFAM:PF00704.34, PFAM:PF08239.17 contig_15 cds 47856 48644 + GCA009771115_00789 hypothetical protein contig_15 cds 48896 50272 - GCA009771115_00790 Replicative DNA helicase SO:0001217, UniRef:UniRef50_A0A3C0VUV2 contig_15 cds 50282 50731 - GCA009771115_00791 Large ribosomal subunit protein bL9 SO:0001217, UniRef:UniRef50_C4Z4Q1 contig_15 cds 50728 52773 - GCA009771115_00792 Cyclic-di-AMP phosphodiesterase SO:0001217, UniRef:UniRef50_A0A1I6YPF9 contig_15 cds 52979 54358 + GCA009771115_00793 nhaC Na+/H+ antiporter NhaC SO:0001217, UniRef:UniRef50_D6GTK0 contig_15 cds 54423 54671 - GCA009771115_00794 Small ribosomal subunit protein bS18 SO:0001217, UniRef:UniRef50_G5GFZ1 contig_15 cds 54686 55144 - GCA009771115_00795 Single-stranded DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2N2EHE2 contig_15 cds 55162 55452 - GCA009771115_00796 Small ribosomal subunit protein bS6 SO:0001217, UniRef:UniRef50_D9R1Y0 contig_15 cds 55662 56402 - GCA009771115_00797 NAD-dependent protein deacetylase SO:0001217, UniRef:UniRef50_Q97MB4 contig_15 cds 56471 57349 - GCA009771115_00798 Ribosomal RNA small subunit methyltransferase I SO:0001217, UniRef:UniRef50_R9K7V2 contig_15 cds 57333 58079 - GCA009771115_00799 tRNA1(Val) (Adenine(37)-N6)-methyltransferase SO:0001217, UniRef:UniRef50_A0A564U0I4 contig_15 cds 58104 59126 - GCA009771115_00800 hypothetical protein contig_15 cds 59119 60129 - GCA009771115_00801 hypothetical protein PFAM:PF00004.35, PFAM:PF09115.15, PFAM:PF13177.12 contig_15 cds 60134 60577 - GCA009771115_00802 DUF327 domain-containing protein SO:0001217, UniRef:UniRef50_A0A4R1QXT3 contig_15 cds 60589 61146 - GCA009771115_00803 Guanylate kinase-like domain-containing protein SO:0001217, UniRef:UniRef50_C0FZX6 contig_15 cds 61280 62116 - GCA009771115_00804 hypothetical protein contig_15 cds 62155 62286 - GCA009771115_00805 hypothetical protein contig_15 cds 62293 62919 - GCA009771115_00806 AbiEi antitoxin C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_N2B2Q5 contig_15 cds 63067 63567 + GCA009771115_00807 Arginine repressor SO:0001217, UniRef:UniRef50_A0A923LP99 contig_15 cds 63582 64241 + GCA009771115_00808 tRNA (guanine-N(7)-)-methyltransferase SO:0001217, UniRef:UniRef50_A9KLV5 contig_15 cds 64379 65047 + GCA009771115_00809 L-serine deaminase SO:0001217, UniRef:UniRef50_D6GU18 contig_15 cds 65053 65943 + GCA009771115_00810 L-serine dehydratase SO:0001217, UniRef:UniRef50_A0A1E9AI08 contig_15 cds 65936 67168 + GCA009771115_00811 Sodium:proton antiporter SO:0001217, UniRef:UniRef50_A0A0M1VXJ6 contig_15 cds 67510 68745 + GCA009771115_00812 Sodium:proton antiporter SO:0001217, UniRef:UniRef50_A0A0M1VXJ6 contig_15 cds 69052 69168 - GCA009771115_00813 hypothetical protein contig_15 cds 69773 70828 + GCA009771115_00814 Tyr recombinase domain-containing protein SO:0001217, UniRef:UniRef50_A0A352CU48 contig_15 tRNA 70911 70983 - GCA009771115_00815 trnK tRNA-Lys(ctt) SO:0000265 contig_15 cds 71055 72911 - GCA009771115_00816 hypothetical protein contig_15 tRNA 73095 73168 - GCA009771115_00817 trnR tRNA-Arg(cct) SO:0001036 contig_15 cds 73201 74067 - GCA009771115_00818 hypothetical protein contig_15 cds 74141 74644 - GCA009771115_00819 DUF4446 domain-containing protein SO:0001217, UniRef:UniRef50_UPI001568EA97 contig_15 cds 74702 75625 - GCA009771115_00820 ParB/Sulfiredoxin domain-containing protein SO:0001217, UniRef:UniRef50_F7JRP3 contig_15 cds 75625 76395 - GCA009771115_00821 AAA domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Z9IRV3 contig_15 cds 76706 77440 - GCA009771115_00822 Ribosomal RNA small subunit methyltransferase G SO:0001217, UniRef:UniRef50_R9IZH6 contig_15 cds 77554 79455 - GCA009771115_00823 hypothetical protein PFAM:PF07992.20, PFAM:PF13932.14, PFAM:PF21680.2 contig_15 cds 79642 81039 - GCA009771115_00824 mnmE tRNA modification GTPase MnmE SO:0001217, UniRef:UniRef50_A0A174S4J2 contig_15 cds 81101 81862 - GCA009771115_00825 khpB RNA-binding protein KhpB SO:0001217, UniRef:UniRef50_A0A927T347 contig_15 cds 81879 83147 - GCA009771115_00826 yidC Membrane protein YidC 1 SO:0001217, UniRef:UniRef50_A0A0M6WLW6 contig_15 cds 83153 83398 - GCA009771115_00827 Putative membrane protein insertion efficiency factor SO:0001217, UniRef:UniRef50_A5I819 contig_15 cds 83402 83740 - GCA009771115_00828 Ribonuclease P protein component SO:0001217, UniRef:UniRef50_C0CSB4 contig_15 cds 83813 83947 - GCA009771115_00829 Large ribosomal subunit protein bL34 SO:0001217, UniRef:UniRef50_P80340 contig_15 cds 84201 85541 + GCA009771115_00830 dnaA Chromosomal replication initiator protein DnaA SO:0001217, UniRef:UniRef50_A0A1M6ISA2 contig_15 cds 85705 86808 + GCA009771115_00831 Beta sliding clamp SO:0001217, UniRef:UniRef50_A0A354I316 contig_15 cds 86825 87043 + GCA009771115_00832 RNA-binding S4 domain-containing protein SO:0001217, UniRef:UniRef50_A0A829NL56 contig_15 cds 87040 88131 + GCA009771115_00833 recF DNA replication and repair protein RecF SO:0001217, UniRef:UniRef50_C4Z176 contig_15 cds 88149 90071 + GCA009771115_00834 DNA gyrase subunit B SO:0001217, UniRef:UniRef50_R6C6R9 contig_15 cds 90086 92530 + GCA009771115_00835 DNA gyrase subunit A SO:0001217, UniRef:UniRef50_A0A174GCP3 contig_15 tRNA 92673 92760 + GCA009771115_00836 trnS tRNA-Ser(gct) SO:0000269 contig_16 cds 198 1064 + GCA009771115_00837 Phosphate-binding protein SO:0001217, UniRef:UniRef50_R0BSF0 contig_16 cds 1075 1971 + GCA009771115_00838 Phosphate transport system permease protein SO:0001217, UniRef:UniRef50_R6BVA8 contig_16 cds 1968 2831 + GCA009771115_00839 pstA Phosphate transport system permease protein PstA SO:0001217, UniRef:UniRef50_A0A944GLX7 contig_16 cds 2835 3593 + GCA009771115_00840 pstB Phosphate import ATP-binding protein PstB 1 SO:0001217, UniRef:UniRef50_P63375 contig_16 cds 3688 4341 + GCA009771115_00841 phoU Phosphate-specific transport system accessory protein PhoU SO:0001217, UniRef:UniRef50_A0A373VZ90 contig_16 cds 4440 5174 + GCA009771115_00842 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A174Z049 contig_16 cds 5171 6496 + GCA009771115_00843 histidine kinase SO:0001217, UniRef:UniRef50_A0A1H2W5M6 contig_16 cds 6691 7491 + GCA009771115_00844 Cof subfamily of IIB subfamily of haloacid dehalogenase superfamily/HAD-superfamily hydrolase, subfamily IIB SO:0001217, UniRef:UniRef50_A0A1H2UW55 contig_16 cds 7642 9324 + GCA009771115_00845 Phosphoglucomutase SO:0001217, UniRef:UniRef50_A0A0U5JF54 contig_16 cds 9466 11625 - GCA009771115_00846 hypothetical protein PFAM:PF22673.2 contig_16 cds 11987 12952 + GCA009771115_00847 PTS system mannose-specific EIIAB component SO:0001217, UniRef:UniRef50_Q5XAF5 contig_16 cds 12980 13783 + GCA009771115_00848 PTS system mannose-specific transporter subunit IIC SO:0001217, UniRef:UniRef50_A0A9X8XG99 contig_16 cds 13802 14713 + GCA009771115_00849 Mannose permease IID component SO:0001217, UniRef:UniRef50_A0A081Q4C1 contig_16 cds 14745 15119 + GCA009771115_00850 DUF956 domain-containing protein SO:0001217, UniRef:UniRef50_A0A150K1J2 contig_16 cds 15269 17434 - GCA009771115_00851 hypothetical protein PFAM:PF00672.30, PFAM:PF02743.24, PFAM:PF22673.2 contig_16 cds 17630 17971 - GCA009771115_00852 hypothetical protein contig_17 cds 287 919 + GCA009771115_00853 RNA polymerase sigma factor 70 region 4 type 2 domain-containing protein SO:0001217, UniRef:UniRef50_A0A4D6AR69 contig_17 cds 1020 1199 + GCA009771115_00854 hypothetical protein SO:0001217, UniRef:UniRef50_A0A133XQK1 contig_17 cds 1211 1498 + GCA009771115_00855 rRNA biogenesis protein rrp5 SO:0001217, UniRef:UniRef50_S4H101 contig_17 cds 1506 2633 + GCA009771115_00856 Nuclease SO:0001217, UniRef:UniRef50_A0A366SHJ7 contig_17 cds 2635 3183 + GCA009771115_00857 Phage-associated protein SO:0001217, UniRef:UniRef50_C2EVF5 contig_17 cds 3246 5213 + GCA009771115_00858 DNA-directed DNA polymerase SO:0001217, UniRef:UniRef50_A0A6N9QAP8 contig_17 cds 5313 6104 + GCA009771115_00859 Bro-N domain-containing protein SO:0001217, UniRef:UniRef50_A0A140L201 contig_17 cds 6097 6459 + GCA009771115_00860 DUF4406 domain-containing protein SO:0001217, UniRef:UniRef50_A0A134CHB4 contig_17 cds 6464 8677 + GCA009771115_00861 SF3 helicase domain-containing protein SO:0001217, UniRef:UniRef50_A0A6N2UMX0 contig_17 cds 8760 8939 + GCA009771115_00862 hypothetical protein contig_17 cds 9052 9342 + GCA009771115_00863 VRR-NUC domain-containing protein SO:0001217, UniRef:UniRef50_S6EYH4 contig_17 cds 9323 10663 + GCA009771115_00864 DNA repair and recombination protein SO:0001217, UniRef:UniRef50_F8E029 contig_17 cds 10766 11167 + GCA009771115_00865 DUF1492 domain-containing protein SO:0001217, UniRef:UniRef50_D6S6T9 contig_17 cds 11372 11740 + GCA009771115_00866 yajD Putative HNH nuclease YajD SO:0001217, UniRef:UniRef50_A0A841KRL3 contig_17 cds 11888 12439 + GCA009771115_00867 Terminase SO:0001217, UniRef:UniRef50_S4H0Z0, UniRef:UniRef90_S4H0Z0 contig_18 cds 636 845 + GCA009771115_00868 hypothetical protein SO:0001217, UniRef:UniRef50_A0A133YGE4, UniRef:UniRef90_A0A133YGE4 contig_18 cds 805 2457 + GCA009771115_00869 recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_UPI001E65B759, UniRef:UniRef90_UPI0001E9A7E3 