# Annotated with Bakta # Software: v1.11.4 # Database: v6.0, full # DOI: 10.1099/mgen.0.000685 # URL: github.com/oschwengers/bakta #Sequence Id Type Start Stop Strand Locus Tag Gene Product DbXrefs contig_1 cds 5 250 + GCA000529525_00001 hypothetical protein contig_1 cds 255 1580 - GCA000529525_00002 hypothetical protein PFAM:PF02415.23 contig_1 assembly_gap 1727 1995 . contig_1 cds 2038 2277 + GCA000529525_00003 hypothetical protein contig_1 gap 2045 2045 . contig_1 cds 3046 3153 + GCA000529525_00004 hypothetical protein contig_1 cds 4870 7998 - GCA000529525_00005 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF13229.12, PFAM:PF24346.1 contig_1 cds 9621 9770 - GCA000529525_00006 hypothetical protein contig_1 cds 9936 10445 + GCA000529525_00007 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12 contig_1 cds 11087 11776 - GCA000529525_00008 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12, PFAM:PF14582.11 contig_1 cds 11790 12314 - GCA000529525_00009 hypothetical protein PFAM:PF09869.16, PFAM:PF23100.1 contig_1 cds 12311 12577 - GCA000529525_00010 hypothetical protein contig_1 cds 12830 13069 - GCA000529525_00011 hypothetical protein contig_1 cds 13066 13725 - GCA000529525_00012 hypothetical protein PFAM:PF02754.22 contig_1 cds 13747 14304 - GCA000529525_00013 hypothetical protein PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13534.11 contig_1 cds 14301 14651 - GCA000529525_00014 hypothetical protein contig_1 cds 15004 15588 + GCA000529525_00015 hypothetical protein PFAM:PF01702.25 contig_1 cds 15743 16165 - GCA000529525_00016 hypothetical protein contig_1 cds 16169 17086 - GCA000529525_00017 hypothetical protein contig_1 cds 17686 18300 + GCA000529525_00018 hypothetical protein PFAM:PF01609.27, PFAM:PF13359.12 contig_1 cds 18831 19616 - GCA000529525_00019 hypothetical protein PFAM:PF00590.25 contig_1 cds 19653 20657 + GCA000529525_00020 hypothetical protein PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF13649.12, PFAM:PF13847.12, PFAM:PF18093.7, PFAM:PF25133.1 contig_1 cds 20654 21583 - GCA000529525_00021 Methylthioribose-1-phosphate isomerase SO:0001217, UniRef:UniRef50_Q746Y8 contig_1 cds 21598 22518 - GCA000529525_00022 Manganese-dependent inorganic pyrophosphatase SO:0001217, UniRef:UniRef50_P37487 contig_1 cds 23025 25724 - GCA000529525_00023 hypothetical protein PFAM:PF01841.26, PFAM:PF02369.22, PFAM:PF09373.15, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF22433.2, PFAM:PF24025.1 contig_1 cds 26153 26629 - GCA000529525_00024 hypothetical protein contig_1 cds 26715 27581 - GCA000529525_00025 nifB FeMo cofactor biosynthesis protein NifB SO:0001217, UniRef:UniRef50_A0A161X9Z0 contig_1 cds 27652 28212 - GCA000529525_00026 hypothetical protein contig_1 cds 28231 29466 - GCA000529525_00027 (pseudo) Methanogenesis marker 5 protein SO:0001217, UniRef:UniRef50_A0AA96V0M9, UniRef:UniRef90_A0A9D1XQU7 contig_1 cds 29468 29785 - GCA000529525_00028 hypothetical protein contig_1 cds 29959 30402 - GCA000529525_00029 hypothetical protein contig_1 cds 30380 31921 - GCA000529525_00030 hypothetical protein contig_1 cds 32053 32772 + GCA000529525_00031 hypothetical protein PFAM:PF00565.23 contig_1 cds 32785 33759 - GCA000529525_00032 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_1 cds 33777 34895 - GCA000529525_00033 hypothetical protein contig_1 cds 34892 35398 - GCA000529525_00034 hypothetical protein PFAM:PF17146.10 contig_1 cds 35560 36351 + GCA000529525_00035 hypothetical protein PFAM:PF01022.26 contig_1 cds 36351 37001 + GCA000529525_00036 hypothetical protein contig_1 cds 37150 37458 + GCA000529525_00037 hypothetical protein PFAM:PF01022.26 contig_1 cds 37458 37964 + GCA000529525_00038 Molybdenum cofactor biosynthesis protein B SO:0001217, UniRef:UniRef50_O34457 contig_1 cds 37999 38190 - GCA000529525_00039 orotate phosphoribosyltransferase SO:0001217, UniRef:UniRef50_UPI00271B1B9E contig_1 cds 38169 38525 - GCA000529525_00040 hypothetical protein contig_1 cds 38531 38764 - GCA000529525_00041 hypothetical protein PFAM:PF05239.21 contig_1 cds 39152 39352 + GCA000529525_00042 hypothetical protein contig_1 cds 40253 40471 + GCA000529525_00043 Exodeoxyribonuclease 7 small subunit SO:0001217, UniRef:UniRef50_R5M1Y4 contig_1 cds 40549 40995 - GCA000529525_00044 hypothetical protein contig_1 cds 41163 41486 - GCA000529525_00045 hypothetical protein contig_1 cds 41527 43140 - GCA000529525_00046 hypothetical protein contig_1 cds 43398 44018 + GCA000529525_00047 hypothetical protein contig_1 cds 44030 45166 - GCA000529525_00048 hypothetical protein contig_1 cds 45395 46444 - GCA000529525_00049 hypothetical protein PFAM:PF01118.30, PFAM:PF02774.23 contig_1 cds 46454 47275 - GCA000529525_00050 hypothetical protein PFAM:PF01113.26, PFAM:PF05173.19 contig_1 cds 47288 48181 - GCA000529525_00051 4-hydroxy-tetrahydrodipicolinate synthase SO:0001217, UniRef:UniRef50_Q1MPX7 contig_1 cds 48178 49398 - GCA000529525_00052 hypothetical protein PFAM:PF01842.31, PFAM:PF13840.12, PFAM:PF22468.2 contig_1 cds 49813 49914 - GCA000529525_00053 hypothetical protein contig_1 cds 49901 50242 - GCA000529525_00054 hypothetical protein PFAM:PF01817.26 contig_1 cds 50546 50803 + GCA000529525_00055 hypothetical protein contig_1 cds 50781 51428 - GCA000529525_00056 hypothetical protein PFAM:PF00288.32 contig_1 cds 51428 51760 - GCA000529525_00057 hypothetical protein PFAM:PF13692.12 contig_1 cds 51868 52494 - GCA000529525_00058 hypothetical protein PFAM:PF08323.17, PFAM:PF13439.12, PFAM:PF13477.12, PFAM:PF13579.12 contig_1 cds 52521 53120 - GCA000529525_00059 hypothetical protein contig_1 cds 53132 53593 - GCA000529525_00060 hypothetical protein contig_1 cds 53624 53884 - GCA000529525_00061 hypothetical protein PFAM:PF00085.26, PFAM:PF13192.12 contig_1 cds 53987 54841 + GCA000529525_00062 hypothetical protein PFAM:PF00270.35 contig_1 cds 54940 56055 + GCA000529525_00063 hypothetical protein PFAM:PF00633.29, PFAM:PF12826.13, PFAM:PF14520.12, PFAM:PF21280.2 contig_1 cds 56069 56365 - GCA000529525_00064 hypothetical protein contig_1 cds 56378 56659 - GCA000529525_00065 hypothetical protein PFAM:PF05239.21 contig_1 cds 56765 57883 + GCA000529525_00066 hypothetical protein PFAM:PF04055.27, PFAM:PF23613.1 contig_1 cds 57889 58440 + GCA000529525_00067 hypothetical protein contig_1 cds 58489 59220 + GCA000529525_00068 hypothetical protein PFAM:PF01791.15 contig_1 tRNA 59291 59363 - GCA000529525_00069 trnF tRNA-Phe(gaa) SO:0000267 contig_1 tRNA 59367 59438 - GCA000529525_00070 trnV tRNA-Val(gac) SO:0000273 contig_1 cds 59566 59766 - GCA000529525_00071 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23, PFAM:PF15630.12 contig_1 cds 59968 61248 - GCA000529525_00072 hypothetical protein PFAM:PF01938.26, PFAM:PF04055.27 contig_1 cds 61263 61880 - GCA000529525_00073 hypothetical protein contig_1 cds 61903 62088 - GCA000529525_00074 hypothetical protein contig_1 cds 62429 63976 - GCA000529525_00075 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11, PFAM:PF23545.1 contig_1 cds 64128 64691 + GCA000529525_00076 hypothetical protein contig_1 cds 64688 65599 - GCA000529525_00077 hypothetical protein contig_1 cds 65563 65706 - GCA000529525_00078 hypothetical protein contig_1 cds 65708 66796 - GCA000529525_00079 hypothetical protein contig_1 cds 66786 68102 - GCA000529525_00080 hypothetical protein contig_1 cds 68918 70111 - GCA000529525_00081 hypothetical protein PFAM:PF18912.6 contig_1 cds 70060 70665 - GCA000529525_00082 hypothetical protein PFAM:PF13240.11, PFAM:PF13248.11 contig_1 cds 71116 71979 - GCA000529525_00083 hypothetical protein PFAM:PF01416.25 contig_1 cds 72048 73880 - GCA000529525_00084 Cadmium-translocating P-type ATPase SO:0001217, UniRef:UniRef50_A0A7C0W7H4 contig_1 cds 73959 74321 + GCA000529525_00085 hypothetical protein contig_1 cds 74495 74881 - GCA000529525_00086 HTH arsR-type domain-containing protein SO:0001217, UniRef:UniRef50_R9JBG6 contig_1 cds 75086 75832 + GCA000529525_00087 hypothetical protein PFAM:PF00121.24, PFAM:PF01207.24, PFAM:PF01884.23, PFAM:PF05690.20 contig_1 cds 75829 76287 + GCA000529525_00088 hypothetical protein PFAM:PF01467.32 contig_1 cds 76289 77308 + GCA000529525_00089 N-acetyl-gamma-glutamyl-phosphate reductase SO:0001217, UniRef:UniRef50_A0LIV2 contig_1 cds 77321 77815 + GCA000529525_00090 hypothetical protein PFAM:PF00258.30, PFAM:PF03358.20, PFAM:PF12641.12, PFAM:PF12682.12, PFAM:PF12724.12 contig_1 cds 77822 78241 + GCA000529525_00091 hypothetical protein PFAM:PF01948.23 contig_1 cds 78306 79508 - GCA000529525_00092 hypothetical protein PFAM:PF00037.32, PFAM:PF00732.25, PFAM:PF05199.19, PFAM:PF07992.20, PFAM:PF13450.12 contig_1 cds 79630 81000 + GCA000529525_00093 hypothetical protein PFAM:PF01523.21, PFAM:PF19289.4, PFAM:PF19290.4 contig_1 cds 81000 81557 + GCA000529525_00094 hypothetical protein contig_1 cds 81566 82342 + GCA000529525_00095 hypothetical protein PFAM:PF02421.24, PFAM:PF17835.6 contig_1 cds 82417 82584 + GCA000529525_00096 hypothetical protein contig_1 cds 82655 83215 + GCA000529525_00097 hypothetical protein PFAM:PF00011.27 contig_1 cds 83335 84345 - GCA000529525_00098 hypothetical protein PFAM:PF01380.27 contig_1 cds 84606 86321 - GCA000529525_00099 Adenine deaminase SO:0001217, UniRef:UniRef50_Q2S006 contig_1 cds 86323 87558 - GCA000529525_00100 hypothetical protein PFAM:PF21570.3, PFAM:PF21571.2 contig_1 cds 87724 87966 - GCA000529525_00101 hypothetical protein contig_1 cds 87972 88529 - GCA000529525_00102 hypothetical protein contig_1 cds 88645 89517 - GCA000529525_00103 hypothetical protein PFAM:PF00491.26 contig_1 cds 89551 89940 - GCA000529525_00104 Translation initiation factor 5A SO:0001217, UniRef:UniRef50_A0A9E5XWC2 contig_1 cds 90044 90397 - GCA000529525_00105 hypothetical protein contig_1 cds 90513 90974 + GCA000529525_00106 hypothetical protein contig_1 cds 90977 91972 + GCA000529525_00107 hypothetical protein contig_1 cds 92147 92824 + GCA000529525_00108 hypothetical protein PFAM:PF01513.26, PFAM:PF20143.4 contig_1 cds 92805 93989 + GCA000529525_00109 hypothetical protein PFAM:PF08245.18 contig_1 cds 94332 95201 + GCA000529525_00110 hypothetical protein PFAM:PF01379.25, PFAM:PF03900.20 contig_1 cds 95214 95393 + GCA000529525_00111 hypothetical protein PFAM:PF01408.29 contig_1 cds 95456 96166 + GCA000529525_00112 hypothetical protein PFAM:PF01408.29, PFAM:PF02894.22, PFAM:PF22725.1 contig_1 cds 96180 96341 + GCA000529525_00113 hypothetical protein contig_1 cds 96404 96793 + GCA000529525_00114 hypothetical protein PFAM:PF00156.33 contig_1 cds 96838 97212 - GCA000529525_00115 hypothetical protein contig_1 cds 97500 97616 + GCA000529525_00116 hypothetical protein contig_1 cds 97661 97954 + GCA000529525_00117 hypothetical protein contig_1 cds 98093 99973 + GCA000529525_00118 hypothetical protein PFAM:PF01061.29 contig_1 cds 100022 100312 - GCA000529525_00119 hypothetical protein contig_1 cds 100394 100579 - GCA000529525_00120 hypothetical protein contig_1 cds 100642 101013 - GCA000529525_00121 hypothetical protein contig_1 cds 100992 101135 - GCA000529525_00122 hypothetical protein contig_1 cds 101129 101269 - GCA000529525_00123 hypothetical protein contig_1 cds 101365 102912 - GCA000529525_00124 hypothetical protein SO:0001217, UniRef:UniRef50_M5DZB3 contig_1 cds 103553 104530 - GCA000529525_00125 tRNA-dihydrouridine synthase SO:0001217, UniRef:UniRef50_A9NE09 contig_1 cds 104737 105288 - GCA000529525_00126 hypothetical protein contig_1 cds 105273 105701 - GCA000529525_00127 hypothetical protein contig_1 cds 106162 107496 - GCA000529525_00128 Glutamate dehydrogenase SO:0001217, UniRef:UniRef50_Q5QVZ2 contig_1 cds 107882 108088 + GCA000529525_00129 hypothetical protein contig_1 cds 108093 108200 - GCA000529525_00130 hypothetical protein PFAM:PF03465.20 contig_1 cds 108416 109336 - GCA000529525_00131 hypothetical protein PFAM:PF03463.20, PFAM:PF03464.20 contig_1 cds 109416 110387 - GCA000529525_00132 hypothetical protein contig_1 cds 110492 111058 + GCA000529525_00133 hypothetical protein PFAM:PF13240.11, PFAM:PF24463.1 contig_1 cds 111045 111482 - GCA000529525_00134 hypothetical protein PFAM:PF13302.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_1 cds 111598 111987 + GCA000529525_00135 hypothetical protein PFAM:PF03686.19 contig_1 cds 111994 114414 + GCA000529525_00136 hypothetical protein PFAM:PF00690.31, PFAM:PF00702.32, PFAM:PF08282.18 contig_1 cds 114414 115172 + GCA000529525_00137 hypothetical protein contig_1 tRNA 115226 115308 - GCA000529525_00138 trnS tRNA-Ser(tga) SO:0000269 contig_1 cds 115345 115653 - GCA000529525_00139 hypothetical protein PFAM:PF00338.27 contig_1 cds 115718 116389 - GCA000529525_00140 hypothetical protein PFAM:PF03143.23, PFAM:PF03144.31, PFAM:PF22594.2 contig_1 cds 116368 116958 - GCA000529525_00141 hypothetical protein PFAM:PF00009.33 contig_1 cds 117105 119282 - GCA000529525_00142 hypothetical protein PFAM:PF00009.33, PFAM:PF00679.30, PFAM:PF03144.31, PFAM:PF03764.24, PFAM:PF14492.12, PFAM:PF22042.2 contig_1 cds 119646 119894 - GCA000529525_00143 hypothetical protein contig_1 cds 119897 120322 - GCA000529525_00144 hypothetical protein PFAM:PF00164.32 contig_1 cds 120857 121288 - GCA000529525_00145 hypothetical protein PFAM:PF07650.23, PFAM:PF13184.12 contig_1 cds 121295 121591 - GCA000529525_00146 hypothetical protein PFAM:PF01248.31 contig_1 cds 121603 122757 - GCA000529525_00147 hypothetical protein PFAM:PF04998.22 contig_1 cds 122766 125489 - GCA000529525_00148 hypothetical protein PFAM:PF00623.25, PFAM:PF04983.23, PFAM:PF04997.17, PFAM:PF04998.22, PFAM:PF05000.22 contig_1 cds 125514 127475 - GCA000529525_00149 DNA-directed RNA polymerase subunit beta SO:0001217, UniRef:UniRef50_A0A2E7N7N6 contig_1 cds 127499 129043 - GCA000529525_00150 hypothetical protein PFAM:PF04561.19, PFAM:PF04565.21 contig_1 cds 129293 129529 - GCA000529525_00151 hypothetical protein PFAM:PF01191.24 contig_1 tRNA 129574 129647 - GCA000529525_00152 trnK tRNA-Lys(ttt) SO:0000265 contig_1 tRNA 129671 129742 - GCA000529525_00153 trnD tRNA-Asp(gtc) SO:0000256 contig_1 tRNA 129886 129959 - GCA000529525_00154 trnY tRNA-Tyr(gta) SO:0000272 contig_1 tRNA 129966 130040 - GCA000529525_00155 trnP tRNA-Pro(tgg) SO:0000268 contig_1 tRNA 130156 130229 - GCA000529525_00156 trnT tRNA-Thr(tgt) SO:0000270 contig_1 cds 130346 131209 + GCA000529525_00157 hypothetical protein PFAM:PF02110.20 contig_1 cds 131472 131648 + GCA000529525_00158 hypothetical protein PFAM:PF02581.23 contig_1 cds 131681 131827 + GCA000529525_00159 hypothetical protein contig_1 cds 131906 132154 - GCA000529525_00160 VOC domain-containing protein SO:0001217, UniRef:UniRef50_H6LHE1 contig_1 cds 132160 133377 - GCA000529525_00161 hypothetical protein PFAM:PF00162.24 contig_1 cds 133426 134094 - GCA000529525_00162 hypothetical protein PFAM:PF00121.24 contig_1 cds 134197 135111 + GCA000529525_00163 hypothetical protein PFAM:PF04055.27 contig_1 cds 135120 135785 - GCA000529525_00164 2-amino-4-deoxychorismate dehydrogenase SO:0001217, UniRef:UniRef50_A0A162RUT0 contig_1 cds 135798 136904 - GCA000529525_00165 hypothetical protein PFAM:PF00549.24, PFAM:PF01071.24, PFAM:PF02786.22, PFAM:PF08442.15, PFAM:PF13549.11 contig_1 cds 136914 137459 - GCA000529525_00166 porC Pyruvate synthase subunit PorC SO:0001217, UniRef:UniRef50_A0A1V4IC63 contig_1 cds 137528 138334 - GCA000529525_00167 2-oxoglutarate ferredoxin oxidoreductase subunit beta SO:0001217, UniRef:UniRef50_A0A841L2V2 contig_1 cds 138335 139303 - GCA000529525_00168 hypothetical protein PFAM:PF02780.25, PFAM:PF17147.9 contig_1 cds 139470 139733 - GCA000529525_00169 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11 contig_1 cds 140018 140338 + GCA000529525_00170 hypothetical protein contig_1 cds 140348 140599 - GCA000529525_00171 hypothetical protein PFAM:PF18046.7 contig_1 cds 140596 140772 - GCA000529525_00172 hypothetical protein PFAM:PF22199.2 contig_1 cds 140769 141080 - GCA000529525_00173 hypothetical protein PFAM:PF00254.34 contig_1 cds 141163 141951 + GCA000529525_00174 hypothetical protein contig_1 cds 141963 142289 + GCA000529525_00175 DUF763 domain-containing protein SO:0001217, UniRef:UniRef50_A0A0F9IZR7 contig_1 cds 142321 142860 - GCA000529525_00176 hypothetical protein contig_1 cds 142882 143664 - GCA000529525_00177 hypothetical protein contig_1 cds 143667 144704 - GCA000529525_00178 hypothetical protein contig_1 cds 144858 145112 + GCA000529525_00179 hypothetical protein contig_1 cds 145630 146025 + GCA000529525_00180 hypothetical protein contig_1 cds 146022 146696 + GCA000529525_00181 hypothetical protein PFAM:PF00733.27, PFAM:PF06508.19 contig_1 cds 146917 147243 - GCA000529525_00182 hypothetical protein contig_1 cds 147222 147881 - GCA000529525_00183 hypothetical protein contig_1 cds 148198 148305 - GCA000529525_00184 hypothetical protein contig_1 cds 148600 149592 - GCA000529525_00185 hypothetical protein PFAM:PF00724.26, PFAM:PF01207.24 contig_1 cds 149716 151428 - GCA000529525_00186 hypothetical protein PFAM:PF00364.28, PFAM:PF00682.25, PFAM:PF02436.23, PFAM:PF13533.12 contig_1 cds 151552 152646 - GCA000529525_00187 Inositol-3-phosphate synthase SO:0001217, UniRef:UniRef50_Q8NLE6 contig_1 cds 152751 153158 + GCA000529525_00188 hypothetical protein contig_1 cds 153418 154260 + GCA000529525_00189 hypothetical protein contig_1 cds 154271 155794 + GCA000529525_00190 hypothetical protein contig_1 cds 156318 157850 + GCA000529525_00191 hypothetical protein contig_1 cds 157943 158995 - GCA000529525_00192 hypothetical protein PFAM:PF03102.20, PFAM:PF08666.17 contig_1 cds 159005 160678 - GCA000529525_00193 UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase SO:0001217, UniRef:UniRef50_A0A846JB83 contig_1 cds 160768 161814 + GCA000529525_00194 hypothetical protein contig_1 cds 161825 162526 + GCA000529525_00195 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_1 cds 162538 163842 + GCA000529525_00196 hypothetical protein PFAM:PF01523.21, PFAM:PF19289.4, PFAM:PF19290.4 contig_1 cds 164053 164169 + GCA000529525_00197 hypothetical protein contig_1 cds 165021 165410 - GCA000529525_00198 hypothetical protein PFAM:PF01638.23 contig_1 cds 165581 165871 + GCA000529525_00199 ABM domain-containing protein SO:0001217, UniRef:UniRef50_F3LE00 contig_1 cds 165884 166495 - GCA000529525_00200 metN Methionine import ATP-binding protein MetN 2 SO:0001217, UniRef:UniRef50_A0A1C5Z9F9 contig_1 cds 166485 167432 - GCA000529525_00201 nikD Nickel import system ATP-binding protein NikD SO:0001217, UniRef:UniRef50_A0A1M7T254 contig_1 cds 167441 168304 - GCA000529525_00202 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_Q24XL6 contig_1 cds 168301 169281 - GCA000529525_00203 hypothetical protein contig_1 cds 169359 170990 - GCA000529525_00204 hypothetical protein PFAM:PF00496.27 contig_1 cds 172513 173898 - GCA000529525_00205 hypothetical protein PFAM:PF02415.23 contig_1 cds 174983 175231 - GCA000529525_00206 hypothetical protein contig_1 cds 175241 175702 - GCA000529525_00207 hypothetical protein PFAM:PF06445.20 contig_1 cds 175751 176974 - GCA000529525_00208 hypothetical protein PFAM:PF00994.29, PFAM:PF03454.20 contig_1 cds 177093 177398 + GCA000529525_00209 hypothetical protein PFAM:PF01176.25 contig_1 cds 177547 178203 + GCA000529525_00210 hypothetical protein PFAM:PF01163.29 contig_1 cds 178253 178870 + GCA000529525_00211 hypothetical protein PFAM:PF00013.35, PFAM:PF21800.4, PFAM:PF22891.2 contig_1 cds 179179 179664 + GCA000529525_00212 hypothetical protein PFAM:PF02518.31, PFAM:PF13589.12 contig_1 cds 179664 180854 + GCA000529525_00213 hypothetical protein PFAM:PF09239.17 contig_1 cds 180859 181956 + GCA000529525_00214 hypothetical protein PFAM:PF04406.19, PFAM:PF20768.2, PFAM:PF21180.3 contig_1 cds 182070 182330 + GCA000529525_00215 Metal-sensitive transcriptional repressor SO:0001217, UniRef:UniRef50_S3CFU3 contig_1 cds 182454 182807 + GCA000529525_00216 hypothetical protein contig_1 cds 182810 183595 + GCA000529525_00217 hypothetical protein PFAM:PF00702.32 contig_1 cds 183592 184227 + GCA000529525_00218 HAD-IC family P-type ATPase SO:0001217, UniRef:UniRef50_UPI0026AB1CCF contig_1 cds 184301 184513 + GCA000529525_00219 copZ Copper chaperone CopZ SO:0001217, UniRef:UniRef50_C8WVM7 contig_1 cds 184634 185650 + GCA000529525_00220 hypothetical protein PFAM:PF01113.26, PFAM:PF02800.25 contig_1 cds 185678 185944 + GCA000529525_00221 hypothetical protein contig_1 cds 185899 186078 + GCA000529525_00222 hypothetical protein contig_1 cds 186300 186512 + GCA000529525_00223 hypothetical protein contig_1 cds 186598 187506 + GCA000529525_00224 hypothetical protein PFAM:PF00004.35, PFAM:PF05496.18, PFAM:PF06068.19, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF13401.12, PFAM:PF23900.1 contig_1 cds 187805 188623 + GCA000529525_00225 hypothetical protein contig_1 cds 188776 189828 - GCA000529525_00226 hypothetical protein PFAM:PF00745.25, PFAM:PF05201.20, PFAM:PF13241.12 contig_1 cds 189898 190452 - GCA000529525_00227 hypothetical protein PFAM:PF13241.12 contig_1 cds 190454 190936 - GCA000529525_00228 hypothetical protein contig_1 cds 191194 191553 + GCA000529525_00229 hypothetical protein contig_1 cds 191607 191759 + GCA000529525_00230 hypothetical protein contig_1 cds 191826 193430 - GCA000529525_00231 hypothetical protein PFAM:PF00005.33, PFAM:PF03193.22 contig_1 cds 193490 194197 - GCA000529525_00232 hypothetical protein PFAM:PF01207.24 contig_1 cds 194230 194415 - GCA000529525_00233 hypothetical protein contig_1 cds 194364 194993 - GCA000529525_00234 hypothetical protein contig_1 cds 195010 195915 - GCA000529525_00235 hypothetical protein contig_1 cds 195924 196688 - GCA000529525_00236 hypothetical protein contig_1 cds 196715 197341 - GCA000529525_00237 hypothetical protein PFAM:PF07826.16 contig_1 cds 197358 197768 - GCA000529525_00238 hypothetical protein contig_1 cds 197777 198145 - GCA000529525_00239 hypothetical protein contig_1 cds 198217 198615 - GCA000529525_00240 hypothetical protein contig_1 cds 198764 199132 - GCA000529525_00241 hypothetical protein contig_1 cds 199081 199290 - GCA000529525_00242 hypothetical protein contig_1 cds 199348 200112 - GCA000529525_00243 hypothetical protein PFAM:PF14450.12 contig_1 cds 200154 200420 - GCA000529525_00244 hypothetical protein contig_1 cds 200423 201061 - GCA000529525_00245 hypothetical protein contig_1 cds 201450 202145 + GCA000529525_00246 hypothetical protein contig_1 cds 202189 203088 + GCA000529525_00247 hypothetical protein contig_1 cds 203106 203339 + GCA000529525_00248 hypothetical protein contig_1 cds 203380 204102 + GCA000529525_00249 hypothetical protein PFAM:PF04203.18 contig_1 cds 204103 204474 + GCA000529525_00250 hypothetical protein contig_1 cds 204471 205628 - GCA000529525_00251 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25, PFAM:PF00282.25, PFAM:PF01041.23 contig_1 cds 205682 207955 - GCA000529525_00252 hypothetical protein PFAM:PF00391.29, PFAM:PF02896.24 contig_1 cds 208628 208786 + GCA000529525_00253 hypothetical protein contig_1 cds 208995 211571 - GCA000529525_00254 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_1 cds 211638 212204 - GCA000529525_00255 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_A0A953IA79 contig_1 cds 212279 213136 - GCA000529525_00256 hypothetical protein contig_1 cds 213147 213947 - GCA000529525_00257 hypothetical protein PFAM:PF01061.29 contig_1 cds 214326 215276 + GCA000529525_00258 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_1 cds 215321 216919 + GCA000529525_00259 hypothetical protein contig_1 cds 216916 217911 + GCA000529525_00260 hypothetical protein PFAM:PF05050.19 contig_1 cds 217914 218720 + GCA000529525_00261 hypothetical protein PFAM:PF00132.30 contig_1 cds 218730 219728 + GCA000529525_00262 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_1 cds 219725 220126 + GCA000529525_00263 hypothetical protein contig_1 cds 220306 220803 + GCA000529525_00264 hypothetical protein contig_1 cds 220837 221415 + GCA000529525_00265 ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG SO:0001217, UniRef:UniRef50_UPI0024AE16CD contig_1 cds 221429 222037 + GCA000529525_00266 Methyltransferase type 11 domain-containing protein SO:0001217, UniRef:UniRef50_W4LQH0 contig_1 cds 222999 223130 - GCA000529525_00267 hypothetical protein contig_1 cds 223085 223477 - GCA000529525_00268 hypothetical protein contig_1 cds 223552 224160 - GCA000529525_00269 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_1 cds 224241 224486 - GCA000529525_00270 hypothetical protein contig_1 cds 224854 225354 - GCA000529525_00271 hypothetical protein contig_1 cds 226565 226768 + GCA000529525_00272 hypothetical protein PFAM:PF02737.24, PFAM:PF03721.20 contig_1 cds 226801 227820 + GCA000529525_00273 hypothetical protein PFAM:PF00984.24, PFAM:PF03720.21, PFAM:PF03721.20 contig_1 cds 227904 228662 + GCA000529525_00274 hypothetical protein PFAM:PF00535.33 contig_1 cds 228628 228960 + GCA000529525_00275 hypothetical protein contig_1 cds 229661 231820 - GCA000529525_00276 hypothetical protein contig_1 cds 232461 233210 - GCA000529525_00277 hypothetical protein contig_1 cds 233769 234251 - GCA000529525_00278 hypothetical protein PFAM:PF00252.24 contig_1 cds 234425 234673 + GCA000529525_00279 hypothetical protein contig_1 cds 234824 235333 + GCA000529525_00280 hypothetical protein contig_1 cds 235339 235740 + GCA000529525_00281 hypothetical protein contig_1 cds 235665 236813 - GCA000529525_00282 hypothetical protein PFAM:PF01467.32, PFAM:PF16581.11 contig_1 cds 236893 237447 + GCA000529525_00283 hypothetical protein contig_1 cds 237461 237778 + GCA000529525_00284 hypothetical protein PFAM:PF01979.26 contig_1 cds 237838 238074 + GCA000529525_00285 hypothetical protein contig_1 cds 238427 238714 + GCA000529525_00286 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_1 cds 238753 239991 - GCA000529525_00287 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_1 cds 240009 241433 - GCA000529525_00288 hypothetical protein contig_1 cds 241435 242361 - GCA000529525_00289 hypothetical protein PFAM:PF01058.29 contig_1 cds 242376 242801 - GCA000529525_00290 F420-non-reducing hydrogenase iron-sulfur subunit SO:0001217, UniRef:UniRef50_A0A916HS97 contig_1 cds 243128 244387 - GCA000529525_00291 SUF system FeS cluster assembly SufBD core domain-containing protein SO:0001217, UniRef:UniRef50_A0A1F8MQ93 contig_1 cds 244344 245102 - GCA000529525_00292 sufC Iron-sulfur cluster assembly ATPase protein SufC SO:0001217, UniRef:UniRef50_A0A0F7GD74 contig_1 cds 245217 245531 - GCA000529525_00293 hypothetical protein PFAM:PF05239.21 contig_1 cds 245518 246144 - GCA000529525_00294 hypothetical protein PFAM:PF12804.13 contig_1 cds 246165 247634 - GCA000529525_00295 hypothetical protein PFAM:PF09887.15 