BAKTAGenome Explorer: Rothia dentocariosa (GCA_000143585.1)
Select a Genome:
|
BAKTA Annotations for GCA_000143585.1
|
Search & Sort all 4456 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | GL379574.1 | GCA000143585_00638 | gene | open | 753861-754232 | ssrA | ||
| 2 | GL379574.1 | GCA000143585_00638 | tmRNA | open | 753861-754232 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | GL379574.1 | GCA000143585_00001 | gene | open | 541-659 | rrf | ||
| 4 | GL379574.1 | GCA000143585_00176 | gene | open | 205745-206134 | RNaseP_bact_a | ||
| 5 | GL379574.1 | GCA000143585_01513 | gene | open | 1701366-1701482 | rrf | ||
| 6 | GL379574.1 | GCA000143585_01519 | gene | open | 1705419-1705535 | rrf | ||
| 7 | GL379574.1 | GCA000143585_00176 | ncRNA | open | 205745-206134 | Bacterial RNase P class A | ||
| 8 | GL379574.1 | regulatory_region | open | 228118-228257 | FMN riboswitch aptamer (RFN element) | |||
| 9 | GL379574.1 | regulatory_region | open | 275884-276008 | TPP riboswitch aptamer (THI element) | |||
| 10 | GL379574.1 | regulatory_region | open | 1319713-1319772 | Rothia-sucC RNA | |||
| 11 | GL379574.1 | regulatory_region | open | 1329148-1329298 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 12 | GL379574.1 | GCA000143585_00001 | rRNA | open | 541-659 | rrf | 5S ribosomal RNA | |
| 13 | GL379574.1 | GCA000143585_01513 | rRNA | open | 1701366-1701482 | rrf | 5S ribosomal RNA | |
| 14 | GL379574.1 | GCA000143585_01519 | rRNA | open | 1705419-1705535 | rrf | 5S ribosomal RNA | |
| 15 | GL379574.1 | repeat_region | open | 1535538-1535760 | CRISPR array with 4 repeats of length 29%2C consensus sequence GGAACCACCCATGCACACGCGGGGCAGAC and spacer length 32 | |||
| 16 | GL379574.1 | GCA000143585_00002 | CDS | open | 948-2078 | _na 376_aa | Tetratricopeptide repeat protein | |
| 17 | GL379574.1 | GCA000143585_00003 | CDS | open | 2141-3175 | _na 344_aa | nagD | UMP phosphatase |
| 18 | GL379574.1 | GCA000143585_00004 | CDS | open | 3179-3379 | _na 66_aa | hypothetical protein | |
| 19 | GL379574.1 | GCA000143585_00005 | CDS | open | 3380-4114 | _na 244_aa | yqxC | 16S/23S rRNA (Cytidine-2'-O)-methyltransferase TlyA |
| 20 | GL379574.1 | GCA000143585_00006 | CDS | open | 4242-5216 | _na 324_aa | nadK | NAD kinase |
| 21 | GL379574.1 | GCA000143585_00007 | CDS | open | 5358-7067 | _na 569_aa | recN | DNA repair protein RecN |
| 22 | GL379574.1 | GCA000143585_00008 | CDS | open | 7306-9003 | _na 565_aa | pyrG | CTP synthase |
| 23 | GL379574.1 | GCA000143585_00009 | CDS | open | 9201-9881 | _na 226_aa | mutT | ADP-ribose pyrophosphatase |
| 24 | GL379574.1 | GCA000143585_00010 | CDS | open | 9888-11063 | _na 391_aa | xerC | Tyrosine recombinase XerC |
| 25 | GL379574.1 | GCA000143585_00011 | CDS | open | 11407-12834 | _na 475_aa | gltP | Aerobic C4-dicarboxylate transport protein |
| 26 | GL379574.1 | GCA000143585_00012 | CDS | open | 13049-13966 | _na 305_aa | parA | Chromosome (Plasmid) partitioning protein ParA |
| 27 | GL379574.1 | GCA000143585_00013 | CDS | open | 14111-15103 | _na 330_aa | scpA | Segregation and condensation protein A |
| 28 | GL379574.1 | GCA000143585_00014 | CDS | open | 15100-16035 | _na 311_aa | scpB | SMC-Scp complex subunit ScpB |
| 29 | GL379574.1 | GCA000143585_00015 | CDS | open | 16124-17197 | _na 357_aa | rsuA | Pseudouridine synthase |
| 30 | GL379574.1 | GCA000143585_00016 | CDS | open | 17197-18333 | _na 378_aa | tyrA | prephenate dehydrogenase |
| 31 | GL379574.1 | GCA000143585_00017 | CDS | open | 18398-19156 | _na 252_aa | cmk | (d)CMP kinase |
| 32 | GL379574.1 | GCA000143585_00018 | CDS | open | 19249-20838 | _na 529_aa | der | ribosome biogenesis GTPase Der |
| 33 | GL379574.1 | GCA000143585_00019 | CDS | open | 20932-21531 | _na 199_aa | mdaB | NADPH-quinone reductase (Modulator of drug activity B) |
| 34 | GL379574.1 | GCA000143585_00021 | CDS | open | 22514-24172 | _na 552_aa | lldP | L-lactate permease |
| 35 | GL379574.1 | GCA000143585_00022 | CDS | open | 24358-24753 | _na 131_aa | DUF1304 domain-containing protein | |
| 36 | GL379574.1 | GCA000143585_00023 | CDS | open | 24864-25568 | _na 234_aa | tag | DNA-3-methyladenine glycosylase I |
| 37 | GL379574.1 | GCA000143585_00024 | CDS | open | 25667-26260 | _na 197_aa | adaB | Methylated-DNA--protein-cysteine methyltransferase |
| 38 | GL379574.1 | GCA000143585_00025 | CDS | open | 26457-27434 | _na 325_aa | Tetratricopeptide repeat protein | |
| 39 | GL379574.1 | GCA000143585_00026 | CDS | open | 27846-28478 | _na 210_aa | hP0602 | Deoxyribonuclease |
| 40 | GL379574.1 | GCA000143585_00027 | CDS | open | 28682-30238 | _na 518_aa | glpK | glycerol kinase GlpK |
| 41 | GL379574.1 | GCA000143585_00028 | CDS | open | 30345-31136 | _na 263_aa | glpF | Aquaporin family protein |
| 42 | GL379574.1 | GCA000143585_00029 | CDS | open | 31403-33169 | _na 588_aa | glpA | Glycerol-3-phosphate dehydrogenase |
| 43 | GL379574.1 | GCA000143585_00030 | CDS | open | 33303-34250 | _na 315_aa | deoR | Putative sugar-binding domain protein |
| 44 | GL379574.1 | GCA000143585_00031 | CDS | open | 34267-35172 | _na 301_aa | lysR | HTH-type transcriptional regulator gltC |
| 45 | GL379574.1 | GCA000143585_00032 | CDS | open | 35749-39240 | _na 1163_aa | adhE | L-glutamate gamma-semialdehyde dehydrogenase |
| 46 | GL379574.1 | GCA000143585_00033 | CDS | open | 39531-39917 | _na 128_aa | gcvH | glycine cleavage system protein GcvH |
| 47 | GL379574.1 | GCA000143585_00034 | CDS | open | 40366-41142 | _na 258_aa | soxR | Transcriptional regulator%2C MerR family |
| 48 | GL379574.1 | GCA000143585_00035 | CDS | open | 41647-42318 | _na 223_aa | soxR | HTH merR-type domain-containing protein |
| 49 | GL379574.1 | GCA000143585_00036 | CDS | open | 42508-43320 | _na 270_aa | parA | Sporulation initiation inhibitor protein soj |
| 50 | GL379574.1 | GCA000143585_00037 | CDS | open | 43423-44859 | _na 478_aa | lpd | mycothione reductase |
| 51 | GL379574.1 | GCA000143585_00038 | CDS | open | 44933-47038 | _na 701_aa | fAA1 | AMP-binding enzyme |
| 52 | GL379574.1 | GCA000143585_00039 | CDS | open | 47067-47930 | _na 287_aa | yvaK | Thermostable monoacylglycerol lipase |
| 53 | GL379574.1 | GCA000143585_00040 | CDS | open | 48269-49018 | _na 249_aa | plsC | Acyltransferase |
| 54 | GL379574.1 | GCA000143585_00041 | CDS | open | 49137-50498 | _na 453_aa | aroG2 | class II 3-deoxy-7-phosphoheptulonate synthase |
| 55 | GL379574.1 | GCA000143585_00042 | CDS | open | 50578-52242 | _na 554_aa | sPS1 | non-specific serine/threonine protein kinase |
| 56 | GL379574.1 | GCA000143585_00043 | CDS | open | 52440-52808 | _na 122_aa | DNA-binding protein | |
| 57 | GL379574.1 | GCA000143585_00044 | CDS | open | 52917-54059 | _na 380_aa | ispA | Polyprenyl synthetase |
| 58 | GL379574.1 | GCA000143585_00045 | CDS | open | 54228-55562 | _na 444_aa | dinB | DNA polymerase IV |
| 59 | GL379574.1 | GCA000143585_00046 | CDS | open | 55819-56238 | _na 139_aa | DUF3040 domain-containing protein | |
| 60 | GL379574.1 | GCA000143585_00047 | CDS | open | 56485-56916 | _na 143_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 61 | GL379574.1 | GCA000143585_00048 | CDS | open | 57003-58082 | _na 359_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 62 | GL379574.1 | GCA000143585_00049 | CDS | open | 58166-59143 | _na 325_aa | ftsL | Cell division protein FtsL |
| 63 | GL379574.1 | GCA000143585_00050 | CDS | open | 59194-61041 | _na 615_aa | ftsI | Penicillin-binding protein 2 |
| 64 | GL379574.1 | GCA000143585_00051 | CDS | open | 61169-62887 | _na 572_aa | murE | UDP-N-acetylmuramyl-tripeptide synthetase |
| 65 | GL379574.1 | GCA000143585_00052 | CDS | open | 62897-64504 | _na 535_aa | murF | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase |
| 66 | GL379574.1 | GCA000143585_00053 | CDS | open | 64507-65712 | _na 401_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 67 | GL379574.1 | GCA000143585_00054 | CDS | open | 65712-67313 | _na 533_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 68 | GL379574.1 | GCA000143585_00055 | CDS | open | 67416-69392 | _na 658_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 69 | GL379574.1 | GCA000143585_00056 | CDS | open | 69526-70620 | _na 364_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 70 | GL379574.1 | GCA000143585_00057 | CDS | open | 70621-72105 | _na 494_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 71 | GL379574.1 | GCA000143585_00058 | CDS | open | 72108-73328 | _na 406_aa | ftsQ | Cell division protein FtsQ |
| 72 | GL379574.1 | GCA000143585_00059 | CDS | open | 73537-74748 | _na 403_aa | ftsZ | cell division protein FtsZ |
| 73 | GL379574.1 | GCA000143585_00060 | CDS | open | 74843-75658 | _na 271_aa | yfiH | Laccase domain-containing protein |
| 74 | GL379574.1 | GCA000143585_00061 | CDS | open | 75716-76534 | _na 272_aa | yggS | Pyridoxal phosphate homeostasis protein |
| 75 | GL379574.1 | GCA000143585_00062 | CDS | open | 76828-77658 | _na 276_aa | sepF | Cell division protein SepF |
| 76 | GL379574.1 | GCA000143585_00063 | CDS | open | 77662-77964 | _na 100_aa | YGGT family | |
| 77 | GL379574.1 | GCA000143585_00064 | CDS | open | 78239-78823 | _na 194_aa | Cell wall synthesis protein Wag31 | |
| 78 | GL379574.1 | GCA000143585_00065 | CDS | open | 78994-79617 | _na 207_aa | lspA | signal peptidase II |
| 79 | GL379574.1 | GCA000143585_00066 | CDS | open | 79686-80594 | _na 302_aa | rluA | Pseudouridine synthase |
| 80 | GL379574.1 | GCA000143585_00067 | CDS | open | 80651-84193 | _na 1180_aa | dnaE | DNA polymerase III subunit alpha |
| 81 | GL379574.1 | GCA000143585_00068 | CDS | open | 84445-85056 | _na 203_aa | nrdR | transcriptional regulator NrdR |
| 82 | GL379574.1 | GCA000143585_00069 | CDS | open | 85168-86043 | _na 291_aa | ppgK | polyphosphate--glucose phosphotransferase |
| 83 | GL379574.1 | GCA000143585_00070 | CDS | open | 86085-86981 | _na 298_aa | map | type I methionyl aminopeptidase |
| 84 | GL379574.1 | GCA000143585_00071 | CDS | open | 87210-87404 | _na 64_aa | SPOR domain-containing protein | |
| 85 | GL379574.1 | GCA000143585_00072 | CDS | open | 87512-88435 | _na 307_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 86 | GL379574.1 | GCA000143585_00073 | CDS | open | 88535-90067 | _na 510_aa | DUF5129 domain-containing protein | |
| 87 | GL379574.1 | GCA000143585_00074 | CDS | open | 90133-91785 | _na 550_aa | DUF5129 domain-containing protein | |
| 88 | GL379574.1 | GCA000143585_00075 | CDS | open | 92265-93605 | _na 446_aa | glnA | type I glutamate--ammonia ligase |
| 89 | GL379574.1 | GCA000143585_00076 | CDS | open | 93633-97019 | _na 1128_aa | glnE1 | bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase |
| 90 | GL379574.1 | GCA000143585_00077 | CDS | open | 97287-98093 | _na 268_aa | hypothetical protein | |
| 91 | GL379574.1 | GCA000143585_00078 | CDS | open | 98159-98422 | _na 87_aa | Antitoxin | |
| 92 | GL379574.1 | GCA000143585_00079 | CDS | open | 98423-98536 | _na 37_aa | hypothetical protein | |
| 93 | GL379574.1 | GCA000143585_00080 | CDS | open | 98490-99128 | _na 212_aa | PH domain-containing protein | |
| 94 | GL379574.1 | GCA000143585_00081 | CDS | open | 99248-99877 | _na 209_aa | PH domain-containing protein | |
| 95 | GL379574.1 | GCA000143585_00082 | CDS | open | 100034-104473 | _na 1479_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 96 | GL379574.1 | GCA000143585_00083 | CDS | open | 104585-105235 | _na 216_aa | rimL | [ribosomal protein uS5]-alanine N-acetyltransferase |
| 97 | GL379574.1 | GCA000143585_00084 | CDS | open | 105275-106219 | _na 314_aa | qor | Beta-ketoacyl-acyl-carrier-protein synthase I |
| 98 | GL379574.1 | GCA000143585_00085 | CDS | open | 106443-106961 | _na 172_aa | HXXEE domain-containing protein | |
| 99 | GL379574.1 | GCA000143585_00087 | CDS | open | 107258-108943 | _na 561_aa | argS | arginine--tRNA ligase |
| 100 | GL379574.1 | GCA000143585_00088 | CDS | open | 109126-110640 | _na 504_aa | lysA | diaminopimelate decarboxylase |
| 101 | GL379574.1 | GCA000143585_00089 | CDS | open | 110847-112130 | _na 427_aa | thrA | Homoserine dehydrogenase |
| 102 | GL379574.1 | GCA000143585_00090 | CDS | open | 112210-113310 | _na 366_aa | thrC | threonine synthase |
| 103 | GL379574.1 | GCA000143585_00091 | CDS | open | 113506-114486 | _na 326_aa | thrB | homoserine kinase |
| 104 | GL379574.1 | GCA000143585_00092 | CDS | open | 114849-116966 | _na 705_aa | rho | transcription termination factor Rho |
| 105 | GL379574.1 | GCA000143585_00093 | CDS | open | 117130-118212 | _na 360_aa | prfA | peptide chain release factor 1 |
| 106 | GL379574.1 | GCA000143585_00094 | CDS | open | 118230-119171 | _na 313_aa | prmC | peptide chain release factor N(5)-glutamine methyltransferase |
| 107 | GL379574.1 | GCA000143585_00095 | CDS | open | 119264-120313 | _na 349_aa | tsaC | L-threonylcarbamoyladenylate synthase |
| 108 | GL379574.1 | GCA000143585_00096 | CDS | open | 120434-121444 | _na 336_aa | wcaG | NAD-dependent epimerase/dehydratase family protein |
| 109 | GL379574.1 | GCA000143585_00097 | CDS | open | 121752-123671 | _na 639_aa | wcaE | Glycosyltransferase%2C group 2 family protein |
| 110 | GL379574.1 | GCA000143585_00098 | CDS | open | 123672-125582 | _na 636_aa | flaA1 | Polysaccharide biosynthesis protein |
| 111 | GL379574.1 | GCA000143585_00099 | CDS | open | 125734-126840 | _na 368_aa | rfe | Glycosyltransferase%2C group 4 family |
| 112 | GL379574.1 | GCA000143585_00100 | CDS | open | 126837-127328 | _na 163_aa | ATP synthase protein I | |
| 113 | GL379574.1 | GCA000143585_00101 | CDS | open | 127368-127622 | _na 84_aa | AtpZ/AtpI family protein | |
| 114 | GL379574.1 | GCA000143585_00102 | CDS | open | 127722-128519 | _na 265_aa | atpB | F0F1 ATP synthase subunit A |
| 115 | GL379574.1 | GCA000143585_00103 | CDS | open | 128650-128841 | _na 63_aa | atpE | ATP synthase F0 subunit C |
| 116 | GL379574.1 | GCA000143585_00104 | CDS | open | 128892-129449 | _na 185_aa | atpF | F0F1 ATP synthase subunit B |
| 117 | GL379574.1 | GCA000143585_00105 | CDS | open | 129449-130264 | _na 271_aa | atpH | F0F1 ATP synthase subunit delta |
| 118 | GL379574.1 | GCA000143585_00106 | CDS | open | 130417-132042 | _na 541_aa | atpA | F0F1 ATP synthase subunit alpha |
| 119 | GL379574.1 | GCA000143585_00107 | CDS | open | 132122-133066 | _na 314_aa | atpG | F0F1 ATP synthase subunit gamma |
| 120 | GL379574.1 | GCA000143585_00108 | CDS | open | 133122-134564 | _na 480_aa | atpD | F0F1 ATP synthase subunit beta |
| 121 | GL379574.1 | GCA000143585_00109 | CDS | open | 134567-134848 | _na 93_aa | atpC | F-ATPase epsilon subunit |
| 122 | GL379574.1 | GCA000143585_00110 | CDS | open | 134962-135789 | _na 275_aa | nucS | endonuclease NucS |
| 123 | GL379574.1 | GCA000143585_00111 | CDS | open | 136181-136999 | _na 272_aa | Alpha/beta hydrolase | |
| 124 | GL379574.1 | GCA000143585_00112 | CDS | open | 137084-138319 | _na 411_aa | perM | AI-2E family transporter |
| 125 | GL379574.1 | GCA000143585_00113 | CDS | open | 138620-139576 | _na 318_aa | cnoX | Thioredoxin |
| 126 | GL379574.1 | GCA000143585_00114 | CDS | open | 139734-140723 | _na 329_aa | rbbA | ABC transporter |
| 127 | GL379574.1 | GCA000143585_00115 | CDS | open | 140699-142354 | _na 551_aa | Transporter | |
| 128 | GL379574.1 | GCA000143585_00116 | CDS | open | 142524-142823 | _na 99_aa | DUF3039 domain-containing protein | |