contig_18 cds 2609 2815 + GCA009771115_00870 type II toxin-antitoxin system Phd/YefM family antitoxin SO:0001217, UniRef:UniRef50_A0A0R2KR78, UniRef:UniRef90_UPI00254E4D7F contig_18 cds 2836 3477 + GCA009771115_00871 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A3D1BIG0 contig_18 cds 3844 4071 + GCA009771115_00872 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_W6RTY0 contig_18 cds 4074 5291 + GCA009771115_00873 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_A0A1B1S8V7 contig_18 cds 5288 6787 + GCA009771115_00874 Cytosine-specific methyltransferase SO:0001217, UniRef:UniRef50_A0A1C5RKF4 contig_18 cds 6799 7446 + GCA009771115_00875 hypothetical protein SO:0001217, UniRef:UniRef50_UPI000DCFA7FB contig_18 cds 7439 8866 + GCA009771115_00876 hypothetical protein PFAM:PF07728.20 contig_18 cds 8859 10163 + GCA009771115_00877 LlaJI restriction endonuclease SO:0001217, UniRef:UniRef50_B0MB39, UniRef:UniRef90_B0MB39 contig_18 cds 10202 11389 - GCA009771115_00878 CGNR zinc finger domain-containing protein SO:0001217, UniRef:UniRef50_B0MB38 contig_18 cds 11618 11755 + GCA009771115_00879 SMP domain-containing protein SO:0001217, UniRef:UniRef50_K1LNA5 contig_19 cds 569 1825 + GCA009771115_00880 ABC-three component systems C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2K1SWD8 contig_19 cds 1809 2039 + GCA009771115_00881 ABC-three component (ABC-3C) system Middle Component 7 RefSeq:WP_075038614.1, SO:0001217, UniParc:UPI000942162B, UniRef:UniRef100_A0A1Q6D5C1, UniRef:UniRef50_A0A3S4VUC3, UniRef:UniRef90_A0A1Q6D5C1 contig_19 cds 2029 3666 + GCA009771115_00882 DUF2326 domain-containing protein SO:0001217, UniRef:UniRef50_A0A2I1KQJ5, UniRef:UniRef90_A0A2K1SWE5 contig_19 cds 3626 3910 + GCA009771115_00883 XRE family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A3S5EW56, UniRef:UniRef90_A0A1Q6D5A5 contig_19 cds 3862 4002 + GCA009771115_00884 hypothetical protein PFAM:PF13443.12 contig_19 cds 4019 4303 + GCA009771115_00885 hypothetical protein PFAM:PF04326.19 contig_19 cds 4293 5243 + GCA009771115_00886 DNA (cytosine-5-)-methyltransferase SO:0001217, UniRef:UniRef50_A0A158SXV1 contig_19 cds 5245 6519 + GCA009771115_00887 HNH nuclease domain-containing protein SO:0001217, UniRef:UniRef50_A0A0D0IJ91 contig_19 cds 7121 8599 - GCA009771115_00888 lsa Lsa family ABC-F type ribosomal protection protein COG:COG0488, COG:R, GO:0005524, GO:0016887, NCBIProtein:WP_063851347.1, RefSeq:WP_101891814.1, SO:0001217, UniParc:UPI000C7AD165, UniRef:UniRef100_UPI000C7AD165, UniRef:UniRef50_X7RVK0, UniRef:UniRef90_X7RVK0 contig_19 cds 9058 10941 - GCA009771115_00889 NERD domain-containing protein SO:0001217, UniRef:UniRef50_D2MNF9, UniRef:UniRef90_A0A133Z2I7 contig_20 cds 31 147 + GCA009771115_00890 Flagellin C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A7C6IZE6 contig_20 cds 512 2029 + GCA009771115_00891 Flagellin SO:0001217, UniRef:UniRef50_A0A413QUQ1 contig_20 cds 2315 3757 + GCA009771115_00892 Na+/H+ antiporter family protein SO:0001217, UniRef:UniRef50_G9X3E8 contig_20 cds 3864 4901 + GCA009771115_00893 Band 7 domain-containing protein SO:0001217, UniRef:UniRef50_A0A329U0N7 contig_20 cds 4882 5097 + GCA009771115_00894 PTS ascorbate transporter subunit IIC SO:0001217, UniRef:UniRef50_B9YDT8 contig_20 ncRNA-region 5198 5384 + FMN riboswitch aptamer (RFN element) RFAM:RF00050, SO:0000035 contig_20 cds 5484 6074 + GCA009771115_00895 Riboflavin transporter SO:0001217, UniRef:UniRef50_U2UVQ5 contig_20 cds 6080 7228 + GCA009771115_00896 hypothetical protein PFAM:PF00288.32, PFAM:PF08544.19 contig_20 cds 7253 7936 + GCA009771115_00897 HTH gntR-type domain-containing protein SO:0001217, UniRef:UniRef50_R9J344 contig_20 cds 8085 8990 - GCA009771115_00898 HTH araC/xylS-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A1S9BWK3 contig_20 cds 9215 9796 + GCA009771115_00899 Alkyl hydroperoxide reductase C SO:0001217, UniRef:UniRef50_P0AE08 contig_20 cds 9800 11485 + GCA009771115_00900 Alkyl hydroperoxide reductase subunit F SO:0001217, UniRef:UniRef50_A0A2X0VJ61 contig_20 cds 11685 12923 + GCA009771115_00901 hypothetical protein contig_20 cds 12920 13675 + GCA009771115_00902 hypothetical protein contig_20 cds 13697 16207 + GCA009771115_00903 hypothetical protein PFAM:PF00005.33, PFAM:PF02687.27, PFAM:PF13304.12 contig_20 cds 16287 17270 + GCA009771115_00904 hypothetical protein contig_20 cds 17224 17334 + GCA009771115_00905 hypothetical protein contig_20 cds 17399 19396 + GCA009771115_00906 Putative K(+)-stimulated pyrophosphate-energized sodium pump SO:0001217, UniRef:UniRef50_F7Q188 contig_20 cds 19570 20490 + GCA009771115_00907 Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase SO:0001217, UniRef:UniRef50_A0A9E1ETQ1 contig_20 cds 20566 21099 - GCA009771115_00908 hypothetical protein contig_20 cds 21514 22626 + GCA009771115_00909 Membrane protease subunit, stomatin/prohibitin family, contains C-terminal Zn-ribbon domain SO:0001217, UniRef:UniRef50_A0A1H3YEA0 contig_20 cds 22650 24050 + GCA009771115_00910 hypothetical protein contig_20 cds 24040 24882 + GCA009771115_00911 hypothetical protein PFAM:PF04536.20 contig_20 cds 25038 25775 + GCA009771115_00912 HTH deoR-type domain-containing protein SO:0001217, UniRef:UniRef50_V9HIK3 contig_20 cds 25777 26694 + GCA009771115_00913 Tagatose-6-phosphate kinase SO:0001217, UniRef:UniRef50_A0A2A7MHF1 contig_20 cds 26710 28743 + GCA009771115_00914 PTS fructose transporter subunit IIC SO:0001217, UniRef:UniRef50_A0A0B7GV04 contig_20 cds 28867 29124 + GCA009771115_00915 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_A0A174CI12 contig_20 cds 29362 29811 + GCA009771115_00916 hypothetical protein contig_20 cds 29973 30566 + GCA009771115_00917 Chromate transporter SO:0001217, UniRef:UniRef50_G4Q3L6 contig_20 cds 30563 31159 + GCA009771115_00918 Chromate transporter SO:0001217, UniRef:UniRef50_R9M6X7 contig_20 cds 31287 34505 + GCA009771115_00919 Isoleucine--tRNA ligase SO:0001217, UniRef:UniRef50_Q899C3 contig_20 cds 34522 35367 + GCA009771115_00920 hypothetical protein contig_20 cds 35627 37426 + GCA009771115_00921 hypothetical protein contig_20 cds 37537 41046 + GCA009771115_00922 DNA polymerase III subunit alpha SO:0001217, UniRef:UniRef50_A0A7U9QVC1 contig_20 cds 41099 42070 + GCA009771115_00923 ATP-dependent 6-phosphofructokinase SO:0001217, UniRef:UniRef50_A0A133Y6J0 contig_20 cds 42075 42935 + GCA009771115_00924 hypothetical protein PFAM:PF08032.17, PFAM:PF22435.1 contig_20 cds 42951 43214 + GCA009771115_00925 Phage protein SO:0001217, UniRef:UniRef50_R9J5D3 contig_20 cds 43264 43998 + GCA009771115_00926 ywaC GTP pyrophosphokinase ywaC SO:0001217, UniRef:UniRef50_A0A1C5TQT0 contig_20 cds 44091 45440 + GCA009771115_00927 mepA Multidrug export protein MepA SO:0001217, UniRef:UniRef50_A0A1C5MK14 contig_20 cds 45527 47011 + GCA009771115_00928 Dipeptidase SO:0001217, UniRef:UniRef50_Q8G6Z9 contig_20 cds 47208 49589 + GCA009771115_00929 ftsH ATP-dependent zinc metalloprotease FtsH SO:0001217, UniRef:UniRef50_C8W731 contig_20 cds 49644 51503 + GCA009771115_00930 UvrABC system protein C SO:0001217, UniRef:UniRef50_A6TVI7 contig_20 cds 51523 52461 + GCA009771115_00931 HPr kinase/phosphorylase SO:0001217, UniRef:UniRef50_A0A2J8B156 contig_20 cds 52508 53425 + GCA009771115_00932 UDP-N-acetylenolpyruvoylglucosamine reductase SO:0001217, UniRef:UniRef50_N2A8K8 contig_20 cds 53456 54331 + GCA009771115_00933 Nucleotide-binding protein Cthe_0113 SO:0001217, UniRef:UniRef50_A3DBM5 contig_20 cds 54331 55236 + GCA009771115_00934 hypothetical protein PFAM:PF02650.20, PFAM:PF14527.11 contig_20 cds 55242 55493 + GCA009771115_00935 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_A0A373W348 contig_20 cds 55506 56417 + GCA009771115_00936 DAGKc domain-containing protein SO:0001217, UniRef:UniRef50_D4M488 contig_20 cds 56536 57399 + GCA009771115_00937 putative fructose-bisphosphate aldolase SO:0001217, UniRef:UniRef50_P13243 contig_20 cds 57465 59579 + GCA009771115_00938 Glutamine synthetase SO:0001217, UniRef:UniRef50_D4N192 contig_20 cds 59690 60673 + GCA009771115_00939 hypothetical protein contig_20 cds 60682 63423 - GCA009771115_00940 Penicillin-binding protein 1A SO:0001217, UniRef:UniRef50_C0FS52 contig_20 cds 63536 64189 + GCA009771115_00941 hypothetical protein contig_20 tRNA 64402 64473 + GCA009771115_00942 trnQ tRNA-Gln(ctg) SO:0000261 contig_20 cds 64527 65339 + GCA009771115_00943 hypothetical protein PFAM:PF01643.23, PFAM:PF20791.3 contig_20 cds 65459 66379 + GCA009771115_00944 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_R9IRC0 contig_20 cds 66464 66661 - GCA009771115_00945 hypothetical protein contig_20 cds 66970 67893 + GCA009771115_00946 Thioredoxin reductase SO:0001217, UniRef:UniRef50_A0A174HYC0 contig_20 cds 68027 69319 + GCA009771115_00947 hypothetical protein PFAM:PF06347.19, PFAM:PF08239.17 contig_20 cds 70015 71103 + GCA009771115_00948 pucR PucR family transcriptional regulator SO:0001217, UniRef:UniRef50_G2SZZ4 contig_20 cds 71158 71832 + GCA009771115_00949 ftsE Cell division ATP-binding protein FtsE SO:0001217, UniRef:UniRef50_U4TPN4 contig_20 cds 71908 72753 + GCA009771115_00950 ftsX Cell division protein FtsX SO:0001217, UniRef:UniRef50_A0A1H3HY68 contig_20 cds 72771 74048 + GCA009771115_00951 hypothetical protein PFAM:PF00595.29, PFAM:PF13180.12, PFAM:PF17820.7 contig_20 cds 74106 75245 + GCA009771115_00952 Peptide chain release factor 2 SO:0001217, UniRef:UniRef50_A0A1C7IF91 contig_20 cds 75338 75907 + GCA009771115_00953 hypothetical protein PFAM:PF14317.12 contig_20 cds 75920 76366 + GCA009771115_00954 tsaE tRNA threonylcarbamoyladenosine biosynthesis protein TsaE SO:0001217, UniRef:UniRef50_A0A4U7JFV1 contig_20 cds 76543 77283 + GCA009771115_00955 N(6)-L-threonylcarbamoyladenine synthase SO:0001217, UniRef:UniRef50_B0NF98 contig_20 cds 77273 77746 + GCA009771115_00956 hypothetical protein PFAM:PF13420.