contig_1 cds 247747 248685 - GCA000529525_00296 hypothetical protein contig_1 cds 248699 248941 - GCA000529525_00297 hypothetical protein contig_1 cds 248953 249159 - GCA000529525_00298 hypothetical protein contig_1 cds 249172 249888 - GCA000529525_00299 hypothetical protein contig_1 cds 249889 250218 - GCA000529525_00300 hypothetical protein contig_1 cds 250235 251047 - GCA000529525_00301 hypothetical protein contig_1 cds 251048 251749 - GCA000529525_00302 hypothetical protein contig_1 cds 251762 252637 - GCA000529525_00303 hypothetical protein contig_1 cds 252866 254359 - GCA000529525_00304 hypothetical protein PFAM:PF02249.22, PFAM:PF02745.20 contig_1 cds 254380 254532 - GCA000529525_00305 hypothetical protein PFAM:PF02745.20 contig_1 cds 254526 255284 - GCA000529525_00306 hypothetical protein PFAM:PF02240.21 contig_1 cds 255287 255886 - GCA000529525_00307 hypothetical protein contig_1 cds 255888 256343 - GCA000529525_00308 hypothetical protein contig_1 cds 256383 257711 - GCA000529525_00309 hypothetical protein PFAM:PF02241.23, PFAM:PF02783.20 contig_1 cds 258196 259119 + GCA000529525_00310 hypothetical protein PFAM:PF04055.27, PFAM:PF19238.5 contig_1 cds 259221 259439 + GCA000529525_00311 hypothetical protein contig_1 cds 259449 260366 - GCA000529525_00312 hypothetical protein contig_1 cds 260419 260940 - GCA000529525_00313 hypothetical protein contig_1 cds 260979 261668 + GCA000529525_00314 hypothetical protein contig_1 cds 261730 262899 + GCA000529525_00315 hypothetical protein contig_1 cds 262954 263166 + GCA000529525_00316 hypothetical protein PFAM:PF09082.15 contig_1 cds 263189 264511 + GCA000529525_00317 hypothetical protein PFAM:PF00571.33, PFAM:PF01595.25, PFAM:PF03471.22 contig_1 cds 264513 265457 + GCA000529525_00318 Sodium/calcium exchanger membrane region domain-containing protein SO:0001217, UniRef:UniRef50_V9H470 contig_1 cds 265425 266291 - GCA000529525_00319 hypothetical protein contig_1 cds 266344 266649 + GCA000529525_00320 hypothetical protein PFAM:PF01910.22 contig_1 cds 266682 268406 - GCA000529525_00321 hypothetical protein PFAM:PF00005.33 contig_1 cds 268406 268753 - GCA000529525_00322 ABC transporter SO:0001217, UniRef:UniRef50_A0A1I1ZQQ6 contig_1 cds 269083 270135 - GCA000529525_00323 hypothetical protein contig_1 cds 270128 270556 - GCA000529525_00324 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_1 cds 270714 271769 - GCA000529525_00325 hypothetical protein PFAM:PF00005.33, PFAM:PF01078.27, PFAM:PF13304.12, PFAM:PF13555.12 contig_1 cds 271769 272407 - GCA000529525_00326 hypothetical protein contig_1 cds 272572 273111 - GCA000529525_00327 hypothetical protein contig_1 cds 273501 273638 - GCA000529525_00328 hypothetical protein contig_1 cds 273647 274045 - GCA000529525_00329 hypothetical protein contig_1 cds 274380 274547 + GCA000529525_00330 hypothetical protein contig_1 cds 275243 276250 + GCA000529525_00331 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11, PFAM:PF13353.11 contig_1 cds 276225 277166 + GCA000529525_00332 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11, PFAM:PF13353.11 contig_1 cds 277251 278369 - GCA000529525_00333 degT Aminotransferase DegT SO:0001217, UniRef:UniRef50_A0A7W7SEN9 contig_1 cds 278468 279628 + GCA000529525_00334 hypothetical protein contig_1 cds 279928 280404 + GCA000529525_00335 hypothetical protein PFAM:PF01037.27, PFAM:PF13404.12, PFAM:PF13412.12 contig_1 cds 280583 280735 + GCA000529525_00336 hypothetical protein contig_1 cds 280765 281520 + GCA000529525_00337 hypothetical protein contig_1 cds 281525 281965 + GCA000529525_00338 hypothetical protein contig_1 cds 281962 283062 + GCA000529525_00339 hypothetical protein PFAM:PF04055.27 contig_1 cds 283040 283777 - GCA000529525_00340 hypothetical protein PFAM:PF02475.23, PFAM:PF25133.1 contig_1 cds 283962 284576 + GCA000529525_00341 hypothetical protein PFAM:PF00227.31 contig_1 cds 284707 286620 + GCA000529525_00342 hypothetical protein PFAM:PF00753.33, PFAM:PF07521.17, PFAM:PF07650.23, PFAM:PF10996.14, PFAM:PF12706.13, PFAM:PF16661.11, PFAM:PF17214.9 contig_1 cds 286724 287743 + GCA000529525_00343 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_1 cds 287763 288791 + GCA000529525_00344 hypothetical protein contig_1 cds 289082 291349 + GCA000529525_00345 hypothetical protein PFAM:PF16640.11, PFAM:PF24025.1 contig_1 cds 291361 293160 - GCA000529525_00346 hypothetical protein PFAM:PF13482.12 contig_1 cds 293162 294181 - GCA000529525_00347 hypothetical protein contig_1 cds 294197 294997 - GCA000529525_00348 hypothetical protein PFAM:PF00175.26, PFAM:PF10418.14 contig_1 cds 295000 295911 - GCA000529525_00349 hypothetical protein PFAM:PF01180.27, PFAM:PF01207.24 contig_1 cds 295948 296493 - GCA000529525_00350 hypothetical protein contig_1 cds 296587 296739 + GCA000529525_00351 hypothetical protein contig_1 cds 297014 297742 + GCA000529525_00352 hypothetical protein contig_1 cds 297739 298380 + GCA000529525_00353 hypothetical protein PFAM:PF01269.23 contig_1 cds 298996 299652 - GCA000529525_00354 hypothetical protein PFAM:PF04127.22 contig_1 cds 299645 300154 - GCA000529525_00355 hypothetical protein PFAM:PF02441.25 contig_1 cds 300180 300728 - GCA000529525_00356 hypothetical protein contig_1 cds 300745 301110 - GCA000529525_00357 hypothetical protein contig_1 cds 301125 301454 - GCA000529525_00358 hypothetical protein contig_1 cds 301516 301971 - GCA000529525_00359 hypothetical protein PFAM:PF01842.31 contig_1 cds 302373 303173 - GCA000529525_00360 hypothetical protein PFAM:PF00571.33 contig_1 cds 303197 304138 - GCA000529525_00361 hypothetical protein PFAM:PF00571.33 contig_1 cds 304201 304899 - GCA000529525_00362 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11 contig_1 cds 304899 305414 - GCA000529525_00363 hypothetical protein PFAM:PF01242.24 contig_1 cds 305411 306004 - GCA000529525_00364 hypothetical protein contig_1 cds 306100 308658 - GCA000529525_00365 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7 contig_1 cds 308622 310892 - GCA000529525_00366 hypothetical protein PFAM:PF00112.29, PFAM:PF18560.7 contig_1 assembly_gap 312350 313905 . contig_1 cds 315419 315679 - GCA000529525_00367 hypothetical protein contig_1 cds 315680 315886 - GCA000529525_00368 hypothetical protein contig_1 cds 316766 317839 + GCA000529525_00369 hypothetical protein contig_1 cds 317985 318770 + GCA000529525_00370 hypothetical protein contig_1 cds 318771 318923 - GCA000529525_00371 hypothetical protein PFAM:PF18462.6 contig_1 cds 318941 319429 - GCA000529525_00372 hypothetical protein PFAM:PF13291.12, PFAM:PF18462.6, PFAM:PF22629.2 contig_1 cds 319416 319673 - GCA000529525_00373 hypothetical protein contig_1 cds 319696 320694 - GCA000529525_00374 hypothetical protein contig_1 cds 320699 321826 - GCA000529525_00375 hypothetical protein contig_1 cds 321839 322285 - GCA000529525_00376 hypothetical protein PFAM:PF01058.29 contig_1 cds 322286 322777 - GCA000529525_00377 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF14697.11 contig_1 cds 322778 324187 - GCA000529525_00378 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13370.11, PFAM:PF13459.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_1 cds 324200 324448 - GCA000529525_00379 hypothetical protein contig_1 cds 324458 324931 - GCA000529525_00380 hypothetical protein contig_1 cds 324928 325209 - GCA000529525_00381 hypothetical protein contig_1 cds 325202 325537 - GCA000529525_00382 hypothetical protein contig_1 cds 325534 326988 - GCA000529525_00383 hypothetical protein PFAM:PF00361.26 contig_1 cds 326981 327367 - GCA000529525_00384 hypothetical protein contig_1 cds 327367 327600 - GCA000529525_00385 hypothetical protein PFAM:PF13244.11 contig_1 cds 327602 328030 - GCA000529525_00386 hypothetical protein contig_1 cds 328030 328290 - GCA000529525_00387 hypothetical protein contig_1 cds 328346 328660 - GCA000529525_00388 hypothetical protein contig_1 cds 328832 329803 + GCA000529525_00389 Arsenic resistance protein SO:0001217, UniRef:UniRef50_A0A0B5AP30 contig_1 cds 330083 330496 - GCA000529525_00390 hypothetical protein PFAM:PF04307.19 contig_1 cds 330625 331365 - GCA000529525_00391 hypothetical protein PFAM:PF24827.1 contig_1 cds 331425 331928 + GCA000529525_00392 hypothetical protein contig_1 cds 332343 332759 + GCA000529525_00393 hypothetical protein PFAM:PF13086.12 contig_1 cds 332774 333340 + GCA000529525_00394 hypothetical protein PFAM:PF13087.12 contig_1 cds 334156 335331 + GCA000529525_00395 hypothetical protein PFAM:PF00733.27, PFAM:PF00764.25, PFAM:PF20979.2 contig_1 cds 335346 335852 - GCA000529525_00396 hypothetical protein PFAM:PF03749.19 contig_1 cds 336030 336236 - GCA000529525_00397 hypothetical protein PFAM:PF01256.23 contig_1 cds 336518 337564 - GCA000529525_00398 hypothetical protein PFAM:PF01256.23, PFAM:PF03853.21 contig_1 cds 338069 338959 - GCA000529525_00399 hypothetical protein PFAM:PF01913.23, PFAM:PF02741.20 contig_1 cds 339045 340103 - GCA000529525_00400 Phosphatidylglycerol lysyltransferase SO:0001217, UniRef:UniRef50_A0A3B9Z9H3 contig_1 cds 340176 340610 + GCA000529525_00401 hypothetical protein contig_1 cds 340637 341608 + GCA000529525_00402 hypothetical protein contig_1 cds 341664 342314 + GCA000529525_00403 hypothetical protein PFAM:PF02080.26, PFAM:PF02254.24, PFAM:PF13241.12 contig_1 cds 342371 343621 - GCA000529525_00404 hypothetical protein contig_1 cds 343624 343923 - GCA000529525_00405 hypothetical protein contig_1 cds 344368 344883 - GCA000529525_00406 hypothetical protein PFAM:PF13565.12, PFAM:PF13592.12 contig_1 cds 344969 345583 - GCA000529525_00407 hypothetical protein PFAM:PF00753.33 contig_1 cds 345833 346240 - GCA000529525_00408 hypothetical protein contig_1 tRNA 346283 346358 - GCA000529525_00409 trnH tRNA-His(gtg) SO:0000262 contig_1 tRNA 346397 346479 - GCA000529525_00410 trnL tRNA-Leu(tag) SO:0000264 contig_1 tRNA 346534 346608 - GCA000529525_00411 trnE tRNA-Glu(ttc) SO:0000259 contig_1 tRNA 346638 346711 - GCA000529525_00412 trnI tRNA-Ile2(cat) SO:0000263 contig_1 tRNA 346717 346789 - GCA000529525_00413 trnN tRNA-Asn(gtt) SO:0000257 contig_1 cds 346983 347972 + GCA000529525_00414 hypothetical protein PFAM:PF04055.27 contig_1 cds 348007 348978 + GCA000529525_00415 hypothetical protein PFAM:PF02558.23, PFAM:PF02737.24, PFAM:PF03446.21, PFAM:PF07479.19, PFAM:PF20618.3 contig_1 cds 348988 349242 + GCA000529525_00416 hypothetical protein PFAM:PF12804.13 contig_1 cds 349239 349754 + GCA000529525_00417 hypothetical protein contig_1 cds 349899 351251 + GCA000529525_00418 hypothetical protein PFAM:PF02637.23, PFAM:PF02934.20 contig_1 cds 351256 352071 + GCA000529525_00419 hypothetical protein PFAM:PF00571.33 contig_1 cds 352072 352362 + GCA000529525_00420 hypothetical protein contig_1 cds 352337 353203 + GCA000529525_00421 hypothetical protein PFAM:PF01061.29 contig_1 cds 353213 354043 + GCA000529525_00422 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_G1WG96 contig_1 cds 354046 354555 + GCA000529525_00423 hypothetical protein contig_1 cds 354567 355124 - GCA000529525_00424 hypothetical protein PFAM:PF13302.13, PFAM:PF13508.13, PFAM:PF13673.13 contig_1 cds 355126 355377 - GCA000529525_00425 hypothetical protein PFAM:PF00731.26 contig_1 cds 355509 355886 - GCA000529525_00426 hypothetical protein contig_1 cds 355970 357901 + GCA000529525_00427 hypothetical protein PFAM:PF00708.24, PFAM:PF07503.17, PFAM:PF17788.7, PFAM:PF22521.2 contig_1 cds 357898 358098 + GCA000529525_00428 hypothetical protein contig_1 cds 358197 358895 - GCA000529525_00429 hypothetical protein PFAM:PF01022.26 contig_1 cds 359009 359209 + GCA000529525_00430 hypothetical protein contig_1 cds 359206 359559 + GCA000529525_00431 hypothetical protein contig_1 cds 359766 361469 + GCA000529525_00432 hypothetical protein contig_1 cds 361597 362742 + GCA000529525_00433 dnaJ Chaperone protein DnaJ SO:0001217, UniRef:UniRef50_B8CXL0 contig_1 cds 363032 367291 - GCA000529525_00434 hypothetical protein PFAM:PF13229.12, PFAM:PF17789.7 contig_1 cds 367425 372236 - GCA000529525_00435 hypothetical protein PFAM:PF13620.12, PFAM:PF17802.7 contig_1 ncRNA 372977 373257 - GCA000529525_00436 RNaseP_arch Archaeal RNase P RFAM:RF00373, SO:0000386 contig_1 tRNA 373279 373353 - GCA000529525_00437 trnfM tRNA-fMet(cat) SO:0000266 contig_1 cds 373456 373968 - GCA000529525_00438 hypothetical protein contig_1 cds 373978 374382 - GCA000529525_00439 hypothetical protein contig_1 cds 374474 375391 + GCA000529525_00440 hypothetical protein PFAM:PF00557.29 contig_1 cds 375440 376291 - GCA000529525_00441 hypothetical protein PFAM:PF04432.18 contig_1 cds 376303 377118 - GCA000529525_00442 hypothetical protein PFAM:PF00037.32, PFAM:PF01058.29, PFAM:PF12838.12 contig_1 cds 377070 377687 - GCA000529525_00443 hypothetical protein PFAM:PF01750.23 contig_1 cds 377712 378929 - GCA000529525_00444 hypothetical protein contig_1 cds 379176 379694 + GCA000529525_00445 hypothetical protein contig_1 tRNA 379782 379855 + GCA000529525_00446 trnR tRNA-Arg(tct) SO:0001036 contig_1 tRNA 379909 379982 + GCA000529525_00447 trnR tRNA-Arg(cct) SO:0001036 contig_1 cds 379993 380454 - GCA000529525_00448 hypothetical protein contig_1 cds 380613 380897 - GCA000529525_00449 hypothetical protein contig_1 cds 380912 381169 - GCA000529525_00450 hypothetical protein contig_1 cds 381233 382006 - GCA000529525_00451 hypothetical protein contig_1 cds 382011 382178 - GCA000529525_00452 hypothetical protein contig_1 cds 382185 382982 - GCA000529525_00453 hypothetical protein PFAM:PF00575.29 contig_1 cds 383044 383223 - GCA000529525_00454 hypothetical protein contig_1 cds 383772 384596 - GCA000529525_00455 hypothetical protein PFAM:PF22090.1 contig_1 cds 384640 385374 - GCA000529525_00456 hypothetical protein PFAM:PF00705.23, PFAM:PF02747.20 contig_1 cds 385655 386056 - GCA000529525_00457 hypothetical protein contig_1 cds 386090 386812 - GCA000529525_00458 hypothetical protein contig_1 cds 386821 387288 - GCA000529525_00459 hypothetical protein contig_1 cds 387261 387518 - GCA000529525_00460 hypothetical protein contig_1 cds 387518 387721 - GCA000529525_00461 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12, PFAM:PF13560.12 contig_1 cds 387844 388221 + GCA000529525_00462 hypothetical protein PFAM:PF00206.25 contig_1 cds 388239 389192 + GCA000529525_00463 hypothetical protein PFAM:PF00206.25, PFAM:PF10397.14 contig_1 cds 389183 390049 + GCA000529525_00464 hypothetical protein contig_1 cds 390059 391222 - GCA000529525_00465 Cadmium-translocating P-type ATPase SO:0001217, UniRef:UniRef50_A0A7C4ALC8 contig_1 cds 391401 392543 - GCA000529525_00466 hypothetical protein PFAM:PF00403.32 contig_1 cds 392592 393011 - GCA000529525_00467 hypothetical protein contig_1 cds 393080 393385 - GCA000529525_00468 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11 contig_1 cds 393382 394194 - GCA000529525_00469 hypothetical protein PFAM:PF01979.26 contig_1 cds 394310 394594 - GCA000529525_00470 hypothetical protein contig_1 cds 394599 394991 - GCA000529525_00471 hypothetical protein PFAM:PF01989.22 contig_1 tRNA 396321 396394 - GCA000529525_00472 trnR tRNA-Arg(gcg) SO:0001036 contig_1 cds 396446 396883 - GCA000529525_00473 hypothetical protein contig_1 cds 397113 399869 - GCA000529525_00474 hypothetical protein PFAM:PF16640.11 contig_1 cds 399891 400103 - GCA000529525_00475 hypothetical protein contig_1 cds 400100 405487 - GCA000529525_00476 hypothetical protein PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF16640.11 contig_1 cds 405614 408112 - GCA000529525_00477 hypothetical protein PFAM:PF16640.11, PFAM:PF19077.6 contig_1 cds 408175 409887 - GCA000529525_00478 hypothetical protein contig_1 cds 410553 411803 - GCA000529525_00479 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_1 cds 411805 412404 - GCA000529525_00480 hisH Imidazole glycerol phosphate synthase subunit HisH SO:0001217, UniRef:UniRef50_P60599 contig_1 cds 412401 413471 - GCA000529525_00481 hypothetical protein PFAM:PF00148.24 contig_1 cds 413645 415264 - GCA000529525_00482 hypothetical protein contig_1 cds 415522 416700 - GCA000529525_00483 hypothetical protein PFAM:PF01637.24, PFAM:PF13191.12, PFAM:PF13401.12 contig_1 cds 416856 418049 - GCA000529525_00484 hypothetical protein PFAM:PF02421.24, PFAM:PF02824.27, PFAM:PF08438.16 contig_1 cds 418156 418998 + GCA000529525_00485 hypothetical protein PFAM:PF00149.33 contig_1 cds 418999 421104 + GCA000529525_00486 hypothetical protein contig_1 cds 421093 421941 - GCA000529525_00487 Deacetylase sirtuin-type domain-containing protein SO:0001217, UniRef:UniRef50_A0A136Q6J6 contig_1 cds 421943 422725 - GCA000529525_00488 Protein-ADP-ribose hydrolase SO:0001217, UniRef:UniRef50_A0A9J6NZK5 contig_1 cds 422837 423214 + GCA000529525_00489 hypothetical protein PFAM:PF01638.23 contig_1 cds 423216 423527 + GCA000529525_00490 hypothetical protein PFAM:PF00590.25 contig_1 cds 423602 423853 + GCA000529525_00491 hypothetical protein PFAM:PF00590.25 contig_1 cds 424030 427098 + GCA000529525_00492 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_1 cds 427148 427441 + GCA000529525_00493 hypothetical protein contig_1 cds 427478 428485 - GCA000529525_00494 hypothetical protein PFAM:PF01656.29, PFAM:PF02374.21, PFAM:PF13614.12 contig_1 cds 428666 429343 + GCA000529525_00495 NH(3)-dependent NAD(+) synthetase SO:0001217, UniRef:UniRef50_A0A351JPZ2 contig_1 cds 429464 432319 + GCA000529525_00496 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF08264.19, PFAM:PF13603.12 contig_1 cds 432340 433065 - GCA000529525_00497 hypothetical protein PFAM:PF01596.23, PFAM:PF08241.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_1 cds 433081 433848 - GCA000529525_00498 hypothetical protein PFAM:PF01435.24, PFAM:PF13202.12 contig_1 cds 433911 434036 - GCA000529525_00499 hypothetical protein contig_1 cds 434626 435573 + GCA000529525_00500 hypothetical protein PFAM:PF00004.35, PFAM:PF01078.27, PFAM:PF03215.21, PFAM:PF08542.16, PFAM:PF13177.12, PFAM:PF21960.2 contig_1 cds 435583 436833 + GCA000529525_00501 hypothetical protein PFAM:PF00004.35, PFAM:PF03215.21, PFAM:PF05496.18, PFAM:PF07728.20, PFAM:PF21960.2 contig_1 cds 436830 436988 + GCA000529525_00502 hypothetical protein contig_1 cds 436971 437654 - GCA000529525_00503 hypothetical protein contig_1 cds 437662 438510 - GCA000529525_00504 hypothetical protein PFAM:PF08501.16, PFAM:PF18317.6 contig_1 cds 438596 439903 + GCA000529525_00505 hypothetical protein PFAM:PF00587.30, PFAM:PF01409.25, PFAM:PF03129.25, PFAM:PF13393.11 contig_1 cds 439893 440300 + GCA000529525_00506 Phosphoribosyl-AMP cyclohydrolase SO:0001217, UniRef:UniRef50_Q9K0H5 contig_1 cds 440290 442143 + GCA000529525_00507 hypothetical protein PFAM:PF00437.27, PFAM:PF01850.27 contig_1 cds 442151 442843 + GCA000529525_00508 hypothetical protein PFAM:PF01261.30 contig_1 cds 442893 444485 - GCA000529525_00509 hypothetical protein PFAM:PF00271.37, PFAM:PF00633.29, PFAM:PF02732.21, PFAM:PF12826.13, PFAM:PF14520.12, PFAM:PF21210.2 contig_1 cds 444512 445207 - GCA000529525_00510 hypothetical protein PFAM:PF00270.35 contig_1 cds 445516 445938 - GCA000529525_00511 hypothetical protein PFAM:PF01850.27 contig_1 cds 445928 446170 - GCA000529525_00512 hypothetical protein contig_1 cds 446694 447065 + GCA000529525_00513 hypothetical protein contig_1 cds 447706 449760 + GCA000529525_00514 hypothetical protein contig_1 cds 449995 453045 + GCA000529525_00515 hypothetical protein contig_1 cds 453197 454633 - GCA000529525_00516 hypothetical protein PFAM:PF08245.18 contig_1 cds 454626 456008 - GCA000529525_00517 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_1 cds 456147 457532 - GCA000529525_00518 hypothetical protein PFAM:PF01070.24, PFAM:PF01645.23 contig_1 cds 457773 458969 - GCA000529525_00519 hypothetical protein contig_1 cds 458962 460296 - GCA000529525_00520 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF21763.2 contig_1 cds 460286 460684 - GCA000529525_00521 hypothetical protein PFAM:PF00312.27, PFAM:PF08069.17 contig_1 cds 460751 461302 - GCA000529525_00522 hypothetical protein PFAM:PF01725.21 contig_1 cds 461347 462939 - GCA000529525_00523 hypothetical protein PFAM:PF01163.29, PFAM:PF22521.2 contig_1 cds 463029 463487 + GCA000529525_00524 hypothetical protein contig_1 cds 463506 464555 + GCA000529525_00525 hypothetical protein contig_1 cds 464599 465444 - GCA000529525_00526 hypothetical protein contig_1 cds 465444 466367 - GCA000529525_00527 Branched-chain-amino-acid aminotransferase SO:0001217, UniRef:UniRef50_A0A537X7K9 contig_1 tRNA 466499 466570 + GCA000529525_00528 trnV tRNA-Val(tac) SO:0000273 contig_1 cds 466825 467652 + GCA000529525_00529 hypothetical protein contig_1 cds 467692 468270 - GCA000529525_00530 Imidazoleglycerol-phosphate dehydratase SO:0001217, UniRef:UniRef50_Q6ANL7 contig_1 cds 468524 469216 - GCA000529525_00531 hypothetical protein PFAM:PF03459.23 contig_2 cds 223 597 + GCA000529525_00532 hypothetical protein contig_2 cds 711 3986 + GCA000529525_00533 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF13229.12 contig_2 cds 3986 5176 + GCA000529525_00534 hypothetical protein PFAM:PF01345.24 contig_2 cds 5360 5533 + GCA000529525_00535 hypothetical protein contig_2 cds 5672 6442 - GCA000529525_00536 hypothetical protein contig_2 cds 6871 7083 - GCA000529525_00537 hypothetical protein contig_2 cds 7207 7650 + GCA000529525_00538 hypothetical protein contig_2 cds 8013 8420 + GCA000529525_00539 hypothetical protein PFAM:PF01957.25 contig_2 cds 8433 9335 + GCA000529525_00540 hypothetical protein contig_2 cds 10229 10996 + GCA000529525_00541 hypothetical protein PFAM:PF13635.12 contig_2 cds 11430 11960 + GCA000529525_00542 hypothetical protein PFAM:PF04893.22 contig_2 cds 11957 12721 + GCA000529525_00543 hypothetical protein contig_2 cds 13155 14039 - GCA000529525_00544 hypothetical protein contig_2 assembly_gap 15018 15286 . contig_2 cds 16755 17456 + GCA000529525_00545 hypothetical protein contig_2 cds 17549 17956 + GCA000529525_00546 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_UPI0011437D34 contig_2 cds 17959 18477 + GCA000529525_00547 hypothetical protein SO:0001217, UniRef:UniRef50_UPI000A6217B8 contig_2 cds 18494 19234 + GCA000529525_00548 hypothetical protein contig_2 cds 19314 19421 - GCA000529525_00549 hypothetical protein contig_2 cds 19418 19855 - GCA000529525_00550 hypothetical protein contig_2 cds 20213 20971 + GCA000529525_00551 hypothetical protein contig_2 assembly_gap 21421 22976 . contig_2 cds 23405 23866 + GCA000529525_00552 hypothetical protein contig_2 cds 24010 24459 - GCA000529525_00553 hypothetical protein PFAM:PF01047.28 contig_2 cds 24887 25720 + GCA000529525_00554 Glyoxal reductase SO:0001217, UniRef:UniRef50_M1WRM0 contig_2 cds 25780 26226 + GCA000529525_00555 Cupin type-2 domain-containing protein SO:0001217, UniRef:UniRef50_C4Z234 contig_2 cds 26368 26931 + GCA000529525_00556 (pseudo) Aldo/keto reductase SO:0001217, UniRef:UniRef50_A0A377JWK0, UniRef:UniRef90_A0A943GG52 contig_2 cds 26910 27230 + GCA000529525_00557 NADP-dependent oxidoreductase domain-containing protein SO:0001217, UniRef:UniRef50_B1C4L2 contig_2 cds 27409 27759 - GCA000529525_00558 hypothetical protein contig_2 cds 27815 28096 + GCA000529525_00559 hypothetical protein PFAM:PF00462.30, PFAM:PF13098.12 contig_2 cds 28131 28610 + GCA000529525_00560 hypothetical protein PFAM:PF02943.20, PFAM:PF21349.2 contig_2 cds 29204 29560 - GCA000529525_00561 hypothetical protein contig_2 cds 29557 29808 - GCA000529525_00562 hypothetical protein contig_2 cds 29916 30041 - GCA000529525_00563 hypothetical protein contig_2 cds 30973 31332 + GCA000529525_00564 Glycosyltransferase 2-like domain-containing protein SO:0001217, UniRef:UniRef50_A0A292SN82 contig_2 cds 31545 31958 + GCA000529525_00565 hypothetical protein contig_2 cds 32073 32309 + GCA000529525_00566 hypothetical protein PFAM:PF04014.23 contig_2 cds 32306 32707 + GCA000529525_00567 hypothetical protein PFAM:PF01850.27 contig_2 cds 34274 34741 - GCA000529525_00568 hypothetical protein PFAM:PF01710.22, PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_2 cds 34978 35130 - GCA000529525_00569 hypothetical protein PFAM:PF08220.18 contig_2 cds 35213 35938 - GCA000529525_00570 hypothetical protein contig_2 cds 36055 36399 - GCA000529525_00571 hypothetical protein PFAM:PF01637.24, PFAM:PF13191.12 contig_2 cds 36486 37064 - GCA000529525_00572 hypothetical protein PFAM:PF13358.12 contig_2 cds 37414 38448 - GCA000529525_00573 hypothetical protein PFAM:PF13635.12 contig_2 cds 38516 38773 - GCA000529525_00574 hypothetical protein contig_2 cds 38898 39551 - GCA000529525_00575 hypothetical protein PFAM:PF13635.12 contig_2 cds 39590 40207 - GCA000529525_00576 hypothetical protein contig_2 cds 40333 40827 + GCA000529525_00577 hypothetical protein contig_2 cds 40857 41063 + GCA000529525_00578 hypothetical protein contig_2 cds 41060 41251 + GCA000529525_00579 hypothetical protein PFAM:PF01980.22 contig_2 cds 41248 42639 - GCA000529525_00580 hypothetical protein contig_2 cds 42653 43213 - GCA000529525_00581 hypothetical protein PFAM:PF01047.28, PFAM:PF13412.12, PFAM:PF13463.12 contig_2 cds 43718 46126 + GCA000529525_00582 hypothetical protein PFAM:PF02663.19 contig_2 cds 46452 46931 + GCA000529525_00583 hypothetical protein contig_2 cds 47006 47119 + GCA000529525_00584 hypothetical protein contig_2 cds 47186 47572 + GCA000529525_00585 hypothetical protein contig_2 cds 47597 47716 + GCA000529525_00586 hypothetical protein contig_2 cds 47713 48246 + GCA000529525_00587 hypothetical protein contig_2 cds 48252 48734 - GCA000529525_00588 hypothetical protein contig_2 cds 48785 49990 - GCA000529525_00589 putative hydrolase or acyltransferase of alpha/beta superfamily SO:0001217, UniRef:UniRef50_C7N2K6 contig_2 assembly_gap 50365 50683 . contig_2 cds 51153 51431 - GCA000529525_00590 hypothetical protein PFAM:PF13240.11 contig_2 cds 51625 51978 - GCA000529525_00591 hypothetical protein contig_2 cds 52163 53302 - GCA000529525_00592 Toxic anion resistance protein SO:0001217, UniRef:UniRef50_A0A2M9MRB1 contig_2 cds 53321 54241 - GCA000529525_00593 hypothetical protein contig_2 cds 54577 54783 + GCA000529525_00594 hypothetical protein contig_2 cds 54866 55195 - GCA000529525_00595 hypothetical protein PFAM:PF03553.21 contig_2 cds 55801 56241 - GCA000529525_00596 D-aminoacyl-tRNA deacylase SO:0001217, UniRef:UniRef50_A6GW89 contig_2 cds 56485 57147 + GCA000529525_00597 hypothetical protein contig_2 cds 57261 58781 + GCA000529525_00598 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF10431.15, PFAM:PF17871.7 contig_2 cds 58812 60425 + GCA000529525_00599 hypothetical protein PFAM:PF00069.31, PFAM:PF07714.23 contig_2 cds 60447 61820 + GCA000529525_00600 hypothetical protein contig_2 cds 61842 62453 + GCA000529525_00601 hypothetical protein contig_2 cds 62483 64555 + GCA000529525_00602 hypothetical protein contig_2 cds 64702 64995 + GCA000529525_00603 hypothetical protein contig_2 cds 65016 65780 + GCA000529525_00604 hypothetical protein PFAM:PF00149.33 contig_2 cds 65789 66106 + GCA000529525_00605 hypothetical protein contig_2 cds 66134 66280 + GCA000529525_00606 hypothetical protein contig_2 cds 66253 66804 + GCA000529525_00607 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF14853.12 contig_2 cds 67014 67397 + GCA000529525_00608 hypothetical protein contig_2 cds 67497 68438 - GCA000529525_00609 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13181.