| 129 | GL379574.1 | GCA000143585_00117 | CDS | open | 143063-144853 | _na 596_aa | sSL2 | Helicase ATP-binding domain-containing protein |
| 130 | GL379574.1 | GCA000143585_00118 | CDS | open | 144871-145497 | _na 208_aa | pncA | nicotinamidase |
| 131 | GL379574.1 | GCA000143585_00119 | CDS | open | 145539-146837 | _na 432_aa | pncB | nicotinate phosphoribosyltransferase |
| 132 | GL379574.1 | GCA000143585_00120 | CDS | open | 146989-147336 | _na 115_aa | clpS | ATP-dependent Clp protease adapter ClpS |
| 133 | GL379574.1 | GCA000143585_00121 | CDS | open | 147340-147906 | _na 188_aa | DUF2017 domain-containing protein | |
| 134 | GL379574.1 | GCA000143585_00122 | CDS | open | 148131-149171 | _na 346_aa | murI | glutamate racemase |
| 135 | GL379574.1 | GCA000143585_00123 | CDS | open | 149184-150071 | _na 295_aa | elaC | Metallo-beta-lactamase domain-containing protein |
| 136 | GL379574.1 | GCA000143585_00124 | CDS | open | 150079-150816 | _na 245_aa | rph | ribonuclease PH |
| 137 | GL379574.1 | GCA000143585_00125 | CDS | open | 150824-151486 | _na 220_aa | rdgB | dITP/XTP pyrophosphatase |
| 138 | GL379574.1 | GCA000143585_00126 | CDS | open | 151691-152920 | _na 409_aa | Peptidase E | |
| 139 | GL379574.1 | GCA000143585_00127 | CDS | open | 153009-153221 | _na 70_aa | hypothetical protein | |
| 140 | GL379574.1 | GCA000143585_00128 | CDS | open | 153440-155542 | _na 700_aa | DNA topoisomerase (ATP-hydrolyzing) | |
| 141 | GL379574.1 | GCA000143585_00129 | CDS | open | 156030-157607 | _na 525_aa | appC | Cytochrome bd-II oxidase subunit 1 |
| 142 | GL379574.1 | GCA000143585_00130 | CDS | open | 157628-158701 | _na 357_aa | cydB | cytochrome d ubiquinol oxidase subunit II |
| 143 | GL379574.1 | GCA000143585_00131 | CDS | open | 158882-162679 | _na 1265_aa | cydD | thiol reductant ABC exporter subunit CydD |
| 144 | GL379574.1 | GCA000143585_00132 | CDS | open | 162793-163263 | _na 156_aa | rimI | Acetyltransferase%2C GNAT family |
| 145 | GL379574.1 | GCA000143585_00133 | CDS | open | 163325-163702 | _na 125_aa | Nuclear transport factor 2 family protein | |
| 146 | GL379574.1 | GCA000143585_00134 | CDS | open | 163765-164364 | _na 199_aa | tPR | Tetratricopeptide repeat protein |
| 147 | GL379574.1 | GCA000143585_00135 | CDS | open | 164527-165042 | _na 171_aa | rimI | GNAT family N-acetyltransferase |
| 148 | GL379574.1 | GCA000143585_00136 | CDS | open | 165049-166377 | _na 442_aa | ycf37 | Tetratricopeptide repeat protein |
| 149 | GL379574.1 | GCA000143585_00137 | CDS | open | 166581-168737 | _na 718_aa | Tetratricopeptide repeat protein | |
| 150 | GL379574.1 | GCA000143585_00138 | CDS | open | 168856-169905 | _na 349_aa | Tetratricopeptide repeat protein | |
| 151 | GL379574.1 | GCA000143585_00139 | CDS | open | 170052-172580 | _na 842_aa | gyrA | DNA topoisomerase (ATP-hydrolyzing) |
| 152 | GL379574.1 | GCA000143585_00140 | CDS | open | 172794-173390 | _na 198_aa | Cell wall biosynthesis glycosyltransferase | |
| 153 | GL379574.1 | GCA000143585_00141 | CDS | open | 173392-174636 | _na 414_aa | ataC | Type I phosphodiesterase / nucleotide pyrophosphatase |
| 154 | GL379574.1 | GCA000143585_00142 | CDS | open | 174696-175769 | _na 357_aa | sepH | septation protein SepH |
| 155 | GL379574.1 | GCA000143585_00143 | CDS | open | 176111-176410 | _na 99_aa | dUTPase | |
| 156 | GL379574.1 | GCA000143585_00144 | CDS | open | 176477-176926 | _na 149_aa | DUF3093 domain-containing protein | |
| 157 | GL379574.1 | GCA000143585_00145 | CDS | open | 177137-177583 | _na 148_aa | dut | dUTP diphosphatase |
| 158 | GL379574.1 | GCA000143585_00146 | CDS | open | 177692-178555 | _na 287_aa | DUF3710 domain-containing protein | |
| 159 | GL379574.1 | GCA000143585_00147 | CDS | open | 178555-179112 | _na 185_aa | Asparaginase | |
| 160 | GL379574.1 | GCA000143585_00148 | CDS | open | 179105-179842 | _na 245_aa | DUF3159 domain-containing protein | |
| 161 | GL379574.1 | GCA000143585_00149 | CDS | open | 179931-182036 | _na 701_aa | DUF5129 domain-containing protein | |
| 162 | GL379574.1 | GCA000143585_00150 | CDS | open | 182152-182805 | _na 217_aa | trkA | Trk system potassium uptake protein TrkA |
| 163 | GL379574.1 | GCA000143585_00151 | CDS | open | 182818-183585 | _na 255_aa | trkA | Trk system potassium uptake protein TrkA |
| 164 | GL379574.1 | GCA000143585_00152 | CDS | open | 183719-185764 | _na 681_aa | potE | APC family permease |
| 165 | GL379574.1 | GCA000143585_00153 | CDS | open | 185876-187510 | _na 544_aa | trmA | Class I SAM-dependent RNA methyltransferase |
| 166 | GL379574.1 | GCA000143585_00154 | CDS | open | 187675-189684 | _na 669_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 167 | GL379574.1 | GCA000143585_00155 | CDS | open | 189824-190345 | _na 173_aa | nirD | Cytochrome bc1 complex Rieske iron-sulfur subunit |
| 168 | GL379574.1 | GCA000143585_00156 | CDS | open | 190538-191812 | _na 424_aa | rnd | Ribonuclease D |
| 169 | GL379574.1 | GCA000143585_00157 | CDS | open | 191986-192402 | _na 138_aa | msrB | peptide-methionine (R)-S-oxide reductase |
| 170 | GL379574.1 | GCA000143585_00158 | CDS | open | 192425-192985 | _na 186_aa | N-acetyltransferase domain-containing protein | |
| 171 | GL379574.1 | GCA000143585_00159 | CDS | open | 192966-193466 | _na 166_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 172 | GL379574.1 | GCA000143585_00160 | CDS | open | 193555-194481 | _na 308_aa | rskA | Anti-sigma K factor RskA C-terminal domain-containing protein |
| 173 | GL379574.1 | GCA000143585_00161 | CDS | open | 194471-195100 | _na 209_aa | rpoE | Sigma-K factor |
| 174 | GL379574.1 | GCA000143585_00162 | CDS | open | 195216-195593 | _na 125_aa | Pentapeptide MXKDX repeat protein | |
| 175 | GL379574.1 | GCA000143585_00163 | CDS | open | 195953-197764 | _na 603_aa | ccdA | Thiol-disulfide oxidoreductase |
| 176 | GL379574.1 | GCA000143585_00164 | CDS | open | 198004-199056 | _na 350_aa | zapE | cell division protein ZapE |
| 177 | GL379574.1 | GCA000143585_00168 | CDS | open | 199608-200021 | _na 137_aa | Cas3 C-terminal domain-containing protein | |
| 178 | GL379574.1 | GCA000143585_00170 | CDS | open | 200336-201103 | _na 255_aa | DUF6318 domain-containing protein | |
| 179 | GL379574.1 | GCA000143585_00171 | CDS | open | 201234-201998 | _na 254_aa | DUF6318 domain-containing protein | |
| 180 | GL379574.1 | GCA000143585_00172 | CDS | open | 202133-202657 | _na 174_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 181 | GL379574.1 | GCA000143585_00173 | CDS | open | 202792-203682 | _na 296_aa | nIF3 | Nif3-like dinuclear metal center hexameric protein |
| 182 | GL379574.1 | GCA000143585_00174 | CDS | open | 203864-204622 | _na 252_aa | Endo-1%2C4-beta-xylanase A | |
| 183 | GL379574.1 | GCA000143585_00175 | CDS | open | 204894-205679 | _na 261_aa | yaaA | Peroxide stress protein YaaA |
| 184 | GL379574.1 | GCA000143585_00177 | CDS | open | 206220-206792 | _na 190_aa | def | peptide deformylase |
| 185 | GL379574.1 | GCA000143585_00178 | CDS | open | 206854-208014 | _na 386_aa | caiA | Acyl-[acyl-carrier-protein] dehydrogenase MbtN |
| 186 | GL379574.1 | GCA000143585_00180 | CDS | open | 208318-208980 | _na 220_aa | ssb | Single-stranded DNA-binding protein |
| 187 | GL379574.1 | GCA000143585_00181 | CDS | open | 209365-210270 | _na 301_aa | GmrSD restriction endonucleases C-terminal domain-containing protein | |
| 188 | GL379574.1 | GCA000143585_00183 | CDS | open | 210620-212263 | _na 547_aa | mptB | polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB |
| 189 | GL379574.1 | GCA000143585_00184 | CDS | open | 212520-213155 | _na 211_aa | orn | oligoribonuclease |