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_20 cds 77828 78736 + GCA009771115_00957 Ribonuclease Z SO:0001217, UniRef:UniRef50_A9KSU3 contig_20 cds 78847 79434 + GCA009771115_00958 hypothetical protein PFAM:PF20462.4 contig_20 cds 79532 80533 + GCA009771115_00959 tRNA N6-adenosine threonylcarbamoyltransferase SO:0001217, UniRef:UniRef50_Q8RC98 contig_20 cds 80536 81231 + GCA009771115_00960 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase SO:0001217, UniRef:UniRef50_A0A1G5DQC6 contig_20 tRNA 81336 81420 - GCA009771115_00961 trnL tRNA-Leu(aag) SO:0000264 contig_20 tRNA 81464 81547 - GCA009771115_00962 trnL tRNA-Leu(cag) SO:0000264 contig_20 cds 81815 82411 - GCA009771115_00963 Abortive infection protein SO:0001217, UniRef:UniRef50_A0A8H2QY77 contig_20 cds 82558 83280 - GCA009771115_00964 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A0F0CCQ7 contig_20 cds 83461 84828 - GCA009771115_00965 hypothetical protein PFAM:PF16916.10 contig_20 cds 85118 85459 + GCA009771115_00966 hypothetical protein PFAM:PF04221.18 contig_20 cds 85535 86539 + GCA009771115_00967 hypothetical protein PFAM:PF03328.21 contig_20 cds 86817 87323 + GCA009771115_00968 DUF4143 domain-containing protein SO:0001217, UniRef:UniRef50_UPI00265730B7 contig_20 cds 87483 88553 + GCA009771115_00969 Lon protease SO:0001217, UniRef:UniRef50_A0A2X1YJ50 contig_20 cds 88638 90878 + GCA009771115_00970 Subtilase family protein SO:0001217, UniRef:UniRef50_A0A1H3AGP2 contig_20 cds 91163 93415 + GCA009771115_00971 hypothetical protein PFAM:PF01473.26, PFAM:PF04650.22, PFAM:PF19085.6 contig_20 cds 93591 95465 + GCA009771115_00972 hypothetical protein PFAM:PF00359.27, PFAM:PF00874.25, PFAM:PF05043.19, PFAM:PF08220.18, PFAM:PF08279.18 contig_20 cds 95571 95966 + GCA009771115_00973 hypothetical protein PFAM:PF00359.27 contig_20 cds 96048 96365 + GCA009771115_00974 PTS system fructose-like EIIB component 1 SO:0001217, UniRef:UniRef50_P69808 contig_20 cds 96385 97611 + GCA009771115_00975 Fructose-like permease IIC component 1 SO:0001217, UniRef:UniRef50_P77579 contig_20 cds 97779 100490 + GCA009771115_00976 hypothetical protein PFAM:PF01074.27, PFAM:PF07748.19, PFAM:PF09261.16, PFAM:PF17677.7 contig_20 cds 100658 101404 + GCA009771115_00977 yxlF ABC transporter ATP-binding protein YxlF SO:0001217, UniRef:UniRef50_A0A1V5RLS2 contig_20 cds 101480 103249 + GCA009771115_00978 hypothetical protein contig_20 cds 103488 105041 + GCA009771115_00979 Flagellin SO:0001217, UniRef:UniRef50_A0A413QUQ1 contig_20 cds 105259 106788 + GCA009771115_00980 yfcC YfcC family protein SO:0001217, UniRef:UniRef50_Q8XLQ6 contig_20 cds 107072 108901 + GCA009771115_00981 asparagine synthase (glutamine-hydrolyzing) SO:0001217, UniRef:UniRef50_A0A1C6FL69 contig_20 cds 109006 110031 + GCA009771115_00982 Deoxyguanosinetriphosphate triphosphohydrolase-like protein SO:0001217, UniRef:UniRef50_A0A971P007 contig_20 cds 110113 111915 + GCA009771115_00983 hypothetical protein PFAM:PF00772.26, PFAM:PF01807.25, PFAM:PF08275.17, PFAM:PF10410.14, PFAM:PF13662.12 contig_20 cds 111951 113192 + GCA009771115_00984 sigA RNA polymerase sigma factor SigA SO:0001217, UniRef:UniRef50_P06224 contig_20 cds 113185 114000 + GCA009771115_00985 hypothetical protein PFAM:PF12847.13 contig_20 cds 114014 114889 + GCA009771115_00986 hypothetical protein contig_20 cds 115008 116675 + GCA009771115_00987 Nucleoside kinase SO:0001217, UniRef:UniRef50_A0A173ZJQ5 contig_20 ncRNA 116736 117083 + GCA009771115_00988 RNaseP_bact_a Bacterial RNase P class A RFAM:RF00010, SO:0000386 contig_20 cds 117249 118163 + GCA009771115_00989 hypothetical protein contig_20 cds 118163 120496 + GCA009771115_00990 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17764.6, PFAM:PF18074.6 contig_20 cds 120610 121101 + GCA009771115_00991 Peptide deformylase SO:0001217, UniRef:UniRef50_B9MR36 contig_20 cds 121103 122041 + GCA009771115_00992 Methionyl-tRNA formyltransferase SO:0001217, UniRef:UniRef50_C4ZEV8 contig_20 cds 122120 122833 + GCA009771115_00993 Zn-dependent protease SO:0001217, UniRef:UniRef50_A0A2T5IPL0 contig_20 cds 122833 124107 + GCA009771115_00994 hypothetical protein PFAM:PF01029.23, PFAM:PF13649.12, PFAM:PF13847.12 contig_20 cds 124115 125146 + GCA009771115_00995 rlmN putative dual-specificity RNA methyltransferase RlmN SO:0001217, UniRef:UniRef50_A4J582 contig_20 cds 125146 125868 + GCA009771115_00996 Serine/threonine phosphatase stp SO:0001217, UniRef:UniRef50_A0A7U9S5R6 contig_20 cds 125927 127816 + GCA009771115_00997 non-specific serine/threonine protein kinase SO:0001217, UniRef:UniRef50_A0A1I5WB45 contig_20 cds 127824 128690 + GCA009771115_00998 rsgA Small ribosomal subunit biogenesis GTPase RsgA SO:0001217, UniRef:UniRef50_C4ZEV1 contig_20 cds 128712 129362 + GCA009771115_00999 Ribulose-phosphate 3-epimerase SO:0001217, UniRef:UniRef50_A0A931T8B0 contig_20 cds 129437 130123 + GCA009771115_01000 hypothetical protein PFAM:PF04263.21, PFAM:PF04265.19 contig_20 cds 130154 131251 + GCA009771115_01001 hypothetical protein PFAM:PF02421.24, PFAM:PF06071.19 contig_20 cds 131298 131747 + GCA009771115_01002 hypothetical protein PFAM:PF03477.21, PFAM:PF22811.2 contig_20 cds 131925 132323 + GCA009771115_01003 hypothetical protein contig_20 cds 132637 133167 + GCA009771115_01004 yqeG YqeG family HAD IIIA-type phosphatase SO:0001217, UniRef:UniRef50_G2T171 contig_20 cds 133222 133674 + GCA009771115_01005 Ribose 5-phosphate isomerase B/allose 6-phosphate isomerase SO:0001217, UniRef:UniRef50_B7LM09 contig_20 cds 133714 134271 + GCA009771115_01006 Elongation factor P SO:0001217, UniRef:UniRef50_Q894F6 contig_20 cds 134459 135409 + GCA009771115_01007 Putative gluconeogenesis factor SO:0001217, UniRef:UniRef50_R7NHP4 contig_20 cds 135439 136119 + GCA009771115_01008 hypothetical protein PFAM:PF01648.25 contig_20 cds 136116 136937 + GCA009771115_01009 hypothetical protein contig_20 cds 137040 137414 + GCA009771115_01010 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A0M6WR64 contig_20 cds 137418 138299 + GCA009771115_01011 cheX Chemotaxis protein CheX SO:0001217, UniRef:UniRef50_A0A1Q9JX58 contig_20 cds 138565 139620 - GCA009771115_01012 hypothetical protein contig_20 cds 139752 140036 - GCA009771115_01013 hypothetical protein SO:0001217, UniRef:UniRef50_UPI001D0814C6 contig_20 cds 140090 140548 - GCA009771115_01014 DNA-binding protein SO:0001217, UniRef:UniRef50_A0A2A7B7G2 contig_20 cds 140733 140942 + GCA009771115_01015 HTH cro/C1-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A4D6A8R8 contig_20 cds 140982 141374 + GCA009771115_01016 hypothetical protein PFAM:PF01381.28, PFAM:PF13443.12, PFAM:PF13560.12 contig_20 cds 141390 142289 + GCA009771115_01017 Pentapeptide repeat-containing protein SO:0001217, UniRef:UniRef50_A0A2R3MVY5 contig_20 cds 142318 142992 + GCA009771115_01018 hypothetical protein PFAM:PF01464.25 contig_20 cds 142996 143190 + GCA009771115_01019 hypothetical protein contig_20 cds 143184 143576 + GCA009771115_01020 Archaeal holliday junction resolvase (Hjc) SO:0001217, UniRef:UniRef50_A0A1C5MUQ7 contig_20 cds 143707 143811 + GCA009771115_01021 hypothetical protein contig_20 cds 143984 144643 + GCA009771115_01022 yqaJ YqaJ viral recombinase domain-containing protein SO:0001217, UniRef:UniRef50_A0A916VF52 contig_20 cds 144675 145550 + GCA009771115_01023 hypothetical protein contig_20 cds 145578 146501 + GCA009771115_01024 P33 SO:0001217, UniRef:UniRef50_A0AAI9K4K2 contig_20 cds 146494 146892 + GCA009771115_01025 rusA Holliday junction resolvase RusA (Prophage-encoded endonuclease) SO:0001217, UniRef:UniRef50_A0A1H8KWN4 contig_20 cds 146912 147124 + GCA009771115_01026 hypothetical protein contig_20 cds 147124 148161 + GCA009771115_01027 hypothetical protein contig_20 cds 148533 149360 + GCA009771115_01028 hypothetical protein PFAM:PF13392.12 contig_20 gap 148934 148934 . contig_20 gap 148936 148936 . contig_20 gap 148938 148938 . contig_20 cds 149375 149614 + GCA009771115_01029 hypothetical protein contig_20 cds 149626 149820 + GCA009771115_01030 hypothetical protein contig_20 cds 149860 150276 + GCA009771115_01031 hypothetical protein contig_20 cds 150343 150537 - GCA009771115_01032 hypothetical protein SO:0001217, UniRef:UniRef50_A0A371IJS4 contig_20 cds 151133 151513 + GCA009771115_01033 