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF14559.12, PFAM:PF25064.1 contig_2 cds 68679 69023 + GCA000529525_00610 hypothetical protein contig_2 cds 69235 69333 + GCA000529525_00611 hypothetical protein contig_2 cds 69457 70257 + GCA000529525_00612 hypothetical protein contig_2 cds 70277 70783 + GCA000529525_00613 Amidohydrolase SO:0001217, UniRef:UniRef50_A0A3C2BAI0 contig_2 cds 70777 71070 + GCA000529525_00614 hypothetical protein PFAM:PF04909.20 contig_2 cds 71067 72074 - GCA000529525_00615 hypothetical protein contig_2 cds 72340 72930 - GCA000529525_00616 hypothetical protein contig_2 cds 73089 73301 - GCA000529525_00617 hypothetical protein contig_2 cds 73324 73983 - GCA000529525_00618 hypothetical protein contig_2 cds 74145 74324 - GCA000529525_00619 hypothetical protein PFAM:PF13358.12 contig_2 gap 74454 74534 . contig_2 cds 74698 75030 - GCA000529525_00620 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12 contig_2 cds 75296 75700 + GCA000529525_00621 hypothetical protein PFAM:PF03061.28 contig_2 cds 75936 77600 - GCA000529525_00622 3-[(3aS,4S,7aS)-7a-methyl-1, 5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase SO:0001217, UniRef:UniRef50_A0A0P0L9Z5 contig_2 cds 77611 78180 - GCA000529525_00623 (S)-2-hydroxypropylphosphonic acid epoxidase SO:0001217, UniRef:UniRef50_A0A174ISJ1 contig_2 cds 78339 78917 + GCA000529525_00624 hypothetical protein PFAM:PF00132.30, PFAM:PF14602.12 contig_2 cds 78914 79639 - GCA000529525_00625 hypothetical protein PFAM:PF12705.13 contig_2 cds 80070 80615 - GCA000529525_00626 hypothetical protein contig_2 cds 80895 81206 - GCA000529525_00627 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF13534.11 contig_2 cds 81531 81818 - GCA000529525_00628 hypothetical protein contig_2 cds 82031 82318 - GCA000529525_00629 hypothetical protein contig_2 cds 82633 84432 + GCA000529525_00630 irtA Iron import ATP-binding/permease protein IrtA SO:0001217, UniRef:UniRef50_A0A174NUF5 contig_2 cds 84425 85096 + GCA000529525_00631 hypothetical protein contig_2 cds 85132 86181 + GCA000529525_00632 ABC transporter ATP-binding protein SO:0001217, UniRef:UniRef50_A0A2G6GEH7 contig_2 cds 86276 86455 - GCA000529525_00633 hypothetical protein contig_2 cds 86820 87587 + GCA000529525_00634 hypothetical protein contig_2 cds 87742 88344 - GCA000529525_00635 hypothetical protein PFAM:PF13240.11 contig_2 cds 88438 88776 - GCA000529525_00636 UPF0145 protein SCO3412 SO:0001217, UniRef:UniRef50_Q9X8J2 contig_2 cds 89108 90094 - GCA000529525_00637 hypothetical protein PFAM:PF00165.29, PFAM:PF12833.13 contig_2 cds 90159 91013 + GCA000529525_00638 hypothetical protein contig_2 cds 91068 91223 + GCA000529525_00639 hypothetical protein contig_2 cds 91276 91395 - GCA000529525_00640 hypothetical protein contig_2 cds 91569 92426 - GCA000529525_00641 hypothetical protein contig_2 cds 92670 93233 - GCA000529525_00642 hypothetical protein contig_2 cds 93273 93659 - GCA000529525_00643 hypothetical protein PFAM:PF01638.23 contig_2 cds 94148 94927 - GCA000529525_00644 Polyketide biosynthesis methyltransferase SO:0001217, UniRef:UniRef50_G5F3T7 contig_2 cds 95897 96514 - GCA000529525_00645 hypothetical protein contig_2 cds 96556 97266 - GCA000529525_00646 hypothetical protein contig_2 cds 97307 97750 - GCA000529525_00647 hypothetical protein PFAM:PF01047.28, PFAM:PF01638.23, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13601.12, PFAM:PF22381.2 contig_2 cds 97790 98728 - GCA000529525_00648 hypothetical protein PFAM:PF00725.27, PFAM:PF02737.24 contig_2 cds 98923 99384 - GCA000529525_00649 hypothetical protein PFAM:PF01047.28, PFAM:PF13463.12 contig_2 cds 99451 99933 - GCA000529525_00650 hypothetical protein contig_2 cds 100158 100565 - GCA000529525_00651 hypothetical protein contig_2 cds 101408 102256 - GCA000529525_00652 hypothetical protein contig_2 cds 102264 103019 - GCA000529525_00653 Site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A0B4S2U2 contig_2 cds 103019 103201 - GCA000529525_00654 hypothetical protein contig_2 cds 103329 103700 - GCA000529525_00655 hypothetical protein contig_2 cds 103979 104764 - GCA000529525_00656 hypothetical protein contig_2 cds 104772 105503 - GCA000529525_00657 hypothetical protein contig_2 cds 105506 105709 - GCA000529525_00658 hypothetical protein PFAM:PF01381.28, PFAM:PF12844.13, PFAM:PF13443.12, PFAM:PF13560.12 contig_2 cds 106322 106888 + GCA000529525_00659 Flavin reductase like domain-containing protein SO:0001217, UniRef:UniRef50_G4Q5S3 contig_2 cds 107171 107278 + GCA000529525_00660 hypothetical protein contig_2 cds 107702 107941 - GCA000529525_00661 hypothetical protein contig_2 cds 108341 108922 + GCA000529525_00662 TIGR02185 protein SO:0001217, UniRef:UniRef50_Q24MQ7 contig_2 cds 108931 109674 + GCA000529525_00663 hypothetical protein contig_2 cds 109667 110653 + GCA000529525_00664 hypothetical protein PFAM:PF00005.33, PFAM:PF00485.24, PFAM:PF00910.28, PFAM:PF02367.23, PFAM:PF03215.21, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13476.12, PFAM:PF13555.12, PFAM:PF20720.3 contig_2 cds 110665 111102 + GCA000529525_00665 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_S3LP03 contig_2 cds 111079 113631 - GCA000529525_00666 hypothetical protein PFAM:PF13307.12 contig_2 cds 113743 114303 - GCA000529525_00667 hypothetical protein contig_2 cds 115373 115930 - GCA000529525_00668 Rubrerythrin family protein SO:0001217, UniRef:UniRef50_A0A9D2IN08 contig_2 cds 116049 116525 - GCA000529525_00669 Methylated-DNA--protein-cysteine methyltransferase SO:0001217, UniRef:UniRef50_A0A1M5FE19 contig_2 cds 116540 116845 - GCA000529525_00670 hypothetical protein PFAM:PF03459.23 contig_2 cds 116993 117646 - GCA000529525_00671 hypothetical protein PFAM:PF00005.33 contig_2 cds 117646 118437 - GCA000529525_00672 ModB2: putative molybdenum transport system permease protein SO:0001217, UniRef:UniRef50_K0NI36 contig_2 cds 118456 119244 - GCA000529525_00673 hypothetical protein contig_2 cds 119713 120417 + GCA000529525_00674 ABC transporter domain-containing protein SO:0001217, UniRef:UniRef50_R2RX92 contig_2 cds 120401 122698 + GCA000529525_00675 hypothetical protein PFAM:PF02687.27 contig_2 crispr 122757 124979 ? CRISPR array with 34 repeats of length 30, consensus sequence ATTTCAATCCCAAATTGGTCTGATTAACAT and spacer length 36 SO:0001459 contig_2 crispr-repeat 122757 122786 ? CRISPR repeat contig_2 crispr-spacer 122787 122822 ? CRISPR spacer, sequence AAGCAATGTTTTTCTTGAAATTGATGGGAAAATTTA contig_2 crispr-repeat 122823 122852 ? CRISPR repeat contig_2 crispr-spacer 122853 122889 ? CRISPR spacer, sequence AGGTTACAGCTGTACAGTTGCAAGGTTTGTTGAGTGT contig_2 crispr-repeat 122890 122919 ? CRISPR repeat contig_2 crispr-spacer 122920 122954 ? CRISPR spacer, sequence CTGGTAATGATGTGATTATTACTGATGATGAATTG contig_2 crispr-repeat 122955 122984 ? CRISPR repeat contig_2 crispr-spacer 122985 123021 ? CRISPR spacer, sequence TTATAGAAGGTGAAGAATGTGAATAACACTCTTGAGG contig_2 crispr-repeat 123022 123051 ? CRISPR repeat contig_2 crispr-spacer 123052 123088 ? CRISPR spacer, sequence TATTAGGTTAGAATATTTCTTTTTTTAAATATAATCC contig_2 crispr-repeat 123089 123118 ? CRISPR repeat contig_2 crispr-spacer 123119 123155 ? CRISPR spacer, sequence CATCCTCACTCTTCTTCTTACTAGGCTTACCAAGGCT contig_2 crispr-repeat 123156 123185 ? CRISPR repeat contig_2 crispr-spacer 123186 123221 ? CRISPR spacer, sequence ATCACACCTCGTATTTGTCTTGCAACAAGTACAGCA contig_2 crispr-repeat 123222 123251 ? CRISPR repeat contig_2 crispr-spacer 123252 123289 ? CRISPR spacer, sequence AGGGAGTGAGGATGGAATAGACTACACCTATTCCACTG contig_2 crispr-repeat 123290 123319 ? CRISPR repeat contig_2 crispr-spacer 123320 123358 ? CRISPR spacer, sequence TGCACTTTCTTAAATCAGAGAATATTGATAGGATTTATC contig_2 crispr-repeat 123359 123388 ? CRISPR repeat contig_2 crispr-spacer 123389 123424 ? CRISPR spacer, sequence TGTTCTACTTTGTTTTGTGTCTAGGCTATAATCAAT contig_2 crispr-repeat 123425 123454 ? CRISPR repeat contig_2 crispr-spacer 123455 123491 ? CRISPR spacer, sequence TACTTGTGATTTCATCGTCACCACCTGGTTATAGTTA contig_2 crispr-repeat 123492 123521 ? CRISPR repeat contig_2 crispr-spacer 123522 123558 ? CRISPR spacer, sequence TTTCTATTTGTATATCGATATCTTTTCGAGTATTGGG contig_2 crispr-repeat 123559 123588 ? CRISPR repeat contig_2 crispr-spacer 123589 123623 ? CRISPR spacer, sequence CCCCTTATGTGGCTTTTTGTTTTTGAAATGTGTAG contig_2 crispr-repeat 123624 123653 ? CRISPR repeat contig_2 crispr-spacer 123654 123685 ? CRISPR spacer, sequence ATGTTTCAGATGACGCCCAACTTAATAACCAG contig_2 crispr-repeat 123686 123715 ? CRISPR repeat contig_2 crispr-spacer 123716 123751 ? CRISPR spacer, sequence TCAATTGTTTGATTATTTATTTGCATGTTTAAGCAA contig_2 crispr-repeat 123752 123781 ? CRISPR repeat contig_2 crispr-spacer 123782 123817 ? CRISPR spacer, sequence ATGTGAATTGTCCAATAGTTGCCTCTTGATATACAT contig_2 crispr-repeat 123818 123847 ? CRISPR repeat contig_2 crispr-spacer 123848 123883 ? CRISPR spacer, sequence TTAAGAAAATTAAAATATGTAAGAGATGGTCAATAA contig_2 crispr-repeat 123884 123913 ? CRISPR repeat contig_2 crispr-spacer 123914 123951 ? CRISPR spacer, sequence ATTAAAGGTTCCGGCAAAATTAATACTCATGAGTTTTA contig_2 crispr-repeat 123952 123981 ? CRISPR repeat contig_2 crispr-spacer 123982 124015 ? CRISPR spacer, sequence TTGAAGGTCTTAACATACCTACTTTCCTTTTTTG contig_2 crispr-repeat 124016 124045 ? CRISPR repeat contig_2 crispr-spacer 124046 124082 ? CRISPR spacer, sequence TATTATTACCGGGGGATAAAAATCCTAGGATACGCCC contig_2 crispr-repeat 124083 124112 ? CRISPR repeat contig_2 crispr-spacer 124113 124147 ? CRISPR spacer, sequence TTTTTTGCTGTCGCTGGGTCTTGTGTTGAGCAATC contig_2 crispr-repeat 124148 124177 ? CRISPR repeat contig_2 crispr-spacer 124178 124214 ? CRISPR spacer, sequence AATATTTATACCTTGCTCCATGTGTCCCATCTAAATT contig_2 crispr-repeat 124215 124244 ? CRISPR repeat contig_2 crispr-spacer 124245 124280 ? CRISPR spacer, sequence TTGATTATAAGTATATTTATCATCTATACTATGTTG contig_2 crispr-repeat 124281 124310 ? CRISPR repeat contig_2 crispr-spacer 124311 124346 ? CRISPR spacer, sequence AGTGTTTTTTGGGGGTGTTTGTTTTTTCTTGGTTTA contig_2 crispr-repeat 124347 124376 ? CRISPR repeat contig_2 crispr-spacer 124377 124412 ? CRISPR spacer, sequence TCAATTGTTTGATTATTTATTTGCATGTTTAAGCAA contig_2 crispr-repeat 124413 124442 ? CRISPR repeat contig_2 crispr-spacer 124443 124478 ? CRISPR spacer, sequence ATGTGAATTGTCCAATAGTTGCCTCTTGATATACAT contig_2 crispr-repeat 124479 124508 ? CRISPR repeat contig_2 crispr-spacer 124509 124544 ? CRISPR spacer, sequence TTAAGAAAATTAAAATATGTAAGAGATGGTCAATAA contig_2 crispr-repeat 124545 124574 ? CRISPR repeat contig_2 crispr-spacer 124575 124610 ? CRISPR spacer, sequence GATGAAAATAAAGTTGAACATGAACTTACAAAGGAA contig_2 crispr-repeat 124611 124640 ? CRISPR repeat contig_2 crispr-spacer 124641 124677 ? CRISPR spacer, sequence TCTTAAAATGGTTAGTTACAATCTTAATAACATTATT contig_2 crispr-repeat 124678 124707 ? CRISPR repeat contig_2 crispr-spacer 124708 124743 ? CRISPR spacer, sequence TGTAGCATATTTTTTCATTGATGCTCTATAATAATC contig_2 crispr-repeat 124744 124773 ? CRISPR repeat contig_2 crispr-spacer 124774 124809 ? CRISPR spacer, sequence GTATTGTTATTCGTTAATTTAATTTTAATTATCTTA contig_2 crispr-repeat 124810 124839 ? CRISPR repeat contig_2 crispr-spacer 124840 124875 ? CRISPR spacer, sequence TGCTATATTTAAACTCGATACTGCTGGATTTAGTAT contig_2 crispr-repeat 124876 124905 ? CRISPR repeat contig_2 crispr-spacer 124906 124939 ? CRISPR spacer, sequence TTGACATGGATAGTGAATATGTGATGCATTACAC contig_2 crispr-repeat 124940 124969 ? CRISPR repeat contig_2 crispr-spacer 124970 124979 ? CRISPR spacer, sequence GCAGCAGTAA contig_2 cds 125983 126213 + GCA000529525_00676 hypothetical protein PFAM:PF04014.23 contig_2 cds 126213 126602 + GCA000529525_00677 hypothetical protein PFAM:PF01850.27 contig_2 cds 127663 128763 + GCA000529525_00678 hypothetical protein PFAM:PF00037.32, PFAM:PF04432.18, PFAM:PF13534.11 contig_2 cds 128772 129254 + GCA000529525_00679 hypothetical protein PFAM:PF03460.22 contig_2 cds 129741 130865 - GCA000529525_00680 hypothetical protein contig_2 cds 130937 131155 - GCA000529525_00681 hypothetical protein PFAM:PF18127.6 contig_2 cds 131472 132011 - GCA000529525_00682 Glutathione peroxidase SO:0001217, UniRef:UniRef50_C9LIC7 contig_2 cds 132242 132436 + GCA000529525_00683 hypothetical protein PFAM:PF01637.24 contig_2 cds 132633 133439 + GCA000529525_00684 hypothetical protein PFAM:PF13635.12 contig_2 cds 133899 134051 - GCA000529525_00685 hypothetical protein contig_2 cds 134054 134245 - GCA000529525_00686 hypothetical protein contig_2 cds 134419 135846 - GCA000529525_00687 hypothetical protein contig_2 cds 135988 137112 - GCA000529525_00688 hypothetical protein PFAM:PF02775.26, PFAM:PF02776.23 contig_2 cds 137128 138309 - GCA000529525_00689 Saccharopine dehydrogenase NADP binding domain-containing protein SO:0001217, UniRef:UniRef50_C9RPC9 contig_2 cds 138311 139081 - GCA000529525_00690 hypothetical protein PFAM:PF20202.4 contig_2 cds 139168 140088 - GCA000529525_00691 hypothetical protein PFAM:PF16363.11 contig_2 cds 140109 140714 - GCA000529525_00692 Phosphodiesterase family protein SO:0001217, UniRef:UniRef50_C8PP49 contig_2 cds 140735 140839 - GCA000529525_00693 hypothetical protein contig_2 cds 140849 141244 - GCA000529525_00694 Phosphoenolpyruvate phosphomutase SO:0001217, UniRef:UniRef50_A0A350H532 contig_2 cds 141301 142155 - GCA000529525_00695 hypothetical protein PFAM:PF01467.32, PFAM:PF13714.12 contig_2 cds 142313 143143 - GCA000529525_00696 hypothetical protein PFAM:PF04991.19 contig_2 cds 143157 143930 - GCA000529525_00697 hypothetical protein PFAM:PF04991.19 contig_2 cds 144007 144702 - GCA000529525_00698 hypothetical protein PFAM:PF12804.13 contig_2 cds 144712 145680 - GCA000529525_00699 hypothetical protein PFAM:PF01118.30, PFAM:PF02558.23, PFAM:PF02737.24, PFAM:PF03446.21, PFAM:PF07479.19, PFAM:PF20618.3 contig_2 cds 145813 146133 + GCA000529525_00700 Guanidinium exporter SO:0001217, UniRef:UniRef50_A0A0W0VPM2 contig_2 cds 146181 146597 + GCA000529525_00701 hypothetical protein PFAM:PF00293.34 contig_2 cds 146559 147452 - GCA000529525_00702 hypothetical protein contig_2 cds 147509 148060 + GCA000529525_00703 mntP Putative manganese efflux pump MntP SO:0001217, UniRef:UniRef50_A8MEV0 contig_2 cds 148441 148935 - GCA000529525_00704 hypothetical protein PFAM:PF03167.24 contig_2 cds 148962 150017 - GCA000529525_00705 hypothetical protein PFAM:PF13240.11 contig_2 cds 150076 151062 - GCA000529525_00706 hypothetical protein PFAM:PF13240.11 contig_2 cds 151273 151956 - GCA000529525_00707 ABC-type polar amino acid transport system, ATPase component SO:0001217, UniRef:UniRef50_A0A0M6WZM0 contig_2 cds 151969 152619 - GCA000529525_00708 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_F7KSM3 contig_2 cds 152757 153476 - GCA000529525_00709 ABC transporter, substrate-binding protein, family 3 SO:0001217, UniRef:UniRef50_B1C6W5 contig_2 cds 153585 154262 - GCA000529525_00710 hypothetical protein contig_2 cds 154393 154506 - GCA000529525_00711 hypothetical protein contig_2 cds 154864 155904 - GCA000529525_00712 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 155913 157274 - GCA000529525_00713 hypothetical protein contig_2 cds 157278 158090 - GCA000529525_00714 hypothetical protein PFAM:PF00984.24, PFAM:PF03720.21 contig_2 cds 158132 159865 - GCA000529525_00715 hypothetical protein PFAM:PF00535.33, PFAM:PF03721.20, PFAM:PF13641.12 contig_2 cds 159869 160984 - GCA000529525_00716 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 160977 161276 - GCA000529525_00717 hypothetical protein contig_2 cds 161339 162118 - GCA000529525_00718 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 162129 163148 - GCA000529525_00719 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 assembly_gap 163953 164286 . contig_2 cds 164496 166259 - GCA000529525_00720 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 166314 166538 - GCA000529525_00721 hypothetical protein contig_2 cds 166535 166786 - GCA000529525_00722 hypothetical protein contig_2 assembly_gap 166859 167600 . contig_2 cds 169092 170177 - GCA000529525_00723 hypothetical protein contig_2 cds 170219 170425 - GCA000529525_00724 hypothetical protein contig_2 cds 170446 171663 - GCA000529525_00725 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 171680 172990 - GCA000529525_00726 hypothetical protein contig_2 cds 173062 173520 - GCA000529525_00727 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_2 cds 173539 174864 - GCA000529525_00728 Carbamoylphosphate synthase large subunit short form SO:0001217, UniRef:UniRef50_A8FI10 contig_2 cds 174938 176650 - GCA000529525_00729 hypothetical protein contig_2 cds 176683 177711 - GCA000529525_00730 DegT/DnrJ/EryC1/StrS aminotransferase SO:0001217, UniRef:UniRef50_G5GHY7 contig_2 cds 177651 177812 - GCA000529525_00731 hypothetical protein contig_2 cds 177959 178441 - GCA000529525_00732 hypothetical protein contig_2 cds 178438 179643 - GCA000529525_00733 hypothetical protein contig_2 cds 179688 180107 - GCA000529525_00734 hypothetical protein PFAM:PF00535.33 contig_2 cds 180132 180887 - GCA000529525_00735 CDP-glycerol glycerophosphotransferase family protein SO:0001217, UniRef:UniRef50_UPI0030CEC393 contig_2 cds 180914 181717 - GCA000529525_00736 hypothetical protein contig_2 cds 181717 182355 - GCA000529525_00737 hypothetical protein PFAM:PF00535.33 contig_2 cds 182450 184255 - GCA000529525_00738 hypothetical protein contig_2 cds 184302 184682 - GCA000529525_00739 hypothetical protein contig_2 cds 184874 185125 - GCA000529525_00740 hypothetical protein PFAM:PF00582.32 contig_2 cds 186782 187513 - GCA000529525_00741 hypothetical protein contig_2 cds 187523 187930 - GCA000529525_00742 hypothetical protein PFAM:PF13175.12, PFAM:PF13304.12 contig_2 cds 188086 188808 - GCA000529525_00743 hypothetical protein contig_2 cds 188952 190043 + GCA000529525_00744 Cation transporter SO:0001217, UniRef:UniRef50_A0A9D8QYH2 contig_2 cds 190040 190618 - GCA000529525_00745 hypothetical protein contig_2 cds 190696 191394 + GCA000529525_00746 hypothetical protein PFAM:PF00303.24 contig_2 cds 191401 194907 - GCA000529525_00747 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_2 cds 195014 195787 - GCA000529525_00748 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11 contig_2 cds 195889 197013 - GCA000529525_00749 hypothetical protein PFAM:PF00112.29 contig_2 cds 196991 198433 - GCA000529525_00750 hypothetical protein PFAM:PF02415.23 contig_2 cds 198552 198848 - GCA000529525_00751 hypothetical protein PFAM:PF03992.22 contig_2 cds 198861 199535 - GCA000529525_00752 hypothetical protein contig_2 cds 199605 200681 - GCA000529525_00753 NADP-dependent isopropanol dehydrogenase SO:0001217, UniRef:UniRef50_P25984 contig_2 cds 201976 202596 - GCA000529525_00754 hypothetical protein contig_2 assembly_gap 202848 203134 . contig_2 cds 203277 203546 - GCA000529525_00755 hypothetical protein contig_2 cds 203647 204618 - GCA000529525_00756 hypothetical protein PFAM:PF02289.21 contig_2 cds 205217 206779 - GCA000529525_00757 hypothetical protein PFAM:PF02080.26 contig_2 cds 206815 207132 - GCA000529525_00758 hypothetical protein PFAM:PF01096.23 contig_2 cds 207557 207967 - GCA000529525_00759 hypothetical protein PFAM:PF01850.27 contig_2 cds 207960 208199 - GCA000529525_00760 hypothetical protein contig_2 cds 209250 209771 - GCA000529525_00761 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_2 cds 209966 210682 + GCA000529525_00762 hypothetical protein contig_2 cds 210734 211498 + GCA000529525_00763 hypothetical protein contig_2 cds 211504 212265 + GCA000529525_00764 hypothetical protein PFAM:PF01026.27 contig_2 cds 212255 212623 - GCA000529525_00765 hypothetical protein contig_2 cds 212670 213170 - GCA000529525_00766 hypothetical protein contig_2 cds 213167 213556 - GCA000529525_00767 hypothetical protein contig_2 cds 213655 214407 + GCA000529525_00768 cbiF Cobalt-precorrin 4 C11-methyltransferase CbiF SO:0001217, UniRef:UniRef50_W8T9L4 contig_2 cds 214557 215330 - GCA000529525_00769 hypothetical protein PFAM:PF01717.24 contig_2 cds 215480 215785 - GCA000529525_00770 hypothetical protein PFAM:PF08979.16 contig_2 cds 215790 216242 - GCA000529525_00771 hypothetical protein PFAM:PF09001.16 contig_2 cds 216255 217337 - GCA000529525_00772 hypothetical protein contig_2 tRNA 217380 217452 - GCA000529525_00773 trnA tRNA-Ala(ggc) SO:0000254 contig_2 cds 217503 218534 - GCA000529525_00774 hypothetical protein contig_2 cds 218647 218805 - GCA000529525_00775 hypothetical protein PFAM:PF02492.25 contig_2 cds 219090 219206 - GCA000529525_00776 hypothetical protein contig_2 cds 219220 219597 - GCA000529525_00777 hypothetical protein PFAM:PF01155.25 contig_2 cds 219825 220961 + GCA000529525_00778 hypothetical protein PFAM:PF00248.27, PFAM:PF13237.11 contig_2 cds 221190 222590 - GCA000529525_00779 hypothetical protein PFAM:PF07719.23, PFAM:PF09369.15, PFAM:PF14559.12 contig_2 cds 222722 224059 - GCA000529525_00780 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37 contig_2 cds 224286 224609 - GCA000529525_00781 hypothetical protein contig_2 cds 224783 226156 + GCA000529525_00782 hypothetical protein PFAM:PF00270.35, PFAM:PF00580.27, PFAM:PF13086.12, PFAM:PF13245.12 contig_2 cds 226363 227232 + GCA000529525_00783 hypothetical protein PFAM:PF13361.12 contig_2 cds 227245 227826 + GCA000529525_00784 hypothetical protein contig_2 cds 227939 228478 + GCA000529525_00785 hypothetical protein contig_2 cds 228506 229180 + GCA000529525_00786 hypothetical protein contig_2 cds 229224 229865 - GCA000529525_00787 hypothetical protein PFAM:PF12804.13 contig_2 cds 229858 231045 - GCA000529525_00788 hypothetical protein contig_2 cds 231124 232404 - GCA000529525_00789 hypothetical protein PFAM:PF08245.18 contig_2 cds 232503 232898 + GCA000529525_00790 hypothetical protein contig_2 cds 233168 233788 - GCA000529525_00791 hypothetical protein PFAM:PF02463.25, PFAM:PF13558.12 contig_2 cds 234134 235915 - GCA000529525_00792 hypothetical protein PFAM:PF04423.19, PFAM:PF13304.12, PFAM:PF13476.12, PFAM:PF13514.12, PFAM:PF13555.12 contig_2 cds 235912 237126 - GCA000529525_00793 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_2 cds 237355 238080 - GCA000529525_00794 hypothetical protein contig_2 cds 238248 239729 - GCA000529525_00795 hypothetical protein PFAM:PF01935.23, PFAM:PF05872.18, PFAM:PF09378.16 contig_2 cds 239735 240496 - GCA000529525_00796 hypothetical protein PFAM:PF09376.16 contig_2 cds 240622 240801 - GCA000529525_00797 hypothetical protein contig_2 cds 240865 241617 - GCA000529525_00798 hypothetical protein PFAM:PF01884.23 contig_2 cds 241725 241871 - GCA000529525_00799 hypothetical protein contig_2 cds 242031 242546 - GCA000529525_00800 hypothetical protein PFAM:PF04034.18 contig_2 cds 242548 243207 - GCA000529525_00801 hypothetical protein contig_2 cds 243339 244043 + GCA000529525_00802 hypothetical protein contig_2 cds 244060 244599 + GCA000529525_00803 hypothetical protein PFAM:PF01467.32 contig_2 cds 245211 245417 - GCA000529525_00804 Molybdenum-pterin-binding protein 2 SO:0001217, UniRef:UniRef50_P08854 contig_2 cds 245624 246109 + GCA000529525_00805 trmO tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO SO:0001217, UniRef:UniRef50_A0A6P1ZCM4 contig_2 cds 246396 246845 + GCA000529525_00806 hypothetical protein contig_2 assembly_gap 247999 248155 . contig_2 cds 248415 249407 - GCA000529525_00807 hypothetical protein PFAM:PF00891.24, PFAM:PF05175.20, PFAM:PF08100.17, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_2 cds 250079 250642 + GCA000529525_00808 Acetyltransferase SO:0001217, UniRef:UniRef50_A0A1I7JY25 contig_2 cds 250850 251746 + GCA000529525_00809 hypothetical protein PFAM:PF08245.18 contig_2 cds 251821 252285 + GCA000529525_00810 hypothetical protein contig_2 cds 252335 253363 - GCA000529525_00811 hypothetical protein PFAM:PF04389.22 contig_2 cds 253446 254948 - GCA000529525_00812 hypothetical protein PFAM:PF02985.28, PFAM:PF13646.12 contig_2 cds 254950 255999 - GCA000529525_00813 hypothetical protein PFAM:PF13482.12 contig_2 cds 256825 257208 + GCA000529525_00814 hypothetical protein contig_2 cds 257219 257956 + GCA000529525_00815 hypothetical protein contig_2 cds 257966 258244 + GCA000529525_00816 hypothetical protein PFAM:PF13207.12 contig_2 cds 258247 258504 + GCA000529525_00817 hypothetical protein contig_2 cds 258577 259185 - GCA000529525_00818 hypothetical protein PFAM:PF01902.24 contig_2 cds 259190 260011 - GCA000529525_00819 hypothetical protein contig_2 cds 260071 260499 - GCA000529525_00820 hypothetical protein PFAM:PF04021.17 contig_2 cds 260500 261369 - GCA000529525_00821 hypothetical protein contig_2 cds 261453 263069 - GCA000529525_00822 CTP synthase SO:0001217, UniRef:UniRef50_Q97F61 contig_2 cds 263110 263889 - GCA000529525_00823 hypothetical protein PFAM:PF00756.26, PFAM:PF02230.22 contig_2 cds 263908 265275 - GCA000529525_00824 norM putative multidrug resistance protein NorM SO:0001217, UniRef:UniRef50_T0UIN7 contig_2 cds 265357 265893 - GCA000529525_00825 hypothetical protein contig_2 cds 265917 267635 - GCA000529525_00826 hypothetical protein PFAM:PF00208.27, PFAM:PF00742.24, PFAM:PF03447.22 contig_2 cds 267644 268129 - GCA000529525_00827 hypothetical protein contig_2 cds 268143 268358 - GCA000529525_00828 hypothetical protein contig_2 cds 268516 269271 - GCA000529525_00829 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_2 cds 269280 270095 - GCA000529525_00830 Iron ABC transporter permease SO:0001217, UniRef:UniRef50_A0A357XZX3 contig_2 cds 270326 270607 - GCA000529525_00831 hypothetical protein contig_2 cds 270817 271374 - GCA000529525_00832 hypothetical protein PFAM:PF08100.17 contig_2 cds 271398 272513 - GCA000529525_00833 hypothetical protein PFAM:PF01497.23 contig_2 cds 272885 273160 - GCA000529525_00834 hypothetical protein contig_2 cds 273163 273438 - GCA000529525_00835 hypothetical protein contig_2 cds 273431 274495 - GCA000529525_00836 hypothetical protein PFAM:PF13175.12, PFAM:PF13304.12 contig_2 cds 274918 276366 - GCA000529525_00837 hypothetical protein PFAM:PF00733.27, PFAM:PF13522.11, PFAM:PF13537.11 contig_2 cds 276432 277721 + GCA000529525_00838 Methionine gamma-lyase SO:0001217, UniRef:UniRef50_A0AAP8BEH7 contig_2 cds 277748 279214 - GCA000529525_00839 hypothetical protein PFAM:PF00561.26, PFAM:PF00571.33 contig_2 cds 279204 279884 - GCA000529525_00840 hypothetical protein PFAM:PF00035.32 contig_2 cds 280056 280400 + GCA000529525_00841 hypothetical protein contig_2 cds 280412 280759 - GCA000529525_00842 hypothetical protein contig_2 cds 280817 281227 - GCA000529525_00843 hypothetical protein contig_2 cds 281394 281576 - GCA000529525_00844 hypothetical protein contig_2 cds 281642 281875 - GCA000529525_00845 hypothetical protein PFAM:PF01423.28 contig_2 cds 282558 282857 - GCA000529525_00846 hypothetical protein contig_2 cds 282931 283164 - GCA000529525_00847 hypothetical protein contig_2 cds 283139 283552 - GCA000529525_00848 hypothetical protein contig_2 cds 284331 284729 + GCA000529525_00849 hypothetical protein PFAM:PF09183.16 contig_2 cds 284743 285435 + GCA000529525_00850 hypothetical protein contig_2 cds 285453 285821 - GCA000529525_00851 hypothetical protein contig_2 cds 285889 286149 + GCA000529525_00852 hypothetical protein contig_2 cds 286501 286611 - GCA000529525_00853 hypothetical protein PFAM:PF00301.25, PFAM:PF21349.2 contig_2 cds 286621 286755 - GCA000529525_00854 Rubredoxin SO:0001217, UniRef:UniRef50_A0A2U3LEZ3 contig_2 cds 286912 287073 - GCA000529525_00855 hypothetical protein PFAM:PF00301.25, PFAM:PF21349.2 contig_2 cds 287134 287916 - GCA000529525_00856 hypothetical protein PFAM:PF00132.30, PFAM:PF14602.12 contig_2 cds 288029 288430 - GCA000529525_00857 hypothetical protein contig_2 cds 288686 289699 + GCA000529525_00858 hypothetical protein PFAM:PF06508.19 contig_2 cds 289709 289888 + GCA000529525_00859 hypothetical protein contig_2 cds 289917 291338 - GCA000529525_00860 hypothetical protein PFAM:PF00206.25, PFAM:PF14698.11 contig_2 cds 291386 291538 - GCA000529525_00861 hypothetical protein PFAM:PF01599.25 contig_2 cds 291547 291858 - GCA000529525_00862 hypothetical protein contig_2 cds 291874 291993 - GCA000529525_00863 hypothetical protein contig_2 cds 292152 292382 - GCA000529525_00864 hypothetical protein contig_2 cds 292394 292570 - GCA000529525_00865 hypothetical protein PFAM:PF06093.19 contig_2 cds 292567 293133 - GCA000529525_00866 hypothetical protein PFAM:PF00575.29, PFAM:PF03876.22 contig_2 cds 293170 293562 - GCA000529525_00867 hypothetical protein PFAM:PF13638.12, PFAM:PF18477.7 contig_2 cds 293577 294791 - GCA000529525_00868 hypothetical protein PFAM:PF00009.33, PFAM:PF09173.17 contig_2 cds 294842 295225 - GCA000529525_00869 hypothetical protein contig_2 cds 295261 297051 - GCA000529525_00870 hypothetical protein PFAM:PF00009.33, PFAM:PF03144.31, PFAM:PF11987.13, PFAM:PF14578.12 contig_2 cds 297090 297542 - GCA000529525_00871 Nucleoside diphosphate kinase SO:0001217, UniRef:UniRef50_Q5KXU2 contig_2 cds 297539 297700 - GCA000529525_00872 hypothetical protein PFAM:PF01246.26, PFAM:PF06467.20 contig_2 cds 297715 297921 - GCA000529525_00873 hypothetical protein contig_2 cds 297957 298328 - GCA000529525_00874 hypothetical protein PFAM:PF01248.31 contig_2 cds 298789 298986 - GCA000529525_00875 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23, PFAM:PF15630.12 contig_2 cds 299219 300415 - GCA000529525_00876 hypothetical protein contig_2 cds 300613 301083 - GCA000529525_00877 hypothetical protein contig_2 cds 301083 302171 - GCA000529525_00878 hypothetical protein contig_2 cds 302278 302793 - GCA000529525_00879 hypothetical protein PFAM:PF01974.23, PFAM:PF02778.19 contig_2 cds 302882 303595 - GCA000529525_00880 hypothetical protein PFAM:PF01325.25, PFAM:PF02742.21, PFAM:PF04023.20, PFAM:PF13412.12 contig_2 assembly_gap 303885 304014 . contig_2 cds 304314 306413 - GCA000529525_00881 hypothetical protein PFAM:PF01841.26, PFAM:PF09373.15, PFAM:PF13200.12 contig_2 cds 306635 308353 - GCA000529525_00882 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_2 assembly_gap 309033 310241 . contig_2 cds 310281 310682 - GCA000529525_00883 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12 contig_2 cds 310810 313125 - GCA000529525_00884 hypothetical protein PFAM:PF02369.22, PFAM:PF13200.12, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_2 cds 313207 314847 - GCA000529525_00885 hypothetical protein contig_2 cds 315789 315929 + GCA000529525_00886 hypothetical protein contig_2 cds 315981 316433 + GCA000529525_00887 hypothetical protein contig_2 cds 316443 317081 + GCA000529525_00888 hypothetical protein contig_2 cds 317083 318285 - GCA000529525_00889 hydroxymethylglutaryl-CoA reductase (NADPH) SO:0001217, UniRef:UniRef50_A0A2T2S8Q0 contig_2 cds 318286 319146 - GCA000529525_00890 Succinate--CoA ligase [ADP-forming] subunit alpha SO:0001217, UniRef:UniRef50_Q51567 contig_2 cds 319160 319885 - GCA000529525_00891 hypothetical protein contig_2 cds 321898 322572 + GCA000529525_00892 hypothetical protein PFAM:PF01487.21 contig_2 cds 322572 323192 + GCA000529525_00893 hypothetical protein PFAM:PF00717.28, PFAM:PF10502.14 contig_2 cds 323223 323561 - GCA000529525_00894 Nitrogen regulatory protein P-II SO:0001217, UniRef:UniRef50_A0A2Z4UHA8 contig_2 cds 323576 323761 - GCA000529525_00895 hypothetical protein contig_2 assembly_gap 323937 324381 . contig_2 cds 324430 325557 - GCA000529525_00896 Ammonium transporter SO:0001217, UniRef:UniRef50_O66515 contig_2 cds 325732 326073 + GCA000529525_00897 hypothetical protein contig_2 cds 326070 327305 + GCA000529525_00898 hypothetical protein contig_2 cds 327314 327862 + GCA000529525_00899 ubiX Flavin prenyltransferase UbiX SO:0001217, UniRef:UniRef50_A0A140L3I3 contig_2 cds 327863 328432 + GCA000529525_00900 hypothetical protein PFAM:PF00398.26, PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF12847.13, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_2 cds 328433 329191 + GCA000529525_00901 hypothetical protein contig_2 cds 329188 329793 + GCA000529525_00902 hypothetical protein PFAM:PF12804.13 contig_2 cds 329790 330575 - GCA000529525_00903 hypothetical protein PFAM:PF01138.27, PFAM:PF03725.20 contig_2 cds 330585 331283 - GCA000529525_00904 hypothetical protein PFAM:PF01138.27, PFAM:PF03725.20 contig_2 cds 331335 332234 - GCA000529525_00905 hypothetical protein PFAM:PF00013.35, PFAM:PF00575.29, PFAM:PF14382.12, PFAM:PF15985.11, PFAM:PF21266.3, PFAM:PF22625.2 contig_2 cds 332262 332960 - GCA000529525_00906 hypothetical protein PFAM:PF01172.24, PFAM:PF09377.16, PFAM:PF20268.4 contig_2 cds 332990 333754 - GCA000529525_00907 hypothetical protein PFAM:PF00227.31 contig_2 cds 333962 334318 - GCA000529525_00908 hypothetical protein contig_2 cds 334308 335012 - GCA000529525_00909 hypothetical protein PFAM:PF01876.22 contig_2 cds 335442 335723 + GCA000529525_00910 hypothetical protein PFAM:PF14947.12 contig_2 cds 335725 336144 - GCA000529525_00911 hypothetical protein contig_2 cds 336117 336698 - GCA000529525_00912 hypothetical protein contig_2 cds 336916 337593 - GCA000529525_00913 hypothetical protein PFAM:PF12172.15, PFAM:PF13240.11 contig_2 cds 337606 339864 - GCA000529525_00914 hypothetical protein PFAM:PF00575.29, PFAM:PF01336.31, PFAM:PF01368.27 contig_2 cds 339881 340381 - GCA000529525_00915 hypothetical protein contig_2 cds 340459 340833 - GCA000529525_00916 hypothetical protein PFAM:PF01880.24 contig_2 cds 340890 341261 - GCA000529525_00917 nifU NIF system FeS cluster assembly NifU N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A0K8JIH9 contig_2 cds 341274 342458 - GCA000529525_00918 iscS Cysteine desulfurase IscS SO:0001217, UniRef:UniRef50_A0A3B8NMT2 contig_2 cds 342498 343796 - GCA000529525_00919 O-acetyl-L-homoserine sulfhydrylase 1 SO:0001217, UniRef:UniRef50_Q5SK88 contig_2 cds 344077 345417 - GCA000529525_00920 Cysteine--tRNA ligase SO:0001217, UniRef:UniRef50_A0A1G2FB13 contig_2 tRNA 345449 345520 - GCA000529525_00921 trnC tRNA-Cys(gca) SO:0000258 contig_2 cds 345589 345963 - GCA000529525_00922 hypothetical protein PFAM:PF01381.28 contig_2 cds 345975 346673 - GCA000529525_00923 Serine acetyltransferase SO:0001217, UniRef:UniRef50_A0A3M1HI88 contig_2 cds 346747 347103 - GCA000529525_00924 hypothetical protein contig_2 cds 347250 347693 - GCA000529525_00925 hypothetical protein contig_2 cds 347784 348407 - GCA000529525_00926 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_2 cds 348407 349723 - GCA000529525_00927 hypothetical protein contig_2 cds 349933 350088 + GCA000529525_00928 hypothetical protein PFAM:PF08000.17 contig_2 cds 350273 351055 - GCA000529525_00929 Rebeccamycin O-methyltransferase SO:0001217, UniRef:UniRef50_A0AAQ1UH95 contig_2 cds 351364 354078 - GCA000529525_00930 hypothetical protein PFAM:PF00133.28, PFAM:PF08264.19 contig_2 cds 354987 355208 + GCA000529525_00931 hypothetical protein contig_2 cds 355243 355356 + GCA000529525_00932 hypothetical protein contig_2 cds 355325 355609 + GCA000529525_00933 hypothetical protein contig_2 cds 356769 358511 + GCA000529525_00934 hypothetical protein PFAM:PF02415.23 contig_2 cds 359028 359270 + GCA000529525_00935 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12 contig_2 cds 359309 359479 + GCA000529525_00936 hypothetical protein PFAM:PF13592.12 contig_2 cds 359537 359899 - GCA000529525_00937 hypothetical protein contig_2 cds 361973 362329 + GCA000529525_00938 hypothetical protein contig_2 cds 362345 364000 + GCA000529525_00939 hypothetical protein PFAM:PF01409.25, PFAM:PF03483.22, PFAM:PF03484.21, PFAM:PF17759.6 contig_2 cds 364143 364532 - GCA000529525_00940 hypothetical protein contig_2 cds 364571 366223 - GCA000529525_00941 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_2 cds 366462 369449 + GCA000529525_00942 hypothetical protein PFAM:PF02369.22, PFAM:PF05048.19, PFAM:PF13229.12, PFAM:PF13620.12, PFAM:PF17789.7 contig_2 cds 369479 369703 - GCA000529525_00943 hypothetical protein contig_2 cds 369712 370398 - GCA000529525_00944 hypothetical protein contig_2 cds 370407 370844 - GCA000529525_00945 hypothetical protein contig_2 cds 370845 371888 - GCA000529525_00946 hypothetical protein PFAM:PF00465.25 contig_2 cds 372103 372816 - GCA000529525_00947 hypothetical protein PFAM:PF01345.24 contig_2 cds 372960 374615 - GCA000529525_00948 hypothetical protein PFAM:PF02415.23 contig_2 assembly_gap 376550 376730 . contig_2 cds 377167 377955 - GCA000529525_00949 hypothetical protein contig_2 cds 378085 378405 - GCA000529525_00950 hypothetical protein contig_2 cds 378392 378616 - GCA000529525_00951 hypothetical protein contig_2 cds 380355 381245 + GCA000529525_00952 hypothetical protein PFAM:PF00587.30 contig_2 cds 381254 381757 + GCA000529525_00953 hypothetical protein PFAM:PF03129.25, PFAM:PF09180.16 contig_2 cds 381767 382264 + GCA000529525_00954 hypothetical protein PFAM:PF12804.13 contig_2 cds 382291 382440 + GCA000529525_00955 hypothetical protein contig_2 cds 382441 383181 + GCA000529525_00956 hypothetical protein PFAM:PF00294.29 contig_2 cds 383186 383938 - GCA000529525_00957 cmpD Bicarbonate transport ATP-binding protein CmpD SO:0001217, UniRef:UniRef50_A0A1S1V9B1 contig_2 cds 383947 384693 - GCA000529525_00958 hypothetical protein contig_2 assembly_gap 385214 385704 . contig_2 cds 386163 389639 - GCA000529525_00959 hypothetical protein PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF24025.1 contig_2 cds 389861 392005 - GCA000529525_00960 Cd(2+)-exporting ATPase SO:0001217, UniRef:UniRef50_U2JSI1 contig_2 cds 392033 392299 - GCA000529525_00961 hypothetical protein contig_2 cds 392756 393616 + GCA000529525_00962 hypothetical protein contig_2 cds 393696 394460 + GCA000529525_00963 hypothetical protein contig_2 cds 394475 394804 - GCA000529525_00964 hypothetical protein contig_2 cds 394869 395252 - GCA000529525_00965 hypothetical protein contig_2 cds 395433 395774 + GCA000529525_00966 hypothetical protein contig_2 cds 395847 396125 + GCA000529525_00967 hypothetical protein contig_2 cds 396279 397346 + GCA000529525_00968 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12569.14, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF22860.2, PFAM:PF25062.1, PFAM:PF25064.1 contig_2 cds 397389 397862 - GCA000529525_00969 hypothetical protein contig_2 cds 397834 398391 - GCA000529525_00970 hypothetical protein contig_2 cds 400583 400933 - GCA000529525_00971 hypothetical protein contig_2 cds 401026 401646 - GCA000529525_00972 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_2 cds 401662 402279 - GCA000529525_00973 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_2 cds 403009 403512 + GCA000529525_00974 Sulfate exporter family transporter SO:0001217, UniRef:UniRef50_A0A9D2U2K5 contig_2 cds 403478 403933 - GCA000529525_00975 hypothetical protein contig_2 cds 405120 406748 + GCA000529525_00976 hypothetical protein PFAM:PF00496.27 contig_2 cds 406809 407801 + GCA000529525_00977 hypothetical protein contig_2 cds 407931 408626 + GCA000529525_00978 ABC transmembrane type-1 domain-containing protein SO:0001217, UniRef:UniRef50_R9MB22 contig_2 cds 408637 409584 + GCA000529525_00979 nikD Nickel import system ATP-binding protein NikD SO:0001217, UniRef:UniRef50_A0A1M7T254 contig_2 cds 409586 410128 + GCA000529525_00980 Dipeptide ABC superfamily ATP binding cassette transporter, ABC protein SO:0001217, UniRef:UniRef50_F9ENK6 contig_2 cds 410238 410912 - GCA000529525_00981 hypothetical protein contig_2 cds 411177 411803 - GCA000529525_00982 Uracil phosphoribosyltransferase SO:0001217, UniRef:UniRef50_Q5SIQ7 contig_2 cds 411796 413085 - GCA000529525_00983 Uracil permease SO:0001217, UniRef:UniRef50_A0A3B8SNL8 contig_2 cds 413298 413939 - GCA000529525_00984 hypothetical protein contig_2 cds 414213 414533 + GCA000529525_00985 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12 contig_2 assembly_gap 414553 414993 . contig_2 cds 415584 415859 + GCA000529525_00986 hypothetical protein contig_2 cds 415752 416129 - GCA000529525_00987 GtrA/DPMS transmembrane domain-containing protein SO:0001217, UniRef:UniRef50_R9LNT3 contig_2 cds 416153 417646 - GCA000529525_00988 hypothetical protein contig_2 cds 417718 418656 - GCA000529525_00989 Bactoprenol glucosyl transferase-like protein from prophage CPS-53 SO:0001217, UniRef:UniRef50_A0A174NEJ2 contig_2 cds 419104 419682 - GCA000529525_00990 hypothetical protein PFAM:PF01609.27 contig_2 cds 420021 420311 - GCA000529525_00991 hypothetical protein contig_2 cds 420426 420713 - GCA000529525_00992 hypothetical protein PFAM:PF16363.11 contig_2 cds 421020 421655 - GCA000529525_00993 hypothetical protein PFAM:PF00571.33 contig_2 cds 421668 422495 - GCA000529525_00994 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_2 cds 422558 423490 - GCA000529525_00995 hypothetical protein PFAM:PF00294.29 contig_2 cds 423500 424390 - GCA000529525_00996 hypothetical protein PFAM:PF01913.23, PFAM:PF02741.20 contig_2 cds 424400 425446 - GCA000529525_00997 hypothetical protein contig_2 cds 425451 426809 - GCA000529525_00998 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13247.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_2 cds 426815 427840 - GCA000529525_00999 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_2 cds 427841 428965 - GCA000529525_01000 hypothetical protein contig_2 cds 428962 429411 - GCA000529525_01001 hypothetical protein PFAM:PF01058.29 contig_2 cds 429431 429694 - GCA000529525_01002 hypothetical protein PFAM:PF09218.15 contig_2 cds 429821 430129 - GCA000529525_01003 hypothetical protein contig_2 cds 430138 430392 - GCA000529525_01004 hypothetical protein contig_2 cds 430405 431256 - GCA000529525_01005 hypothetical protein contig_2 cds 431273 431488 - GCA000529525_01006 hypothetical protein contig_2 cds 431497 432168 - GCA000529525_01007 hypothetical protein PFAM:PF00361.26 contig_2 cds 432178 432873 - GCA000529525_01008 hypothetical protein contig_2 cds 432873 433466 - GCA000529525_01009 hypothetical protein contig_2 cds 433463 433675 - GCA000529525_01010 hypothetical protein contig_2 cds 433693 433983 - GCA000529525_01011 hypothetical protein contig_2 cds 433993 434241 - GCA000529525_01012 hypothetical protein contig_2 cds 434246 434743 - GCA000529525_01013 hypothetical protein contig_2 cds 434736 435119 - GCA000529525_01014 hypothetical protein contig_2 cds 435234 436142 + GCA000529525_01015 UDP-N-acetylglucosamine 4-epimerase SO:0001217, UniRef:UniRef50_A0A2H5VZ82 contig_2 cds 436175 437005 + GCA000529525_01016 hypothetical protein contig_2 cds 436986 437351 - GCA000529525_01017 hypothetical protein contig_2 cds 437528 438079 + GCA000529525_01018 hypothetical protein PFAM:PF01381.28, PFAM:PF07883.17, PFAM:PF12844.13 contig_2 cds 438099 439766 + GCA000529525_01019 Acetyl-coenzyme A synthetase SO:0001217, UniRef:UniRef50_K5ZS30 contig_2 cds 439778 440056 + GCA000529525_01020 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF14697.11 contig_2 cds 440062 441174 + GCA000529525_01021 hypothetical protein PFAM:PF17147.9 contig_2 cds 441186 442628 + GCA000529525_01022 hypothetical protein PFAM:PF01558.24, PFAM:PF02775.26 contig_2 cds 442639 443949 + GCA000529525_01023 hypothetical protein PFAM:PF00710.25, PFAM:PF17763.6, PFAM:PF18195.6 contig_2 cds 443962 445827 + GCA000529525_01024 hypothetical protein PFAM:PF02637.23, PFAM:PF02934.20, PFAM:PF02938.19 contig_2 assembly_gap 446305 446500 . contig_2 cds 446556 446822 + GCA000529525_01025 hypothetical protein PFAM:PF13358.12 contig_2 cds 446993 447403 + GCA000529525_01026 hypothetical protein contig_2 cds 447405 448085 + GCA000529525_01027 hypothetical protein PFAM:PF03749.19, PFAM:PF17746.7 contig_2 cds 448151 448666 + GCA000529525_01028 hypothetical protein PFAM:PF00440.29 contig_2 cds 449272 449883 - GCA000529525_01029 hypothetical protein contig_2 cds 449935 450222 + GCA000529525_01030 hypothetical protein PFAM:PF07992.20 contig_2 cds 450327 450551 + GCA000529525_01031 hypothetical protein PFAM:PF00070.33, PFAM:PF07992.20 contig_2 cds 450527 450886 + GCA000529525_01032 hypothetical protein PFAM:PF07992.20 contig_2 cds 451172 451744 + GCA000529525_01033 hypothetical protein PFAM:PF00117.34, PFAM:PF07722.19 contig_2 cds 451737 451991 + GCA000529525_01034 hypothetical protein contig_2 cds 452441 452917 + GCA000529525_01035 hypothetical protein PFAM:PF00958.27 contig_2 cds 452967 453824 + GCA000529525_01036 hypothetical protein contig_2 cds 453851 454135 + GCA000529525_01037 hypothetical protein contig_2 cds 454181 455101 + GCA000529525_01038 hypothetical protein PFAM:PF01041.23 contig_2 cds 455079 455567 - GCA000529525_01039 hypothetical protein PFAM:PF08617.15 contig_2 cds 455575 457044 - GCA000529525_01040 hypothetical protein PFAM:PF00682.25, PFAM:PF08502.15, PFAM:PF22617.1 contig_2 rRNA 457121 457238 - GCA000529525_01041 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_3 cds 106 2073 + GCA000529525_01042 hypothetical protein contig_3 cds 2874 3326 + GCA000529525_01043 hypothetical protein PFAM:PF02415.23 contig_3 cds 3416 9337 + GCA000529525_01044 hypothetical protein PFAM:PF02369.22, PFAM:PF05688.17, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_3 cds 9334 9999 + GCA000529525_01045 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_3 cds 10488 15848 - GCA000529525_01046 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_3 cds 16872 17081 + GCA000529525_01047 hypothetical protein contig_3 assembly_gap 17355 17623 . contig_3 cds 17677 18123 - GCA000529525_01048 hypothetical protein contig_3 cds 18818 19732 - GCA000529525_01049 hypothetical protein PFAM:PF01047.28, PFAM:PF01895.24, PFAM:PF13412.12 contig_3 cds 19698 20522 - GCA000529525_01050 hypothetical protein contig_3 cds 20609 22105 - GCA000529525_01051 hypothetical protein contig_3 cds 22446 23462 + GCA000529525_01052 hypothetical protein PFAM:PF22616.2 contig_3 cds 24167 24598 + GCA000529525_01053 hypothetical protein PFAM:PF06968.18 contig_3 cds 24633 25112 + GCA000529525_01054 hypothetical protein PFAM:PF11576.13 contig_3 cds 25116 25592 + GCA000529525_01055 hypothetical protein contig_3 cds 25661 25900 + GCA000529525_01056 hypothetical protein contig_3 cds 25901 26596 + GCA000529525_01057 hypothetical protein contig_3 cds 26611 27261 + GCA000529525_01058 hypothetical protein contig_3 cds 27245 27811 + GCA000529525_01059 hypothetical protein contig_3 tRNA 27813 27885 - GCA000529525_01060 trnT tRNA-Thr(ggt) SO:0000270 contig_3 tRNA 27921 28003 - GCA000529525_01061 trnL tRNA-Leu(taa) SO:0000264 contig_3 cds 28372 29142 + GCA000529525_01062 hypothetical protein contig_3 cds 29538 30431 + GCA000529525_01063 hypothetical protein contig_3 cds 30685 31314 + GCA000529525_01064 hypothetical protein contig_3 cds 31316 31615 + GCA000529525_01065 hypothetical protein PFAM:PF13190.11 contig_3 cds 31671 32405 + GCA000529525_01066 hypothetical protein contig_3 cds 32510 33352 + GCA000529525_01067 ecfA Energy-coupling factor transporter ATP-binding protein EcfA SO:0001217, UniRef:UniRef50_Q3ABN1 contig_3 cds 33345 33599 - GCA000529525_01068 hypothetical protein contig_3 cds 33586 33816 - GCA000529525_01069 Fe(2+) transport protein A SO:0001217, UniRef:UniRef50_A0A9E2F4A8 contig_3 cds 33848 35554 - GCA000529525_01070 hypothetical protein PFAM:PF07670.19, PFAM:PF17910.6 contig_3 cds 35554 35949 - GCA000529525_01071 feoB Iron transporter FeoB SO:0001217, UniRef:UniRef50_A0A2A6RIG6 contig_3 cds 36685 36801 + GCA000529525_01072 hypothetical protein contig_3 cds 36962 37681 + GCA000529525_01073 hypothetical protein contig_3 cds 38095 38226 - GCA000529525_01074 hypothetical protein contig_3 cds 38424 38984 + GCA000529525_01075 hypothetical protein PFAM:PF13508.13, PFAM:PF13673.13 contig_3 cds 38974 39885 - GCA000529525_01076 hypothetical protein PFAM:PF00482.28 contig_3 cds 39878 41320 - GCA000529525_01077 hypothetical protein PFAM:PF00437.27 contig_3 cds 41432 42370 + GCA000529525_01078 hypothetical protein PFAM:PF05175.20 contig_3 cds 42744 43058 + GCA000529525_01079 hypothetical protein contig_3 cds 43334 43459 - GCA000529525_01080 hypothetical protein contig_3 cds 43456 44583 - GCA000529525_01081 hypothetical protein contig_3 cds 44753 45367 + GCA000529525_01082 hypothetical protein contig_3 cds 45364 45831 - GCA000529525_01083 hypothetical protein PFAM:PF01047.28 contig_3 cds 45927 46196 - GCA000529525_01084 hypothetical protein PFAM:PF00736.24 contig_3 cds 46217 46378 - GCA000529525_01085 hypothetical protein PFAM:PF07754.17 contig_3 cds 46379 47038 - GCA000529525_01086 hypothetical protein contig_3 cds 47092 47430 - GCA000529525_01087 hypothetical protein contig_3 cds 47963 48946 + GCA000529525_01088 hypothetical protein contig_3 cds 48958 49548 - GCA000529525_01089 hypothetical protein contig_3 cds 49786 50196 - GCA000529525_01090 hypothetical protein PFAM:PF00005.33 contig_3 cds 50376 51506 - GCA000529525_01091 hypothetical protein PFAM:PF00005.33, PFAM:PF00485.24, PFAM:PF00910.28, PFAM:PF00931.28, PFAM:PF01078.27, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13479.12, PFAM:PF13555.12, PFAM:PF20720.3 contig_3 cds 51516 53282 - GCA000529525_01092 hypothetical protein PFAM:PF00005.33 contig_3 cds 53282 54796 - GCA000529525_01093 hypothetical protein PFAM:PF00005.33 contig_3 cds 55093 55659 - GCA000529525_01094 hypothetical protein contig_3 cds 55995 57773 + GCA000529525_01095 hypothetical protein PFAM:PF00005.33, PFAM:PF00037.32 contig_3 cds 57770 58138 - GCA000529525_01096 hypothetical protein PFAM:PF08859.16 contig_3 cds 58398 58568 - GCA000529525_01097 hypothetical protein contig_3 cds 58578 59564 - GCA000529525_01098 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25 contig_3 cds 59507 59752 - GCA000529525_01099 hypothetical protein contig_3 cds 60112 60783 - GCA000529525_01100 hypothetical protein PFAM:PF13529.12 contig_3 cds 60834 61598 - GCA000529525_01101 hypothetical protein PFAM:PF22337.1 contig_3 cds 61603 63924 - GCA000529525_01102 hypothetical protein contig_3 assembly_gap 64218 65773 . contig_3 cds 65930 66349 - GCA000529525_01103 hypothetical protein contig_3 cds 66391 66600 - GCA000529525_01104 hypothetical protein contig_3 cds 66597 66854 - GCA000529525_01105 hypothetical protein contig_3 cds 66881 68356 - GCA000529525_01106 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11 contig_3 cds 68447 70123 - GCA000529525_01107 hypothetical protein PFAM:PF07602.17 contig_3 cds 70125 70412 - GCA000529525_01108 hypothetical protein contig_3 cds 70517 71269 - GCA000529525_01109 hypothetical protein contig_3 cds 71266 71694 - GCA000529525_01110 hypothetical protein contig_3 cds 71716 72993 - GCA000529525_01111 hypothetical protein contig_3 cds 72997 73683 - GCA000529525_01112 hypothetical protein contig_3 cds 73680 74771 - GCA000529525_01113 hypothetical protein PFAM:PF24032.1 contig_3 cds 74797 75030 - GCA000529525_01114 hypothetical protein contig_3 cds 74985 75710 - GCA000529525_01115 hypothetical protein contig_3 cds 75715 76218 - GCA000529525_01116 hypothetical protein contig_3 cds 76224 79637 - GCA000529525_01117 hypothetical protein contig_3 cds 79658 79876 - GCA000529525_01118 hypothetical protein contig_3 cds 79851 80282 - GCA000529525_01119 hypothetical protein contig_3 cds 80483 80584 - GCA000529525_01120 hypothetical protein contig_3 cds 80770 81027 - GCA000529525_01121 hypothetical protein contig_3 cds 81065 82198 - GCA000529525_01122 hypothetical protein contig_3 cds 82204 82398 - GCA000529525_01123 hypothetical protein contig_3 cds 82448 83059 - GCA000529525_01124 hypothetical protein contig_3 cds 83094 83576 - GCA000529525_01125 hypothetical protein contig_3 cds 83581 83916 - GCA000529525_01126 hypothetical protein contig_3 cds 83917 84378 - GCA000529525_01127 hypothetical protein contig_3 cds 84441 85463 - GCA000529525_01128 hypothetical protein contig_3 cds 85489 86541 - GCA000529525_01129 hypothetical protein contig_3 cds 86794 86901 + GCA000529525_01130 hypothetical protein contig_3 cds 86936 87463 - GCA000529525_01131 hypothetical protein contig_3 cds 87632 87940 - GCA000529525_01132 hypothetical protein contig_3 cds 87982 88410 - GCA000529525_01133 hypothetical protein contig_3 cds 88518 89723 - GCA000529525_01134 hypothetical protein contig_3 cds 89725 91023 - GCA000529525_01135 hypothetical protein contig_3 cds 91047 91670 - GCA000529525_01136 hypothetical protein PFAM:PF17289.8 contig_3 cds 91697 92428 - GCA000529525_01137 hypothetical protein contig_3 cds 92382 92963 - GCA000529525_01138 hypothetical protein contig_3 cds 93056 93385 - GCA000529525_01139 hypothetical protein contig_3 cds 93392 93661 - GCA000529525_01140 hypothetical protein contig_3 cds 93983 94309 - GCA000529525_01141 hypothetical protein contig_3 cds 94577 95056 - GCA000529525_01142 hypothetical protein contig_3 cds 95128 95361 - GCA000529525_01143 hypothetical protein contig_3 cds 95363 95560 - GCA000529525_01144 hypothetical protein contig_3 cds 95957 