| 190 | GL379574.1 | GCA000143585_00185 | CDS | open | 213410-213757 | _na 115_aa | rplS | 50S ribosomal protein L19 |
| 191 | GL379574.1 | GCA000143585_00186 | CDS | open | 213780-214412 | _na 210_aa | lepB | signal peptidase I |
| 192 | GL379574.1 | GCA000143585_00187 | CDS | open | 214518-215645 | _na 375_aa | lepB | signal peptidase I |
| 193 | GL379574.1 | GCA000143585_00188 | CDS | open | 215809-216603 | _na 264_aa | rnhB | ribonuclease HII |
| 194 | GL379574.1 | GCA000143585_00189 | CDS | open | 216603-216938 | _na 111_aa | Histidine kinase | |
| 195 | GL379574.1 | GCA000143585_00190 | CDS | open | 217219-217665 | _na 148_aa | yraN | UPF0102 protein B8W87_03925 |
| 196 | GL379574.1 | GCA000143585_00191 | CDS | open | 217665-219209 | _na 514_aa | yifB | Mg chelatase-like protein |
| 197 | GL379574.1 | GCA000143585_00192 | CDS | open | 219260-220744 | _na 494_aa | dprA | DNA-processing protein DprA |
| 198 | GL379574.1 | GCA000143585_00193 | CDS | open | 220805-221875 | _na 356_aa | xerC | Tyrosine recombinase XerC |
| 199 | GL379574.1 | GCA000143585_00194 | CDS | open | 222170-223069 | _na 299_aa | fabD | Malonyl CoA-acyl carrier protein transacylase |
| 200 | GL379574.1 | GCA000143585_00195 | CDS | open | 223126-224151 | _na 341_aa | fabH | Beta-ketoacyl-[acyl-carrier-protein] synthase III |
| 201 | GL379574.1 | GCA000143585_00196 | CDS | open | 224354-224596 | _na 80_aa | acpP | acyl carrier protein |
| 202 | GL379574.1 | GCA000143585_00197 | CDS | open | 224685-225953 | _na 422_aa | fabF | beta-ketoacyl-ACP synthase II |
| 203 | GL379574.1 | GCA000143585_00198 | CDS | open | 226162-227637 | _na 491_aa | acm | Lysozyme M1 |
| 204 | GL379574.1 | GCA000143585_00199 | CDS | open | 228381-229100 | _na 239_aa | pnuC | nicotinamide riboside transporter PnuC |
| 205 | GL379574.1 | GCA000143585_00200 | CDS | open | 229097-230344 | _na 415_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 206 | GL379574.1 | GCA000143585_00201 | CDS | open | 230536-231813 | _na 425_aa | ribC | riboflavin synthase |
| 207 | GL379574.1 | GCA000143585_00202 | CDS | open | 231810-232571 | _na 253_aa | ribA | GTP cyclohydrolase-2 |
| 208 | GL379574.1 | GCA000143585_00203 | CDS | open | 232654-233127 | _na 157_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 209 | GL379574.1 | GCA000143585_00204 | CDS | open | 233267-234859 | _na 530_aa | trpE | anthranilate synthase component I |
| 210 | GL379574.1 | GCA000143585_00205 | CDS | open | 234884-235567 | _na 227_aa | Trp biosynthesis-associated membrane protein | |
| 211 | GL379574.1 | GCA000143585_00206 | CDS | open | 235740-235994 | _na 84_aa | DUF2530 domain-containing protein | |
| 212 | GL379574.1 | GCA000143585_00207 | CDS | open | 236089-236883 | _na 264_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 213 | GL379574.1 | GCA000143585_00208 | CDS | open | 237071-238402 | _na 443_aa | trpB | tryptophan synthase subunit beta |
| 214 | GL379574.1 | GCA000143585_00209 | CDS | open | 238399-239250 | _na 283_aa | trpA | tryptophan synthase subunit alpha |
| 215 | GL379574.1 | GCA000143585_00210 | CDS | open | 239252-240382 | _na 376_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 216 | GL379574.1 | GCA000143585_00211 | CDS | open | 240611-241183 | _na 190_aa | fldA | Flavodoxin |
| 217 | GL379574.1 | GCA000143585_00212 | CDS | open | 241693-243171 | _na 492_aa | pyk | pyruvate kinase |
| 218 | GL379574.1 | GCA000143585_00214 | CDS | open | 243662-244276 | _na 204_aa | amiR | Response regulator |
| 219 | GL379574.1 | GCA000143585_00215 | CDS | open | 244443-244694 | _na 83_aa | Zn-dependent hydrolase including glyoxylase | |
| 220 | GL379574.1 | GCA000143585_00216 | CDS | open | 244717-245181 | _na 154_aa | paaI | Thioesterase domain-containing protein |
| 221 | GL379574.1 | GCA000143585_00217 | CDS | open | 245294-245707 | _na 137_aa | SnoaL-like domain-containing protein | |
| 222 | GL379574.1 | GCA000143585_00218 | CDS | open | 245776-247062 | _na 428_aa | gltP | Dicarboxylate/amino acid:cation symporter |
| 223 | GL379574.1 | GCA000143585_00219 | CDS | open | 247292-250237 | _na 981_aa | polA | DNA polymerase I |
| 224 | GL379574.1 | GCA000143585_00220 | CDS | open | 250558-252018 | _na 486_aa | rpsA | 30S ribosomal protein S1 |
| 225 | GL379574.1 | GCA000143585_00221 | CDS | open | 252135-252755 | _na 206_aa | coaE | dephospho-CoA kinase |
| 226 | GL379574.1 | GCA000143585_00222 | CDS | open | 252789-253481 | _na 230_aa | yIH1 | IMPACT family member yigZ |
| 227 | GL379574.1 | GCA000143585_00223 | CDS | open | 253621-254820 | _na 399_aa | hypothetical protein | |
| 228 | GL379574.1 | GCA000143585_00224 | CDS | open | 254935-257103 | _na 722_aa | uvrB | excinuclease ABC subunit UvrB |
| 229 | GL379574.1 | GCA000143585_00225 | CDS | open | 257313-257996 | _na 227_aa | Transcriptional initiation protein Tat | |
| 230 | GL379574.1 | GCA000143585_00226 | CDS | open | 258151-258846 | _na 231_aa | hypothetical protein | |
| 231 | GL379574.1 | GCA000143585_00227 | CDS | open | 258868-259266 | _na 132_aa | hxlR | HTH-type transcriptional activator hxlR |
| 232 | GL379574.1 | GCA000143585_00228 | CDS | open | 259425-260027 | _na 200_aa | ywnB | NAD dependent epimerase/dehydratase family protein |
| 233 | GL379574.1 | GCA000143585_00229 | CDS | open | 260105-261556 | _na 483_aa | Prolyl aminopeptidase | |
| 234 | GL379574.1 | GCA000143585_00230 | CDS | open | 261779-262024 | _na 81_aa | hypothetical protein | |
| 235 | GL379574.1 | GCA000143585_00231 | CDS | open | 262238-263578 | _na 446_aa | Tat pathway signal sequence domain protein | |
| 236 | GL379574.1 | GCA000143585_00232 | CDS | open | 264274-265638 | _na 454_aa | Tat pathway signal sequence domain protein | |
| 237 | GL379574.1 | GCA000143585_00233 | CDS | open | 266096-266344 | _na 82_aa | hypothetical protein | |
| 238 | GL379574.1 | GCA000143585_00234 | CDS | open | 266324-268930 | _na 868_aa | dob10 | Putative helicase |
| 239 | GL379574.1 | GCA000143585_00235 | CDS | open | 269156-269881 | _na 241_aa | Immunity protein 52 domain-containing protein | |
| 240 | GL379574.1 | GCA000143585_00236 | CDS | open | 270119-271936 | _na 605_aa | mdlB | Lipid A export ATP-binding/permease protein MsbA |
| 241 | GL379574.1 | GCA000143585_00237 | CDS | open | 271940-273619 | _na 559_aa | mdlB | Multidrug export ATP-binding/permease protein SAV1866 |
| 242 | GL379574.1 | GCA000143585_00238 | CDS | open | 273786-274937 | _na 383_aa | PKD domain-containing protein | |
| 243 | GL379574.1 | GCA000143585_00239 | CDS | open | 274921-275685 | _na 254_aa | DUF6318 domain-containing protein | |
| 244 | GL379574.1 | GCA000143585_00240 | CDS | open | 276109-277752 | _na 547_aa | tenA | bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase |
| 245 | GL379574.1 | GCA000143585_00241 | CDS | open | 277863-278411 | _na 182_aa | mdaB | Glutathione-regulated potassium-efflux system ancillary protein kefF |
| 246 | GL379574.1 | GCA000143585_00242 | CDS | open | 278665-279213 | _na 182_aa | mdaB | General stress protein 14 |
| 247 | GL379574.1 | GCA000143585_00243 | CDS | open | 279423-280205 | _na 260_aa | hflK | FtsH protease regulator HflK |
| 248 | GL379574.1 | GCA000143585_00244 | CDS | open | 280364-281173 | _na 269_aa | Transposase | |
| 249 | GL379574.1 | GCA000143585_00245 | CDS | open | 281179-283590 | _na 803_aa | norB | Nitric oxide reductase subunit B |
| 250 | GL379574.1 | GCA000143585_00246 | CDS | open | 284051-284731 | _na 226_aa | plsC | 1-acyl-sn-glycerol-3-phosphate acyltransferase |
| 251 | GL379574.1 | GCA000143585_00247 | CDS | open | 284823-286796 | _na 657_aa | uvrC | excinuclease ABC subunit UvrC |