Terminase small subunit SO:0001217, UniRef:UniRef50_A0A810PZ50 contig_20 cds 151500 152864 + GCA009771115_01034 PBSX family phage terminase large subunit SO:0001217, UniRef:UniRef50_A0A350VVC2 contig_20 cds 152882 154309 + GCA009771115_01035 Phage portal protein SO:0001217, UniRef:UniRef50_A0A416HMV5 contig_20 cds 154401 156077 + GCA009771115_01036 hypothetical protein contig_20 cds 156074 156406 + GCA009771115_01037 hypothetical protein contig_20 cds 156644 157255 + GCA009771115_01038 Phage minor structural protein GP20 SO:0001217, UniRef:UniRef50_A0A6L5YN07 contig_20 cds 157285 158151 + GCA009771115_01039 HK97 family phage major capsid protein SO:0001217, UniRef:UniRef50_R9KWM6 contig_20 cds 158239 158376 + GCA009771115_01040 hypothetical protein contig_20 cds 158391 158738 + GCA009771115_01041 hypothetical protein contig_20 cds 158740 159165 + GCA009771115_01042 hypothetical protein contig_20 cds 159169 159519 + GCA009771115_01043 Minor capsid protein SO:0001217, UniRef:UniRef50_A0A173RLZ2 contig_20 cds 159528 159962 + GCA009771115_01044 hypothetical protein contig_20 cds 159967 160503 + GCA009771115_01045 Phage major tail protein, TP901-1 family SO:0001217, UniRef:UniRef50_C4Z839 contig_20 cds 160523 160957 + GCA009771115_01046 hypothetical protein contig_20 cds 160965 161531 + GCA009771115_01047 Bacteriophage Gp15 protein SO:0001217, UniRef:UniRef50_A0A844E726 contig_20 cds 161592 163715 + GCA009771115_01048 hypothetical protein contig_20 cds 163719 164576 + GCA009771115_01049 hypothetical protein PFAM:PF05709.17 contig_20 cds 164579 165628 + GCA009771115_01050 hypothetical protein contig_20 cds 165634 167301 + GCA009771115_01051 hypothetical protein contig_20 cds 167330 167752 + GCA009771115_01052 Holin SO:0001217, UniRef:UniRef50_A0A7U9NGW2 contig_20 cds 168038 169072 + GCA009771115_01053 hypothetical protein PFAM:PF01183.26, PFAM:PF01473.26, PFAM:PF08924.17, PFAM:PF19127.6 contig_20 cds 169154 169765 - GCA009771115_01054 hypothetical protein contig_20 cds 169781 170296 - GCA009771115_01055 hypothetical protein SO:0001217, UniRef:UniRef50_A0A133ZBX2 contig_20 cds 170950 172545 + GCA009771115_01056 Flagellin SO:0001217, UniRef:UniRef50_A0A1G8NKQ2 contig_20 cds 172725 174203 + GCA009771115_01057 Flagellin SO:0001217, UniRef:UniRef50_A0A415I3E4 contig_20 cds 174375 175028 + GCA009771115_01058 Glutamate racemase SO:0001217, UniRef:UniRef50_A0A379C1N2 contig_20 cds 175118 176923 + GCA009771115_01059 hypothetical protein PFAM:PF08269.17 contig_20 cds 177314 177946 + GCA009771115_01060 xrtG Exosortase family protein XrtG SO:0001217, UniRef:UniRef50_A0A927TZG0 contig_20 cds 177943 179319 + GCA009771115_01061 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_C4Z6K0 contig_20 cds 179385 180710 + GCA009771115_01062 hypothetical protein contig_20 cds 180703 181683 + GCA009771115_01063 hypothetical protein PFAM:PF01242.24 contig_20 cds 182273 182518 - GCA009771115_01064 hypothetical protein contig_21 tRNA 222 292 + GCA009771115_01065 trnC tRNA-Cys(gca) SO:0000258 contig_21 ncRNA-region 335 602 + T-box leader RFAM:RF00230, SO:0000140 contig_21 cds 659 1876 + GCA009771115_01066 Tyrosine--tRNA ligase SO:0001217, UniRef:UniRef50_A5I748 contig_21 cds 1964 2497 + GCA009771115_01067 Undecaprenyl-diphosphatase SO:0001217, UniRef:UniRef50_A0A1H2UI41 contig_21 cds 2614 2901 + GCA009771115_01068 hypothetical protein contig_21 cds 2945 4921 + GCA009771115_01069 Methionine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A3S5CG73 contig_21 cds 4966 5742 + GCA009771115_01070 tatD TatD family hydrolase SO:0001217, UniRef:UniRef50_A0A174KK32 contig_21 cds 5883 6752 + GCA009771115_01071 Ribosomal RNA small subunit methyltransferase A SO:0001217, UniRef:UniRef50_A9KL97 contig_21 cds 6756 8375 + GCA009771115_01072 hypothetical protein PFAM:PF00990.26 contig_21 cds 8390 8929 - GCA009771115_01073 hypothetical protein PFAM:PF13302.13, PFAM:PF13420.13 contig_21 cds 8991 9497 - GCA009771115_01074 tRNA-specific adenosine deaminase SO:0001217, UniRef:UniRef50_A0A1G5AIM6 contig_21 cds 9751 10740 + GCA009771115_01075 SCP2 domain-containing protein SO:0001217, UniRef:UniRef50_R5EBX9 contig_21 cds 10844 11263 + GCA009771115_01076 HIT domain-containing protein SO:0001217, UniRef:UniRef50_S0IPI8 contig_21 cds 11316 12374 - GCA009771115_01077 UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase SO:0001217, UniRef:UniRef50_Q893R7 contig_21 cds 12560 14137 + GCA009771115_01078 Glucose-6-phosphate isomerase SO:0001217, UniRef:UniRef50_O83488 contig_21 cds 14251 15324 + GCA009771115_01079 hypothetical protein PFAM:PF08239.17 contig_21 cds 15484 15858 + GCA009771115_01080 DUF3846 domain-containing protein SO:0001217, UniRef:UniRef50_A0A395UV08 contig_21 cds 15845 16858 + GCA009771115_01081 tRNA-dihydrouridine synthase SO:0001217, UniRef:UniRef50_A0A174Z974 contig_21 cds 16894 17430 + GCA009771115_01082 greA Transcription elongation factor GreA SO:0001217, UniRef:UniRef50_C4GCW1 contig_21 cds 17461 19416 + GCA009771115_01083 Lysine--tRNA ligase SO:0001217, UniRef:UniRef50_C4GCV9 contig_21 cds 19555 21525 - GCA009771115_01084 ABC3 transporter permease C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_E7MR67 contig_21 cds 21522 22280 - GCA009771115_01085 Peptide ABC transporter ATPase SO:0001217, UniRef:UniRef50_A0A0Z8FM40 contig_21 cds 22240 22368 - GCA009771115_01086 hypothetical protein contig_21 cds 22401 23306 - GCA009771115_01087 histidine kinase SO:0001217, UniRef:UniRef50_A0A223AUC2 contig_21 cds 23314 24039 - GCA009771115_01088 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A173WZF8 contig_21 cds 24082 25074 - GCA009771115_01089 WYL domain-containing protein SO:0001217, UniRef:UniRef50_I5AX22 contig_21 cds 25332 27011 + GCA009771115_01090 hypothetical protein PFAM:PF00563.25, PFAM:PF00990.26, PFAM:PF08447.18 contig_21 cds 27063 28775 + GCA009771115_01091 hypothetical protein PFAM:PF00990.26 contig_21 cds 28862 30046 + GCA009771115_01092 Zinc ribbon domain-containing protein SO:0001217, UniRef:UniRef50_D3R0C2 contig_21 cds 30089 30514 - GCA009771115_01093 Flavodoxin SO:0001217, UniRef:UniRef50_A0AAI9K268 contig_21 cds 31074 32384 + GCA009771115_01094 Phosphocarrier protein HPr SO:0001217, UniRef:UniRef50_I5ASQ5 contig_21 cds 32381 32695 + GCA009771115_01095 Glutaredoxin domain-containing protein SO:0001217, UniRef:UniRef50_D2MMS3 contig_21 cds 32766 34553 + GCA009771115_01096 Threonine--tRNA ligase SO:0001217, UniRef:UniRef50_C9LXY4 contig_21 cds 34731 36215 + GCA009771115_01097 hypothetical protein PFAM:PF01841.26, PFAM:PF16403.11 contig_21 cds 36446 38017 + GCA009771115_01098 hypothetical protein contig_21 cds 38001 38243 + GCA009771115_01099 hypothetical protein PFAM:PF00550.31 contig_21 cds 38243 39811 + GCA009771115_01100 hypothetical protein contig_21 cds 39815 40843 + GCA009771115_01101 GDSL-like lipase/acylhydrolase family protein SO:0001217, UniRef:UniRef50_A0A3D9I0E5 contig_21 cds 40845 41339 + GCA009771115_01102 hypothetical protein contig_21 cds 41354 41848 - GCA009771115_01103 Large-conductance mechanosensitive channel SO:0001217, UniRef:UniRef50_A0A401LBH7 contig_21 cds 42011 42883 + GCA009771115_01104 hypothetical protein PFAM:PF00398.26, PFAM:PF13489.12 contig_21 cds 42888 44036 + GCA009771115_01105 hypothetical protein contig_21 cds 44107 45981 + GCA009771115_01106 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_21 cds 45974 47893 + GCA009771115_01107 hypothetical protein PFAM:PF00535.33 contig_21 cds 47929 49467 + GCA009771115_01108 hypothetical protein contig_21 cds 49486 50715 + GCA009771115_01109 Polysaccharide biosynthesis protein C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_S0JID6 contig_21 cds 50718 51779 + GCA009771115_01110 hypothetical protein PFAM:PF01757.29 contig_21 cds 51760 52476 + GCA009771115_01111 Poly-beta-1,6-N-acetyl-D-glucosamine synthase SO:0001217, UniRef:UniRef50_A0A1C5LHJ8 contig_21 cds 52491 52841 + GCA009771115_01112 hypothetical protein contig_21 cds 52875 53672 + GCA009771115_01113 THIF-type NAD/FAD binding fold domain-containing protein SO:0001217, UniRef:UniRef50_R9JDK7 contig_21 cds 53656 54567 + GCA009771115_01114 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A348N824 contig_21 cds 54582 56291 + GCA009771115_01115 hypothetical protein PFAM:PF00535.33, PFAM:PF13506.12, PFAM:PF13641.12 contig_21 cds 56495 57544 + GCA009771115_01116 ATP-binding cassette domain-containing protein SO:0001217, UniRef:UniRef50_A0A174HFH9 contig_21 cds 57541 58206 + GCA009771115_01117 metI D-methionine transport system permease protein MetI SO:0001217, UniRef:UniRef50_A0A1N6F0V7 contig_21 cds 58257 59141 + GCA009771115_01118 Lipoprotein SO:0001217, UniRef:UniRef50_G5GF38 contig_21 ncRNA-region 59171 59265 + TPP riboswitch aptamer (THI element) RFAM:RF00059, SO:0000035 contig_21 cds 59311 59985 + GCA009771115_01119 Thiamine transporter SO:0001217, UniRef:UniRef50_A0A255IJK7 contig_21 cds 60078 61886 + GCA009771115_01120 hypothetical protein contig_21 cds 62159 63505 + GCA009771115_01121 mgtE Magnesium transporter MgtE SO:0001217, UniRef:UniRef50_F5YDZ2 contig_21 cds 63579 