96097 - GCA000529525_01145 hypothetical protein contig_3 cds 96115 96222 - GCA000529525_01146 hypothetical protein contig_3 cds 96232 96567 - GCA000529525_01147 hypothetical protein contig_3 cds 96772 97056 - GCA000529525_01148 hypothetical protein contig_3 cds 97246 97863 - GCA000529525_01149 hypothetical protein PFAM:PF13391.12 contig_3 cds 97856 98089 - GCA000529525_01150 hypothetical protein PFAM:PF04434.22 contig_3 cds 98094 98591 - GCA000529525_01151 hypothetical protein contig_3 cds 98593 98907 - GCA000529525_01152 hypothetical protein PFAM:PF08960.15 contig_3 cds 98913 99425 - GCA000529525_01153 hypothetical protein PFAM:PF13392.12 contig_3 cds 99395 99955 - GCA000529525_01154 hypothetical protein PFAM:PF13479.12 contig_3 cds 99958 100221 - GCA000529525_01155 hypothetical protein contig_3 cds 100218 100715 - GCA000529525_01156 hypothetical protein contig_3 cds 100712 101401 - GCA000529525_01157 hypothetical protein contig_3 cds 101394 101558 - GCA000529525_01158 hypothetical protein contig_3 cds 101752 101964 + GCA000529525_01159 KTSC domain-containing protein SO:0001217, UniRef:UniRef50_W0N2E5 contig_3 cds 101981 102142 - GCA000529525_01160 hypothetical protein contig_3 cds 102257 102412 + GCA000529525_01161 hypothetical protein contig_3 cds 102868 103335 - GCA000529525_01162 hypothetical protein contig_3 cds 103332 104006 - GCA000529525_01163 hypothetical protein contig_3 cds 103973 104473 - GCA000529525_01164 hypothetical protein contig_3 cds 105010 106350 + GCA000529525_01165 N-6 DNA methylase SO:0001217, UniRef:UniRef50_UPI002E77C82A contig_3 cds 106365 106892 + GCA000529525_01166 hypothetical protein contig_3 cds 106900 107319 + GCA000529525_01167 hypothetical protein PFAM:PF01420.25 contig_3 cds 107360 107989 + GCA000529525_01168 hypothetical protein PFAM:PF01420.25 contig_3 cds 108122 108502 - GCA000529525_01169 hypothetical protein contig_3 cds 108506 108949 - GCA000529525_01170 hypothetical protein contig_3 cds 108975 109283 - GCA000529525_01171 hypothetical protein contig_3 cds 109361 109645 - GCA000529525_01172 hypothetical protein contig_3 cds 109785 109988 - GCA000529525_01173 hypothetical protein contig_3 cds 109945 110442 - GCA000529525_01174 hypothetical protein contig_3 cds 110585 110890 - GCA000529525_01175 hypothetical protein contig_3 cds 110990 111277 - GCA000529525_01176 hypothetical protein contig_3 cds 111504 111695 - GCA000529525_01177 hypothetical protein contig_3 cds 111797 112501 - GCA000529525_01178 hypothetical protein PFAM:PF05707.18, PFAM:PF06745.19, PFAM:PF08423.17, PFAM:PF13479.12, PFAM:PF13481.12 contig_3 cds 112613 113521 + GCA000529525_01179 hypothetical protein contig_3 cds 113529 113837 - GCA000529525_01180 hypothetical protein contig_3 cds 113846 114109 - GCA000529525_01181 hypothetical protein contig_3 cds 114157 114723 + GCA000529525_01182 hypothetical protein contig_3 cds 114720 114962 + GCA000529525_01183 hypothetical protein contig_3 cds 114973 115359 - GCA000529525_01184 hypothetical protein PFAM:PF00005.33 contig_3 cds 115449 115676 - GCA000529525_01185 hypothetical protein PFAM:PF00005.33 contig_3 cds 115685 116821 - GCA000529525_01186 hypothetical protein PFAM:PF02687.27, PFAM:PF12704.14 contig_3 cds 116856 117032 + GCA000529525_01187 hypothetical protein PFAM:PF12636.12 contig_3 cds 117126 117608 - GCA000529525_01188 Fructose-1,6-bisphosphate aldolase/phosphatase SO:0001217, UniRef:UniRef50_A0A661AH95 contig_3 cds 117560 118219 - GCA000529525_01189 hypothetical protein contig_3 cds 118328 119473 - GCA000529525_01190 hypothetical protein PFAM:PF02540.23, PFAM:PF02926.22, PFAM:PF03054.22, PFAM:PF06508.19, PFAM:PF22025.1 contig_3 cds 119712 120092 - GCA000529525_01191 hypothetical protein contig_3 cds 120168 120428 + GCA000529525_01192 hypothetical protein contig_3 cds 120438 120587 + GCA000529525_01193 hypothetical protein contig_3 cds 120650 121249 + GCA000529525_01194 hypothetical protein contig_3 cds 121450 121656 - GCA000529525_01195 hypothetical protein PFAM:PF13358.12 contig_3 cds 122312 122776 - GCA000529525_01196 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_3 cds 122919 125606 - GCA000529525_01197 hypothetical protein PFAM:PF02272.25, PFAM:PF07973.19 contig_3 cds 125764 126069 - GCA000529525_01198 hypothetical protein contig_3 cds 126131 127138 - GCA000529525_01199 hypothetical protein PFAM:PF17777.6 contig_3 cds 127138 127776 - GCA000529525_01200 hypothetical protein PFAM:PF00687.26 contig_3 cds 127949 128428 - GCA000529525_01201 hypothetical protein PFAM:PF00298.24, PFAM:PF03946.19 contig_3 cds 128428 128895 - GCA000529525_01202 hypothetical protein contig_3 cds 129274 129453 - GCA000529525_01203 hypothetical protein contig_3 cds 129538 130674 - GCA000529525_01204 hypothetical protein PFAM:PF00091.31, PFAM:PF12327.13 contig_3 cds 131459 132244 + GCA000529525_01205 hypothetical protein contig_3 cds 132244 132396 + GCA000529525_01206 hypothetical protein contig_3 cds 133866 134438 - GCA000529525_01207 hypothetical protein PFAM:PF02887.21 contig_3 cds 134512 135369 + GCA000529525_01208 hypothetical protein contig_3 cds 135510 136205 + GCA000529525_01209 hypothetical protein contig_3 cds 136277 137371 + GCA000529525_01210 capD Capsular polysaccharide biosynthesis protein CapD SO:0001217, UniRef:UniRef50_A0A0K8J5Z8 contig_3 cds 137386 137505 + GCA000529525_01211 (pseudo) DegT/DnrJ/EryC1/StrS family aminotransferase SO:0001217, UniRef:UniRef50_A0A968MWX4, UniRef:UniRef90_UPI0035A6D6DE contig_3 cds 137565 138584 + GCA000529525_01212 Glutamine--scyllo-inositol transaminase SO:0001217, UniRef:UniRef50_A0A7Z9DJ26 contig_3 cds 138700 139059 + GCA000529525_01213 hypothetical protein contig_3 cds 139029 139220 + GCA000529525_01214 hypothetical protein contig_3 cds 139226 139717 + GCA000529525_01215 HD domain-containing protein SO:0001217, UniRef:UniRef50_A0A1G1GSR3 contig_3 cds 139719 140627 + GCA000529525_01216 hypothetical protein PFAM:PF14810.12, PFAM:PF17884.7 contig_3 cds 140708 140992 + GCA000529525_01217 hypothetical protein PFAM:PF01883.24 contig_3 tRNA 141098 141172 + GCA000529525_01218 trnI tRNA-Ile(gat) SO:0000263 contig_3 cds 141284 141787 + GCA000529525_01219 hypothetical protein contig_3 cds 141784 142053 - GCA000529525_01220 HypC/HybG/HupF family hydrogenase formation chaperone SO:0001217, UniRef:UniRef50_A0A3B9V7P3 contig_3 cds 142129 143430 + GCA000529525_01221 hypothetical protein PFAM:PF00070.33, PFAM:PF07992.20 contig_3 cds 143436 144485 - GCA000529525_01222 hypothetical protein PFAM:PF13692.12 contig_3 cds 144490 145449 - GCA000529525_01223 hypothetical protein contig_3 cds 145530 145715 - GCA000529525_01224 hypothetical protein PFAM:PF03465.20 contig_3 cds 146215 146589 - GCA000529525_01225 hypothetical protein PFAM:PF03463.20 contig_3 cds 146661 147962 + GCA000529525_01226 hypothetical protein PFAM:PF02153.23, PFAM:PF03446.21, PFAM:PF20463.3 contig_3 cds 148296 148592 + GCA000529525_01227 hypothetical protein PFAM:PF02359.24 contig_3 cds 148658 150487 + GCA000529525_01228 ftsH ATP-dependent zinc metalloprotease FtsH SO:0001217, UniRef:UniRef50_A0A1V5I9R8 contig_3 cds 151196 151522 + GCA000529525_01229 hypothetical protein PFAM:PF01964.24 contig_3 cds 151522 152469 + GCA000529525_01230 hypothetical protein PFAM:PF01964.24 contig_3 cds 152469 154127 + GCA000529525_01231 hypothetical protein PFAM:PF01068.26 contig_3 cds 154274 154672 + GCA000529525_01232 hypothetical protein contig_3 cds 154729 156093 + GCA000529525_01233 hypothetical protein PFAM:PF00408.26, PFAM:PF02878.22, PFAM:PF02879.22, PFAM:PF02880.22 contig_3 cds 156265 156378 - GCA000529525_01234 hypothetical protein contig_3 cds 156396 157400 - GCA000529525_01235 hypothetical protein PFAM:PF00515.34, PFAM:PF01535.26, PFAM:PF03704.23, PFAM:PF04266.20, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14853.12, PFAM:PF20308.4 contig_3 cds 157418 158128 - GCA000529525_01236 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11 contig_3 cds 158128 159228 - GCA000529525_01237 hypothetical protein PFAM:PF00155.27, PFAM:PF00266.25, PFAM:PF01041.23, PFAM:PF01053.26, PFAM:PF04864.19 contig_3 cds 159230 159712 - GCA000529525_01238 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase SO:0001217, UniRef:UniRef50_A0A4Y7S493 contig_3 cds 159724 161004 - GCA000529525_01239 hypothetical protein PFAM:PF00132.30, PFAM:PF12804.13, PFAM:PF14602.12, PFAM:PF24894.1, PFAM:PF25084.1 contig_3 cds 161148 161315 + GCA000529525_01240 hypothetical protein PFAM:PF00301.25 contig_3 cds 161337 162674 - GCA000529525_01241 hypothetical protein PFAM:PF00408.26, PFAM:PF02878.22, PFAM:PF02879.22, PFAM:PF02880.22 contig_3 cds 162685 163923 - GCA000529525_01242 hypothetical protein contig_3 assembly_gap 164242 164560 . contig_3 cds 164756 165436 - GCA000529525_01243 hypothetical protein contig_3 cds 165591 166229 - GCA000529525_01244 hypothetical protein contig_3 cds 167178 168371 + GCA000529525_01245 hypothetical protein contig_3 cds 168371 168571 + GCA000529525_01246 hypothetical protein contig_3 cds 168558 168902 - GCA000529525_01247 hypothetical protein contig_3 cds 168904 169263 - GCA000529525_01248 hypothetical protein PFAM:PF03358.20 contig_3 cds 169253 169498 - GCA000529525_01249 hypothetical protein PFAM:PF03358.20 contig_3 cds 169482 170240 - GCA000529525_01250 hypothetical protein PFAM:PF01048.26 contig_3 cds 170245 171621 - GCA000529525_01251 hypothetical protein contig_3 cds 171728 172048 - GCA000529525_01252 hypothetical protein contig_3 cds 172083 172502 - GCA000529525_01253 hypothetical protein PFAM:PF01951.21 contig_3 cds 172876 173985 - GCA000529525_01254 hypothetical protein PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF22703.2 contig_3 cds 174065 174733 - GCA000529525_01255 hypothetical protein contig_3 cds 174999 175235 + GCA000529525_01256 hypothetical protein contig_3 cds 175342 176484 + GCA000529525_01257 hypothetical protein PFAM:PF00266.25 contig_3 cds 176593 177015 + GCA000529525_01258 hypothetical protein contig_3 cds 177028 177579 + GCA000529525_01259 hypothetical protein contig_3 cds 177569 177832 + GCA000529525_01260 hypothetical protein contig_3 cds 177835 179367 - GCA000529525_01261 hypothetical protein PFAM:PF00205.28, PFAM:PF02775.26, PFAM:PF02776.23 contig_3 cds 179364 179822 - GCA000529525_01262 hypothetical protein PFAM:PF00692.24, PFAM:PF22769.1 contig_3 cds 179920 180105 + GCA000529525_01263 hypothetical protein PFAM:PF01361.26 contig_3 cds 180318 181796 - GCA000529525_01264 hypothetical protein contig_3 cds 181871 182248 + GCA000529525_01265 hypothetical protein contig_3 cds 182250 183173 - GCA000529525_01266 hypothetical protein PFAM:PF13200.12 contig_3 cds 184083 184172 - GCA000529525_01267 hypothetical protein contig_3 cds 184346 185077 - GCA000529525_01268 hypothetical protein PFAM:PF00448.28, PFAM:PF02881.24, PFAM:PF13604.12 contig_3 cds 185721 185897 - GCA000529525_01269 hypothetical protein contig_3 cds 186145 186246 - GCA000529525_01270 hypothetical protein contig_3 cds 186240 186575 - GCA000529525_01271 hypothetical protein PFAM:PF02996.22 contig_3 cds 186595 186819 - GCA000529525_01272 hypothetical protein PFAM:PF01775.22 contig_3 cds 186816 187508 - GCA000529525_01273 hypothetical protein contig_3 cds 187558 187803 - GCA000529525_01274 hypothetical protein contig_3 cds 187816 187971 - GCA000529525_01275 hypothetical protein contig_3 cds 187996 188580 - GCA000529525_01276 hypothetical protein contig_3 cds 188586 188942 - GCA000529525_01277 hypothetical protein contig_3 cds 188966 189403 - GCA000529525_01278 hypothetical protein contig_3 cds 189455 190090 - GCA000529525_01279 hypothetical protein PFAM:PF01985.26 contig_3 gap 190414 190494 . contig_3 cds 190739 191278 - GCA000529525_01280 hypothetical protein PFAM:PF00004.35, PFAM:PF00910.28, PFAM:PF01202.28, PFAM:PF03266.21, PFAM:PF13207.12, PFAM:PF13238.12 contig_3 cds 191298 192392 - GCA000529525_01281 hypothetical protein PFAM:PF00025.27, PFAM:PF02421.24, PFAM:PF02824.27 contig_3 cds 192452 195145 - GCA000529525_01282 hypothetical protein PFAM:PF02516.20, PFAM:PF21436.2 contig_3 cds 195487 197529 - GCA000529525_01283 hypothetical protein PFAM:PF01396.24 contig_3 cds 197499 197636 - GCA000529525_01284 hypothetical protein contig_3 cds 198340 198570 - GCA000529525_01285 hypothetical protein PFAM:PF08984.16 contig_3 cds 198584 199270 - GCA000529525_01286 DUF2249 domain-containing protein SO:0001217, UniRef:UniRef50_A0A1E8VWK5 contig_3 cds 199661 199810 - GCA000529525_01287 hypothetical protein contig_3 cds 200310 201041 - GCA000529525_01288 hypothetical protein PFAM:PF00702.32, PFAM:PF08282.18 contig_3 cds 201055 201600 - GCA000529525_01289 hypothetical protein PFAM:PF00352.27 contig_3 cds 201823 202362 + GCA000529525_01290 hypothetical protein PFAM:PF01928.26 contig_3 cds 202411 203580 + GCA000529525_01291 hypothetical protein PFAM:PF00682.25, PFAM:PF22617.1 contig_3 cds 203593 204846 + GCA000529525_01292 hypothetical protein contig_3 cds 204857 205333 + GCA000529525_01293 hypothetical protein PFAM:PF01947.21, PFAM:PF04345.18 contig_3 cds 205431 206414 + GCA000529525_01294 hypothetical protein contig_3 cds 206411 207061 - GCA000529525_01295 hypothetical protein PFAM:PF09892.16 contig_3 cds 207084 208334 - GCA000529525_01296 hypothetical protein PFAM:PF00670.27, PFAM:PF02826.25, PFAM:PF05221.23 contig_3 tRNA 208494 208603 + GCA000529525_01297 tRNA-Xxx contig_3 cds 208721 209791 + GCA000529525_01298 hypothetical protein PFAM:PF00248.27 contig_3 cds 209792 210547 + GCA000529525_01299 hypothetical protein PFAM:PF00899.27 contig_3 cds 210801 212156 + GCA000529525_01300 hypothetical protein PFAM:PF00120.29, PFAM:PF03951.24 contig_3 cds 212197 212310 + GCA000529525_01301 hypothetical protein PFAM:PF08461.16 contig_3 cds 212334 213875 + GCA000529525_01302 hypothetical protein PFAM:PF01995.21, PFAM:PF08461.16 contig_3 cds 213876 214166 - GCA000529525_01303 hypothetical protein contig_3 cds 214264 214536 - GCA000529525_01304 hypothetical protein contig_3 cds 214607 215473 - GCA000529525_01305 hypothetical protein contig_3 cds 215486 217195 - GCA000529525_01306 hypothetical protein PFAM:PF01979.26, PFAM:PF07969.17 contig_3 cds 217207 218583 - GCA000529525_01307 hypothetical protein PFAM:PF00384.28 contig_3 cds 218573 219142 - GCA000529525_01308 hypothetical protein PFAM:PF01568.27 contig_3 cds 219154 219384 - GCA000529525_01309 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF14697.11 contig_3 cds 219650 220489 - GCA000529525_01310 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11, PFAM:PF17179.9 contig_3 cds 220482 220940 - GCA000529525_01311 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF14697.11 contig_3 cds 221355 222392 + GCA000529525_01312 hypothetical protein PFAM:PF03205.20 contig_3 cds 222393 222803 + GCA000529525_01313 hypothetical protein PFAM:PF04055.27, PFAM:PF13353.11 contig_3 cds 222866 223318 + GCA000529525_01314 hypothetical protein PFAM:PF06463.18 contig_3 cds 223392 224591 - GCA000529525_01315 hypothetical protein PFAM:PF04432.18 contig_3 cds 224608 226752 - GCA000529525_01316 fdhF Hydrogen dependent carbon dioxide reductase subunit FdhF SO:0001217, UniRef:UniRef50_A0A097ATK5 contig_3 cds 226813 227601 - GCA000529525_01317 Formate/nitrite transporter family protein SO:0001217, UniRef:UniRef50_A0A7V9KEM3 contig_3 cds 228033 228623 - GCA000529525_01318 hypothetical protein PFAM:PF01380.27, PFAM:PF13580.11 contig_3 cds 228700 229569 + GCA000529525_01319 hypothetical protein PFAM:PF00126.33 contig_3 cds 229731 230429 + GCA000529525_01320 hypothetical protein PFAM:PF00294.29 contig_3 cds 230888 232186 + GCA000529525_01321 Phosphomethylpyrimidine synthase SO:0001217, UniRef:UniRef50_Q39RJ6 contig_3 cds 232301 233884 + GCA000529525_01322 hypothetical protein PFAM:PF19269.4 contig_3 cds 233953 234423 - GCA000529525_01323 tRNA(adenine(34)) deaminase SO:0001217, UniRef:UniRef50_A0A6N8J6I0 contig_3 cds 234429 235568 - GCA000529525_01324 hypothetical protein contig_3 cds 236195 236368 - GCA000529525_01325 hypothetical protein contig_3 cds 236365 236556 - GCA000529525_01326 hypothetical protein contig_3 cds 236867 238735 + GCA000529525_01327 hypothetical protein PFAM:PF03833.19, PFAM:PF24844.1 contig_3 cds 238861 240165 + GCA000529525_01328 hypothetical protein PFAM:PF22912.2, PFAM:PF24846.1 contig_3 cds 240477 242678 + GCA000529525_01329 hypothetical protein PFAM:PF03477.21 contig_3 cds 244540 244758 - GCA000529525_01330 hypothetical protein contig_3 cds 244964 245134 - GCA000529525_01331 hypothetical protein contig_3 assembly_gap 245923 246256 . contig_3 cds 246789 247142 + GCA000529525_01332 hypothetical protein contig_3 cds 247381 252483 + GCA000529525_01333 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7 contig_3 cds 253642 253851 - GCA000529525_01334 hypothetical protein contig_3 cds 253852 254196 + GCA000529525_01335 hypothetical protein contig_3 cds 254395 254685 + GCA000529525_01336 hypothetical protein contig_3 cds 254691 255035 + GCA000529525_01337 hypothetical protein contig_3 cds 255200 255811 + GCA000529525_01338 hypothetical protein contig_3 cds 255847 256251 + GCA000529525_01339 hypothetical protein PFAM:PF00398.26, PFAM:PF02475.23, PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_3 cds 256278 256547 + GCA000529525_01340 hypothetical protein PFAM:PF00398.26 contig_3 cds 256721 257305 + GCA000529525_01341 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_3 cds 257320 258180 - GCA000529525_01342 hypothetical protein PFAM:PF01678.24 contig_3 cds 258189 259472 - GCA000529525_01343 hypothetical protein PFAM:PF00278.28, PFAM:PF02784.22 contig_3 cds 259640 260095 - GCA000529525_01344 hypothetical protein contig_3 cds 261170 261595 - GCA000529525_01345 hypothetical protein contig_3 cds 261612 262088 - GCA000529525_01346 hypothetical protein contig_3 cds 262078 262218 - GCA000529525_01347 hypothetical protein contig_3 cds 262305 262562 - GCA000529525_01348 hypothetical protein contig_3 cds 262836 263366 - GCA000529525_01349 hypothetical protein PFAM:PF13240.11 contig_3 cds 265100 265504 + GCA000529525_01350 hypothetical protein PFAM:PF00293.34, PFAM:PF14815.12 contig_3 cds 265524 266666 - GCA000529525_01351 hypothetical protein PFAM:PF00202.27 contig_3 cds 266742 267173 + GCA000529525_01352 Peptidyl-prolyl cis-trans isomerase SO:0001217, UniRef:UniRef50_Q7UP01 contig_3 assembly_gap 267373 268114 . contig_3 cds 268424 269074 - GCA000529525_01353 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_3 cds 269200 269355 - GCA000529525_01354 hypothetical protein contig_3 cds 269352 270176 - GCA000529525_01355 hypothetical protein PFAM:PF01207.24, PFAM:PF03060.21, PFAM:PF05690.20 contig_3 cds 270224 270385 - GCA000529525_01356 hypothetical protein contig_3 cds 270439 270810 - GCA000529525_01357 hypothetical protein contig_3 cds 270786 270914 - GCA000529525_01358 hypothetical protein contig_3 cds 270919 272127 - GCA000529525_01359 hypothetical protein PFAM:PF21238.2, PFAM:PF22023.1 contig_3 cds 272132 273016 - GCA000529525_01360 hypothetical protein PFAM:PF00448.28, PFAM:PF02978.25 contig_3 cds 273034 273471 - GCA000529525_01361 hypothetical protein PFAM:PF00448.28, PFAM:PF02881.24 contig_3 cds 273565 274134 + GCA000529525_01362 hypothetical protein PFAM:PF00156.33 contig_3 cds 274136 274900 + GCA000529525_01363 hypothetical protein contig_3 cds 274912 275139 + GCA000529525_01364 hypothetical protein contig_3 cds 275200 275772 + GCA000529525_01365 hypothetical protein PFAM:PF10447.15, PFAM:PF14382.12 contig_3 cds 275784 276062 + GCA000529525_01366 hypothetical protein PFAM:PF01193.29, PFAM:PF13656.11 contig_3 cds 276094 276516 + GCA000529525_01367 hypothetical protein PFAM:PF00293.34 contig_3 cds 276603 276917 + GCA000529525_01368 hypothetical protein PFAM:PF01096.23, PFAM:PF02150.21 contig_3 cds 276930 277787 + GCA000529525_01369 hypothetical protein contig_3 tRNA 277957 278030 + GCA000529525_01370 trnR tRNA-Arg(tcg) SO:0001036 contig_3 cds 279947 280651 + GCA000529525_01371 hypothetical protein PFAM:PF00590.25 contig_3 cds 280652 281032 - GCA000529525_01372 hypothetical protein contig_3 cds 281119 281418 - GCA000529525_01373 hypothetical protein PFAM:PF01022.26, PFAM:PF13412.12 contig_3 cds 281644 282888 + GCA000529525_01374 hypothetical protein PFAM:PF00258.30, PFAM:PF19583.5 contig_3 cds 282926 283342 + GCA000529525_01375 hypothetical protein PFAM:PF00210.30, PFAM:PF02915.23 contig_3 cds 283385 284515 - GCA000529525_01376 hypothetical protein contig_3 cds 284532 285749 - GCA000529525_01377 hypothetical protein PFAM:PF00994.29, PFAM:PF03454.20 contig_3 cds 285766 287904 - GCA000529525_01378 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27, PFAM:PF18072.6 contig_3 cds 287906 291139 - GCA000529525_01379 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF08264.19, PFAM:PF19302.4 contig_3 cds 291287 292492 - GCA000529525_01380 hypothetical protein contig_3 cds 292616 292759 + GCA000529525_01381 hypothetical protein contig_3 cds 292772 293098 + GCA000529525_01382 hypothetical protein contig_3 cds 293084 293776 - GCA000529525_01383 hypothetical protein PFAM:PF00037.32, PFAM:PF02441.25, PFAM:PF12837.12, PFAM:PF13183.11, PFAM:PF13237.11 contig_3 cds 293783 295051 - GCA000529525_01384 hypothetical protein PFAM:PF00155.27, PFAM:PF00464.25 contig_3 cds 295471 297462 - GCA000529525_01385 hypothetical protein PFAM:PF00037.32, PFAM:PF07992.20, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF14697.11 contig_3 cds 297762 298667 - GCA000529525_01386 hypothetical protein contig_3 cds 299860 300258 + GCA000529525_01387 hypothetical protein contig_3 cds 301390 304869 + GCA000529525_01388 hypothetical protein PFAM:PF13229.12 contig_3 cds 305269 305778 + GCA000529525_01389 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13565.12, PFAM:PF13592.12 contig_3 cds 305812 306222 + GCA000529525_01390 hypothetical protein contig_3 cds 306266 306595 + GCA000529525_01391 hypothetical protein PFAM:PF13358.12 contig_3 cds 307753 308043 - GCA000529525_01392 hypothetical protein contig_3 cds 308203 310782 - GCA000529525_01393 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_3 cds 312372 312488 - GCA000529525_01394 hypothetical protein contig_3 cds 312569 312709 - GCA000529525_01395 hypothetical protein contig_3 cds 313695 315464 - GCA000529525_01396 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7 contig_3 cds 315497 316909 - GCA000529525_01397 hypothetical protein PFAM:PF13229.12 contig_3 cds 317471 318406 - GCA000529525_01398 hypothetical protein PFAM:PF06745.19, PFAM:PF08423.17, PFAM:PF12826.13, PFAM:PF13481.12, PFAM:PF14520.12 contig_3 cds 318435 320705 - GCA000529525_01399 hypothetical protein PFAM:PF01336.31, PFAM:PF16686.11, PFAM:PF16900.11, PFAM:PF17244.8, PFAM:PF21473.3, PFAM:PF24903.1 contig_3 cds 320702 320977 - GCA000529525_01400 hypothetical protein contig_3 cds 321209 322612 - GCA000529525_01401 Bacterial sugar transferase domain-containing protein SO:0001217, UniRef:UniRef50_Q24S81 contig_3 cds 322666 323523 - GCA000529525_01402 Glycosyltransferase family 2 protein SO:0001217, UniRef:UniRef50_A0AA95KTA8 contig_3 cds 323532 324494 - GCA000529525_01403 Family 2 glycosyl transferase SO:0001217, UniRef:UniRef50_J7SBV9 contig_3 cds 324642 325454 - GCA000529525_01404 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_3 cds 325456 325872 - GCA000529525_01405 hypothetical protein contig_3 cds 325974 326357 - GCA000529525_01406 hypothetical protein contig_3 cds 326592 326873 - GCA000529525_01407 hypothetical protein contig_3 cds 326882 327166 - GCA000529525_01408 hypothetical protein contig_3 cds 327646 328401 - GCA000529525_01409 hypothetical protein PFAM:PF04321.23, PFAM:PF13460.12, PFAM:PF16363.11 contig_3 cds 328411 328968 - GCA000529525_01410 dTDP-4-dehydrorhamnose 3,5-epimerase SO:0001217, UniRef:UniRef50_H6T5Z5 contig_3 cds 328974 329840 - GCA000529525_01411 Glucose-1-phosphate thymidylyltransferase SO:0001217, UniRef:UniRef50_P55257 contig_3 cds 330169 330618 - GCA000529525_01412 hypothetical protein PFAM:PF00545.25 contig_3 cds 330669 331460 - GCA000529525_01413 dTDP-4-dehydrorhamnose reductase SO:0001217, UniRef:UniRef50_A0A0L6W381 contig_3 cds 331532 332773 + GCA000529525_01414 hypothetical protein PFAM:PF00984.24, PFAM:PF03446.21, PFAM:PF03720.21, PFAM:PF03721.20 contig_3 cds 332776 333984 - GCA000529525_01415 DUF2264 domain-containing protein SO:0001217, UniRef:UniRef50_K5ZEP7 contig_3 cds 334245 334430 + GCA000529525_01416 hypothetical protein contig_3 cds 334730 334879 - GCA000529525_01417 hypothetical protein contig_3 cds 335075 336328 + GCA000529525_01418 hypothetical protein contig_3 cds 336325 337788 + GCA000529525_01419 hypothetical protein PFAM:PF00180.25, PFAM:PF00694.25 contig_3 cds 337795 337893 + GCA000529525_01420 hypothetical protein contig_3 cds 337913 338329 + GCA000529525_01421 hypothetical protein PFAM:PF00885.24 contig_3 cds 338338 339273 + GCA000529525_01422 hypothetical protein PFAM:PF08489.16, PFAM:PF22641.2 contig_3 cds 339285 340631 - GCA000529525_01423 hypothetical protein contig_3 cds 341113 341451 + GCA000529525_01424 Tex-like N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_UPI002FD7BBA6 contig_3 cds 342162 342782 + GCA000529525_01425 Transcription accessory protein SO:0001217, UniRef:UniRef50_A0A447UM03 contig_3 cds 342740 343264 + GCA000529525_01426 S1 motif domain-containing protein SO:0001217, UniRef:UniRef50_L5N197 contig_3 cds 343320 344354 + GCA000529525_01427 hypothetical protein PFAM:PF00731.26 contig_3 cds 344344 345600 + GCA000529525_01428 hypothetical protein PFAM:PF01977.22, PFAM:PF20695.2, PFAM:PF20696.2 contig_3 cds 345654 345842 + GCA000529525_01429 hypothetical protein contig_3 assembly_gap 345921 346207 . contig_3 cds 346522 351909 - GCA000529525_01430 hypothetical protein PFAM:PF02415.23, PFAM:PF13229.12 contig_3 cds 352329 354113 - GCA000529525_01431 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27, PFAM:PF04055.27 contig_3 cds 354171 354632 - GCA000529525_01432 hypothetical protein PFAM:PF01903.22 contig_3 cds 354692 355612 - GCA000529525_01433 hypothetical protein PFAM:PF01903.22 contig_3 cds 355584 355982 - GCA000529525_01434 hypothetical protein PFAM:PF01796.24, PFAM:PF12172.15 contig_3 cds 356152 356487 + GCA000529525_01435 hypothetical protein contig_3 cds 356541 357092 + GCA000529525_01436 hypothetical protein contig_3 cds 357092 357445 + GCA000529525_01437 hypothetical protein contig_3 cds 357448 357939 + GCA000529525_01438 hypothetical protein contig_3 cds 357936 359189 - GCA000529525_01439 hypothetical protein contig_3 cds 359223 359819 - GCA000529525_01440 hypothetical protein PFAM:PF01895.24, PFAM:PF02080.26 contig_3 cds 359875 360270 - GCA000529525_01441 hypothetical protein contig_3 cds 360465 360899 - GCA000529525_01442 hypothetical protein PFAM:PF00590.25 contig_3 cds 360912 361415 - GCA000529525_01443 hypothetical protein contig_4 cds 189 1670 - GCA000529525_01444 Inosine-5'-monophosphate dehydrogenase SO:0001217, UniRef:UniRef50_O50316 contig_4 cds 1679 2395 - GCA000529525_01445 hypothetical protein contig_4 cds 2592 2978 - GCA000529525_01446 hypothetical protein PFAM:PF00037.32, PFAM:PF12800.