| 252 | GL379574.1 | GCA000143585_00248 | CDS | open | 286900-287790 | _na 296_aa | rapZ | RNase adapter RapZ |
| 253 | GL379574.1 | GCA000143585_00249 | CDS | open | 287790-288860 | _na 356_aa | cofD | Putative gluconeogenesis factor |
| 254 | GL379574.1 | GCA000143585_00250 | CDS | open | 288997-289962 | _na 321_aa | whiA | DNA-binding protein WhiA |
| 255 | GL379574.1 | GCA000143585_00251 | CDS | open | 290208-290384 | _na 58_aa | hypothetical protein | |
| 256 | GL379574.1 | GCA000143585_00252 | CDS | open | 290437-291441 | _na 334_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 257 | GL379574.1 | GCA000143585_00253 | CDS | open | 291713-292936 | _na 407_aa | pgk | Phosphoglycerate kinase |
| 258 | GL379574.1 | GCA000143585_00254 | CDS | open | 293051-294508 | _na 485_aa | hypothetical protein | |
| 259 | GL379574.1 | GCA000143585_00255 | CDS | open | 294652-295428 | _na 258_aa | tpiA | triose-phosphate isomerase |
| 260 | GL379574.1 | GCA000143585_00256 | CDS | open | 295558-295905 | _na 115_aa | NIPSNAP domain-containing protein | |
| 261 | GL379574.1 | GCA000143585_00257 | CDS | open | 296195-297817 | _na 540_aa | betP | Glycine betaine transporter BetP |
| 262 | GL379574.1 | GCA000143585_00258 | CDS | open | 297962-298372 | _na 136_aa | hypothetical protein | |
| 263 | GL379574.1 | GCA000143585_00259 | CDS | open | 298495-298752 | _na 85_aa | secG | preprotein translocase subunit SecG |
| 264 | GL379574.1 | GCA000143585_00260 | CDS | open | 299000-300379 | _na 459_aa | SWIM-type domain-containing protein | |
| 265 | GL379574.1 | GCA000143585_00261 | CDS | open | 300449-303130 | _na 893_aa | DUF6493 domain-containing protein | |
| 266 | GL379574.1 | GCA000143585_00262 | CDS | open | 303120-305783 | _na 887_aa | DUF6493 domain-containing protein | |
| 267 | GL379574.1 | GCA000143585_00263 | CDS | open | 305851-306816 | _na 321_aa | nagB | 6-phosphogluconolactonase |
| 268 | GL379574.1 | GCA000143585_00264 | CDS | open | 306809-307795 | _na 328_aa | opcA | OpcA protein |
| 269 | GL379574.1 | GCA000143585_00265 | CDS | open | 307792-309339 | _na 515_aa | zwf | glucose-6-phosphate dehydrogenase |
| 270 | GL379574.1 | GCA000143585_00266 | CDS | open | 309552-310658 | _na 368_aa | tal | transaldolase |
| 271 | GL379574.1 | GCA000143585_00267 | CDS | open | 310768-312993 | _na 741_aa | tkt | transketolase |
| 272 | GL379574.1 | GCA000143585_00268 | CDS | open | 313238-314236 | _na 332_aa | cyoE | heme o synthase |
| 273 | GL379574.1 | GCA000143585_00269 | CDS | open | 314453-315499 | _na 348_aa | ctaA | Cytochrome oxidase assembly protein |
| 274 | GL379574.1 | GCA000143585_00270 | CDS | open | 315593-316423 | _na 276_aa | Putative ABC transporter | |
| 275 | GL379574.1 | GCA000143585_00271 | CDS | open | 316420-317484 | _na 354_aa | rbbA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 276 | GL379574.1 | GCA000143585_00272 | CDS | open | 317763-318578 | _na 271_aa | HTH domain protein | |
| 277 | GL379574.1 | GCA000143585_00273 | CDS | open | 318681-320138 | _na 485_aa | sufB | Fe-S cluster assembly protein SufB |
| 278 | GL379574.1 | GCA000143585_00274 | CDS | open | 320138-321412 | _na 424_aa | sufD | Fe-S cluster assembly protein SufD |
| 279 | GL379574.1 | GCA000143585_00275 | CDS | open | 321431-322189 | _na 252_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 280 | GL379574.1 | GCA000143585_00276 | CDS | open | 322226-322555 | _na 109_aa | paaD | FeS assembly SUF system protein |
| 281 | GL379574.1 | GCA000143585_00277 | CDS | open | 322692-323114 | _na 140_aa | hypothetical protein | |
| 282 | GL379574.1 | GCA000143585_00278 | CDS | open | 323250-324332 | _na 360_aa | N-acetyltransferase domain-containing protein | |
| 283 | GL379574.1 | GCA000143585_00279 | CDS | open | 324588-325400 | _na 270_aa | DUF4253 domain-containing protein | |
| 284 | GL379574.1 | GCA000143585_00280 | CDS | open | 325451-326098 | _na 215_aa | bioN | Energy-coupling factor transporter transmembrane protein BioN |
| 285 | GL379574.1 | GCA000143585_00281 | CDS | open | 326135-326926 | _na 263_aa | bioM | Biotin transport ATP-binding protein BioM |
| 286 | GL379574.1 | GCA000143585_00282 | CDS | open | 326933-327526 | _na 197_aa | bioY | Biotin transporter |
| 287 | GL379574.1 | GCA000143585_00283 | CDS | open | 327794-329392 | _na 532_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 288 | GL379574.1 | GCA000143585_00284 | CDS | open | 329984-330700 | _na 238_aa | Metal-dependent hydrolase | |
| 289 | GL379574.1 | GCA000143585_00285 | CDS | open | 330832-331800 | _na 322_aa | shy1 | SURF1-like protein |
| 290 | GL379574.1 | GCA000143585_00286 | CDS | open | 331959-332192 | _na 77_aa | Acetone carboxylase | |
| 291 | GL379574.1 | GCA000143585_00287 | CDS | open | 332243-332734 | _na 163_aa | DUF3099 domain-containing protein | |
| 292 | GL379574.1 | GCA000143585_00288 | CDS | open | 332943-333659 | _na 238_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 293 | GL379574.1 | GCA000143585_00289 | CDS | open | 333726-334469 | _na 247_aa | fabG | Glucose 1-dehydrogenase |
| 294 | GL379574.1 | GCA000143585_00290 | CDS | open | 334556-335341 | _na 261_aa | modF | HMP/thiamine import ATP-binding protein YkoD |
| 295 | GL379574.1 | GCA000143585_00291 | CDS | open | 335408-336280 | _na 290_aa | spoU | TrmH family tRNA/rRNA methyltransferase |
| 296 | GL379574.1 | GCA000143585_00292 | CDS | open | 336447-336704 | _na 85_aa | rpmE | type B 50S ribosomal protein L31 |
| 297 | GL379574.1 | GCA000143585_00293 | CDS | open | 336866-337999 | _na 377_aa | cps2a | LCP family protein |
| 298 | GL379574.1 | GCA000143585_00294 | CDS | open | 338102-339331 | _na 409_aa | HIRAN domain-containing protein | |
| 299 | GL379574.1 | GCA000143585_00295 | CDS | open | 339550-342222 | _na 890_aa | pepN | aminopeptidase N |
| 300 | GL379574.1 | GCA000143585_00297 | CDS | open | 342650-343732 | _na 360_aa | Sorbitol dehydrogenase | |
| 301 | GL379574.1 | GCA000143585_00298 | CDS | open | 344319-345278 | _na 319_aa | mdh | L-lactate dehydrogenase |
| 302 | GL379574.1 | GCA000143585_00299 | CDS | open | 345400-345675 | _na 91_aa | Dehydrogenase | |
| 303 | GL379574.1 | GCA000143585_00300 | CDS | open | 345760-346527 | _na 255_aa | recO | DNA repair protein RecO |
| 304 | GL379574.1 | GCA000143585_00301 | CDS | open | 346588-347370 | _na 260_aa | uppS | isoprenyl transferase |
| 305 | GL379574.1 | GCA000143585_00302 | CDS | open | 347394-348485 | _na 363_aa | pyrD | quinone-dependent dihydroorotate dehydrogenase |
| 306 | GL379574.1 | GCA000143585_00303 | CDS | open | 348554-349177 | _na 207_aa | DUF3043 domain-containing protein | |
| 307 | GL379574.1 | GCA000143585_00304 | CDS | open | 349274-350680 | _na 468_aa | argE | Succinyl-diaminopimelate desuccinylase |
| 308 | GL379574.1 | GCA000143585_00305 | CDS | open | 350867-351220 | _na 117_aa | iscA | Iron-sulfur cluster assembly accessory protein |
| 309 | GL379574.1 | GCA000143585_00306 | CDS | open | 351440-352327 | _na 295_aa | coxB | cytochrome c oxidase subunit II |
| 310 | GL379574.1 | GCA000143585_00307 | CDS | open | 352343-354046 | _na 567_aa | ctaD | cytochrome c oxidase subunit I |
| 311 | GL379574.1 | GCA000143585_00308 | CDS | open | 354050-354451 | _na 133_aa | Cytochrome c oxidase polypeptide 4 | |
| 312 | GL379574.1 | GCA000143585_00309 | CDS | open | 355137-356801 | _na 554_aa | petB | Cytochrome bc1 complex cytochrome b subunit |
| 313 | GL379574.1 | GCA000143585_00310 | CDS | open | 356805-357911 | _na 368_aa | petC | Cytochrome bc1 complex Rieske iron-sulfur subunit |
| 314 | GL379574.1 | GCA000143585_00311 | CDS | open | 357955-358749 | _na 264_aa | Cytochrome bc1 complex cytochrome c subunit | |