64229 + GCA009771115_01122 Uridine kinase SO:0001217, UniRef:UniRef50_A0A449BBH0 contig_21 cds 64280 65263 + GCA009771115_01123 Sodium/calcium exchanger membrane region domain-containing protein SO:0001217, UniRef:UniRef50_G2SYK0 contig_21 cds 65515 66531 + GCA009771115_01124 Alcohol dehydrogenase 1 SO:0001217, UniRef:UniRef50_P20368 contig_22 cds 360 1148 + GCA009771115_01125 Uridine phosphorylase SO:0001217, UniRef:UniRef50_O83990 contig_22 cds 1228 2268 + GCA009771115_01126 ABC transporter substrate-binding protein PnrA-like domain-containing protein SO:0001217, UniRef:UniRef50_F3B0Z1 contig_22 cds 2382 3929 + GCA009771115_01127 yjjI Glycine radical enzyme, YjjI family SO:0001217, UniRef:UniRef50_C6PX87 contig_22 cds 3926 4762 + GCA009771115_01128 Pyruvate formate-lyase 1-activating enzyme SO:0001217, UniRef:UniRef50_A0A1C6EZS9 contig_22 cds 4786 6333 + GCA009771115_01129 ABC transporter, ATP-binding protein SO:0001217, UniRef:UniRef50_C2KXY1 contig_22 cds 6323 7417 + GCA009771115_01130 ABC transporter permease SO:0001217, UniRef:UniRef50_F3B0Y7 contig_22 cds 7417 8358 + GCA009771115_01131 ABC transporter permease SO:0001217, UniRef:UniRef50_G1WIQ6 contig_22 cds 8478 8909 + GCA009771115_01132 Cytidine deaminase SO:0001217, UniRef:UniRef50_A0A2N2A4G2 contig_22 cds 8912 9547 + GCA009771115_01133 Deoxyribose-phosphate aldolase SO:0001217, UniRef:UniRef50_Q8DU34 contig_22 cds 9558 10322 + GCA009771115_01134 Crp/Fnr family transcriptional regulator SO:0001217, UniRef:UniRef50_A0A6N7J0J5 contig_22 cds 10343 11164 + GCA009771115_01135 Purine nucleoside phosphorylase SO:0001217, UniRef:UniRef50_I3EA52 contig_22 cds 11168 12379 + GCA009771115_01136 hflX GTPase HflX SO:0001217, UniRef:UniRef50_D9R4W7 contig_22 ncRNA-region 12434 12509 + Fluoride riboswitch aptamer (crcB RNA motif) RFAM:RF01734, SO:0000035 contig_22 cds 12602 13786 + GCA009771115_01137 Cation/H+ exchanger transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_C4Z4J1 contig_22 cds 13868 14743 + GCA009771115_01138 DUF2179 domain-containing protein SO:0001217, UniRef:UniRef50_E0RVA2 contig_22 cds 14734 16077 - GCA009771115_01139 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_A0A380LMJ1 contig_22 cds 16264 17100 + GCA009771115_01140 DNA-(apurinic or apyrimidinic site) lyase SO:0001217, UniRef:UniRef50_E0RZY2 contig_22 cds 17097 17486 + GCA009771115_01141 hypothetical protein PFAM:PF08984.16 contig_22 cds 17553 19235 - GCA009771115_01142 Phosphoglucomutase SO:0001217, UniRef:UniRef50_A0A174DTK3 contig_22 cds 19400 19996 + GCA009771115_01143 5'-deoxynucleotidase SO:0001217, UniRef:UniRef50_A0A7C6WJQ8 contig_22 cds 20031 20786 - GCA009771115_01144 Exodeoxyribonuclease III Xth SO:0001217, UniRef:UniRef50_F4GLK3 contig_22 cds 20833 22122 - GCA009771115_01145 hypothetical protein PFAM:PF07973.19 contig_22 cds 22272 22775 + GCA009771115_01146 N-acetyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_R9L7Q4 contig_22 cds 22821 23600 + GCA009771115_01147 33 kDa chaperonin SO:0001217, UniRef:UniRef50_A9KTE0 contig_22 cds 23663 23851 + GCA009771115_01148 Resolvase/invertase-type recombinase catalytic domain-containing protein SO:0001217, UniRef:UniRef50_A0A174BZT4 contig_22 cds 23861 24583 + GCA009771115_01149 (pseudo) recombinase family protein KEGG:K06400, SO:0001217, UniRef:UniRef50_V9HQ21, UniRef:UniRef90_UPI0028EA78ED contig_22 cds 24828 25067 + GCA009771115_01150 DNA-binding helix-turn-helix protein SO:0001217, UniRef:UniRef50_V1D7W0 contig_22 cds 25202 25819 + GCA009771115_01151 hypothetical protein SO:0001217, UniRef:UniRef50_J5GI44, UniRef:UniRef90_J5GI44 contig_22 cds 25833 25997 + GCA009771115_01152 hypothetical protein SO:0001217, UniRef:UniRef50_UPI0012EAAB44 contig_22 cds 26574 26852 + GCA009771115_01153 hypothetical protein contig_22 cds 26855 26992 + GCA009771115_01154 hypothetical protein contig_22 cds 26982 27335 + GCA009771115_01155 hypothetical protein contig_22 cds 27536 27862 + GCA009771115_01156 hypothetical protein contig_22 cds 28241 28897 - GCA009771115_01157 Transposase SO:0001217, UniRef:UniRef50_F7UXD0 contig_22 cds 29375 30460 - GCA009771115_01158 hypothetical protein PFAM:PF13472.12 contig_22 cds 30475 31905 - GCA009771115_01159 MBOAT family protein SO:0001217, UniRef:UniRef50_R9N0A5 contig_22 cds 32093 32365 + GCA009771115_01160 Negative regulator of flagellin synthesis SO:0001217, UniRef:UniRef50_A0A3R6CCY0 contig_22 cds 32384 32896 + GCA009771115_01161 hypothetical protein contig_22 cds 32975 34711 + GCA009771115_01162 Flagellar hook-associated protein 1 SO:0001217, UniRef:UniRef50_A0A1C5VAE3 contig_22 cds 34730 36580 + GCA009771115_01163 Flagellar hook-associated protein 1 SO:0001217, UniRef:UniRef50_A0A1H6SNL3 contig_22 cds 36645 38261 + GCA009771115_01164 hypothetical protein contig_22 cds 38314 38778 + GCA009771115_01165 fliW Flagellar assembly factor FliW SO:0001217, UniRef:UniRef50_G2SZK0 contig_22 cds 38780 39004 + GCA009771115_01166 csrA Translational regulator CsrA SO:0001217, UniRef:UniRef50_B8I4D3 contig_22 cds 39296 39712 + GCA009771115_01167 flaG Flagellar biosynthesis protein FlaG SO:0001217, UniRef:UniRef50_A0A7U9XEF7 contig_22 cds 39724 41328 + GCA009771115_01168 hypothetical protein contig_22 cds 41373 41762 + GCA009771115_01169 fliS Flagellar secretion chaperone FliS SO:0001217, UniRef:UniRef50_A0A7U9XP08 contig_22 cds 41790 42269 + GCA009771115_01170 hypothetical protein contig_22 cds 42541 43860 + GCA009771115_01171 hypothetical protein contig_22 cds 44189 44389 + GCA009771115_01172 hypothetical protein contig_22 cds 44402 44914 + GCA009771115_01173 nusG Transcription termination/antitermination protein NusG SO:0001217, UniRef:UniRef50_A0A9D9HZS6 contig_22 cds 44931 45356 + GCA009771115_01174 Large ribosomal subunit protein uL11 SO:0001217, UniRef:UniRef50_P62432 contig_22 cds 45431 46132 + GCA009771115_01175 Large ribosomal subunit protein uL1 SO:0001217, UniRef:UniRef50_P29393 contig_22 ncRNA-region 46168 46298 + Ribosomal protein L10 leader RFAM:RF00557, SO:0000140 contig_22 cds 46312 46824 + GCA009771115_01176 Large ribosomal subunit protein uL10 SO:0001217, UniRef:UniRef50_A0A223B3A6 contig_22 cds 46919 47296 + GCA009771115_01177 Large ribosomal subunit protein bL12 SO:0001217, UniRef:UniRef50_A0A1G2DEI7 contig_22 cds 47515 51453 + GCA009771115_01178 DNA-directed RNA polymerase subunit beta SO:0001217, UniRef:UniRef50_A0PXT8 contig_23 cds 318 911 - GCA009771115_01179 DUF4097 domain-containing protein SO:0001217, UniRef:UniRef50_D6ZGV6, UniRef:UniRef90_D3QZY8 contig_24 cds 1548 2105 + GCA009771115_01180 Nicotinamidase SO:0001217, UniRef:UniRef50_Q1GBT1 contig_24 cds 2596 2748 - GCA009771115_01181 hypothetical protein contig_24 crispr 2962 3405 ? CRISPR array with 7 repeats of length 36, consensus sequence GTTTTAGTCCTATTCAAAACAACACAGTTATAAAAC and spacer length 30 SO:0001459 contig_24 crispr-repeat 2962 2997 ? CRISPR repeat contig_24 crispr-spacer 2998 3027 ? CRISPR spacer, sequence TCATTGATTGTAACACTATGAGAGTGTCTA contig_24 crispr-repeat 3028 3063 ? CRISPR repeat contig_24 crispr-spacer 3064 3094 ? CRISPR spacer, sequence ACAACACAAAAAAACTTTTGCTAAATATCGT contig_24 crispr-repeat 3095 3130 ? CRISPR repeat contig_24 crispr-spacer 3131 3160 ? CRISPR spacer, sequence TTTAATCTGCCTATCAGTGTTTTTTTACCA contig_24 crispr-repeat 3161 3196 ? CRISPR repeat contig_24 crispr-spacer 3197 3226 ? CRISPR spacer, sequence GTATTTGTCCATTGTCCCAGTCCAAAACCG contig_24 crispr-repeat 3227 3262 ? CRISPR repeat contig_24 crispr-spacer 3263 3292 ? CRISPR spacer, sequence GACAAGTTTTATATTGACAAAGTTTCAATA contig_24 crispr-repeat 3293 3328 ? CRISPR repeat contig_24 crispr-spacer 3329 3358 ? CRISPR spacer, sequence TTACGGTAGACGATACAAGTTAGCACAGCA contig_24 crispr-repeat 3359 3394 ? CRISPR repeat contig_24 crispr-spacer 3395 3405 ? CRISPR spacer, sequence CTCGTGATGCC contig_24 cds 3499 4164 - GCA009771115_01182 hypothetical protein contig_24 cds 4157 4477 - GCA009771115_01183 CRISPR-associated endoribonuclease Cas2 SO:0001217, UniRef:UniRef50_G3ECR3 contig_24 cds 4489 5355 - GCA009771115_01184 CRISPR-associated endonuclease Cas1 SO:0001217, UniRef:UniRef50_G3ECR2 contig_24 cds 5356 9396 - GCA009771115_01185 CRISPR-associated endonuclease Cas9 SO:0001217, UniRef:UniRef50_H3NFH0 contig_24 ncRNA 9457 9550 + GCA009771115_01186 tracrRNA Trans-activating crRNA RFAM:RF02348, SO:0000655 contig_24 cds 9882 10100 + GCA009771115_01187 hypothetical protein contig_24 tRNA 10183 10255 - GCA009771115_01188 trnK tRNA-Lys(ttt) SO:0000265 contig_24 tRNA 10284 10355 - GCA009771115_01189 trnQ tRNA-Gln(ttg) SO:0000261 contig_24 tRNA 10383 10456 - GCA009771115_01190 trnH tRNA-His(gtg) SO:0000262 contig_24 tRNA 10462 10535 - GCA009771115_01191 trnR tRNA-Arg(tct) SO:0001036 contig_24 tRNA 10541 10611 - GCA009771115_01192 trnG tRNA-Gly(tcc) SO:0000260 contig_24 tRNA 10627 10701 - GCA009771115_01193 trnP tRNA-Pro(tgg) SO:0000268 contig_24 cds 10953 11432 - GCA009771115_01194 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_24 cds 11724 12329 - GCA009771115_01195 dITP/XTP pyrophosphatase SO:0001217, UniRef:UniRef50_A0A3E3K434 contig_24 cds 12352 13377 - GCA009771115_01196 hypothetical protein PFAM:PF01520.23 contig_24 cds 13361 15046 - GCA009771115_01197 hypothetical protein PFAM:PF00112.29, PFAM:PF07833.16, PFAM:PF18560.7 contig_24 cds 15131 16279 - GCA009771115_01198 THUMP domain-containing protein SO:0001217, UniRef:UniRef50_R9J645 contig_24 cds 16408 16893 - GCA009771115_01199 Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase SO:0001217, UniRef:UniRef50_A0A448TS85 contig_24 cds 16996 17634 - GCA009771115_01200 hypothetical protein contig_24 cds 17770 18777 + GCA009771115_01201 Proline iminopeptidase SO:0001217, UniRef:UniRef50_A0A0R1MGT7, UniRef:UniRef90_C8PB32 contig_24 cds 18968 19072 + GCA009771115_01202 hypothetical protein contig_24 cds 19050 19310 + GCA009771115_01203 Amino acid ABC transporter, permease protein RefSeq:WP_006730829.1, SO:0001217, UniParc:UPI0001E2B67E, UniRef:UniRef100_A0A6G7BA82, UniRef:UniRef50_I7JVB2, UniRef:UniRef90_E1NS74 contig_24 cds 19519 19806 - GCA009771115_01204 Bacteriocin immunity protein RefSeq:WP_164798885.1, SO:0001217, UniParc:UPI0013E19415, UniRef:UniRef100_UPI0013E19415, UniRef:UniRef50_I7IYT6, UniRef:UniRef90_C8PB34 contig_24 cds 20041 20250 + GCA009771115_01205 hypothetical protein contig_24 cds 20281 21390 + GCA009771115_01206 guaD guanine deaminase EC:3.5.4.3, GO:0006147, GO:0008270, GO:0008892, SO:0001217, UniRef:UniRef50_C5R9N4, UniRef:UniRef90_C8PB35 contig_24 cds 21414 22751 + GCA009771115_01207 Putative permease RefSeq:WP_006735215.1, SO:0001217, UniParc:UPI0001E9BAE1, UniRef:UniRef100_A0A6G7BB06, UniRef:UniRef50_A0A4R5NUB0, UniRef:UniRef90_C8PB36 contig_24 tRNA 22801 22873 - GCA009771115_01208 trnK tRNA-Lys(ctt) SO:0000265 contig_24 cds 23050 23784 + GCA009771115_01209 yycF response regulator YycF SO:0001217, UniParc:UPI0001E5DA2B, UniRef:UniRef100_E1NS70, UniRef:UniRef50_P37478, UniRef:UniRef90_E1NS70 contig_24 cds 23826 25664 + GCA009771115_01210 walK cell wall metabolism sensor histidine kinase WalK EC:2.7.13.3, GO:0000155, GO:0007165, GO:0016020, GO:0016310, SO:0001217, UniRef:UniRef50_K8EM52, UniRef:UniRef90_C8PB39 contig_24 cds 25654 26988 + GCA009771115_01211 yycH Regulatory protein YycH domain-containing protein RefSeq:WP_006735210.1, SO:0001217, UniParc:UPI0001E9BAE2, UniRef:UniRef100_UPI0001E9BAE2, UniRef:UniRef50_Q74LW6, UniRef:UniRef90_A0A6G7BB85 contig_24 cds 26978 27814 + GCA009771115_01212 yycH YycH protein SO:0001217, UniRef:UniRef50_C8PB41, UniRef:UniRef90_C8PB41 contig_24 cds 27839 28636 + GCA009771115_01213 MBL fold metallo-hydrolase RefSeq:WP_006736159.1, SO:0001217, UniParc:UPI0001E98C82, UniRef:UniRef100_UPI0001E98C82, UniRef:UniRef50_A0A3Q8SQX8, UniRef:UniRef90_A0A6G7BAK8 contig_24 cds 28672 29844 + GCA009771115_01214 Putative phage prohead protease, HK97 family SO:0001217, UniRef:UniRef50_Q9Z4H7, UniRef:UniRef90_C8PB43 contig_25 cds 1 174 + GCA009771115_01215 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1L8D4G3 contig_26 cds 163 1584 - GCA009771115_01216 Serine/threonine exchange transporter, LAT family SO:0001217, UniRef:UniRef50_A0A1W1Z7E1 contig_26 cds 1823 2281 + GCA009771115_01217 D-aminoacyl-tRNA deacylase SO:0001217, UniRef:UniRef50_F7UZ95 contig_26 cds 2381 2770 - GCA009771115_01218 arsR DNA-binding transcriptional regulator, ArsR family SO:0001217, UniRef:UniRef50_A0A1H6VEL5 contig_26 cds 3119 5020 + GCA009771115_01219 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_A0A9E1AEE7 contig_26 cds 5033 5512 - GCA009771115_01220 Ribosomal RNA large subunit methyltransferase H SO:0001217, UniRef:UniRef50_Q899K8 contig_26 cds 5698 7299 + GCA009771115_01221 D-alanyl-lipoteichoic acid acyltransferase DltB, MBOAT superfamily SO:0001217, UniRef:UniRef50_A0A1H2SWZ2 contig_26 cds 7377 8372 + GCA009771115_01222 hypothetical protein SO:0001217, UniRef:UniRef50_UPI0003FAC039 contig_26 cds 8387 9928 + GCA009771115_01223 D-alanine--poly(Phosphoribitol) ligase SO:0001217, UniRef:UniRef50_A0A3C0J6Q9 contig_26 cds 9925 11127 + GCA009771115_01224 Diaminopimelate decarboxylase SO:0001217, UniRef:UniRef50_A0A425WGE7 contig_26 cds 11167 11397 + GCA009771115_01225 Phosphopantetheine attachment site SO:0001217, UniRef:UniRef50_D4M1K0 contig_26 cds 11486 12190 + GCA009771115_01226 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A4P6M2X9 contig_26 cds 12306 13922 + GCA009771115_01227 hypothetical protein PFAM:PF00512.31, PFAM:PF02518.31 contig_26 cds 14031 15788 + GCA009771115_01228 Phosphate:Na+ symporter SO:0001217, UniRef:UniRef50_A0A1H3GIQ2 contig_26 cds 15829 17949 + GCA009771115_01229 hypothetical protein contig_26 cds 18021 18728 + GCA009771115_01230 hypothetical protein PFAM:PF00633.29, PFAM:PF10531.15, PFAM:PF12836.13 contig_26 cds 18729 19418 + GCA009771115_01231 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_A0A6N2TBA9 contig_26 cds 19418 21151 + GCA009771115_01232 histidine kinase SO:0001217, UniRef:UniRef50_C4G960 contig_26 cds 21148 22074 + GCA009771115_01233 hypothetical protein PFAM:PF10646.14 contig_26 cds 22105 24105 + GCA009771115_01234 hypothetical protein PFAM:PF13567.11 contig_26 cds 24382 24645 + GCA009771115_01235 Small ribosomal subunit protein bS20 SO:0001217, UniRef:UniRef50_A0A1V4X3C7 contig_26 cds 24734 25732 - GCA009771115_01236 hypothetical protein PFAM:PF06144.19, PFAM:PF21694.2 contig_26 cds 25895 27706 + GCA009771115_01237 Elongation factor 4 SO:0001217, UniRef:UniRef50_Q9ZHZ8 contig_26 cds 27715 28872 + GCA009771115_01238 hypothetical protein PFAM:PF04055.27, PFAM:PF06969.22 contig_26 cds 29133 30200 + GCA009771115_01239 hrcA Heat-inducible transcription repressor HrcA SO:0001217, UniRef:UniRef50_A0A9D5RV16 contig_26 cds 30208 30867 + GCA009771115_01240 grpE Protein GrpE SO:0001217, UniRef:UniRef50_A0A9D2MTP8 contig_26 cds 30959 32845 + GCA009771115_01241 dnaK Chaperone protein DnaK SO:0001217, UniRef:UniRef50_A9KKU0 contig_26 cds 32878 34050 + GCA009771115_01242 dnaJ Chaperone protein DnaJ SO:0001217, UniRef:UniRef50_C4Z1J3 contig_26 cds 34266 35420 + GCA009771115_01243 cysteine desulfurase SO:0001217, UniRef:UniRef50_C0FQM5 contig_26 cds 35466 36656 + GCA009771115_01244 putative tRNA sulfurtransferase SO:0001217, UniRef:UniRef50_C4Z0P7 contig_26 cds 36956 37189 - GCA009771115_01245 HPr domain-containing protein SO:0001217, UniRef:UniRef50_S0IY06 contig_26 cds 37275 38603 + GCA009771115_01246 miaB (Dimethylallyl)adenosine tRNA methylthiotransferase MiaB SO:0001217, UniRef:UniRef50_A0A174L320 contig_26 cds 38637 38903 + GCA009771115_01247 UPF0297 protein Cthe_0151 SO:0001217, UniRef:UniRef50_A3DBR3 contig_26 cds 38903 39334 + GCA009771115_01248 Putative pre-16S rRNA nuclease SO:0001217, UniRef:UniRef50_A9KKS6 contig_26 cds 39337 39588 + GCA009771115_01249 hypothetical protein contig_26 cds 39616 41280 + GCA009771115_01250 Ribonuclease J SO:0001217, UniRef:UniRef50_A0A173RL01 contig_26 cds 41282 41923 + GCA009771115_01251 hypothetical protein PFAM:PF01596.23, PFAM:PF13578.12, PFAM:PF13847.12 contig_26 cds 42008 43234 + GCA009771115_01252 yhbU putative protease yhbU SO:0001217, UniRef:UniRef50_A0A174KF40 contig_26 cds 43244 44329 + GCA009771115_01253 hypothetical protein contig_26 cds 44480 45634 + GCA009771115_01254 Queuine tRNA-ribosyltransferase SO:0001217, UniRef:UniRef50_A5I6E9 contig_26 cds 45749 46096 + GCA009771115_01255 yajC Preprotein translocase, YajC subunit SO:0001217, UniRef:UniRef50_C4GA78 contig_26 cds 46217 47587 + GCA009771115_01256 Permease SO:0001217, UniRef:UniRef50_G4Q3D6 contig_26 cds 47765 49975 + GCA009771115_01257 hypothetical protein contig_26 cds 49991 52483 + GCA009771115_01258 clpC ATP-dependent Clp protease ATP-binding subunit ClpC SO:0001217, UniRef:UniRef50_A0A1I2T500 contig_26 cds 52532 52939 + GCA009771115_01259 Peptidase S11 D-Ala-D-Ala carboxypeptidase A C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A9KHW4 contig_26 cds 52939 54303 + GCA009771115_01260 radA DNA repair protein RadA SO:0001217, UniRef:UniRef50_A5GDK5 contig_26 rRNA 54620 56150 + GCA009771115_01261 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_26 rRNA 56227 56344 + GCA009771115_01262 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_27 cds 141 317 + GCA009771115_01263 hypothetical protein contig_27 cds 1963 2379 + GCA009771115_01264 DUF3796 domain-containing protein SO:0001217, UniRef:UniRef50_U2JVW5, UniRef:UniRef90_F1T6K6 contig_27 cds 2382 2585 + GCA009771115_01265 xRE DNA-binding helix-turn-helix protein COG:COG1476, COG:K, RefSeq:WP_012994140.1, SO:0001217, UniParc:UPI0001C4EDF9, UniRef:UniRef100_D3QZX9, UniRef:UniRef50_A0A1A6AI13, UniRef:UniRef90_D3QZX9 contig_27 cds 2799 2975 - GCA009771115_01266 DNA recombinase SO:0001217, UniRef:UniRef50_A0A3A1X580 contig_27 cds 2929 3063 - GCA009771115_01267 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_D6ZHI6, UniRef:UniRef90_D6ZHI6, UniRef:UniRef90_UPI001F093C67 contig_27 cds 3271 3885 - GCA009771115_01268 DUF7010 domain-containing protein SO:0001217, UniRef:UniRef50_I4M0A9, UniRef:UniRef90_C8PC32 contig_27 cds 4118 4723 - GCA009771115_01269 Cadmium resistance transporter family protein SO:0001217, UniRef:UniRef50_A0A1S6IPE0, UniRef:UniRef90_A0A133XU39 contig_27 cds 5421 