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13534.11 contig_4 cds 2984 3793 - GCA000529525_01447 hypothetical protein PFAM:PF02589.21 contig_4 cds 3783 4184 - GCA000529525_01448 hypothetical protein PFAM:PF02754.22 contig_4 cds 4241 4450 - GCA000529525_01449 hypothetical protein PFAM:PF02754.22 contig_4 cds 4456 4800 - GCA000529525_01450 hypothetical protein contig_4 cds 4813 5529 - GCA000529525_01451 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_4 cds 5549 6007 - GCA000529525_01452 hypothetical protein PFAM:PF00885.24 contig_4 cds 6229 6528 - GCA000529525_01453 hypothetical protein contig_4 cds 6535 7071 - GCA000529525_01454 hypothetical protein contig_4 cds 7278 7370 - GCA000529525_01455 hypothetical protein contig_4 cds 7736 8569 - GCA000529525_01456 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 SO:0001217, UniRef:UniRef50_Q0TUN8 contig_4 cds 8572 9267 - GCA000529525_01457 hypothetical protein contig_4 cds 9308 9595 - GCA000529525_01458 cbiN Cobalt transport protein CbiN SO:0001217, UniRef:UniRef50_A8AEQ5 contig_4 cds 9605 10270 - GCA000529525_01459 cbiM Cobalt transport protein CbiM SO:0001217, UniRef:UniRef50_A5VM74 contig_4 cds 10533 11180 + GCA000529525_01460 hypothetical protein PFAM:PF00215.30 contig_4 assembly_gap 11481 11749 . contig_4 cds 12265 12510 + GCA000529525_01461 hypothetical protein contig_4 cds 12550 13077 - GCA000529525_01462 hypothetical protein contig_4 cds 13080 14003 - GCA000529525_01463 hypothetical protein PFAM:PF01916.23 contig_4 cds 14023 14925 - GCA000529525_01464 hypothetical protein PFAM:PF00571.33, PFAM:PF02082.26, PFAM:PF03444.21 contig_4 cds 15018 15992 - GCA000529525_01465 Xaa-Pro dipeptidyl-peptidase-like domain-containing protein SO:0001217, UniRef:UniRef50_H1CXB4 contig_4 cds 16062 16559 - GCA000529525_01466 hypothetical protein contig_4 cds 16556 17596 - GCA000529525_01467 hypothetical protein PFAM:PF00702.32 contig_4 cds 17659 18081 - GCA000529525_01468 putative cation transporting ATPase SO:0001217, UniRef:UniRef50_A5N4C9 contig_4 cds 18405 18884 - GCA000529525_01469 Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_H1PY97 contig_4 cds 18939 20054 - GCA000529525_01470 hypothetical protein PFAM:PF04055.27, PFAM:PF13186.11 contig_4 cds 20098 20307 - GCA000529525_01471 hypothetical protein contig_4 cds 20448 21593 - GCA000529525_01472 hypothetical protein PFAM:PF00248.27, PFAM:PF13534.11 contig_4 cds 21908 22084 - GCA000529525_01473 hypothetical protein contig_4 cds 22050 22196 - GCA000529525_01474 hypothetical protein contig_4 cds 22186 23037 - GCA000529525_01475 UTP--glucose-1-phosphate uridylyltransferase SO:0001217, UniRef:UniRef50_Q05852 contig_4 tRNA 23171 23254 - GCA000529525_01476 trnL tRNA-Leu(gag) SO:0000264 contig_4 cds 23461 24798 + GCA000529525_01477 Xanthine/uracil/vitamin C permease SO:0001217, UniRef:UniRef50_M2P9U6 contig_4 cds 24801 25196 - GCA000529525_01478 hypothetical protein contig_4 cds 25422 26384 - GCA000529525_01479 hypothetical protein PFAM:PF16640.11, PFAM:PF17789.7 contig_4 cds 26412 31601 - GCA000529525_01480 hypothetical protein PFAM:PF02415.23, PFAM:PF13229.12 contig_4 cds 31745 36919 - GCA000529525_01481 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_4 cds 37040 39247 - GCA000529525_01482 hypothetical protein contig_4 cds 39499 44931 - GCA000529525_01483 hypothetical protein PFAM:PF16640.11 contig_4 cds 45256 49884 - GCA000529525_01484 hypothetical protein PFAM:PF01011.27, PFAM:PF09430.16, PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF13620.12, PFAM:PF16640.11 contig_4 cds 50091 52013 - GCA000529525_01485 hypothetical protein contig_4 cds 52314 56492 - GCA000529525_01486 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF16640.11 contig_4 cds 56558 56872 - GCA000529525_01487 hypothetical protein contig_4 assembly_gap 57093 58648 . contig_4 cds 59558 60070 - GCA000529525_01488 hypothetical protein contig_4 cds 60063 61208 - GCA000529525_01489 hypothetical protein PFAM:PF00271.37 contig_4 cds 61162 61632 - GCA000529525_01490 hypothetical protein PFAM:PF00270.35 contig_4 cds 61994 62407 - GCA000529525_01491 hypothetical protein contig_4 cds 62744 63601 - GCA000529525_01492 hypothetical protein contig_4 cds 63686 64456 - GCA000529525_01493 hypothetical protein contig_4 cds 64470 65969 - GCA000529525_01494 hypothetical protein contig_4 cds 66120 69005 - GCA000529525_01495 UvrABC system protein A SO:0001217, UniRef:UniRef50_A0A449B3I9 contig_4 cds 69108 71069 - GCA000529525_01496 UvrABC system protein B SO:0001217, UniRef:UniRef50_P37954 contig_4 cds 71077 71373 - GCA000529525_01497 hypothetical protein contig_4 cds 71375 72262 - GCA000529525_01498 hypothetical protein PFAM:PF00156.33, PFAM:PF13793.12, PFAM:PF14572.12, PFAM:PF14681.12, PFAM:PF24390.1 contig_4 cds 72726 72965 - GCA000529525_01499 hypothetical protein contig_4 cds 73062 73277 - GCA000529525_01500 hypothetical protein contig_4 cds 73411 73899 + GCA000529525_01501 hypothetical protein contig_4 cds 74013 74141 + GCA000529525_01502 hypothetical protein contig_4 cds 74256 74621 - GCA000529525_01503 hypothetical protein contig_4 cds 74654 75163 - GCA000529525_01504 hypothetical protein PFAM:PF13302.13, PFAM:PF13420.13 contig_4 cds 75200 76105 + GCA000529525_01505 ADP-ribosylglycohydrolase SO:0001217, UniRef:UniRef50_A0A1I2M4C7 contig_4 cds 76092 76550 + GCA000529525_01506 hypothetical protein contig_4 cds 76576 78546 - GCA000529525_01507 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF05362.19, PFAM:PF07728.20, PFAM:PF13541.12, PFAM:PF14532.12, PFAM:PF20436.4 contig_4 cds 78830 79204 + GCA000529525_01508 hypothetical protein contig_4 cds 79198 79569 + GCA000529525_01509 hypothetical protein contig_4 cds 79805 79954 + GCA000529525_01510 hypothetical protein contig_4 cds 80246 81073 + GCA000529525_01511 Bro-N domain-containing protein SO:0001217, UniRef:UniRef50_G5SVA9 contig_4 cds 81248 81862 - GCA000529525_01512 hypothetical protein contig_4 cds 81883 82356 - GCA000529525_01513 hypothetical protein contig_4 cds 82709 82972 - GCA000529525_01514 hypothetical protein PFAM:PF09297.16, PFAM:PF13240.11, PFAM:PF13248.11, PFAM:PF14803.11, PFAM:PF17032.10, PFAM:PF18912.6, PFAM:PF24460.1, PFAM:PF24463.1 contig_4 cds 83111 84640 - GCA000529525_01515 hypothetical protein PFAM:PF02369.22, PFAM:PF07602.17 contig_4 cds 84845 86374 + GCA000529525_01516 hypothetical protein PFAM:PF01656.29, PFAM:PF07685.20, PFAM:PF13500.12 contig_4 cds 86349 87092 - GCA000529525_01517 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13649.12, PFAM:PF13847.12 contig_4 cds 87773 88345 - GCA000529525_01518 hypothetical protein PFAM:PF13635.12 contig_4 cds 88476 89060 - GCA000529525_01519 AAA domain-containing protein SO:0001217, UniRef:UniRef50_R6CQK6 contig_4 cds 90006 90371 - GCA000529525_01520 DUF4143 domain-containing protein SO:0001217, UniRef:UniRef50_A0A3D2YHJ3 contig_4 cds 90413 91285 - GCA000529525_01521 DUF4143 domain-containing protein SO:0001217, UniRef:UniRef50_UPI002B20B11C contig_4 assembly_gap 91532 91850 . contig_4 cds 91888 92130 - GCA000529525_01522 hypothetical protein contig_4 cds 92271 93722 - GCA000529525_01523 hypothetical protein PFAM:PF13635.12 contig_4 cds 94285 94548 - GCA000529525_01524 hypothetical protein PFAM:PF05016.21 contig_4 cds 94541 94762 - GCA000529525_01525 hypothetical protein contig_4 cds 95405 96673 - GCA000529525_01526 hypothetical protein PFAM:PF13635.12 contig_4 cds 96859 97092 - GCA000529525_01527 hypothetical protein contig_4 cds 97636 98058 - GCA000529525_01528 hypothetical protein contig_4 cds 98055 98297 - GCA000529525_01529 hypothetical protein contig_4 cds 99167 100369 - GCA000529525_01530 AAA domain-containing protein SO:0001217, UniRef:UniRef50_S3XZU5 contig_4 cds 100829 102100 - GCA000529525_01531 hypothetical protein PFAM:PF13635.12 contig_4 cds 102214 102348 - GCA000529525_01532 hypothetical protein contig_4 cds 102609 102800 - GCA000529525_01533 hypothetical protein contig_4 cds 103290 103415 + GCA000529525_01534 hypothetical protein contig_4 cds 103566 103985 + GCA000529525_01535 hypothetical protein contig_4 cds 104091 104516 - GCA000529525_01536 hypothetical protein contig_4 cds 104524 104901 - GCA000529525_01537 hypothetical protein PFAM:PF09373.15 contig_4 cds 105121 109791 - GCA000529525_01538 hypothetical protein contig_4 cds 109999 110169 - GCA000529525_01539 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A5UP60, UniRef:UniRef90_UPI002A912ACF contig_4 cds 110230 110391 - GCA000529525_01540 (pseudo) hypothetical protein SO:0001217, UniRef:UniRef50_A5UP60, UniRef:UniRef90_UPI002A912ACF contig_4 cds 110628 111554 - GCA000529525_01541 hypothetical protein contig_4 cds 111909 112364 - GCA000529525_01542 hypothetical protein contig_4 cds 112306 112578 - GCA000529525_01543 hypothetical protein contig_4 cds 112580 113065 - GCA000529525_01544 hypothetical protein contig_4 cds 113217 114092 - GCA000529525_01545 hypothetical protein PFAM:PF18864.6 contig_4 cds 114455 117580 + GCA000529525_01546 Type I restriction enzyme endonuclease subunit SO:0001217, UniRef:UniRef50_A0A1G6CMD2 contig_4 cds 117589 119136 + GCA000529525_01547 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_A0A223KNY2 contig_4 cds 119206 119415 + GCA000529525_01548 hypothetical protein contig_4 cds 119412 120332 + GCA000529525_01549 hypothetical protein PFAM:PF01420.25 contig_4 cds 120449 121000 - GCA000529525_01550 Tyr recombinase domain-containing protein SO:0001217, UniRef:UniRef50_A0A0M6WUV2 contig_4 cds 121144 121434 - GCA000529525_01551 hypothetical protein contig_4 cds 121431 122159 - GCA000529525_01552 Restriction endonuclease subunit S SO:0001217, UniRef:UniRef50_A0A7C6BWB3 contig_4 cds 122183 122770 + GCA000529525_01553 hypothetical protein PFAM:PF01420.25 contig_4 cds 122709 123596 - GCA000529525_01554 hypothetical protein contig_4 cds 123575 123958 - GCA000529525_01555 hypothetical protein contig_4 cds 124376 124708 + GCA000529525_01556 hypothetical protein contig_4 cds 125104 125304 + GCA000529525_01557 hypothetical protein contig_4 cds 125462 125941 - GCA000529525_01558 hypothetical protein contig_4 cds 125908 126852 - GCA000529525_01559 hypothetical protein contig_4 cds 126937 127383 - GCA000529525_01560 DNA repair photolyase SO:0001217, UniRef:UniRef50_R7J4Q1 contig_4 cds 127371 127901 - GCA000529525_01561 DUF1848 domain-containing protein SO:0001217, UniRef:UniRef50_A0A9W5AM22 contig_4 cds 128008 128661 - GCA000529525_01562 hypothetical protein contig_4 cds 128615 128905 - GCA000529525_01563 DUF1848 domain-containing protein SO:0001217, UniRef:UniRef50_A0A7U6KD63 contig_4 cds 128928 130088 - GCA000529525_01564 hypothetical protein PFAM:PF00108.29, PFAM:PF00109.32, PFAM:PF02803.24, PFAM:PF22691.2 contig_4 cds 130099 131136 - GCA000529525_01565 hypothetical protein PFAM:PF01154.23, PFAM:PF08541.16 contig_4 tRNA 131278 131351 - GCA000529525_01566 trnG tRNA-Gly(tcc) SO:0000260 contig_4 tRNA 131359 131432 - GCA000529525_01567 trnG tRNA-Gly(gcc) SO:0000260 contig_4 cds 131535 131669 + GCA000529525_01568 hypothetical protein contig_4 cds 131819 132487 - GCA000529525_01569 hypothetical protein PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_4 cds 132497 134476 - GCA000529525_01570 hypothetical protein PFAM:PF01702.25, PFAM:PF14810.12 contig_4 cds 134699 135898 + GCA000529525_01571 hypothetical protein contig_4 cds 135883 136989 - GCA000529525_01572 hypothetical protein contig_4 cds 137142 137771 - GCA000529525_01573 hypothetical protein contig_4 cds 138165 143762 - GCA000529525_01574 hypothetical protein PFAM:PF02415.23, PFAM:PF13360.12, PFAM:PF13570.12, PFAM:PF16640.11 contig_4 cds 144051 146423 - GCA000529525_01575 hypothetical protein PFAM:PF16640.11 contig_4 cds 146529 148016 - GCA000529525_01576 hypothetical protein contig_4 cds 148638 150494 - GCA000529525_01577 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7 contig_4 cds 150582 151631 - GCA000529525_01578 hypothetical protein PFAM:PF01380.27 contig_4 cds 151598 152368 - GCA000529525_01579 hypothetical protein PFAM:PF13522.11, PFAM:PF13537.11 contig_4 cds 152380 153090 - GCA000529525_01580 uroporphyrinogen-III C-methyltransferase SO:0001217, UniRef:UniRef50_A0A972SI56 contig_4 cds 153100 153744 - GCA000529525_01581 purQ Phosphoribosylformylglycinamidine synthase subunit PurQ SO:0001217, UniRef:UniRef50_Q7NL01 contig_4 cds 153745 154011 - GCA000529525_01582 hypothetical protein contig_4 cds 154021 154752 - GCA000529525_01583 Phosphoribosylaminoimidazole-succinocarboxamide synthase SO:0001217, UniRef:UniRef50_Q8RC58 contig_4 cds 155119 155496 - GCA000529525_01584 hypothetical protein contig_4 cds 155599 155793 + GCA000529525_01585 hypothetical protein contig_4 cds 155793 155882 + GCA000529525_01586 hypothetical protein contig_4 cds 156028 157101 - GCA000529525_01587 hypothetical protein contig_4 cds 157098 157520 - GCA000529525_01588 hypothetical protein contig_4 cds 157790 158563 + GCA000529525_01589 hypothetical protein contig_4 cds 158553 159656 + GCA000529525_01590 hypothetical protein PFAM:PF00535.33 contig_4 cds 159661 160752 + GCA000529525_01591 UDP-galactopyranose mutase SO:0001217, UniRef:UniRef50_A0A7S6UFQ3 contig_4 cds 160774 161043 + GCA000529525_01592 hypothetical protein contig_4 cds 161040 162452 + GCA000529525_01593 hypothetical protein PFAM:PF01368.27, PFAM:PF02272.25, PFAM:PF21763.2 contig_4 cds 162513 162755 + GCA000529525_01594 hypothetical protein PFAM:PF01047.28, PFAM:PF08279.18, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13545.12 contig_4 cds 162785 163315 + GCA000529525_01595 hypothetical protein contig_4 cds 163321 163446 - GCA000529525_01596 hypothetical protein contig_4 cds 163470 164600 - GCA000529525_01597 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37 contig_4 cds 164628 165494 - GCA000529525_01598 Radical SAM core domain-containing protein SO:0001217, UniRef:UniRef50_F7JM63 contig_4 cds 165576 166268 + GCA000529525_01599 hypothetical protein PFAM:PF12705.13 contig_4 cds 166283 166696 - GCA000529525_01600 hypothetical protein PFAM:PF06271.18 contig_4 cds 166706 167725 - GCA000529525_01601 hypothetical protein PFAM:PF00586.29, PFAM:PF02769.27 contig_4 cds 167817 168191 - GCA000529525_01602 hypothetical protein contig_4 cds 168393 168650 - GCA000529525_01603 hypothetical protein contig_4 cds 168662 169102 - GCA000529525_01604 hypothetical protein contig_4 cds 169173 169439 - GCA000529525_01605 hypothetical protein contig_4 cds 169722 170048 + GCA000529525_01606 hypothetical protein contig_4 cds 170461 171162 + GCA000529525_01607 hypothetical protein PFAM:PF00702.32, PFAM:PF13242.12 contig_4 cds 171245 171946 - GCA000529525_01608 Exodeoxyribonuclease III SO:0001217, UniRef:UniRef50_A0A7V2LEJ5 contig_4 cds 171946 172734 - GCA000529525_01609 hypothetical protein PFAM:PF01409.25, PFAM:PF17759.6 contig_4 cds 172731 173489 - GCA000529525_01610 hypothetical protein PFAM:PF01978.25, PFAM:PF10771.15, PFAM:PF13412.12 contig_4 cds 173934 174680 - GCA000529525_01611 hypothetical protein PFAM:PF00515.34, PFAM:PF01239.28, PFAM:PF07719.23, PFAM:PF12569.14, PFAM:PF12895.13, PFAM:PF13174.12, PFAM:PF13176.12, PFAM:PF13181.12, PFAM:PF13371.12, PFAM:PF13374.12, PFAM:PF13414.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14863.12, PFAM:PF23914.1, PFAM:PF25063.1, PFAM:PF25064.1 contig_4 cds 174691 175566 - GCA000529525_01612 hypothetical protein contig_4 cds 175563 176039 - GCA000529525_01613 hypothetical protein PFAM:PF00490.27 contig_4 cds 176216 176566 - GCA000529525_01614 hypothetical protein PFAM:PF00490.27 contig_4 cds 176714 176920 + GCA000529525_01615 hypothetical protein contig_4 cds 176975 178069 + GCA000529525_01616 Chorismate synthase SO:0001217, UniRef:UniRef50_Q3Z993 contig_4 cds 178073 178993 - GCA000529525_01617 hypothetical protein PFAM:PF00753.33, PFAM:PF12706.13, PFAM:PF13483.12 contig_4 cds 179003 179923 - GCA000529525_01618 hypothetical protein contig_4 cds 180167 182263 + GCA000529525_01619 hypothetical protein PFAM:PF02629.25, PFAM:PF13380.12, PFAM:PF13549.11, PFAM:PF13607.11, PFAM:PF19045.5 contig_4 cds 182316 182603 + GCA000529525_01620 hypothetical protein contig_4 cds 182872 183294 + GCA000529525_01621 hypothetical protein PFAM:PF04289.18, PFAM:PF20766.2 contig_4 cds 183301 184206 - GCA000529525_01622 hypothetical protein contig_4 cds 184391 184963 - GCA000529525_01623 hypothetical protein contig_4 cds 185404 185739 + GCA000529525_01624 hypothetical protein contig_4 cds 185771 185896 + GCA000529525_01625 hypothetical protein contig_4 cds 185915 187963 - GCA000529525_01626 ATP-dependent Lon protease SO:0001217, UniRef:UniRef50_A0A9X1VBT9 contig_4 cds 187974 190472 - GCA000529525_01627 hypothetical protein PFAM:PF08665.17 contig_4 cds 190474 190989 - GCA000529525_01628 hypothetical protein PFAM:PF08819.17 contig_4 cds 191000 194581 - GCA000529525_01629 hypothetical protein contig_4 cds 194594 195175 - GCA000529525_01630 hypothetical protein PFAM:PF08747.16 contig_4 cds 195176 195769 - GCA000529525_01631 hypothetical protein contig_4 cds 195835 197586 - GCA000529525_01632 hypothetical protein contig_4 cds 197634 198065 - GCA000529525_01633 hypothetical protein PFAM:PF07669.17 contig_4 cds 198183 201716 + GCA000529525_01634 site-specific DNA-methyltransferase (adenine-specific) SO:0001217, UniRef:UniRef50_D4K724 contig_4 cds 201727 203355 - GCA000529525_01635 hypothetical protein contig_4 cds 204171 204398 + GCA000529525_01636 hypothetical protein contig_4 cds 204398 204514 + GCA000529525_01637 hypothetical protein contig_4 cds 204647 204757 + GCA000529525_01638 hypothetical protein contig_4 cds 205865 206014 - GCA000529525_01639 hypothetical protein contig_4 gap 206404 206484 . contig_4 cds 206804 207340 - GCA000529525_01640 hypothetical protein PFAM:PF07669.17 contig_4 cds 207415 208200 - GCA000529525_01641 hypothetical protein contig_4 cds 208161 208658 - GCA000529525_01642 hypothetical protein contig_4 cds 208911 209753 - GCA000529525_01643 hypothetical protein contig_4 cds 209729 209947 - GCA000529525_01644 hypothetical protein contig_4 cds 210035 210268 - GCA000529525_01645 hypothetical protein PFAM:PF13358.12 contig_4 cds 210488 210808 - GCA000529525_01646 hypothetical protein contig_4 cds 210844 211332 - GCA000529525_01647 hypothetical protein PFAM:PF13384.12, PFAM:PF13518.12, PFAM:PF13551.12, PFAM:PF13565.12 contig_4 cds 211568 213592 + GCA000529525_01648 hypothetical protein contig_4 cds 215778 216155 - GCA000529525_01649 hypothetical protein contig_4 cds 216528 216731 - GCA000529525_01650 hypothetical protein contig_5 rRNA 47 164 + GCA000529525_01651 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_5 rRNA 216 333 + GCA000529525_01652 rrf 5S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01985, RFAM:RF00001, SO:0000652 contig_5 cds 688 1299 - GCA000529525_01653 hypothetical protein PFAM:PF01022.26 contig_5 cds 1550 1870 - GCA000529525_01654 hypothetical protein PFAM:PF07693.20, PFAM:PF12775.13, PFAM:PF13191.12 contig_5 cds 2247 3155 - GCA000529525_01655 hypothetical protein PFAM:PF03109.22 contig_5 cds 3146 3892 - GCA000529525_01656 hypothetical protein PFAM:PF03109.22 contig_5 cds 3929 5497 - GCA000529525_01657 hypothetical protein PFAM:PF00488.27 contig_5 cds 5506 5853 - GCA000529525_01658 hypothetical protein PFAM:PF14520.12 contig_5 cds 5968 7158 - GCA000529525_01659 hypothetical protein contig_5 cds 7546 8352 - GCA000529525_01660 Protease SO:0001217, UniRef:UniRef50_A0A381I6I8 contig_5 cds 8349 8570 - GCA000529525_01661 hypothetical protein contig_5 cds 8579 8776 - GCA000529525_01662 hypothetical protein contig_5 cds 8854 9429 - GCA000529525_01663 hypothetical protein contig_5 cds 9492 9878 - GCA000529525_01664 hypothetical protein contig_5 cds 9820 10845 - GCA000529525_01665 hypothetical protein contig_5 assembly_gap 11592 11860 . contig_5 cds 12351 12929 + GCA000529525_01666 hypothetical protein PFAM:PF02223.23 contig_5 cds 12962 13351 - GCA000529525_01667 hypothetical protein contig_5 cds 13344 14036 - GCA000529525_01668 hypothetical protein contig_5 cds 14213 14311 - GCA000529525_01669 hypothetical protein contig_5 cds 14320 15363 - GCA000529525_01670 hypothetical protein contig_5 cds 15391 15798 - GCA000529525_01671 hypothetical protein contig_5 cds 16107 16319 + GCA000529525_01672 hypothetical protein contig_5 cds 17103 19106 - GCA000529525_01673 hypothetical protein PFAM:PF00493.29, PFAM:PF01078.27, PFAM:PF07728.20, PFAM:PF14551.11, PFAM:PF17207.9, PFAM:PF17855.7, PFAM:PF21120.3 contig_5 cds 19744 20163 + GCA000529525_01674 hypothetical protein contig_5 cds 20173 20793 - GCA000529525_01675 hypothetical protein contig_5 cds 20795 21325 - GCA000529525_01676 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_5 cds 21472 22563 + GCA000529525_01677 hypothetical protein PFAM:PF06973.17 contig_5 cds 22569 22955 - GCA000529525_01678 hypothetical protein contig_5 cds 22971 23339 - GCA000529525_01679 hypothetical protein contig_5 cds 23356 23814 - GCA000529525_01680 hypothetical protein PFAM:PF12682.12, PFAM:PF12724.12 contig_5 cds 23827 26421 - GCA000529525_01681 hypothetical protein PFAM:PF00270.35, PFAM:PF00271.37, PFAM:PF19306.5 contig_5 cds 26512 27108 + GCA000529525_01682 hypothetical protein PFAM:PF00514.29, PFAM:PF02985.28, PFAM:PF03130.22, PFAM:PF13646.12 contig_5 cds 27123 27359 + GCA000529525_01683 hypothetical protein contig_5 cds 27422 28186 - GCA000529525_01684 Omega-amidase Nit SO:0001217, UniRef:UniRef50_K4LCP6 contig_5 cds 28233 28931 - GCA000529525_01685 hypothetical protein PFAM:PF18933.6 contig_5 cds 29030 29509 + GCA000529525_01686 hypothetical protein contig_5 cds 29517 30287 - GCA000529525_01687 hypothetical protein PFAM:PF01939.22, PFAM:PF21003.3 contig_5 cds 30442 31353 + GCA000529525_01688 hypothetical protein PFAM:PF00561.26 contig_5 cds 31358 31636 + GCA000529525_01689 hypothetical protein contig_5 cds 31687 31788 - GCA000529525_01690 hypothetical protein contig_5 cds 31785 32576 - GCA000529525_01691 hypothetical protein contig_5 cds 32573 33322 - GCA000529525_01692 hypothetical protein PFAM:PF00924.24, PFAM:PF21088.2 contig_5 cds 33331 34224 - GCA000529525_01693 hypothetical protein PFAM:PF00753.33, PFAM:PF12706.13 contig_5 cds 34293 35123 + GCA000529525_01694 hypothetical protein PFAM:PF01729.25, PFAM:PF02749.22 contig_5 cds 35201 36283 + GCA000529525_01695 Carbamoyl phosphate synthase pyrimidine-specific small chain SO:0001217, UniRef:UniRef50_P77885 contig_5 cds 36319 39495 + GCA000529525_01696 Carbamoyl phosphate synthase large chain SO:0001217, UniRef:UniRef50_Q72FQ1 contig_5 cds 39511 40104 - GCA000529525_01697 hypothetical protein contig_5 cds 40296 41468 + GCA000529525_01698 hypothetical protein PFAM:PF01979.26 contig_5 cds 41493 41921 + GCA000529525_01699 hypothetical protein PFAM:PF00582.32 contig_5 cds 41967 42809 + GCA000529525_01700 hypothetical protein PFAM:PF00571.33 contig_5 cds 42820 43275 + GCA000529525_01701 hypothetical protein contig_5 cds 43549 44286 - GCA000529525_01702 hypothetical protein PFAM:PF02540.23, PFAM:PF06508.19 contig_5 cds 44273 44944 - GCA000529525_01703 hypothetical protein contig_5 cds 44946 46151 - GCA000529525_01704 hypothetical protein contig_5 cds 46153 46794 - GCA000529525_01705 hypothetical protein contig_5 cds 46846 47868 + GCA000529525_01706 hypothetical protein PFAM:PF00557.29, PFAM:PF01321.24 contig_5 cds 48244 49161 + GCA000529525_01707 hypothetical protein PFAM:PF00482.28 contig_5 cds 49170 49352 + GCA000529525_01708 hypothetical protein PFAM:PF04021.17 contig_5 cds 49340 50464 - GCA000529525_01709 hypothetical protein contig_5 cds 50568 50939 + GCA000529525_01710 Flavodoxin SO:0001217, UniRef:UniRef50_F5RPQ8 contig_5 cds 50924 51049 + GCA000529525_01711 hypothetical protein contig_5 cds 51107 52519 + GCA000529525_01712 hypothetical protein contig_5 cds 53222 53635 - GCA000529525_01713 hypothetical protein PFAM:PF01588.26 contig_5 cds 53698 53943 - GCA000529525_01714 hypothetical protein PFAM:PF18489.6 contig_5 cds 54123 54527 + GCA000529525_01715 hypothetical protein PFAM:PF05239.21 contig_5 cds 54593 55357 + GCA000529525_01716 hypothetical protein PFAM:PF01408.29, PFAM:PF01958.23, PFAM:PF03447.22 contig_5 cds 55358 56080 + GCA000529525_01717 hypothetical protein PFAM:PF04446.17, PFAM:PF14413.11 contig_5 cds 56077 56748 + GCA000529525_01718 hypothetical protein contig_5 cds 56801 57940 - GCA000529525_01719 hypothetical protein PFAM:PF01842.31, PFAM:PF02826.25, PFAM:PF19304.4 contig_5 cds 57946 58374 - GCA000529525_01720 Phosphoglycerate dehydrogenase SO:0001217, UniRef:UniRef50_A0A957I4K7 contig_5 cds 58617 59270 + GCA000529525_01721 hypothetical protein contig_5 cds 59303 59419 + GCA000529525_01722 hypothetical protein contig_5 cds 59406 59801 - GCA000529525_01723 hypothetical protein contig_5 cds 59803 60744 - GCA000529525_01724 hypothetical protein PFAM:PF01381.28 contig_5 cds 60812 62077 + GCA000529525_01725 hypothetical protein PFAM:PF01336.31, PFAM:PF08489.16, PFAM:PF22641.2, PFAM:PF23783.1 contig_5 cds 62282 63190 + GCA000529525_01726 DUF3100 domain-containing protein SO:0001217, UniRef:UniRef50_Q5WBB7 contig_5 cds 63190 63678 + GCA000529525_01727 hypothetical protein contig_5 cds 63835 65244 + GCA000529525_01728 hypothetical protein PFAM:PF03972.19, PFAM:PF19305.4 contig_5 cds 65250 66152 + GCA000529525_01729 Peptidase family U32 SO:0001217, UniRef:UniRef50_A0A1H9E331 contig_5 cds 66157 67029 + GCA000529525_01730 L(+)-tartrate dehydratase subunit alpha SO:0001217, UniRef:UniRef50_A0A1B1Q176 contig_5 cds 67048 68472 - GCA000529525_01731 Schlafen AlbA-2 domain-containing protein SO:0001217, UniRef:UniRef50_R9MRR4 contig_5 cds 69360 70013 + GCA000529525_01732 hypothetical protein PFAM:PF00285.26 contig_5 cds 70165 70386 + GCA000529525_01733 hypothetical protein PFAM:PF00881.29 contig_5 cds 70470 70670 + GCA000529525_01734 hypothetical protein PFAM:PF00881.29 contig_5 cds 70676 70816 + GCA000529525_01735 hypothetical protein contig_5 cds 70876 71013 + GCA000529525_01736 hypothetical protein contig_5 cds 71107 71337 - GCA000529525_01737 hypothetical protein contig_5 cds 71470 71628 + GCA000529525_01738 hypothetical protein contig_5 cds 71683 72030 + GCA000529525_01739 hypothetical protein contig_5 cds 72195 72509 + GCA000529525_01740 hypothetical protein contig_5 cds 72522 74525 + GCA000529525_01741 hypothetical protein contig_5 cds 74583 75074 + GCA000529525_01742 hypothetical protein