| 315 | GL379574.1 | GCA000143585_00312 | CDS | open | 358812-359450 | _na 212_aa | cyoC | cytochrome-c oxidase |
| 316 | GL379574.1 | GCA000143585_00313 | CDS | open | 359626-360774 | _na 382_aa | trpD | Anthranilate phosphoribosyltransferase |
| 317 | GL379574.1 | GCA000143585_00314 | CDS | open | 361093-361578 | _na 161_aa | ybbJ | NfeD-like C-terminal domain-containing protein |
| 318 | GL379574.1 | GCA000143585_00315 | CDS | open | 361643-362635 | _na 330_aa | hflK | FtsH protease regulator HflK |
| 319 | GL379574.1 | GCA000143585_00316 | CDS | open | 362802-363140 | _na 112_aa | rbpA | RNA polymerase-binding protein RbpA |
| 320 | GL379574.1 | GCA000143585_00317 | CDS | open | 363217-364803 | _na 528_aa | potE | Amino acid permease |
| 321 | GL379574.1 | GCA000143585_00318 | CDS | open | 365045-366385 | _na 446_aa | gabT | 4-aminobutyrate--2-oxoglutarate transaminase |
| 322 | GL379574.1 | GCA000143585_00319 | CDS | open | 366555-367982 | _na 475_aa | adhE | Putative aminobutyraldehyde dehydrogenase |
| 323 | GL379574.1 | GCA000143585_00320 | CDS | open | 368116-369588 | _na 490_aa | adhE | Succinate-semialdehyde dehydrogenase [NADP(+)] GabD |
| 324 | GL379574.1 | GCA000143585_00321 | CDS | open | 369645-370538 | _na 297_aa | uspA | Universal stress family protein |
| 325 | GL379574.1 | GCA000143585_00322 | CDS | open | 370634-372076 | _na 480_aa | yobN | Putrescine oxidase |
| 326 | GL379574.1 | GCA000143585_00323 | CDS | open | 372373-372975 | _na 200_aa | Tetracycline repressor protein class B from transposon Tn10 | |
| 327 | GL379574.1 | GCA000143585_00324 | CDS | open | 373040-373873 | _na 277_aa | wcaA | Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase |
| 328 | GL379574.1 | GCA000143585_00325 | CDS | open | 373913-375016 | _na 367_aa | ytcJ | Amidohydrolase |
| 329 | GL379574.1 | GCA000143585_00326 | CDS | open | 375032-377953 | _na 973_aa | dob10 | DEAD/DEAH box helicase |
| 330 | GL379574.1 | GCA000143585_00327 | CDS | open | 378015-378899 | _na 294_aa | tatC | Sec-independent protein translocase protein TatC |
| 331 | GL379574.1 | GCA000143585_00328 | CDS | open | 379032-379268 | _na 78_aa | tatA | Sec-independent protein translocase subunit TatA |
| 332 | GL379574.1 | GCA000143585_00329 | CDS | open | 379692-381788 | _na 698_aa | yobV | WYL domain-containing protein |
| 333 | GL379574.1 | GCA000143585_00330 | CDS | open | 381886-382281 | _na 131_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 334 | GL379574.1 | GCA000143585_00331 | CDS | open | 382355-383476 | _na 373_aa | fkpA | peptidylprolyl isomerase |
| 335 | GL379574.1 | GCA000143585_00332 | CDS | open | 383681-385141 | _na 486_aa | pafA | Pup--protein ligase |
| 336 | GL379574.1 | GCA000143585_00333 | CDS | open | 385190-385390 | _na 66_aa | Prokaryotic ubiquitin-like protein Pup | |
| 337 | GL379574.1 | GCA000143585_00334 | CDS | open | 385399-387117 | _na 572_aa | dop | depupylase/deamidase Dop |
| 338 | GL379574.1 | GCA000143585_00335 | CDS | open | 387139-388992 | _na 617_aa | arc | proteasome ATPase |
| 339 | GL379574.1 | GCA000143585_00336 | CDS | open | 389071-390126 | _na 351_aa | gcd14 | SAM-dependent methyltransferase |
| 340 | GL379574.1 | GCA000143585_00337 | CDS | open | 390250-391566 | _na 438_aa | mshC | cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase |
| 341 | GL379574.1 | GCA000143585_00338 | CDS | open | 391662-392555 | _na 297_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 342 | GL379574.1 | GCA000143585_00339 | CDS | open | 392632-394389 | _na 585_aa | leuA | 2-isopropylmalate synthase |
| 343 | GL379574.1 | GCA000143585_00340 | CDS | open | 394735-396165 | _na 476_aa | cps2a | LCP family protein |
| 344 | GL379574.1 | GCA000143585_00341 | CDS | open | 396196-397314 | _na 372_aa | era | GTPase Era |
| 345 | GL379574.1 | GCA000143585_00342 | CDS | open | 397368-398720 | _na 450_aa | mpfA | Magnesium and cobalt efflux protein CorC |
| 346 | GL379574.1 | GCA000143585_00343 | CDS | open | 398729-399250 | _na 173_aa | ybeY | rRNA maturation RNase YbeY |
| 347 | GL379574.1 | GCA000143585_00344 | CDS | open | 399250-400365 | _na 371_aa | phoH | PhoH-like protein |
| 348 | GL379574.1 | GCA000143585_00345 | CDS | open | 400412-401215 | _na 267_aa | rsmE | 16S rRNA (uracil(1498)-N(3))-methyltransferase |
| 349 | GL379574.1 | GCA000143585_00346 | CDS | open | 401264-402400 | _na 378_aa | dnaJ | molecular chaperone DnaJ |
| 350 | GL379574.1 | GCA000143585_00347 | CDS | open | 402498-403598 | _na 366_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 351 | GL379574.1 | GCA000143585_00348 | CDS | open | 403814-404665 | _na 283_aa | DUF3097 domain-containing protein | |
| 352 | GL379574.1 | GCA000143585_00349 | CDS | open | 404820-405299 | _na 159_aa | DUF4870 domain-containing protein | |
| 353 | GL379574.1 | GCA000143585_00350 | CDS | open | 405613-406884 | _na 423_aa | hemW | radical SAM family heme chaperone HemW |
| 354 | GL379574.1 | GCA000143585_00351 | CDS | open | 406993-408852 | _na 619_aa | lepA | translation elongation factor 4 |
| 355 | GL379574.1 | GCA000143585_00352 | CDS | open | 409031-409294 | _na 87_aa | rpsT | 30S ribosomal protein S20 |
| 356 | GL379574.1 | GCA000143585_00353 | CDS | open | 409510-410115 | _na 201_aa | Phage tail protein | |
| 357 | GL379574.1 | GCA000143585_00354 | CDS | open | 410173-411201 | _na 342_aa | holA | DNA polymerase III subunit delta |
| 358 | GL379574.1 | GCA000143585_00355 | CDS | open | 411276-412925 | _na 549_aa | comEC | ComEC/Rec2-like protein |
| 359 | GL379574.1 | GCA000143585_00356 | CDS | open | 412965-414209 | _na 414_aa | comEA | Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein |
| 360 | GL379574.1 | GCA000143585_00357 | CDS | open | 414386-415333 | _na 315_aa | degV | EDD domain protein%2C DegV family |
| 361 | GL379574.1 | GCA000143585_00358 | CDS | open | 415471-417966 | _na 831_aa | leuS | leucine--tRNA ligase |
| 362 | GL379574.1 | GCA000143585_00359 | CDS | open | 418330-419301 | _na 323_aa | menH | Lipase 1 |
| 363 | GL379574.1 | GCA000143585_00360 | CDS | open | 419318-420460 | _na 380_aa | rfaB | Glycosyltransferase%2C group 1 family protein |
| 364 | GL379574.1 | GCA000143585_00361 | CDS | open | 420466-421380 | _na 304_aa | HEPN domain-containing protein | |
| 365 | GL379574.1 | GCA000143585_00362 | CDS | open | 421377-422456 | _na 359_aa | DUF262 domain-containing protein | |
| 366 | GL379574.1 | GCA000143585_00363 | CDS | open | 422543-425008 | _na 821_aa | priA | putative primosomal protein N' |
| 367 | GL379574.1 | GCA000143585_00364 | CDS | open | 425008-426213 | _na 401_aa | metK | methionine adenosyltransferase |
| 368 | GL379574.1 | GCA000143585_00365 | CDS | open | 426352-427680 | _na 442_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 369 | GL379574.1 | GCA000143585_00366 | CDS | open | 427699-428151 | _na 150_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 370 | GL379574.1 | GCA000143585_00367 | CDS | open | 428306-428878 | _na 190_aa | gmk | guanylate kinase |
| 371 | GL379574.1 | GCA000143585_00368 | CDS | open | 428933-429280 | _na 115_aa | MIHF | |
| 372 | GL379574.1 | GCA000143585_00369 | CDS | open | 429459-430316 | _na 285_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 373 | GL379574.1 | GCA000143585_00370 | CDS | open | 430313-433657 | _na 1114_aa | carB | carbamoyl-phosphate synthase large subunit |
| 374 | GL379574.1 | GCA000143585_00371 | CDS | open | 433658-434848 | _na 396_aa | carA | carbamoyl phosphate synthase small subunit |
| 375 | GL379574.1 | GCA000143585_00372 | CDS | open | 434979-435524 | _na 181_aa | Transporter | |
| 376 | GL379574.1 | GCA000143585_00373 | CDS | open | 435580-436887 | _na 435_aa | allB | dihydroorotase |