6863 - GCA009771115_01270 recG ATP-dependent DNA helicase RecG COG:COG2865, COG:K, SO:0001217, UniRef:UniRef50_A0A1X6WRS9, UniRef:UniRef90_A0A7Y0UGS1 contig_27 cds 6902 7198 - GCA009771115_01271 23S rRNA methyltransferase SO:0001217, UniRef:UniRef50_G5GKU6, UniRef:UniRef90_R0B264 contig_27 cds 7639 9003 - GCA009771115_01272 ccmA heme ABC exporter ATP-binding protein CcmA EC:7.6.2.5, GO:0015439, GO:0015886, GO:0017004, GO:0022857, GO:0043190, SO:0001217, UniRef:UniRef50_C2KXE6, UniRef:UniRef90_C2BCZ1 contig_27 cds 8997 9686 - GCA009771115_01273 ykoC HMP/thiamine permease protein YkoC KEGG:K16785, SO:0001217, UniRef:UniRef50_Q8DP88, UniRef:UniRef90_A0A8H2M6F1 contig_27 cds 9686 10270 - GCA009771115_01274 TIGR02185 family protein KEGG:K16926, SO:0001217, UniRef:UniRef50_Q8CYL9, UniRef:UniRef90_H3NR64 contig_27 cds 10281 12002 - GCA009771115_01275 mdlB ABC transporter, ATP-binding protein COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_Q8DP89, UniRef:UniRef90_Q8DP89 contig_27 cds 11986 13740 - GCA009771115_01276 mdlB ABC transporter ATP-binding protein/permease COG:COG1132, COG:V, SO:0001217, UniRef:UniRef50_Q8DP90, UniRef:UniRef90_Q8DP90 contig_27 cds 13900 14892 + GCA009771115_01277 araC AraC family transcriptional regulator SO:0001217, UniRef:UniRef50_Q8CYM0, UniRef:UniRef90_UPI001106617C contig_27 cds 15367 16809 - GCA009771115_01278 recG ATP-dependent DNA helicase RecG COG:COG2865, COG:K, SO:0001217, UniRef:UniRef50_A0A1X6WRS9, UniRef:UniRef90_A0A7Y0UGS1 contig_27 cds 16848 18506 - GCA009771115_01279 rumA 23S rRNA (Uracil-5-)-methyltransferase RumA SO:0001217, UniRef:UniRef50_C7GG53 contig_27 cds 18559 19518 - GCA009771115_01280 HD domain-containing protein SO:0001217, UniRef:UniRef50_G9WK47 contig_27 cds 19744 22134 + GCA009771115_01281 mutS2 Endonuclease MutS2 SO:0001217, UniRef:UniRef50_A9KR74 contig_27 cds 22410 23981 + GCA009771115_01282 ATP-binding protein SO:0001217, UniRef:UniRef50_A0A239SR60 contig_27 cds 24149 24670 - GCA009771115_01283 Large ribosomal subunit protein bL17 SO:0001217, UniRef:UniRef50_C4Z2V8 contig_27 cds 24802 25770 - GCA009771115_01284 DNA-directed RNA polymerase subunit alpha SO:0001217, UniRef:UniRef50_P66709 contig_27 cds 25816 26409 - GCA009771115_01285 Small ribosomal subunit protein uS4 SO:0001217, UniRef:UniRef50_Q8RE43 contig_27 cds 26427 26816 - GCA009771115_01286 rpsK 30S ribosomal protein S11 COG:COG0100, COG:J, GO:0003735, GO:0005840, GO:0006412, KEGG:K02948, SO:0001217, UniRef:UniRef50_P9WH65, UniRef:UniRef90_A0A416E184 contig_27 cds 26861 27232 - GCA009771115_01287 Small ribosomal subunit protein uS13 SO:0001217, UniRef:UniRef50_Q9KP05 contig_27 cds 27613 27831 - GCA009771115_01288 infA translation initiation factor IF-1 COG:COG0361, COG:J, GO:0003743, GO:0006413, KEGG:K02518, SO:0001217, UniRef:UniRef50_Q5SHR1, UniRef:UniRef90_R9J7F9 contig_27 cds 27853 28500 - GCA009771115_01289 Adenylate kinase SO:0001217, UniRef:UniRef50_A5I7I5 contig_27 cds 28517 29830 - GCA009771115_01290 secY Protein translocase subunit SecY SO:0001217, UniRef:UniRef50_F7V4U6 contig_27 cds 29830 30273 - GCA009771115_01291 Large ribosomal subunit protein uL15 SO:0001217, UniRef:UniRef50_Q18CH7 contig_27 cds 30297 30485 - GCA009771115_01292 Large ribosomal subunit protein uL30 SO:0001217, UniRef:UniRef50_C4ZBT6 contig_27 cds 30496 31005 - GCA009771115_01293 Small ribosomal subunit protein uS5 SO:0001217, UniRef:UniRef50_B3E847 contig_27 cds 31021 31389 - GCA009771115_01294 Large ribosomal subunit protein uL18 SO:0001217, UniRef:UniRef50_Q2JIL2 contig_27 cds 31408 31947 - GCA009771115_01295 Large ribosomal subunit protein uL6 SO:0001217, UniRef:UniRef50_B8I7Z4 contig_27 cds 32010 32411 - GCA009771115_01296 Small ribosomal subunit protein uS8 SO:0001217, UniRef:UniRef50_Q46IS2 contig_27 cds 32434 32619 - GCA009771115_01297 type Z 30S ribosomal protein S14 GO:0003735, GO:0005840, GO:0006412, KEGG:K02954, SO:0001217, UniRef:UniRef50_P12878, UniRef:UniRef90_A0A173TNA0 contig_27 cds 32635 33174 - GCA009771115_01298 Large ribosomal subunit protein uL5 SO:0001217, UniRef:UniRef50_P73308 contig_27 cds 33195 33506 - GCA009771115_01299 Large ribosomal subunit protein uL24 SO:0001217, UniRef:UniRef50_C4Z2U1 contig_27 cds 33518 33886 - GCA009771115_01300 Large ribosomal subunit protein uL14 SO:0001217, UniRef:UniRef50_Q5SHP8 contig_27 cds 33905 34162 - GCA009771115_01301 Small ribosomal subunit protein uS17 SO:0001217, UniRef:UniRef50_Q8G409 contig_27 cds 34189 34395 - GCA009771115_01302 Large ribosomal subunit protein uL29 SO:0001217, UniRef:UniRef50_A9KJI6 contig_27 cds 34385 34822 - GCA009771115_01303 Large ribosomal subunit protein uL16 SO:0001217, UniRef:UniRef50_A3DJH9 contig_27 cds 34809 35480 - GCA009771115_01304 Small ribosomal subunit protein uS3 SO:0001217, UniRef:UniRef50_Q38UR8 contig_27 cds 35495 35881 - GCA009771115_01305 Large ribosomal subunit protein uL22 SO:0001217, UniRef:UniRef50_C4Z2T5 contig_27 cds 35908 36195 - GCA009771115_01306 Small ribosomal subunit protein uS19 SO:0001217, UniRef:UniRef50_P21476 contig_27 cds 36207 37049 - GCA009771115_01307 Large ribosomal subunit protein uL2 SO:0001217, UniRef:UniRef50_P94270 contig_27 cds 37110 37409 - GCA009771115_01308 Large ribosomal subunit protein uL23 SO:0001217, UniRef:UniRef50_B0TC58 contig_27 cds 37409 38032 - GCA009771115_01309 Large ribosomal subunit protein uL4 SO:0001217, UniRef:UniRef50_A9KJJ3 contig_27 cds 38057 38734 - GCA009771115_01310 Large ribosomal subunit protein uL3 SO:0001217, UniRef:UniRef50_Q2FW06 contig_27 cds 38842 39192 - GCA009771115_01311 Small ribosomal subunit protein uS10 SO:0001217, UniRef:UniRef50_H6LGV1 contig_27 ncRNA-region 39329 39423 - S10-Clostridia ribosomal protein leader RFAM:RF03136, SO:0000140 contig_27 cds 39622 40524 - GCA009771115_01312 S-adenosylmethionine-dependent methyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_C0C677 contig_27 cds 40541 41188 - GCA009771115_01313 hypothetical protein PFAM:PF00702.32, PFAM:PF13242.12 contig_27 cds 41175 42791 - GCA009771115_01314 Phosphoenolpyruvate-protein phosphotransferase SO:0001217, UniRef:UniRef50_A0A9D2IUS6 contig_27 cds 42888 43634 + GCA009771115_01315 tRNA pseudouridine synthase A SO:0001217, UniRef:UniRef50_A0A9D1A2J3 contig_27 cds 43637 44887 - GCA009771115_01316 hypothetical protein PFAM:PF00165.29, PFAM:PF02311.25, PFAM:PF12833.13 contig_27 cds 45058 46497 - GCA009771115_01317 C4-dicarboxylate anaerobic carrier SO:0001217, UniRef:UniRef50_R9KYF4 contig_27 cds 46513 47448 - GCA009771115_01318 Carbamate kinase SO:0001217, UniRef:UniRef50_Q4L9V7 contig_27 cds 47454 48446 - GCA009771115_01319 Ornithine carbamoyltransferase, catabolic SO:0001217, UniRef:UniRef50_Q81II0 contig_27 cds 48583 49818 - GCA009771115_01320 Arginine deiminase SO:0001217, UniRef:UniRef50_A8AYL1 contig_27 cds 50216 51304 + GCA009771115_01321 hypothetical protein PFAM:PF07687.19 contig_27 cds 51404 52090 - GCA009771115_01322 hypothetical protein PFAM:PF00300.27 contig_27 cds 52208 52666 - GCA009771115_01323 hypothetical protein contig_27 cds 52781 54598 - GCA009771115_01324 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] SO:0001217, UniRef:UniRef50_R7HTQ1 contig_27 cds 54795 55811 - GCA009771115_01325 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_R9JWJ8 contig_27 cds 56151 57362 - GCA009771115_01326 Dicarboxylate/amino acid:cation symporter SO:0001217, UniRef:UniRef50_E5Y6X4 contig_27 cds 57405 58460 - GCA009771115_01327 hypothetical protein contig_27 cds 58667 60022 - GCA009771115_01328 Aspartate aminotransferase SO:0001217, UniRef:UniRef50_R7QXX3 contig_27 cds 60174 62753 - GCA009771115_01329 clpB Chaperone protein ClpB SO:0001217, UniRef:UniRef50_A0A1I2R6A5 contig_27 cds 62940 63710 - GCA009771115_01330 hypothetical protein contig_27 cds 63981 64139 + GCA009771115_01331 hypothetical protein contig_27 cds 64345 65724 - GCA009771115_01332 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF23914.1 contig_27 cds 65726 65893 - GCA009771115_01333 hypothetical protein contig_27 cds 65890 67323 - GCA009771115_01334 hypothetical protein PFAM:PF03961.19 contig_27 cds 67402 70062 - GCA009771115_01335 Valine--tRNA ligase SO:0001217, UniRef:UniRef50_R6HGS7 contig_27 cds 70088 70240 - GCA009771115_01336 hypothetical protein contig_27 cds 70378 70590 - GCA009771115_01337 hypothetical protein contig_27 cds 70614 72776 - GCA009771115_01338 Ferrous iron transport protein B SO:0001217, UniRef:UniRef50_W2BXP1 contig_27 cds 72786 73010 - GCA009771115_01339 Ferrous iron transporter FeoA-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A096BD67 contig_27 cds 73035 73253 - GCA009771115_01340 hypothetical protein PFAM:PF04023.20 contig_27 cds 73549 73989 + GCA009771115_01341 Iron dependent repressor DNA binding domain protein SO:0001217, UniRef:UniRef50_C7H0U9 contig_27 cds 74079 75503 - GCA009771115_01342 Pyruvate kinase SO:0001217, UniRef:UniRef50_A0A0U5JHB3 contig_27 cds 75509 76972 - GCA009771115_01343 degQ Periplasmic pH-dependent serine endoprotease DegQ SO:0001217, UniRef:UniRef50_A0A1C6DGY2 contig_27 cds 77053 78498 - GCA009771115_01344 hypothetical