PFAM:PF00137.26 contig_5 cds 75088 75711 + GCA000529525_01743 hypothetical protein contig_5 cds 75724 76878 + GCA000529525_01744 hypothetical protein contig_5 cds 76875 77192 + GCA000529525_01745 hypothetical protein contig_5 cds 77189 78943 + GCA000529525_01746 V-type ATP synthase alpha chain SO:0001217, UniRef:UniRef50_A5I557 contig_5 cds 78946 80337 + GCA000529525_01747 hypothetical protein PFAM:PF00006.31, PFAM:PF02874.29, PFAM:PF22919.1 contig_5 cds 80365 81048 + GCA000529525_01748 hypothetical protein contig_5 cds 81184 81333 + GCA000529525_01749 hypothetical protein contig_5 cds 81316 81594 - GCA000529525_01750 hypothetical protein contig_5 cds 82190 82489 - GCA000529525_01751 hypothetical protein contig_5 tRNA 82525 82596 - GCA000529525_01752 trnQ tRNA-Gln(ttg) SO:0000261 contig_5 cds 83073 83684 - GCA000529525_01753 hypothetical protein contig_5 cds 84009 85262 - GCA000529525_01754 hypothetical protein PFAM:PF13662.12 contig_5 cds 85686 86423 + GCA000529525_01755 hypothetical protein contig_5 cds 86553 86840 + GCA000529525_01756 hypothetical protein PFAM:PF04410.20 contig_5 cds 86884 87816 + GCA000529525_01757 hypothetical protein PFAM:PF00382.24, PFAM:PF08271.17 contig_5 cds 87883 88905 - GCA000529525_01758 hypothetical protein PFAM:PF04101.22, PFAM:PF13528.12 contig_5 cds 88932 89774 - GCA000529525_01759 hypothetical protein PFAM:PF00535.33, PFAM:PF13641.12 contig_5 cds 89809 90888 - GCA000529525_01760 hypothetical protein contig_5 cds 90942 91751 + GCA000529525_01761 hypothetical protein contig_5 cds 91748 91918 - GCA000529525_01762 hypothetical protein contig_5 cds 91950 92600 - GCA000529525_01763 hypothetical protein contig_5 cds 92602 92823 - GCA000529525_01764 hypothetical protein contig_5 cds 92930 93121 - GCA000529525_01765 hypothetical protein contig_5 cds 93231 93932 - GCA000529525_01766 tatD 3'-5' ssDNA/RNA exonuclease TatD SO:0001217, UniRef:UniRef50_A0A1X0WFV0 contig_5 cds 93941 94291 - GCA000529525_01767 hypothetical protein contig_5 cds 94693 95376 - GCA000529525_01768 Glycerol uptake facilitator SO:0001217, UniRef:UniRef50_F7UYC6 contig_5 cds 95419 96552 - GCA000529525_01769 hypothetical protein contig_5 cds 97017 97358 + GCA000529525_01770 hypothetical protein contig_5 cds 97412 101881 + GCA000529525_01771 hypothetical protein PFAM:PF01345.24, PFAM:PF02415.23, PFAM:PF07705.17, PFAM:PF17973.7, PFAM:PF24346.1, PFAM:PF24593.1, PFAM:PF24595.1 contig_5 cds 102150 102587 + GCA000529525_01772 hypothetical protein contig_5 cds 102597 103178 - GCA000529525_01773 hypothetical protein PFAM:PF03367.19, PFAM:PF22794.1 contig_5 cds 103171 104115 - GCA000529525_01774 hypothetical protein PFAM:PF13238.12 contig_5 cds 104323 105063 + GCA000529525_01775 hypothetical protein PFAM:PF07755.17, PFAM:PF17396.8 contig_5 cds 105138 105374 + GCA000529525_01776 hypothetical protein PFAM:PF07755.17 contig_5 cds 105380 105889 + GCA000529525_01777 hypothetical protein contig_5 cds 105904 106659 - GCA000529525_01778 hypothetical protein PFAM:PF01026.27 contig_5 cds 107375 108163 + GCA000529525_01779 hypothetical protein contig_5 cds 108177 108371 - GCA000529525_01780 hypothetical protein PFAM:PF03129.25 contig_5 cds 108470 109870 - GCA000529525_01781 hypothetical protein PFAM:PF00587.30 contig_5 cds 109886 110365 - GCA000529525_01782 dCTP deaminase, dUMP-forming SO:0001217, UniRef:UniRef50_A0A3C0XF66 contig_5 cds 110498 110692 - GCA000529525_01783 hypothetical protein contig_5 cds 110720 111328 - GCA000529525_01784 hypothetical protein contig_5 cds 111623 113101 - GCA000529525_01785 hypothetical protein PFAM:PF02754.22, PFAM:PF12838.12, PFAM:PF13085.11, PFAM:PF13183.11, PFAM:PF13534.11 contig_5 cds 113219 115114 + GCA000529525_01786 hypothetical protein PFAM:PF00037.32, PFAM:PF02775.26 contig_5 cds 115119 115703 + GCA000529525_01787 hypothetical protein PFAM:PF01558.24 contig_5 cds 115758 116036 + GCA000529525_01788 hypothetical protein contig_5 cds 116101 116532 - GCA000529525_01789 hypothetical protein PFAM:PF01842.31, PFAM:PF19571.5 contig_5 cds 116544 117842 - GCA000529525_01790 Phenylacetate-coenzyme A ligase SO:0001217, UniRef:UniRef50_A0A1S7LEF0 contig_5 cds 118032 119642 + GCA000529525_01791 Sodium:solute symporter family protein SO:0001217, UniRef:UniRef50_A0A7C1HTU5 contig_5 cds 119645 119755 + GCA000529525_01792 hypothetical protein contig_5 cds 120720 121739 + GCA000529525_01793 hypothetical protein PFAM:PF01047.28, PFAM:PF13412.12 contig_5 cds 122780 123277 - GCA000529525_01794 hypothetical protein contig_5 cds 123407 123640 - GCA000529525_01795 hypothetical protein contig_5 cds 123754 124302 - GCA000529525_01796 DNA-3-methyladenine glycosylase 1 SO:0001217, UniRef:UniRef50_A0A2A9I771 contig_5 cds 124541 124810 + GCA000529525_01797 hypothetical protein contig_5 cds 124887 125117 + GCA000529525_01798 hypothetical protein contig_5 cds 125529 125879 + GCA000529525_01799 hypothetical protein PFAM:PF19026.7 contig_5 cds 125885 126628 + GCA000529525_01800 hypothetical protein PFAM:PF00149.33, PFAM:PF12850.12 contig_5 cds 127020 127415 + GCA000529525_01801 hypothetical protein PFAM:PF11977.14 contig_5 cds 127513 128043 + GCA000529525_01802 hypothetical protein contig_5 cds 128036 129238 + GCA000529525_01803 hypothetical protein contig_5 cds 129259 129531 + GCA000529525_01804 hypothetical protein contig_5 cds 129552 130775 + GCA000529525_01805 argJ Arginine biosynthesis bifunctional protein ArgJ 1 SO:0001217, UniRef:UniRef50_Q97GH6 contig_5 cds 130863 130967 + GCA000529525_01806 hypothetical protein contig_5 cds 131242 131514 + GCA000529525_01807 hypothetical protein contig_5 cds 131471 131665 + GCA000529525_01808 hypothetical protein contig_5 cds 131738 132256 + GCA000529525_01809 hypothetical protein contig_5 cds 132525 132845 + GCA000529525_01810 hypothetical protein contig_5 cds 133211 134020 + GCA000529525_01811 hypothetical protein contig_5 cds 134052 134945 + GCA000529525_01812 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13432.12, PFAM:PF14559.12 contig_5 cds 135064 135345 + GCA000529525_01813 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13414.12 contig_5 cds 136589 137911 + GCA000529525_01814 hypothetical protein PFAM:PF01609.27 contig_6 cds 138 407 + GCA000529525_01815 hypothetical protein contig_6 cds 584 1063 + GCA000529525_01816 hypothetical protein contig_6 cds 1065 1331 + GCA000529525_01817 hypothetical protein contig_6 cds 1388 1741 + GCA000529525_01818 hypothetical protein PFAM:PF01920.25 contig_6 cds 1769 2053 + GCA000529525_01819 hypothetical protein contig_6 cds 2872 3558 + GCA000529525_01820 hypothetical protein contig_6 cds 3585 3794 + GCA000529525_01821 hypothetical protein contig_6 cds 3883 4275 + GCA000529525_01822 pyridoxal 5'-phosphate synthase (glutamine hydrolyzing) SO:0001217, UniRef:UniRef50_V9GKN9 contig_6 cds 4311 4763 + GCA000529525_01823 hypothetical protein PFAM:PF01680.23, PFAM:PF05690.20 contig_6 cds 4785 5603 + GCA000529525_01824 hypothetical protein PFAM:PF00294.29 contig_6 cds 5761 5928 + GCA000529525_01825 hypothetical protein contig_6 cds 5904 6533 + GCA000529525_01826 hypothetical protein contig_6 cds 6881 7078 + GCA000529525_01827 hypothetical protein contig_6 cds 7132 7470 + GCA000529525_01828 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13431.12, PFAM:PF13432.12, PFAM:PF14559.12, PFAM:PF14853.12 contig_6 cds 7543 7773 + GCA000529525_01829 hypothetical protein contig_6 cds 7800 8705 + GCA000529525_01830 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13181.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF14559.12 contig_6 cds 8733 9113 + GCA000529525_01831 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13174.12, PFAM:PF13181.12, PFAM:PF13414.12 contig_6 cds 9371 14140 + GCA000529525_01832 hypothetical protein PFAM:PF09848.15, PFAM:PF13086.12, PFAM:PF13087.12, PFAM:PF13245.12, PFAM:PF13604.12, PFAM:PF18741.7 contig_6 cds 14094 15950 + GCA000529525_01833 hypothetical protein contig_6 cds 15937 17709 + GCA000529525_01834 hypothetical protein PFAM:PF01541.30, PFAM:PF08459.17, PFAM:PF12826.13, PFAM:PF14520.12, PFAM:PF22920.2 contig_6 cds 17800 18342 + GCA000529525_01835 hypothetical protein contig_6 cds 18339 18635 - GCA000529525_01836 hypothetical protein contig_6 cds 18888 19115 - GCA000529525_01837 Polymerase beta nucleotidyltransferase domain-containing protein SO:0001217, UniRef:UniRef50_A0A1I2NPR9 contig_6 cds 19601 19711 + GCA000529525_01838 hypothetical protein contig_6 cds 20232 20348 + GCA000529525_01839 hypothetical protein contig_6 cds 20420 21016 + GCA000529525_01840 hypothetical protein contig_6 cds 21050 21661 + GCA000529525_01841 hypothetical protein PFAM:PF01613.24 contig_6 cds 21651 21818 + GCA000529525_01842 hypothetical protein contig_6 cds 21775 21909 + GCA000529525_01843 hypothetical protein contig_6 cds 21925 23073 + GCA000529525_01844 hypothetical protein PFAM:PF02663.19 contig_6 cds 23103 24593 + GCA000529525_01845 hypothetical protein PFAM:PF02663.19 contig_6 cds 24794 26500 + GCA000529525_01846 hypothetical protein PFAM:PF00005.33, PFAM:PF00931.28, PFAM:PF02463.25, PFAM:PF03215.21, PFAM:PF05621.17, PFAM:PF09818.15, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13555.12, PFAM:PF20720.3 contig_6 cds 26501 26926 + GCA000529525_01847 hypothetical protein PFAM:PF00582.32 contig_6 cds 27076 27243 + GCA000529525_01848 hypothetical protein PFAM:PF00037.32, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11 contig_6 cds 27248 28426 + GCA000529525_01849 hypothetical protein PFAM:PF01266.30, PFAM:PF07992.20, PFAM:PF13450.12, PFAM:PF22578.2 contig_6 cds 28436 29401 + GCA000529525_01850 UDP-glucose 4-epimerase SO:0001217, UniRef:UniRef50_P26503 contig_6 cds 29377 30186 + GCA000529525_01851 hypothetical protein contig_6 cds 30301 31722 + GCA000529525_01852 Amidophosphoribosyltransferase SO:0001217, UniRef:UniRef50_M1LPX2 contig_6 cds 31728 32447 + GCA000529525_01853 hypothetical protein contig_6 cds 32444 32974 + GCA000529525_01854 hypothetical protein contig_6 cds 32967 33761 + GCA000529525_01855 hypothetical protein PFAM:PF00142.24, PFAM:PF01656.29, PFAM:PF13614.12 contig_6 cds 34134 34484 + GCA000529525_01856 Arsenate reductase SO:0001217, UniRef:UniRef50_D5DVB1 contig_6 cds 34845 35066 + GCA000529525_01857 hypothetical protein SO:0001217, UniRef:UniRef50_A0A2X0TYB9 contig_6 cds 35218 35388 + GCA000529525_01858 hypothetical protein contig_6 cds 35827 36981 + GCA000529525_01859 hypothetical protein PFAM:PF00587.30, PFAM:PF02403.27 contig_6 cds 37116 38570 + GCA000529525_01860 hypothetical protein PFAM:PF00070.33, PFAM:PF02852.28, PFAM:PF07992.20 contig_6 cds 38588 39070 - GCA000529525_01861 hypothetical protein PFAM:PF03729.18 contig_6 cds 39133 39648 + GCA000529525_01862 Albonoursin synthase SO:0001217, UniRef:UniRef50_A0A136WGY7 contig_6 cds 39649 39978 + GCA000529525_01863 Cystathionine beta-lyase SO:0001217, UniRef:UniRef50_A0A3C0VS42 contig_6 cds 40032 40799 + GCA000529525_01864 hypothetical protein PFAM:PF00155.27 contig_6 cds 40783 41586 - GCA000529525_01865 hypothetical protein PFAM:PF00293.34, PFAM:PF09297.16 contig_6 cds 41821 42321 + GCA000529525_01866 Ferritin SO:0001217, UniRef:UniRef50_A0A238XUQ0 contig_6 cds 42487 43470 + GCA000529525_01867 hypothetical protein PFAM:PF00288.32 contig_6 cds 44941 45372 - GCA000529525_01868 ACT domain-containing protein SO:0001217, UniRef:UniRef50_A0A0U9HLK7 contig_6 cds 45381 46046 - GCA000529525_01869 AMP-dependent ligase C-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A2G6P518 contig_6 cds 46076 46681 - GCA000529525_01870 hypothetical protein contig_6 cds 47290 48000 + GCA000529525_01871 hypothetical protein contig_6 cds 48016 48663 + GCA000529525_01872 hypothetical protein contig_6 cds 48668 49006 + GCA000529525_01873 hypothetical protein contig_6 cds 49018 50373 - GCA000529525_01874 hypothetical protein contig_6 cds 50974 51261 + GCA000529525_01875 hypothetical protein PFAM:PF01893.21 contig_6 cds 51288 52004 - GCA000529525_01876 hypothetical protein contig_6 cds 52108 52878 + GCA000529525_01877 Phosphosulfolactate synthase SO:0001217, UniRef:UniRef50_A0A6N4A8N1 contig_6 cds 52883 54148 + GCA000529525_01878 hypothetical protein PFAM:PF01837.21 contig_6 cds 54162 54761 + GCA000529525_01879 hypothetical protein PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13534.11 contig_6 cds 54763 55701 + GCA000529525_01880 hypothetical protein PFAM:PF02754.22 contig_6 cds 55805 56044 + GCA000529525_01881 hypothetical protein contig_6 cds 56146 58008 + GCA000529525_01882 hypothetical protein PFAM:PF00037.32, PFAM:PF07992.20, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF14697.11 contig_6 cds 58005 58541 - GCA000529525_01883 hypothetical protein PFAM:PF02775.26 contig_6 cds 58546 59037 - GCA000529525_01884 hypothetical protein PFAM:PF02776.23 contig_6 cds 59141 60283 + GCA000529525_01885 hypothetical protein PFAM:PF04055.27 contig_6 cds 60302 60868 + GCA000529525_01886 hypothetical protein PFAM:PF02223.23 contig_6 cds 60863 61120 - GCA000529525_01887 hypothetical protein contig_6 cds 61126 62100 - GCA000529525_01888 hypothetical protein contig_6 cds 62173 62733 + GCA000529525_01889 hypothetical protein contig_6 cds 62730 63449 - GCA000529525_01890 hypothetical protein contig_6 cds 63803 64057 - GCA000529525_01891 hypothetical protein contig_6 cds 64226 65854 + GCA000529525_01892 hypothetical protein PFAM:PF00133.28, PFAM:PF01406.26, PFAM:PF19303.5 contig_6 cds 65875 66198 + GCA000529525_01893 Methionine--tRNA ligase subunit beta SO:0001217, UniRef:UniRef50_A0AA42Z1J6 contig_6 cds 66210 67787 + GCA000529525_01894 hypothetical protein contig_6 cds 67795 68178 + GCA000529525_01895 hypothetical protein contig_6 cds 68308 69321 + GCA000529525_01896 hypothetical protein contig_6 cds 69331 69735 + GCA000529525_01897 hypothetical protein PFAM:PF01872.23 contig_6 cds 69744 70001 + GCA000529525_01898 hypothetical protein PFAM:PF01872.23 contig_6 cds 70006 70470 - GCA000529525_01899 hypothetical protein contig_6 cds 70467 71129 - GCA000529525_01900 Polymerase/histidinol phosphatase N-terminal domain-containing protein SO:0001217, UniRef:UniRef50_A0A075WQ85 contig_6 cds 71429 72652 + GCA000529525_01901 hypothetical protein PFAM:PF00258.30, PFAM:PF00753.33, PFAM:PF19583.5 contig_6 cds 72745 73254 + GCA000529525_01902 Flavodoxin-like domain-containing protein SO:0001217, UniRef:UniRef50_G7M4W7 contig_6 cds 73701 74345 + GCA000529525_01903 hypothetical protein contig_6 cds 74338 75195 + GCA000529525_01904 hypothetical protein PFAM:PF00288.32 contig_6 cds 75188 75709 + GCA000529525_01905 hypothetical protein contig_6 cds 75883 78633 + GCA000529525_01906 hypothetical protein PFAM:PF02369.22, PFAM:PF13620.12, PFAM:PF17789.7 contig_6 cds 78919 80925 + GCA000529525_01907 hypothetical protein contig_6 cds 80997 83996 + GCA000529525_01908 hypothetical protein contig_6 cds 84095 84802 + GCA000529525_01909 hypothetical protein contig_6 cds 84811 85452 + GCA000529525_01910 hypothetical protein contig_6 cds 85609 86400 + GCA000529525_01911 hypothetical protein PFAM:PF01791.15 contig_6 cds 86410 87537 + GCA000529525_01912 hypothetical protein contig_6 cds 87546 88103 + GCA000529525_01913 hypothetical protein PFAM:PF10469.15 contig_6 cds 88108 89478 + GCA000529525_01914 hypothetical protein PFAM:PF01909.29, PFAM:PF09249.16, PFAM:PF18144.7, PFAM:PF21133.2 contig_6 cds 89854 90399 + GCA000529525_01915 hypothetical protein contig_6 cds 90415 90528 + GCA000529525_01916 hypothetical protein contig_6 cds 90579 91094 + GCA000529525_01917 hypothetical protein contig_6 cds 91284 91436 + GCA000529525_01918 hypothetical protein contig_6 cds 91659 91928 + GCA000529525_01919 hypothetical protein contig_6 cds 92276 93610 + GCA000529525_01920 hypothetical protein contig_6 assembly_gap 93740 94008 . contig_6 cds 94186 94371 - GCA000529525_01921 hypothetical protein contig_6 cds 94984 95571 + GCA000529525_01922 hypothetical protein PFAM:PF01345.24 contig_6 cds 95651 95980 + GCA000529525_01923 TIGR04076 family protein SO:0001217, UniRef:UniRef50_F9ZAD3 contig_6 cds 95964 96434 - GCA000529525_01924 hypothetical protein PFAM:PF00302.23 contig_6 cds 96440 96583 - GCA000529525_01925 hypothetical protein contig_6 cds 96675 98006 + GCA000529525_01926 hypothetical protein PFAM:PF00070.33, PFAM:PF01266.30, PFAM:PF02852.28, PFAM:PF07992.20, PFAM:PF13450.12 contig_6 cds 98026 98901 + GCA000529525_01927 Iron-sulfur cluster carrier protein SO:0001217, UniRef:UniRef50_A0A1G1GLI8 contig_6 cds 98888 99280 - GCA000529525_01928 hypothetical protein contig_6 cds 99374 103954 + GCA000529525_01929 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_6 cds 104096 107284 + GCA000529525_01930 hypothetical protein PFAM:PF00112.29, PFAM:PF16640.11, PFAM:PF18560.7 contig_6 cds 107500 108030 + GCA000529525_01931 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF17789.7 contig_6 cds 108020 108940 + GCA000529525_01932 hypothetical protein contig_6 cds 108960 110522 + GCA000529525_01933 hypothetical protein PFAM:PF02369.22, PFAM:PF16640.11 contig_6 cds 111403 111582 + GCA000529525_01934 hypothetical protein contig_6 cds 111591 111845 + GCA000529525_01935 hypothetical protein contig_6 cds 112048 112470 - GCA000529525_01936 hypothetical protein contig_6 cds 112644 113015 - GCA000529525_01937 hypothetical protein PFAM:PF08546.17 contig_6 cds 113022 113594 - GCA000529525_01938 hypothetical protein PFAM:PF02558.23 contig_6 cds 114054 114314 + GCA000529525_01939 hypothetical protein contig_6 cds 114339 114554 + GCA000529525_01940 hypothetical protein contig_6 cds 114598 115962 - GCA000529525_01941 hypothetical protein contig_6 cds 115964 116437 - GCA000529525_01942 hypothetical protein PFAM:PF01047.28, PFAM:PF01638.23, PFAM:PF13412.12, PFAM:PF13463.12, PFAM:PF13601.12 contig_6 assembly_gap 117092 118647 . contig_6 cds 118896 119279 + GCA000529525_01943 hypothetical protein contig_6 cds 119239 119472 + GCA000529525_01944 hypothetical protein contig_6 cds 119551 119814 + GCA000529525_01945 hypothetical protein contig_6 cds 119958 124712 + GCA000529525_01946 hypothetical protein contig_7 cds 1042 1173 + GCA000529525_01947 hypothetical protein contig_7 cds 1441 1815 + GCA000529525_01948 hypothetical protein contig_7 cds 1860 2003 + GCA000529525_01949 hypothetical protein contig_7 cds 2004 2237 + GCA000529525_01950 hypothetical protein PFAM:PF12161.14 contig_7 cds 2459 3502 + GCA000529525_01951 hypothetical protein contig_7 cds 3715 4128 + GCA000529525_01952 hypothetical protein contig_7 cds 4125 4526 + GCA000529525_01953 hypothetical protein contig_7 cds 4579 5601 - GCA000529525_01954 Adenylosuccinate synthetase SO:0001217, UniRef:UniRef50_A0A401RB49 contig_7 assembly_gap 5905 6173 . contig_7 cds 6336 6929 - GCA000529525_01955 hypothetical protein contig_7 cds 6926 7513 - GCA000529525_01956 hypothetical protein PFAM:PF21831.1 contig_7 cds 7518 8201 - GCA000529525_01957 hypothetical protein contig_7 cds 8211 9446 - GCA000529525_01958 LL-diaminopimelate aminotransferase SO:0001217, UniRef:UniRef50_A3DK17 contig_7 cds 9673 10380 - GCA000529525_01959 hypothetical protein contig_7 cds 10449 11051 - GCA000529525_01960 hypothetical protein contig_7 cds 11752 13152 + GCA000529525_01961 hypothetical protein contig_7 cds 13159 13617 - GCA000529525_01962 hypothetical protein contig_7 cds 13627 15294 - GCA000529525_01963 hypothetical protein PFAM:PF00749.27, PFAM:PF03950.23, PFAM:PF20974.2 contig_7 cds 15775 16656 + GCA000529525_01964 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF12895.13, PFAM:PF13374.12, PFAM:PF13424.12, PFAM:PF13428.12, PFAM:PF13432.12, PFAM:PF14559.12 contig_7 cds 16653 16778 + GCA000529525_01965 hypothetical protein contig_7 cds 16781 16948 + GCA000529525_01966 hypothetical protein contig_7 cds 17218 17790 + GCA000529525_01967 iolS Aldo-keto reductase IolS SO:0001217, UniRef:UniRef50_A0A7U9SRK4 contig_7 cds 17795 18040 + GCA000529525_01968 hypothetical protein PFAM:PF05175.20 contig_7 cds 18064 18606 + GCA000529525_01969 hypothetical protein contig_7 cds 18900 19118 - GCA000529525_01970 hypothetical protein contig_7 cds 19458 19952 - GCA000529525_01971 hypothetical protein contig_7 cds 19901 20062 - GCA000529525_01972 hypothetical protein contig_7 cds 20059 20796 - GCA000529525_01973 hypothetical protein contig_7 cds 20777 22243 - GCA000529525_01974 hypothetical protein PFAM:PF00005.33, PFAM:PF00931.28, PFAM:PF01078.27, PFAM:PF02463.25, PFAM:PF13304.12, PFAM:PF13401.12, PFAM:PF13555.12 contig_7 cds 22348 22542 - GCA000529525_01975 hypothetical protein contig_7 cds 22560 24290 - GCA000529525_01976 ABC transporter SO:0001217, UniRef:UniRef50_G5GB05 contig_7 cds 24292 26019 - GCA000529525_01977 Xenobiotic-transporting ATPase SO:0001217, UniRef:UniRef50_A0A449I3P3 contig_7 cds 26239 26805 - GCA000529525_01978 hypothetical protein PFAM:PF00440.29 contig_7 cds 26959 27168 - GCA000529525_01979 hypothetical protein contig_7 cds 27165 27269 - GCA000529525_01980 hypothetical protein contig_7 cds 27339 27653 - GCA000529525_01981 hypothetical protein contig_7 cds 27818 29050 - GCA000529525_01982 hypothetical protein PFAM:PF13635.12 contig_7 cds 29318 29647 - GCA000529525_01983 hypothetical protein PFAM:PF02311.25, PFAM:PF07883.17 contig_7 cds 29651 30958 - GCA000529525_01984 hypothetical protein contig_7 cds 31079 31279 + GCA000529525_01985 hypothetical protein PFAM:PF01978.25 contig_7 cds 31387 31857 + GCA000529525_01986 hypothetical protein contig_7 cds 31849 32118 - GCA000529525_01987 hypothetical protein contig_7 cds 32061 32492 - GCA000529525_01988 hypothetical protein PFAM:PF03119.21, PFAM:PF06827.20, PFAM:PF07282.18, PFAM:PF08271.17, PFAM:PF09297.16, PFAM:PF13240.11, PFAM:PF13248.11, PFAM:PF13920.12, PFAM:PF14803.11, PFAM:PF17032.10, PFAM:PF18912.6, PFAM:PF21344.3, PFAM:PF24460.1, PFAM:PF24463.1 contig_7 cds 32483 32662 - GCA000529525_01989 hypothetical protein contig_7 cds 33045 33452 - GCA000529525_01990 F420-non-reducing hydrogenase iron-sulfur subunit SO:0001217, UniRef:UniRef50_A0A916CBX2 contig_7 cds 33462 34607 - GCA000529525_01991 hypothetical protein PFAM:PF00037.32, PFAM:PF04432.18, PFAM:PF13183.11, PFAM:PF13534.11 contig_7 cds 34615 35649 - GCA000529525_01992 hypothetical protein PFAM:PF00384.28, PFAM:PF04879.21 contig_7 cds 35696 36046 - GCA000529525_01993 hypothetical protein contig_7 cds 36496 37485 - GCA000529525_01994 hypothetical protein PFAM:PF00348.22 contig_7 cds 37498 38841 - GCA000529525_01995 hypothetical protein PFAM:PF00753.33, PFAM:PF07521.17, PFAM:PF12706.13, PFAM:PF22505.1 contig_7 cds 38848 39894 - GCA000529525_01996 hypothetical protein PFAM:PF00478.31, PFAM:PF01070.24, PFAM:PF01645.23, PFAM:PF03060.21 contig_7 cds 39896 40696 - GCA000529525_01997 hypothetical protein contig_7 cds 40702 41385 - GCA000529525_01998 hypothetical protein PFAM:PF00288.32, PFAM:PF08544.19 contig_7 cds 41424 41663 - GCA000529525_01999 hypothetical protein contig_7 cds 41673 42521 - GCA000529525_02000 hypothetical protein PFAM:PF02900.23 contig_7 cds 42531 43130 - GCA000529525_02001 hypothetical protein contig_7 cds 43155 43349 - GCA000529525_02002 hypothetical protein PFAM:PF00037.32, PFAM:PF12838.12, PFAM:PF13237.11 contig_7 cds 43369 44613 - GCA000529525_02003 hypothetical protein PFAM:PF00113.28, PFAM:PF03952.21, PFAM:PF13378.12 contig_7 cds 44745 44924 - GCA000529525_02004 hypothetical protein contig_7 cds 45000 45170 - GCA000529525_02005 hypothetical protein PFAM:PF01194.22 contig_7 cds 45219 45620 - GCA000529525_02006 hypothetical protein contig_7 cds 45639 46064 - GCA000529525_02007 hypothetical protein contig_7 cds 46080 46445 - GCA000529525_02008 hypothetical protein PFAM:PF00828.25 contig_7 cds 46445 47245 - GCA000529525_02009 hypothetical protein PFAM:PF01000.31, PFAM:PF01193.29 contig_7 cds 47258 47650 - GCA000529525_02010 hypothetical protein contig_7 cds 47662 47991 - GCA000529525_02011 hypothetical protein PFAM:PF01479.30 contig_7 cds 48053 48184 - GCA000529525_02012 hypothetical protein contig_7 cds 48235 48681 - GCA000529525_02013 hypothetical protein contig_7 tRNA 48876 48960 - GCA000529525_02014 trnS tRNA-Ser(gga) SO:0000269 contig_7 cds 49212 49766 + GCA000529525_02015 lemA LemA family protein SO:0001217, UniRef:UniRef50_F7UX26 contig_7 cds 49776 51560 + GCA000529525_02016 hypothetical protein PFAM:PF09972.14 contig_7 cds 51626 52588 - GCA000529525_02017 hypothetical protein PFAM:PF08068.17 contig_7 cds 52659 52880 - GCA000529525_02018 hypothetical protein contig_7 cds 52881 53399 - GCA000529525_02019 hypothetical protein PFAM:PF02224.24, PFAM:PF13189.12, PFAM:PF13207.12, PFAM:PF13238.12 contig_7 cds 53809 54399 - GCA000529525_02020 hypothetical protein contig_7 cds 54410 54967 - GCA000529525_02021 hypothetical protein PFAM:PF13207.12, PFAM:PF13238.12 contig_7 cds 55006 56370 - GCA000529525_02022 hypothetical protein PFAM:PF10559.14 contig_7 cds 56402 56839 - GCA000529525_02023 hypothetical protein PFAM:PF00828.25 contig_7 cds 56855 57313 - GCA000529525_02024 hypothetical protein PFAM:PF00327.25 contig_7 cds 57326 57967 - GCA000529525_02025 hypothetical protein PFAM:PF00333.26, PFAM:PF03719.21 contig_7 cds 57970 58551 - GCA000529525_02026 hypothetical protein contig_7 cds 58563 59009 - GCA000529525_02027 hypothetical protein contig_7 cds 59142 59471 - GCA000529525_02028 hypothetical protein contig_7 cds 59485 60021 - GCA000529525_02029 hypothetical protein PFAM:PF00347.28 contig_7 cds 60030 60422 - GCA000529525_02030 hypothetical protein PFAM:PF00410.24 contig_7 cds 60434 60577 - GCA000529525_02031 hypothetical protein PFAM:PF06827.20 contig_7 cds 60586 61098 - GCA000529525_02032 hypothetical protein PFAM:PF00281.24, PFAM:PF00673.26 contig_7 cds 61095 61823 - GCA000529525_02033 hypothetical protein PFAM:PF01479.30, PFAM:PF08071.17 contig_7 cds 61825 62175 - GCA000529525_02034 hypothetical protein contig_7 cds 62271 62582 - GCA000529525_02035 hypothetical protein PFAM:PF00238.24 contig_7 cds 62587 63192 - GCA000529525_02036 hypothetical protein PFAM:PF00366.26 contig_7 cds 63278 63616 - GCA000529525_02037 hypothetical protein PFAM:PF01253.27 contig_7 cds 63617 63823 - GCA000529525_02038 Large ribosomal subunit protein uL29 SO:0001217, UniRef:UniRef50_A0A9E5Y480 contig_7 cds 63856 64614 - GCA000529525_02039 hypothetical protein PFAM:PF00189.25, PFAM:PF07650.23 contig_7 cds 64614 65078 - GCA000529525_02040 hypothetical protein PFAM:PF00237.24 contig_7 cds 65091 65501 - GCA000529525_02041 hypothetical protein PFAM:PF00203.26 contig_7 cds 65517 65813 - GCA000529525_02042 hypothetical protein PFAM:PF03947.24 contig_7 cds 66101 66241 - GCA000529525_02043 hypothetical protein contig_7 cds 66254 66514 - GCA000529525_02044 hypothetical protein contig_7 cds 66538 67302 - GCA000529525_02045 hypothetical protein contig_7 cds 67305 68315 - GCA000529525_02046 hypothetical protein contig_7 cds 68840 69484 - GCA000529525_02047 hypothetical protein contig_7 cds 69728 70357 - GCA000529525_02048 hypothetical protein PFAM:PF01170.24, PFAM:PF05175.20, PFAM:PF13649.12, PFAM:PF13847.12 contig_7 cds 70426 71919 + GCA000529525_02049 Biotin carboxylase SO:0001217, UniRef:UniRef50_A0A2L2XBB6 contig_7 cds 71938 72855 + GCA000529525_02050 hypothetical protein PFAM:PF02237.23, PFAM:PF03099.24, PFAM:PF21948.1 contig_7 cds 73044 74213 - GCA000529525_02051 hypothetical protein PFAM:PF00155.27, PFAM:PF03841.19, PFAM:PF22583.2 contig_7 cds 74215 74427 - GCA000529525_02052 hypothetical protein contig_7 cds 74436 74543 - GCA000529525_02053 hypothetical protein contig_7 cds 74996 75517 - GCA000529525_02054 L(+)-tartrate dehydratase subunit beta SO:0001217, UniRef:UniRef50_A0A448HJ19 contig_7 cds 75625 77445 + GCA000529525_02055 hypothetical protein contig_7 cds 77440 77712 - GCA000529525_02056 hypothetical protein contig_7 cds 77799 78281 + GCA000529525_02057 hypothetical protein contig_7 cds 78235 78465 - GCA000529525_02058 hypothetical protein contig_7 cds 78664 78948 + GCA000529525_02059 hypothetical protein contig_7 cds 78900 79802 + GCA000529525_02060 hypothetical protein PFAM:PF05670.18 contig_7 cds 79799 80056 - GCA000529525_02061 hypothetical protein PFAM:PF13483.12 contig_7 cds 80116 80502 - GCA000529525_02062 hypothetical protein PFAM:PF00753.33, PFAM:PF12706.13, PFAM:PF13483.12 contig_7 cds 80492 81661 - GCA000529525_02063 hypothetical protein contig_7 cds 81839 82057 + GCA000529525_02064 hypothetical protein PFAM:PF04021.17 contig_7 cds 82050 82229 + GCA000529525_02065 hypothetical protein PFAM:PF04021.17 contig_7 cds 82248 83258 - GCA000529525_02066 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12798.12, PFAM:PF12800.