| 377 | GL379574.1 | GCA000143585_00374 | CDS | open | 436912-437913 | _na 333_aa | pyrB | aspartate carbamoyltransferase catalytic subunit |
| 378 | GL379574.1 | GCA000143585_00375 | CDS | open | 437910-438542 | _na 210_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 379 | GL379574.1 | GCA000143585_00376 | CDS | open | 438787-439557 | _na 256_aa | DUF304 domain-containing protein | |
| 380 | GL379574.1 | GCA000143585_00377 | CDS | open | 439645-440055 | _na 136_aa | nusB | transcription antitermination factor NusB |
| 381 | GL379574.1 | GCA000143585_00378 | CDS | open | 440055-440618 | _na 187_aa | efp | elongation factor P |
| 382 | GL379574.1 | GCA000143585_00379 | CDS | open | 440829-441986 | _na 385_aa | aroB | 3-dehydroquinate synthase |
| 383 | GL379574.1 | GCA000143585_00380 | CDS | open | 441979-443247 | _na 422_aa | aroK | Shikimate kinase |
| 384 | GL379574.1 | GCA000143585_00381 | CDS | open | 443251-444468 | _na 405_aa | aroC | chorismate synthase |
| 385 | GL379574.1 | GCA000143585_00382 | CDS | open | 444552-445466 | _na 304_aa | aroE | Shikimate dehydrogenase |
| 386 | GL379574.1 | GCA000143585_00383 | CDS | open | 445630-446841 | _na 403_aa | mltG | Endolytic murein transglycosylase |
| 387 | GL379574.1 | GCA000143585_00384 | CDS | open | 446838-447365 | _na 175_aa | ruvX | Holliday junction resolvase RuvX |
| 388 | GL379574.1 | GCA000143585_00385 | CDS | open | 447394-450075 | _na 893_aa | alaS | alanine--tRNA ligase |
| 389 | GL379574.1 | GCA000143585_00386 | CDS | open | 450161-450640 | _na 159_aa | Peptide chain release factor 4 | |
| 390 | GL379574.1 | GCA000143585_00387 | CDS | open | 450641-451036 | _na 131_aa | DUF948 domain-containing protein | |
| 391 | GL379574.1 | GCA000143585_00388 | CDS | open | 451505-452137 | _na 210_aa | rpsD | 30S ribosomal protein S4 |
| 392 | GL379574.1 | GCA000143585_00389 | CDS | open | 452622-454067 | _na 481_aa | rarA | Recombination factor protein RarA |
| 393 | GL379574.1 | GCA000143585_00390 | CDS | open | 454099-454533 | _na 144_aa | dtd | D-aminoacyl-tRNA deacylase |
| 394 | GL379574.1 | GCA000143585_00391 | CDS | open | 454568-455095 | _na 175_aa | adk | Adenylate kinase |
| 395 | GL379574.1 | GCA000143585_00392 | CDS | open | 455248-457026 | _na 592_aa | aspS | aspartate--tRNA ligase |
| 396 | GL379574.1 | GCA000143585_00393 | CDS | open | 457169-458536 | _na 455_aa | hisS | histidine--tRNA ligase |
| 397 | GL379574.1 | GCA000143585_00394 | CDS | open | 458819-460090 | _na 423_aa | DUF349 domain-containing protein | |
| 398 | GL379574.1 | GCA000143585_00395 | CDS | open | 460240-462645 | _na 801_aa | spoT | Bifunctional (P)ppGpp synthetase/guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase |
| 399 | GL379574.1 | GCA000143585_00396 | CDS | open | 462898-463995 | _na 365_aa | secF | Protein-export membrane protein SecF |
| 400 | GL379574.1 | GCA000143585_00397 | CDS | open | 463998-465686 | _na 562_aa | secD | Protein translocase subunit SecD |
| 401 | GL379574.1 | GCA000143585_00398 | CDS | open | 465776-466114 | _na 112_aa | yajC | preprotein translocase subunit YajC |
| 402 | GL379574.1 | GCA000143585_00399 | CDS | open | 466411-467475 | _na 354_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 403 | GL379574.1 | GCA000143585_00400 | CDS | open | 467536-468156 | _na 206_aa | ruvA | Holliday junction branch migration protein RuvA |
| 404 | GL379574.1 | GCA000143585_00401 | CDS | open | 468277-468942 | _na 221_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 405 | GL379574.1 | GCA000143585_00402 | CDS | open | 469060-469818 | _na 252_aa | tACO1 | YebC/PmpR family DNA-binding transcriptional regulator |
| 406 | GL379574.1 | GCA000143585_00403 | CDS | open | 470010-470771 | _na 253_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 407 | GL379574.1 | GCA000143585_00404 | CDS | open | 470771-472048 | _na 425_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 408 | GL379574.1 | GCA000143585_00405 | CDS | open | 472213-473253 | _na 346_aa | DUF2797 domain-containing protein | |
| 409 | GL379574.1 | GCA000143585_00406 | CDS | open | 473311-474189 | _na 292_aa | DUF6318 domain-containing protein | |
| 410 | GL379574.1 | GCA000143585_00407 | CDS | open | 474495-475064 | _na 189_aa | hinT | AP-4-A phosphorylase |
| 411 | GL379574.1 | GCA000143585_00408 | CDS | open | 475113-476132 | _na 339_aa | Voltage-gated potassium channel | |
| 412 | GL379574.1 | GCA000143585_00409 | CDS | open | 476384-477151 | _na 255_aa | DNA alkylation repair enzyme | |
| 413 | GL379574.1 | GCA000143585_00410 | CDS | open | 478142-479749 | _na 535_aa | P-loop NTPase fold protein | |
| 414 | GL379574.1 | GCA000143585_00411 | CDS | open | 479752-480474 | _na 240_aa | hypothetical protein | |
| 415 | GL379574.1 | GCA000143585_00412 | CDS | open | 480548-482581 | _na 677_aa | thrS | threonine--tRNA ligase |
| 416 | GL379574.1 | GCA000143585_00413 | CDS | open | 482893-485796 | _na 967_aa | glcD | D-lactate dehydrogenase (cytochrome) |
| 417 | GL379574.1 | GCA000143585_00414 | CDS | open | 486284-487012 | _na 242_aa | hypothetical protein | |
| 418 | GL379574.1 | GCA000143585_00415 | CDS | open | 487621-487944 | _na 107_aa | hypothetical protein | |
| 419 | GL379574.1 | GCA000143585_00416 | CDS | open | 488154-488894 | _na 246_aa | DUF6318 domain-containing protein | |
| 420 | GL379574.1 | GCA000143585_00417 | CDS | open | 489336-489659 | _na 107_aa | hypothetical protein | |
| 421 | GL379574.1 | GCA000143585_00418 | CDS | open | 489683-490012 | _na 109_aa | arsR | Transcriptional regulator |
| 422 | GL379574.1 | GCA000143585_00419 | CDS | open | 490395-491285 | _na 296_aa | ycgM | Ureidoglycolate lyase |
| 423 | GL379574.1 | GCA000143585_00420 | CDS | open | 491445-492206 | _na 253_aa | lplA | BPL/LPL catalytic domain-containing protein |
| 424 | GL379574.1 | GCA000143585_00421 | CDS | open | 492396-493895 | _na 499_aa | citT | 2-oxoglutarate/malate translocator |
| 425 | GL379574.1 | GCA000143585_00422 | CDS | open | 494235-495710 | _na 491_aa | bglH | Aryl-phospho-beta-D-glucosidase BglH |
| 426 | GL379574.1 | GCA000143585_00423 | CDS | open | 495822-496880 | _na 352_aa | Aminoglycoside 6'-acetyltransferase | |
| 427 | GL379574.1 | GCA000143585_00424 | CDS | open | 496877-499765 | _na 962_aa | uvrA | excinuclease ABC subunit UvrA |
| 428 | GL379574.1 | GCA000143585_00425 | CDS | open | 499868-500716 | _na 282_aa | gloB | putative polyketide biosynthesis zinc-dependent hydrolase BaeB |
| 429 | GL379574.1 | GCA000143585_00426 | CDS | open | 501329-503041 | _na 570_aa | mIS1 | formate--tetrahydrofolate ligase |
| 430 | GL379574.1 | GCA000143585_00427 | CDS | open | 503343-506510 | _na 1055_aa | Type I restriction enzyme endonuclease subunit | |
| 431 | GL379574.1 | GCA000143585_00428 | CDS | open | 506527-507003 | _na 158_aa | Type I restriction-modification system%2C specificity subunit S | |
| 432 | GL379574.1 | GCA000143585_00429 | CDS | open | 507126-507731 | _na 201_aa | restriction endonuclease subunit S | |
| 433 | GL379574.1 | GCA000143585_00430 | CDS | open | 507775-509448 | _na 557_aa | type I restriction-modification system subunit M | |
| 434 | GL379574.1 | GCA000143585_00431 | CDS | open | 509661-510701 | _na 346_aa | tdh | Glutathione-independent formaldehyde dehydrogenase |
| 435 | GL379574.1 | GCA000143585_00432 | CDS | open | 510882-511262 | _na 126_aa | soxR | HTH-type transcriptional regulator AdhR |
| 436 | GL379574.1 | GCA000143585_00433 | CDS | open | 511444-511932 | _na 162_aa | CTP synthase | |