protein PFAM:PF00535.33 contig_27 cds 78503 79732 - GCA009771115_01345 galU UTP-glucose-1-phosphate uridylyltransferase GalU SO:0001217, UniRef:UniRef50_E0RW75 contig_27 cds 79744 80988 - GCA009771115_01346 wbuB Glycosyltransferase WbuB SO:0001217, UniRef:UniRef50_A0A2G3E4H7 contig_27 cds 80978 82408 - GCA009771115_01347 Sugar transferase SO:0001217, UniRef:UniRef50_A0A9D5YJ75 contig_27 cds 82453 83664 - GCA009771115_01348 hypothetical protein contig_27 cds 83679 84857 - GCA009771115_01349 UDP-galactopyranose mutase SO:0001217, UniRef:UniRef50_E0NTD3 contig_27 cds 84873 86201 - GCA009771115_01350 tagH Teichoic acids export ATP-binding protein TagH SO:0001217, UniRef:UniRef50_A0A1C5NEL8 contig_27 cds 86210 87037 - GCA009771115_01351 Transport permease protein SO:0001217, UniRef:UniRef50_A0A3R5W0I4 contig_27 cds 87051 87623 - GCA009771115_01352 hypothetical protein PFAM:PF00908.23 contig_27 cds 87623 88504 - GCA009771115_01353 Glucose-1-phosphate thymidylyltransferase SO:0001217, UniRef:UniRef50_A0A2N1HBY2 contig_27 cds 88656 89747 - GCA009771115_01354 dTDP-glucose 4,6-dehydratase SO:0001217, UniRef:UniRef50_A0A2T0BC77 contig_27 cds 89783 90658 - GCA009771115_01355 dTDP-4-dehydrorhamnose reductase SO:0001217, UniRef:UniRef50_C7G9K2 contig_27 cds 90674 92023 - GCA009771115_01356 Phosphoglucosamine mutase SO:0001217, UniRef:UniRef50_Q18CL0 contig_27 cds 92043 93290 - GCA009771115_01357 hypothetical protein contig_27 cds 93283 94242 - GCA009771115_01358 Diadenylate cyclase SO:0001217, UniRef:UniRef50_C4GCM8 contig_27 cds 94243 95184 - GCA009771115_01359 hypothetical protein contig_27 cds 95188 95598 - GCA009771115_01360 hypothetical protein contig_27 cds 95686 96090 - GCA009771115_01361 Methionyl/Leucyl tRNA synthetase domain-containing protein SO:0001217, UniRef:UniRef50_R7QYR0 contig_27 cds 96104 96844 - GCA009771115_01362 hypothetical protein PFAM:PF00156.33, PFAM:PF18912.6 contig_27 cds 96916 98310 + GCA009771115_01363 hypothetical protein contig_27 cds 98366 100603 - GCA009771115_01364 recD2 ATP-dependent RecD2 DNA helicase SO:0001217, UniRef:UniRef50_A0A1G9F7W5 contig_27 cds 100590 101066 - GCA009771115_01365 hypothetical protein contig_27 cds 101106 101924 - GCA009771115_01366 flgG Flagellar basal-body rod protein FlgG SO:0001217, UniRef:UniRef50_A0A6L5XZJ3 contig_27 cds 101951 102751 - GCA009771115_01367 Distal rod protein SO:0001217, UniRef:UniRef50_A0A173UTN2 contig_27 cds 102825 103865 - GCA009771115_01368 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_27 cds 103943 104968 - GCA009771115_01369 mreB Cell shape-determining protein MreB SO:0001217, UniRef:UniRef50_A0A174LUE9 contig_27 cds 105119 105958 - GCA009771115_01370 hypothetical protein PFAM:PF00535.33 contig_27 cds 106194 109037 - GCA009771115_01371 UvrABC system protein A SO:0001217, UniRef:UniRef50_A0A3D2IPK4 contig_27 cds 109037 111064 - GCA009771115_01372 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF17757.6 contig_27 cds 111101 113674 - GCA009771115_01373 secA Protein translocase subunit SecA SO:0001217, UniRef:UniRef50_Q8RCB4 contig_27 cds 113921 114130 - GCA009771115_01374 hypothetical protein SO:0001217, UniRef:UniRef50_A0A1U7LZN1, UniRef:UniRef90_A0A1U7LZN1 contig_27 cds 114161 114793 - GCA009771115_01375 hypothetical protein SO:0001217, UniRef:UniRef50_R7ZHH9 contig_27 cds 116668 117543 - GCA009771115_01376 Methionine aminopeptidase SO:0001217, UniRef:UniRef50_A0A0M6WCJ8 contig_27 cds 117561 118274 - GCA009771115_01377 hypothetical protein PFAM:PF13624.11 contig_27 cds 118278 119426 - GCA009771115_01378 hypothetical protein PFAM:PF24568.1 contig_27 cds 119456 119698 - GCA009771115_01379 Veg protein SO:0001217, UniRef:UniRef50_G2T4C6 contig_27 cds 119982 120710 + GCA009771115_01380 hypothetical protein contig_27 cds 120678 121859 - GCA009771115_01381 D-alanine--D-alanine ligase SO:0001217, UniRef:UniRef50_A0A7V7QHS5 contig_27 cds 121937 123556 - GCA009771115_01382 UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase SO:0001217, UniRef:UniRef50_A0A1C5UCH3 contig_27 cds 123635 124399 - GCA009771115_01383 AB hydrolase-1 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1Q9JJD9 contig_27 cds 124486 125445 - GCA009771115_01384 hypothetical protein PFAM:PF01381.28, PFAM:PF13443.12, PFAM:PF13560.12 contig_27 cds 125565 126101 - GCA009771115_01385 Ribosome hibernation promoting factor SO:0001217, UniRef:UniRef50_A0A4Q8U5I6 contig_27 cds 126335 127129 + GCA009771115_01386 3-oxoacyl-[acyl-carrier protein] reductase SO:0001217, UniRef:UniRef50_R9N1H3 contig_27 tRNA 127306 127376 + GCA009771115_01387 trnG tRNA-Gly(ccc) SO:0000260 contig_27 cds 127466 128245 + GCA009771115_01388 Glutamate racemase SO:0001217, UniRef:UniRef50_A0A1V4IYF3 contig_27 cds 128298 131000 - GCA009771115_01389 hypothetical protein PFAM:PF13476.12 contig_27 cds 131000 132112 - GCA009771115_01390 Ser/Thr phosphatase family protein SO:0001217, UniRef:UniRef50_C4GDX3 contig_27 cds 132392 133405 + GCA009771115_01391 Ribonucleoside-diphosphate reductase subunit beta SO:0001217, UniRef:UniRef50_P75461 contig_27 cds 133480 133908 + GCA009771115_01392 nrdI Protein NrdI SO:0001217, UniRef:UniRef50_Q6F0T6 contig_27 cds 133911 136115 + GCA009771115_01393 Ribonucleoside-diphosphate reductase subunit alpha SO:0001217, UniRef:UniRef50_P47473 contig_27 cds 136121 137212 - GCA009771115_01394 Glycosyl transferase SO:0001217, UniRef:UniRef50_A0A3D2EEU7 contig_27 cds 137402 139114 - GCA009771115_01395 Na+/H+ antiporter NhaC-like C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_R9JZ56 contig_27 tRNA 139367 139450 - GCA009771115_01396 trnL tRNA-Leu(taa) SO:0000264 contig_27 cds 139791 141599 - GCA009771115_01397 ftsH ATP-dependent zinc metalloprotease FtsH SO:0001217, UniRef:UniRef50_A0A1E3A963 contig_27 cds 141628 142152 - GCA009771115_01398 Hypoxanthine phosphoribosyltransferase SO:0001217, UniRef:UniRef50_A0A6N7Y1A1 contig_27 cds 142145 143557 - GCA009771115_01399 hypothetical protein PFAM:PF11734.13 contig_27 cds 143607 143900 - GCA009771115_01400 hypothetical protein contig_27 cds 143915 144154 - GCA009771115_01401 RNA-binding S4 domain-containing protein SO:0001217, UniRef:UniRef50_R8VXL6 contig_27 cds 144299 144574 - GCA009771115_01402 DNA-binding protein HU-beta SO:0001217, UniRef:UniRef50_A0A4P7L0U8 contig_27 cds 144817 146103 - GCA009771115_01403 hypothetical protein PFAM:PF08308.17 contig_27 cds 146090 147436 - GCA009771115_01404 putative domain HDIG SO:0001217, UniRef:UniRef50_D4M059 contig_27 cds 147436 148875 - GCA009771115_01405 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25, PFAM:PF09180.16 contig_27 cds 148879 149712 - GCA009771115_01406 hypothetical protein contig_27 cds 149792 150481 - GCA009771115_01407 Stage 0 sporulation A-like protein SO:0001217, UniRef:UniRef50_D4MUY4 contig_27 cds 150453 151964 - GCA009771115_01408 histidine kinase SO:0001217, UniRef:UniRef50_A0A9D1JAE2 contig_27 cds 152027 153208 - GCA009771115_01409 S-adenosylmethionine synthase SO:0001217, UniRef:UniRef50_P9WGV1 contig_27 ncRNA-region 153270 153371 - SAM riboswitch aptamer (S box leader) RFAM:RF00162, SO:0000140 contig_27 cds 153503 154636 - GCA009771115_01410 hypothetical protein PFAM:PF13487.12 contig_27 cds 154680 155972 - GCA009771115_01411 UDP-N-acetylglucosamine 1-carboxyvinyltransferase SO:0001217, UniRef:UniRef50_A0A9D1AG40 contig_27 cds 156059 159598 - GCA009771115_01412 Transcription-repair-coupling factor SO:0001217, UniRef:UniRef50_A0A1H7JX48 contig_27 cds 159622 160194 - GCA009771115_01413 Peptidyl-tRNA hydrolase SO:0001217, UniRef:UniRef50_C4ZBV8 contig_27 cds 160341 160598 - GCA009771115_01414 Putative septation protein SpoVG SO:0001217, UniRef:UniRef50_A0A7U9X998 contig_27 cds 160895 162274 + GCA009771115_01415 UDP-N-acetylmuramate--L-alanine ligase SO:0001217, UniRef:UniRef50_A9KQI8 contig_27 cds 162487 163608 + GCA009771115_01416 hypothetical protein contig_27 cds 163608 164597 + GCA009771115_01417 hypothetical protein PFAM:PF00004.35, PFAM:PF00308.24, PFAM:PF01695.23 contig_27 cds 164634 165815 + GCA009771115_01418 ribose-phosphate diphosphokinase SO:0001217, UniRef:UniRef50_A0A1V4IQK0 contig_27 cds 165916 168315 - GCA009771115_01419 hypothetical protein contig_27 cds 168458 170698 + GCA009771115_01420 mdoB Phosphoglycerol transferase MdoB SO:0001217, UniRef:UniRef50_A0A1H2WZ97 contig_27 cds 170784 171908 - GCA009771115_01421 hypothetical protein contig_27 cds 172005 173447 - GCA009771115_01422 hypothetical protein PFAM:PF04203.18 contig_27 cds 173629 182493 - GCA009771115_01423 hypothetical protein contig_27 tRNA 182785 182858 - GCA009771115_01424 trnP tRNA-Pro(cgg) SO:0000268 contig_27 cds 183000 185021 - GCA009771115_01425 Penicillin-binding protein 1A SO:0001217, UniRef:UniRef50_A0A173VXR2 contig_27 cds 185039 186469 - GCA009771115_01426 hypothetical protein PFAM:PF01022.26, PFAM:PF01637.24, PFAM:PF13401.12 contig_27 tRNA 186767 186839 - GCA009771115_01427 trnF tRNA-Phe(gaa) SO:0000267 contig_27 tRNA 186848 186921 - GCA009771115_01428 trnfM tRNA-fMet(cat) SO:0000266 contig_27 tRNA 186999 187080 - GCA009771115_01429 trnY tRNA-Tyr(gta) SO:0000272