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13183.11, PFAM:PF13237.11, PFAM:PF13484.11, PFAM:PF13534.11, PFAM:PF14697.11 contig_7 cds 83268 83459 - GCA000529525_02067 hypothetical protein PFAM:PF00037.32, PFAM:PF12837.12 contig_7 cds 83785 84015 - GCA000529525_02068 hypothetical protein PFAM:PF01467.32 contig_7 cds 84246 86519 - GCA000529525_02069 hypothetical protein PFAM:PF01841.26, PFAM:PF02369.22, PFAM:PF09134.16, PFAM:PF09373.15, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7, PFAM:PF24025.1 contig_7 cds 87709 89262 + GCA000529525_02070 hypothetical protein PFAM:PF04055.27, PFAM:PF19864.4 contig_7 cds 89328 89867 + GCA000529525_02071 hypothetical protein PFAM:PF00155.27, PFAM:PF01041.23 contig_7 cds 89849 90442 + GCA000529525_02072 hypothetical protein PFAM:PF00155.27 contig_7 cds 90435 91340 + GCA000529525_02073 hypothetical protein PFAM:PF16916.10 contig_7 tRNA 91345 91428 - GCA000529525_02074 trnS tRNA-Ser(gct) SO:0000269 contig_7 cds 93158 93481 - GCA000529525_02075 hypothetical protein contig_7 assembly_gap 94243 95798 . contig_7 cds 96327 96554 - GCA000529525_02076 hypothetical protein contig_7 cds 96739 97128 - GCA000529525_02077 hypothetical protein PFAM:PF00571.33 contig_7 cds 97106 98020 - GCA000529525_02078 hypothetical protein PFAM:PF03477.21 contig_7 cds 98581 98928 + GCA000529525_02079 hypothetical protein contig_7 cds 99372 99515 - GCA000529525_02080 hypothetical protein contig_7 assembly_gap 100329 100647 . contig_7 cds 102431 102685 - GCA000529525_02081 hypothetical protein contig_7 cds 102849 103253 - GCA000529525_02082 hypothetical protein PFAM:PF08000.17 contig_7 cds 103367 104683 + GCA000529525_02083 hypothetical protein contig_7 cds 104700 105317 + GCA000529525_02084 hypothetical protein PFAM:PF00633.29, PFAM:PF00730.31 contig_7 cds 105347 106309 + GCA000529525_02085 hypothetical protein contig_7 cds 106461 106700 + GCA000529525_02086 hypothetical protein contig_7 gap 106889 106969 . contig_7 cds 107591 107818 + GCA000529525_02087 hypothetical protein contig_7 cds 107920 108891 + GCA000529525_02088 hypothetical protein PFAM:PF02289.21 contig_7 cds 108992 109795 + GCA000529525_02089 hypothetical protein contig_7 cds 110301 110573 - GCA000529525_02090 hypothetical protein contig_7 cds 111644 111895 + GCA000529525_02091 hypothetical protein contig_7 assembly_gap 112207 112540 . contig_7 cds 112938 114566 + GCA000529525_02092 hypothetical protein contig_7 cds 115036 118965 + GCA000529525_02093 hypothetical protein PFAM:PF00112.29, PFAM:PF02369.22, PFAM:PF16640.11, PFAM:PF18560.7 contig_8 cds 13 1398 - GCA000529525_02094 hypothetical protein PFAM:PF01345.24, PFAM:PF24346.1 contig_8 cds 1644 4166 - GCA000529525_02095 hypothetical protein PFAM:PF02415.23, PFAM:PF13229.12 contig_8 assembly_gap 4510 4778 . contig_8 cds 5986 6396 + GCA000529525_02096 hypothetical protein contig_8 cds 6579 7613 + GCA000529525_02097 hypothetical protein PFAM:PF00149.33, PFAM:PF01336.31 contig_8 cds 7615 8211 + GCA000529525_02098 hypothetical protein PFAM:PF00596.26 contig_8 cds 8495 8758 + GCA000529525_02099 hypothetical protein contig_8 cds 8784 9782 - GCA000529525_02100 hypothetical protein PFAM:PF01890.21, PFAM:PF11760.13 contig_8 cds 9802 10803 - GCA000529525_02101 hypothetical protein contig_8 cds 10855 11346 + GCA000529525_02102 hypothetical protein contig_8 cds 11873 13024 + GCA000529525_02103 hypothetical protein PFAM:PF09079.17, PFAM:PF13191.12, PFAM:PF13401.12, PFAM:PF22606.2, PFAM:PF22703.2 contig_8 cds 13017 13364 - GCA000529525_02104 hypothetical protein PFAM:PF00185.30 contig_8 cds 13487 13924 - GCA000529525_02105 hypothetical protein PFAM:PF02729.26 contig_8 cds 13976 14248 - GCA000529525_02106 hypothetical protein PFAM:PF08029.16 contig_8 cds 14245 14838 - GCA000529525_02107 hypothetical protein contig_8 cds 15028 15237 + GCA000529525_02108 hypothetical protein PFAM:PF00125.30, PFAM:PF00808.29, PFAM:PF02969.23 contig_8 cds 15274 16578 + GCA000529525_02109 5-methylthioadenosine/S-adenosylhomocysteine deaminase SO:0001217, UniRef:UniRef50_Q2RJW1 contig_8 cds 16571 18214 - GCA000529525_02110 hypothetical protein PFAM:PF02910.25, PFAM:PF07992.20 contig_8 cds 18324 18443 + GCA000529525_02111 hypothetical protein contig_8 cds 18557 18697 + GCA000529525_02112 hypothetical protein PFAM:PF01982.22 contig_8 ncRNA-region 18744 18870 + FMN riboswitch aptamer (RFN element) RFAM:RF00050, SO:0000035 contig_8 cds 18913 19596 + GCA000529525_02113 hypothetical protein contig_8 cds 19593 20003 - GCA000529525_02114 hypothetical protein contig_8 cds 20003 20728 - GCA000529525_02115 hypothetical protein PFAM:PF01656.29, PFAM:PF13500.12 contig_8 cds 20728 21492 - GCA000529525_02116 hypothetical protein PFAM:PF01174.25, PFAM:PF01965.30, PFAM:PF07685.20 contig_8 cds 21606 22976 - GCA000529525_02117 hypothetical protein PFAM:PF01425.27 contig_8 cds 23071 23865 + GCA000529525_02118 hypothetical protein PFAM:PF00702.32 contig_8 cds 23862 24578 - GCA000529525_02119 hypothetical protein PFAM:PF01261.30 contig_8 cds 24714 26210 + GCA000529525_02120 hypothetical protein PFAM:PF00682.25, PFAM:PF08502.15, PFAM:PF22617.1 contig_8 cds 26289 26561 + GCA000529525_02121 hypothetical protein contig_8 cds 26585 27229 - GCA000529525_02122 hypothetical protein PFAM:PF13263.12 contig_8 cds 27231 28262 - GCA000529525_02123 hypothetical protein contig_8 cds 28352 29653 + GCA000529525_02124 hypothetical protein contig_8 cds 30110 30958 + GCA000529525_02125 Sporulation initiation inhibitor protein Soj SO:0001217, UniRef:UniRef50_A0A1V5DY51 contig_8 cds 30951 31643 + GCA000529525_02126 hypothetical protein contig_8 cds 31640 32764 - GCA000529525_02127 hypothetical protein PFAM:PF04055.27, PFAM:PF12836.13 contig_8 cds 33493 33756 + GCA000529525_02128 hypothetical protein contig_8 cds 33996 34181 + GCA000529525_02129 hypothetical protein contig_8 cds 34529 34876 - GCA000529525_02130 hypothetical protein contig_8 assembly_gap 37206 38761 . contig_8 cds 39044 39565 + GCA000529525_02131 hypothetical protein PFAM:PF01345.24 contig_8 assembly_gap 39637 39955 . contig_8 cds 40280 41929 + GCA000529525_02132 hypothetical protein PFAM:PF00920.27, PFAM:PF24877.1 contig_8 cds 41937 43211 + GCA000529525_02133 Histidinol dehydrogenase SO:0001217, UniRef:UniRef50_Q3AD53 contig_8 cds 43348 44667 + GCA000529525_02134 hypothetical protein PFAM:PF00152.25, PFAM:PF01336.31, PFAM:PF01409.25 contig_8 cds 44675 45877 + GCA000529525_02135 hypothetical protein PFAM:PF03486.20, PFAM:PF07992.20 contig_8 cds 46236 48848 + GCA000529525_02136 hypothetical protein PFAM:PF02663.19 contig_8 cds 49116 49679 + GCA000529525_02137 hypothetical protein contig_8 cds 49760 50389 + GCA000529525_02138 hypothetical protein contig_8 cds 50399 51670 + GCA000529525_02139 Glutamate-1-semialdehyde 2,1-aminomutase SO:0001217, UniRef:UniRef50_Q55665 contig_8 cds 51680 52099 + GCA000529525_02140 hypothetical protein PFAM:PF10502.14 contig_8 cds 52118 53815 + GCA000529525_02141 hypothetical protein PFAM:PF03485.21, PFAM:PF05746.21 contig_8 cds 53855 53974 - GCA000529525_02142 hypothetical protein contig_8 cds 54211 54381 - GCA000529525_02143 nitroreductase family protein SO:0001217, UniRef:UniRef50_UPI000B0620B3 contig_8 cds 54475 55785 + GCA000529525_02144 hypothetical protein PFAM:PF01071.24, PFAM:PF02843.22, PFAM:PF02844.21 contig_8 cds 55809 55973 + GCA000529525_02145 hypothetical protein contig_8 cds 55974 56654 + GCA000529525_02146 hypothetical protein contig_8 cds 56711 57616 + GCA000529525_02147 Ornithine carbamoyltransferase SO:0001217, UniRef:UniRef50_Q9ZB62 contig_8 cds 57885 59579 + GCA000529525_02148 Acetolactate synthase SO:0001217, UniRef:UniRef50_A0A2V7PZS0 contig_8 cds 59589 60074 + GCA000529525_02149 Acetolactate synthase small subunit SO:0001217, UniRef:UniRef50_A0A174E9E8 contig_8 cds 60075 60602 + GCA000529525_02150 hypothetical protein PFAM:PF00484.24 contig_8 cds 60768 61760 + GCA000529525_02151 hypothetical protein PFAM:PF01450.25, PFAM:PF02826.25, PFAM:PF03446.21 contig_8 cds 61805 62812 + GCA000529525_02152 hypothetical protein contig_8 cds 62826 63026 - GCA000529525_02153 hypothetical protein PFAM:PF01423.28, PFAM:PF02237.23 contig_8 cds 63113 63256 + GCA000529525_02154 hypothetical protein contig_8 cds 63260 64036 - GCA000529525_02155 hypothetical protein PFAM:PF01975.23 contig_8 cds 64181 65089 + GCA000529525_02156 hypothetical protein contig_8 cds 65075 66136 - GCA000529525_02157 hypothetical protein contig_8 cds 66138 66500 - GCA000529525_02158 hypothetical protein PFAM:PF07685.20 contig_8 cds 66796 67017 + GCA000529525_02159 hypothetical protein contig_8 cds 67021 67491 - GCA000529525_02160 hypothetical protein PFAM:PF01656.29, PFAM:PF13500.12 contig_8 cds 67593 68564 + GCA000529525_02161 hypothetical protein PFAM:PF08915.16 contig_8 cds 68591 69418 + GCA000529525_02162 hypothetical protein PFAM:PF00587.30, PFAM:PF03129.25 contig_8 cds 69476 70711 + GCA000529525_02163 hypothetical protein PFAM:PF00215.30 contig_8 cds 70758 71042 + GCA000529525_02164 Putative zinc ribbon domain-containing protein SO:0001217, UniRef:UniRef50_A0A7C6FQJ7 contig_8 cds 71039 71365 - GCA000529525_02165 hypothetical protein contig_8 cds 71530 71934 - GCA000529525_02166 hypothetical protein contig_8 cds 72038 72622 + GCA000529525_02167 hypothetical protein PFAM:PF03358.20 contig_8 cds 72674 74230 + GCA000529525_02168 hypothetical protein contig_8 gap 74446 74526 . contig_8 cds 75455 75832 - GCA000529525_02169 hypothetical protein contig_8 cds 75879 76028 - GCA000529525_02170 hypothetical protein contig_8 cds 76797 77000 - GCA000529525_02171 hypothetical protein contig_8 cds 78397 78906 - GCA000529525_02172 hypothetical protein contig_8 cds 79091 79651 - GCA000529525_02173 hypothetical protein contig_8 cds 83481 84359 - GCA000529525_02174 Acetylglutamate kinase SO:0001217, UniRef:UniRef50_Q9X2A4 contig_8 cds 84391 84603 - GCA000529525_02175 hypothetical protein contig_8 cds 85116 85256 - GCA000529525_02176 hypothetical protein contig_8 cds 85263 86141 - GCA000529525_02177 hypothetical protein PFAM:PF02037.33 contig_8 assembly_gap 86360 86693 . contig_8 cds 87310 87579 + GCA000529525_02178 hypothetical protein PFAM:PF13358.12 contig_8 cds 88326 89789 - GCA000529525_02179 hypothetical protein contig_8 cds 89886 90002 - GCA000529525_02180 hypothetical protein contig_8 cds 90654 91667 - GCA000529525_02181 Ribulose-5-phosphate reductase SO:0001217, UniRef:UniRef50_A0A143XUA5 contig_8 cds 91671 92372 - GCA000529525_02182 Ribitol-5-phosphate cytidylyltransferase 2 SO:0001217, UniRef:UniRef50_Q2G2C4 contig_8 cds 92374 92979 - GCA000529525_02183 hypothetical protein PFAM:PF05175.20, PFAM:PF08241.18, PFAM:PF08242.18, PFAM:PF13489.12, PFAM:PF13649.12, PFAM:PF13847.12 contig_8 cds 93366 97721 - GCA000529525_02184 hypothetical protein PFAM:PF02369.22, PFAM:PF05048.19, PFAM:PF13229.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_8 cds 97765 99888 - GCA000529525_02185 hypothetical protein PFAM:PF02369.22, PFAM:PF13229.12, PFAM:PF13620.12, PFAM:PF16640.11, PFAM:PF17789.7 contig_8 cds 100822 101664 + GCA000529525_02186 hypothetical protein contig_8 cds 101672 101857 - GCA000529525_02187 hypothetical protein contig_8 cds 101902 102096 - GCA000529525_02188 hypothetical protein contig_8 cds 102492 103748 - GCA000529525_02189 hypothetical protein PFAM:PF05048.19, PFAM:PF13229.12 contig_8 cds 103985 104287 - GCA000529525_02190 hypothetical protein contig_8 cds 104344 104931 - GCA000529525_02191 hypothetical protein contig_8 cds 105026 105559 - GCA000529525_02192 hypothetical protein contig_8 cds 105631 106200 - GCA000529525_02193 hypothetical protein PFAM:PF01258.23, PFAM:PF02663.19 contig_8 cds 106211 107014 - GCA000529525_02194 hypothetical protein PFAM:PF00005.33, PFAM:PF13304.12 contig_8 cds 107005 108018 - GCA000529525_02195 Iron ABC transporter permease SO:0001217, UniRef:UniRef50_A0A0Q3VJE8 contig_8 cds 108027 109097 - GCA000529525_02196 hypothetical protein PFAM:PF01497.23 contig_9 cds 923 4045 + GCA000529525_02197 hypothetical protein PFAM:PF00112.29, PFAM:PF16640.11, PFAM:PF17802.7, PFAM:PF18560.7 contig_9 cds 4061 4234 + GCA000529525_02198 hypothetical protein contig_9 cds 4504 5496 + GCA000529525_02199 hypothetical protein PFAM:PF19077.6 contig_9 cds 6746 8419 + GCA000529525_02200 hypothetical protein contig_9 cds 8610 8744 + GCA000529525_02201 hypothetical protein contig_9 cds 8786 9337 + GCA000529525_02202 hypothetical protein PFAM:PF00881.29 contig_9 cds 9351 10820 - GCA000529525_02203 hypothetical protein PFAM:PF13193.12 contig_9 cds 10821 11798 - GCA000529525_02204 Isocitrate/homoisocitrate dehydrogenase SO:0001217, UniRef:UniRef50_Q5SIJ1 contig_9 cds 11925 12392 + GCA000529525_02205 hypothetical protein PFAM:PF00514.29, PFAM:PF02985.28, PFAM:PF03130.22, PFAM:PF12717.13, PFAM:PF13513.12, PFAM:PF13646.12 contig_9 cds 12480 12740 + GCA000529525_02206 hypothetical protein PFAM:PF01174.25 contig_9 cds 12728 13060 + GCA000529525_02207 hypothetical protein PFAM:PF01174.25 contig_9 cds 14195 15526 + GCA000529525_02208 hypothetical protein PFAM:PF02241.23, PFAM:PF02783.20 contig_9 cds 15536 16030 + GCA000529525_02209 hypothetical protein contig_9 cds 16048 16851 + GCA000529525_02210 hypothetical protein PFAM:PF02240.21 contig_9 cds 16844 18499 + GCA000529525_02211 hypothetical protein PFAM:PF02249.22, PFAM:PF02745.20 contig_9 cds 18681 19406 + GCA000529525_02212 hypothetical protein PFAM:PF00515.34, PFAM:PF07719.23, PFAM:PF13181.12, PFAM:PF13414.12 contig_9 cds 19539 19634 - GCA000529525_02213 hypothetical protein contig_9 cds 19740 20066 - GCA000529525_02214 hypothetical protein PFAM:PF13358.12 contig_9 cds 20041 20250 - GCA000529525_02215 hypothetical protein contig_9 cds 20279 22732 + GCA000529525_02216 hypothetical protein PFAM:PF00580.27, PFAM:PF13245.12, PFAM:PF13604.12, PFAM:PF21396.3 contig_9 cds 22930 23634 + GCA000529525_02217 hypothetical protein PFAM:PF13361.12, PFAM:PF13538.12 contig_9 cds 23737 25866 + GCA000529525_02218 Helicase SO:0001217, UniRef:UniRef50_A0A0K8J7X1 contig_9 cds 26003 26974 + GCA000529525_02219 hypothetical protein PFAM:PF00271.37 contig_9 cds 26979 27752 + GCA000529525_02220 hypothetical protein contig_9 cds 27770 28825 + GCA000529525_02221 Site-specific DNA-methyltransferase SO:0001217, UniRef:UniRef50_A0A970ISN8 contig_9 assembly_gap 29063 29331 . contig_9 cds 29516 29719 + GCA000529525_02222 hypothetical protein contig_9 cds 29722 30396 + GCA000529525_02223 DNA methylase N-4/N-6 domain protein SO:0001217, UniRef:UniRef50_C6PSD4 contig_9 cds 30403 30891 + GCA000529525_02224 hypothetical protein contig_9 cds 30905 32014 + GCA000529525_02225 hypothetical protein PFAM:PF01555.25 contig_9 cds 31998 32312 + GCA000529525_02226 hypothetical protein contig_9 cds 32319 32810 + GCA000529525_02227 hypothetical protein contig_9 cds 32812 33714 + GCA000529525_02228 hypothetical protein PFAM:PF01555.25 contig_9 assembly_gap 34046 35601 . contig_9 cds 35728 36108 + GCA000529525_02229 hypothetical protein contig_9 cds 36117 37496 + GCA000529525_02230 hypothetical protein PFAM:PF00270.35 contig_9 cds 37628 38017 + GCA000529525_02231 hypothetical protein contig_9 cds 38095 39093 + GCA000529525_02232 hypothetical protein PFAM:PF19778.5 contig_9 cds 39261 41948 + GCA000529525_02233 hypothetical protein PFAM:PF07728.20 contig_9 cds 41957 42406 + GCA000529525_02234 hypothetical protein contig_9 cds 42514 43251 + GCA000529525_02235 hypothetical protein contig_10 cds 464 1498 - GCA000529525_02236 hypothetical protein PFAM:PF01170.24, PFAM:PF01555.25, PFAM:PF02926.22 contig_10 cds 2114 2674 - GCA000529525_02237 hypothetical protein PFAM:PF03703.20 contig_10 cds 2803 4056 - GCA000529525_02238 hypothetical protein PFAM:PF00004.35, PFAM:PF07724.20, PFAM:PF07728.20, PFAM:PF16450.11, PFAM:PF17862.7 contig_10 cds 4189 4698 + GCA000529525_02239 hypothetical protein PFAM:PF01381.28 contig_10 cds 4699 5133 - GCA000529525_02240 hypothetical protein contig_10 cds 5170 6429 - GCA000529525_02241 hypothetical protein contig_10 cds 6434 6874 - GCA000529525_02242 hypothetical protein contig_10 cds 6947 8371 - GCA000529525_02243 hypothetical protein PFAM:PF02875.26, PFAM:PF08245.18 contig_10 cds 8380 9450 - GCA000529525_02244 hypothetical protein PFAM:PF10555.14 contig_10 cds 9518 10570 - GCA000529525_02245 hypothetical protein PFAM:PF02222.28, PFAM:PF02786.22 contig_10 cds 10611 10847 - GCA000529525_02246 hypothetical protein PFAM:PF01750.23 contig_10 cds 10969 11088 - GCA000529525_02247 hypothetical protein contig_10 cds 11098 11559 - GCA000529525_02248 hypothetical protein contig_10 cds 11571 11864 - GCA000529525_02249 hypothetical protein PFAM:PF00398.26 contig_10 cds 11875 12303 - GCA000529525_02250 hypothetical protein PFAM:PF01402.27, PFAM:PF08753.17 contig_10 cds 12449 12916 - GCA000529525_02251 hypothetical protein contig_10 cds 13282 13839 + GCA000529525_02252 hypothetical protein contig_10 cds 13839 14375 + GCA000529525_02253 Cytokinin riboside 5'-monophosphate phosphoribohydrolase SO:0001217, UniRef:UniRef50_A0A3R6TM45 contig_10 cds 14443 14634 - GCA000529525_02254 hypothetical protein contig_10 cds 14698 14922 - GCA000529525_02255 hypothetical protein contig_10 cds 15055 16329 + GCA000529525_02256 hypothetical protein PFAM:PF00005.33 contig_10 cds 16308 16775 + GCA000529525_02257 hypothetical protein PFAM:PF00005.33 contig_10 cds 16772 18409 + GCA000529525_02258 ABC transporter SO:0001217, UniRef:UniRef50_H1PMX0 contig_10 cds 18877 20124 - GCA000529525_02259 hypothetical protein PFAM:PF09670.15, PFAM:PF22205.1 contig_10 cds 20124 23351 - GCA000529525_02260 hypothetical protein PFAM:PF00580.27, PFAM:PF12705.13, PFAM:PF13245.12, PFAM:PF13361.12, PFAM:PF13538.12 contig_10 cds 23521 23898 + GCA000529525_02261 hypothetical protein PFAM:PF08797.16 contig_10 assembly_gap 24296 24564 . contig_10 crispr 25032 26531 ? CRISPR array with 21 repeats of length 36, consensus sequence CCACAATCCTTGTTTTTATGGAATTAACTTTGCAAT and spacer length 36 SO:0001459 contig_10 crispr-repeat 25032 25067 ? CRISPR repeat contig_10 crispr-spacer 25068 25102 ? CRISPR spacer, sequence GTGATGGTGTGTGTGGAGGATGTCCTCCATAGGGG contig_10 crispr-repeat 25103 25138 ? CRISPR repeat contig_10 crispr-spacer 25139 25176 ? CRISPR spacer, sequence AGGAATGTCAGTTAAAACCAAATCCCAACCTATTCCTG contig_10 crispr-repeat 25177 25212 ? CRISPR repeat contig_10 crispr-spacer 25213 25249 ? CRISPR spacer, sequence CGAATTAGGAACAGATATTAACAGTCAATGGATTTTG contig_10 crispr-repeat 25250 25285 ? CRISPR repeat contig_10 crispr-spacer 25286 25322 ? CRISPR spacer, sequence AACAATTCTAGTTTAGGGTTCATTATCGGTTTATTAG contig_10 crispr-repeat 25323 25358 ? CRISPR repeat contig_10 crispr-spacer 25359 25395 ? CRISPR spacer, sequence TTGGGTTTGAGTTAGTTATTCTATATCGTCTTCTAGG contig_10 crispr-repeat 25396 25431 ? CRISPR repeat contig_10 crispr-spacer 25432 25467 ? CRISPR spacer, sequence AAAGAGAATTTGAAAATTTTATTATCTTATTCATCA contig_10 crispr-repeat 25468 25503 ? CRISPR repeat contig_10 crispr-spacer 25504 25539 ? CRISPR spacer, sequence CTCAAAACCCTCAAAAAAGCTATTAAAAGACTTTAA contig_10 crispr-repeat 25540 25575 ? CRISPR repeat contig_10 crispr-spacer 25576 25612 ? CRISPR spacer, sequence ATAGCAATATATATATACAACAAAAACCTATTTATTG contig_10 crispr-repeat 25613 25648 ? CRISPR repeat contig_10 crispr-spacer 25649 25684 ? CRISPR spacer, sequence TAAATTAACCAATCTTATATATTCTTCACTATAAAG contig_10 crispr-repeat 25685 25720 ? CRISPR repeat contig_10 crispr-spacer 25721 25757 ? CRISPR spacer, sequence AGTTGGTGAAAAAAACGAATAATAAGGAATTTAAGGG contig_10 crispr-repeat 25758 25793 ? CRISPR repeat contig_10 crispr-spacer 25794 25830 ? CRISPR spacer, sequence CCTGGAGGAACAGAAGAATAGAAGAGAAGAAAGGGGG contig_10 crispr-repeat 25831 25866 ? CRISPR repeat contig_10 crispr-spacer 25867 25904 ? CRISPR spacer, sequence CTCTTTAGCCGAATACGGTATTACATGCGCTGATAAGG contig_10 crispr-repeat 25905 25940 ? CRISPR repeat contig_10 crispr-spacer 25941 25977 ? CRISPR spacer, sequence AAAAATTTCTGCAGTTGACCATCTGAGACTGGACATG contig_10 crispr-repeat 25978 26013 ? CRISPR repeat contig_10 crispr-spacer 26014 26050 ? CRISPR spacer, sequence TTTAAATGGGGTTTATTTTTCTCGCCTGTCGCCTCAG contig_10 crispr-repeat 26051 26086 ? CRISPR repeat contig_10 crispr-spacer 26087 26122 ? CRISPR spacer, sequence CCCCGCGTAGTTGGTGAAAAAATGAATAGCAAGGAG contig_10 crispr-repeat 26123 26158 ? CRISPR repeat contig_10 crispr-spacer 26159 26195 ? CRISPR spacer, sequence AATAGTAGGAAAATTAAGCGAGGAAGAAGTCGCCAAG contig_10 crispr-repeat 26196 26231 ? CRISPR repeat contig_10 crispr-spacer 26232 26268 ? CRISPR spacer, sequence TTTAAAACCAAATGGTTATGACTATTAGCAAAAAATG contig_10 crispr-repeat 26269 26304 ? CRISPR repeat contig_10 crispr-spacer 26305 26340 ? CRISPR spacer, sequence CGGTTGACTCCTAGGGAAACTTGGAGGTTGATGGGG contig_10 crispr-repeat 26341 26376 ? CRISPR repeat contig_10 crispr-spacer 26377 26412 ? CRISPR spacer, sequence TCGAATTCATTAAAAAATGAATCAAATAATAAAGTG contig_10 crispr-repeat 26413 26448 ? CRISPR repeat contig_10 crispr-spacer 26449 26485 ? CRISPR spacer, sequence TTATCTATCGCTAATTCAGCAATTCTAGCTTCATCAG contig_10 crispr-repeat 26486 26521 ? CRISPR repeat contig_10 crispr-spacer 26522 26531 ? CRISPR spacer, sequence AGCGTCGAAA contig_10 cds 26831 27835 - GCA000529525_02262 hypothetical protein contig_10 cds 27832 28113 - GCA000529525_02263 hypothetical protein contig_10 cds 28113 28778 - GCA000529525_02264 hypothetical protein PFAM:PF17262.7, PFAM:PF17955.6 contig_10 cds 28780 30108 - GCA000529525_02265 hypothetical protein PFAM:PF09670.15 contig_10 cds 30110 30895 - GCA000529525_02266 hypothetical protein contig_10 cds 31096 31239 - GCA000529525_02267 hypothetical protein contig_10 cds 31239 31667 - GCA000529525_02268 hypothetical protein PFAM:PF17953.6 contig_10 cds 31724 31876 - GCA000529525_02269 hypothetical protein contig_10 cds 31957 32175 - GCA000529525_02270 hypothetical protein contig_10 cds 32188 32916 - GCA000529525_02271 hypothetical protein contig_10 cds 32919 33374 - GCA000529525_02272 hypothetical protein contig_10 cds 33379 34416 - GCA000529525_02273 hypothetical protein PFAM:PF22335.1 contig_10 cds 34719 35849 - GCA000529525_02274 hypothetical protein PFAM:PF18211.6 contig_10 cds 35932 36279 - GCA000529525_02275 hypothetical protein contig_11 cds 562 1407 - GCA000529525_02276 hypothetical protein contig_11 cds 1583 1837 - GCA000529525_02277 hypothetical protein PFAM:PF00037.32, PFAM:PF12837.12 contig_11 cds 1841 2341 - GCA000529525_02278 hypothetical protein PFAM:PF00037.32, PFAM:PF12797.12, PFAM:PF12837.12, PFAM:PF12838.12, PFAM:PF13237.11, PFAM:PF13247.11 contig_11 cds 2352 2609 - GCA000529525_02279 hypothetical protein contig_11 cds 2721 3215 - GCA000529525_02280 Thiamine pyrophosphate enzyme TPP-binding domain-containing protein SO:0001217, UniRef:UniRef50_A0A949XQ53 contig_11 cds 3218 4363 - GCA000529525_02281 hypothetical protein PFAM:PF02780.25, PFAM:PF17147.9 contig_11 cds 4380 4622 - GCA000529525_02282 porD Pyruvate synthase subunit PorD SO:0001217, UniRef:UniRef50_A0A285GZ84 contig_11 cds 4635 5159 - GCA000529525_02283 hypothetical protein PFAM:PF01558.24 contig_11 cds 5464 5700 + GCA000529525_02284 hypothetical protein contig_11 cds 5938 7062 + GCA000529525_02285 hypothetical protein PFAM:PF00809.28, PFAM:PF14251.12 contig_11 cds 7064 7426 - GCA000529525_02286 hypothetical protein contig_11 assembly_gap 7581 7849 . contig_11 cds 8229 9083 + GCA000529525_02287 hypothetical protein PFAM:PF00004.35, PFAM:PF00158.32, PFAM:PF00493.29, PFAM:PF05496.18, PFAM:PF07724.20, PFAM:PF07726.17, PFAM:PF07728.20, PFAM:PF13191.12, PFAM:PF13401.12 contig_11 cds 9095 9514 + GCA000529525_02288 hypothetical protein contig_11 cds 9454 10251 + GCA000529525_02289 hypothetical protein contig_11 cds 10478 11173 + GCA000529525_02290 hypothetical protein contig_11 cds 11182 11385 + GCA000529525_02291 hypothetical protein PFAM:PF02597.26 contig_11 cds 11386 12195 + GCA000529525_02292 hypothetical protein PFAM:PF01937.24 contig_11 cds 12258 12944 + GCA000529525_02293 hypothetical protein contig_11 cds 13103 14254 - GCA000529525_02294 hypothetical protein PFAM:PF01467.32, PFAM:PF16581.11 contig_11 cds 14274 14756 - GCA000529525_02295 hypothetical protein PFAM:PF03729.18 contig_11 cds 14796 15878 - GCA000529525_02296 hypothetical protein contig_11 cds 16003 16965 - GCA000529525_02297 hypothetical protein PFAM:PF00296.26 contig_12 rRNA 114 3135 - GCA000529525_02298 rrl 23S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01980, RFAM:RF02541, SO:0001001 contig_12 tRNA 3493 3566 - GCA000529525_02299 trnA tRNA-Ala(tgc) SO:0000254 contig_12 rRNA 3969 5453 - GCA000529525_02300 rrs 16S ribosomal RNA GO:0003735, GO:0005840, KEGG:K01977, RFAM:RF00177, SO:0001000 contig_13 gap 1105 1105 . contig_13 assembly_gap 1114 1382 . contig_13 cds 3027 3212 + GCA000529525_02301 hypothetical protein contig_13 cds 3378 3566 - GCA000529525_02302 hypothetical protein contig_14 cds 281 670 - GCA000529525_02303 hypothetical protein PFAM:PF13751.12 contig_14 cds 667 1857 - GCA000529525_02304 hypothetical protein