| 437 | GL379574.1 | GCA000143585_00434 | CDS | open | 512162-513139 | _na 325_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 438 | GL379574.1 | GCA000143585_00435 | CDS | open | 513266-515446 | _na 726_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 439 | GL379574.1 | GCA000143585_00436 | CDS | open | 515419-515949 | _na 176_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 440 | GL379574.1 | GCA000143585_00437 | CDS | open | 516019-516246 | _na 75_aa | nrdH | Glutaredoxin-like protein NrdH |
| 441 | GL379574.1 | GCA000143585_00438 | CDS | open | 517037-518140 | _na 367_aa | app1 | Phosphatidate phosphatase APP1 catalytic domain-containing protein |
| 442 | GL379574.1 | GCA000143585_00439 | CDS | open | 518409-518900 | _na 163_aa | Lipoprotein | |
| 443 | GL379574.1 | GCA000143585_00440 | CDS | open | 519045-520001 | _na 318_aa | pgaB | putative polysaccharide deacetylase pdaA |
| 444 | GL379574.1 | GCA000143585_00441 | CDS | open | 520207-520851 | _na 214_aa | frnE | Protein-disulfide isomerase |
| 445 | GL379574.1 | GCA000143585_00442 | CDS | open | 520924-521829 | _na 301_aa | pgaB | Bifunctional xylanase/deacetylase |
| 446 | GL379574.1 | GCA000143585_00443 | CDS | open | 521939-522517 | _na 192_aa | Excalibur domain protein | |
| 447 | GL379574.1 | GCA000143585_00444 | CDS | open | 522787-523251 | _na 154_aa | adk | Adenylate kinase |
| 448 | GL379574.1 | GCA000143585_00445 | CDS | open | 523278-524555 | _na 425_aa | glsA | glutaminase |
| 449 | GL379574.1 | GCA000143585_00446 | CDS | open | 524863-525636 | _na 257_aa | yqjQ | NADP-dependent 3-hydroxy acid dehydrogenase YdfG |
| 450 | GL379574.1 | GCA000143585_00448 | CDS | open | 526115-526546 | _na 143_aa | rsfS | ribosome silencing factor |
| 451 | GL379574.1 | GCA000143585_00449 | CDS | open | 526617-528431 | _na 604_aa | hypothetical protein | |
| 452 | GL379574.1 | GCA000143585_00450 | CDS | open | 528424-529173 | _na 249_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 453 | GL379574.1 | GCA000143585_00451 | CDS | open | 529191-529421 | _na 76_aa | fixH | Nitrogen fixation protein FixH |
| 454 | GL379574.1 | GCA000143585_00452 | CDS | open | 529564-531162 | _na 532_aa | obgE | GTPase ObgE |
| 455 | GL379574.1 | GCA000143585_00453 | CDS | open | 531321-531578 | _na 85_aa | rpmA | 50S ribosomal protein L27 |
| 456 | GL379574.1 | GCA000143585_00454 | CDS | open | 531619-531999 | _na 126_aa | rplU | 50S ribosomal protein L21 |
| 457 | GL379574.1 | GCA000143585_00455 | CDS | open | 532335-535949 | _na 1204_aa | cafA | Ribonuclease G |
| 458 | GL379574.1 | GCA000143585_00456 | CDS | open | 536421-536660 | _na 79_aa | Nucleoside-diphosphate sugar epimerase | |
| 459 | GL379574.1 | GCA000143585_00457 | CDS | open | 536820-537233 | _na 137_aa | ndk | nucleoside-diphosphate kinase |
| 460 | GL379574.1 | GCA000143585_00458 | CDS | open | 537312-537986 | _na 224_aa | Vitamin K epoxide reductase family | |
| 461 | GL379574.1 | GCA000143585_00459 | CDS | open | 538187-538645 | _na 152_aa | DUF4233 domain-containing protein | |
| 462 | GL379574.1 | GCA000143585_00460 | CDS | open | 538652-540220 | _na 522_aa | folC | tetrahydrofolate synthase |
| 463 | GL379574.1 | GCA000143585_00461 | CDS | open | 540383-543730 | _na 1115_aa | ileS | isoleucine--tRNA ligase |
| 464 | GL379574.1 | GCA000143585_00462 | CDS | open | 543788-544270 | _na 160_aa | hypothetical protein | |
| 465 | GL379574.1 | GCA000143585_00463 | CDS | open | 544562-544675 | _na 37_aa | hypothetical protein | |
| 466 | GL379574.1 | GCA000143585_00464 | CDS | open | 544774-545286 | _na 170_aa | DUF3995 domain-containing protein | |
| 467 | GL379574.1 | GCA000143585_00465 | CDS | open | 545373-545576 | _na 67_aa | hypothetical protein | |
| 468 | GL379574.1 | GCA000143585_00466 | CDS | open | 545548-546351 | _na 267_aa | DUF6318 domain-containing protein | |
| 469 | GL379574.1 | GCA000143585_00467 | CDS | open | 546487-546828 | _na 113_aa | nirD | Nitrite reductase [NAD(P)H] small subunit |
| 470 | GL379574.1 | GCA000143585_00468 | CDS | open | 547104-547277 | _na 57_aa | hypothetical protein | |
| 471 | GL379574.1 | GCA000143585_00469 | CDS | open | 547344-550031 | _na 895_aa | nirB | assimilatory sulfite reductase (ferredoxin) |
| 472 | GL379574.1 | GCA000143585_00470 | CDS | open | 550042-550935 | _na 297_aa | cysG | uroporphyrinogen-III C-methyltransferase |
| 473 | GL379574.1 | GCA000143585_00471 | CDS | open | 551073-551834 | _na 253_aa | sirB | Sirohydrochlorin cobaltochelatase |
| 474 | GL379574.1 | GCA000143585_00472 | CDS | open | 552012-553796 | _na 594_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 475 | GL379574.1 | GCA000143585_00473 | CDS | open | 554146-554946 | _na 266_aa | ydfG | Serine 3-dehydrogenase |
| 476 | GL379574.1 | GCA000143585_00474 | CDS | open | 555143-555439 | _na 98_aa | Penicillin-binding protein | |
| 477 | GL379574.1 | GCA000143585_00475 | CDS | open | 555578-555865 | _na 95_aa | hypothetical protein | |
| 478 | GL379574.1 | GCA000143585_00476 | CDS | open | 555979-558711 | _na 910_aa | valS | valine--tRNA ligase |
| 479 | GL379574.1 | GCA000143585_00477 | CDS | open | 558936-560447 | _na 503_aa | LssY-like C-terminal domain-containing protein | |
| 480 | GL379574.1 | GCA000143585_00478 | CDS | open | 560525-561151 | _na 208_aa | frnE | DsbA-like protein |
| 481 | GL379574.1 | GCA000143585_00479 | CDS | open | 561237-562592 | _na 451_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 482 | GL379574.1 | GCA000143585_00480 | CDS | open | 562851-563531 | _na 226_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 483 | GL379574.1 | GCA000143585_00481 | CDS | open | 563547-564185 | _na 212_aa | ATP-dependent Clp protease proteolytic subunit | |
| 484 | GL379574.1 | GCA000143585_00482 | CDS | open | 564462-565763 | _na 433_aa | tig | trigger factor |
| 485 | GL379574.1 | GCA000143585_00485 | CDS | open | 566554-567438 | _na 294_aa | nei | DNA-(apurinic or apyrimidinic site) lyase |
| 486 | GL379574.1 | GCA000143585_00486 | CDS | open | 567666-568154 | _na 162_aa | rpiB | ribose-5-phosphate isomerase |
| 487 | GL379574.1 | GCA000143585_00487 | CDS | open | 568601-571150 | _na 849_aa | pepN | aminopeptidase N |
| 488 | GL379574.1 | GCA000143585_00488 | CDS | open | 571320-571805 | _na 161_aa | N-acetyltransferase domain-containing protein | |
| 489 | GL379574.1 | GCA000143585_00489 | CDS | open | 571930-572385 | _na 151_aa | yybR | putative HTH-type transcriptional regulator yybR |
| 490 | GL379574.1 | GCA000143585_00490 | CDS | open | 572446-573192 | _na 248_aa | NADP-dependent oxidoreductase | |
| 491 | GL379574.1 | GCA000143585_00491 | CDS | open | 573201-573440 | _na 79_aa | NADPH:quinone oxidoreductase | |
| 492 | GL379574.1 | GCA000143585_00492 | CDS | open | 573442-574284 | _na 280_aa | Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system | |
| 493 | GL379574.1 | GCA000143585_00493 | CDS | open | 574373-574840 | _na 155_aa | yjbI | Truncated hemoglobin |
| 494 | GL379574.1 | GCA000143585_00494 | CDS | open | 574837-575673 | _na 278_aa | Transcriptional regulator | |
| 495 | GL379574.1 | GCA000143585_00495 | CDS | open | 575747-576655 | _na 302_aa | Acyl-CoA thioesterase II | |
| 496 | GL379574.1 | GCA000143585_00496 | CDS | open | 576790-577365 | _na 191_aa | Acid-resistance membrane protein | |
| 497 | GL379574.1 | GCA000143585_00497 | CDS | open | 577613-579292 | _na 559_aa | ettA | energy-dependent translational throttle protein EttA |
| 498 | GL379574.1 | GCA000143585_00498 | CDS | open | 579413-579886 | _na 157_aa | mmcQ | MmcQ/YjbR family DNA-binding protein |
| 499 | GL379574.1 | GCA000143585_00499 | CDS | open | 579902-580552 | _na 216_aa | hypothetical protein | |
| 500 | GL379574.1 | GCA000143585_00500 | CDS | open | 580600-581481 | _na 293_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |

