BAKTAGenome Explorer: Parvimonas micra (GCA_000154405.1)
Select a Genome:
|
BAKTA Annotations for GCA_000154405.1
|
Search & Sort all 3325 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | DS483517.1 | GCA000154405_00854 | gene | open | 143336-144199 | |||
| 1502 | DS483517.1 | GCA000154405_00855 | gene | open | 144219-144482 | |||
| 1503 | DS483517.1 | GCA000154405_00856 | gene | open | 144486-144875 | prgI | ||
| 1504 | DS483517.1 | GCA000154405_00857 | gene | open | 144823-147216 | virB4 | ||
| 1505 | DS483517.1 | GCA000154405_00858 | gene | open | 147220-149352 | |||
| 1506 | DS483517.1 | GCA000154405_00859 | gene | open | 149364-149603 | |||
| 1507 | DS483517.1 | GCA000154405_00860 | gene | open | 149578-151116 | |||
| 1508 | DS483517.1 | GCA000154405_00861 | gene | open | 151211-152917 | |||
| 1509 | DS483517.1 | GCA000154405_00862 | gene | open | 153002-154468 | |||
| 1510 | DS483517.1 | GCA000154405_00863 | gene | open | 154660-163374 | |||
| 1511 | DS483517.1 | GCA000154405_00864 | gene | open | 163417-164076 | |||
| 1512 | DS483517.1 | GCA000154405_00865 | gene | open | 164145-165476 | |||
| 1513 | DS483517.1 | GCA000154405_00866 | gene | open | 165479-165835 | nikA | ||
| 1514 | DS483517.1 | GCA000154405_00867 | gene | open | 166178-166819 | |||
| 1515 | DS483517.1 | GCA000154405_00868 | gene | open | 166877-168628 | mdlB | ||
| 1516 | DS483517.1 | GCA000154405_00869 | gene | open | 168629-170353 | mdlB | ||
| 1517 | DS483517.1 | GCA000154405_00870 | gene | open | 170362-171879 | |||
| 1518 | DS483517.1 | GCA000154405_00871 | gene | open | 171876-172577 | ecfT | ||
| 1519 | DS483517.1 | GCA000154405_00872 | gene | open | 172595-173176 | |||
| 1520 | DS483517.1 | GCA000154405_00873 | gene | open | 173427-173837 | |||
| 1521 | DS483517.1 | GCA000154405_00874 | gene | open | 174512-176284 | spoIVCA | ||
| 1522 | DS483517.1 | GCA000154405_00875 | gene | open | 176744-177880 | nifS | ||
| 1523 | DS483517.1 | GCA000154405_00876 | gene | open | 177880-179052 | thiI | ||
| 1524 | DS483517.1 | GCA000154405_00877 | gene | open | 179150-179941 | |||
| 1525 | DS483517.1 | GCA000154405_00878 | gene | open | 180133-180945 | |||
| 1526 | DS483517.1 | GCA000154405_00879 | gene | open | 180979-181482 | |||
| 1527 | DS483517.1 | GCA000154405_00880 | gene | open | 182431-183168 | |||
| 1528 | DS483517.1 | GCA000154405_00881 | gene | open | 183161-184072 | rbbA | ||
| 1529 | DS483517.1 | GCA000154405_00882 | gene | open | 184264-185598 | brnQ | ||
| 1530 | DS483517.1 | GCA000154405_00883 | gene | open | 186188-186880 | crp | ||
| 1531 | DS483517.1 | GCA000154405_00884 | gene | open | 187304-192208 | |||
| 1532 | DS483517.1 | GCA000154405_00885 | gene | open | 192541-193971 | |||
| 1533 | DS483517.1 | GCA000154405_00886 | gene | open | 194554-195372 | modA | ||
| 1534 | DS483517.1 | GCA000154405_00887 | gene | open | 195419-196081 | modB | ||
| 1535 | DS483517.1 | GCA000154405_00888 | gene | open | 196102-197145 | cysA | ||
| 1536 | DS483517.1 | GCA000154405_00889 | gene | open | 197168-198109 | moaA | ||
| 1537 | DS483517.1 | GCA000154405_00890 | gene | open | 198111-198596 | moaC | ||
| 1538 | DS483517.1 | GCA000154405_00891 | gene | open | 198596-199027 | yiiM | ||
| 1539 | DS483517.1 | GCA000154405_00892 | gene | open | 199155-200762 | |||
| 1540 | DS483517.1 | GCA000154405_00893 | gene | open | 201086-201319 | |||
| 1541 | DS483517.1 | GCA000154405_00894 | gene | open | 201376-202095 | |||
| 1542 | DS483517.1 | GCA000154405_00895 | gene | open | 202342-202590 | |||
| 1543 | DS483517.1 | GCA000154405_00896 | gene | open | 202669-203400 | |||
| 1544 | DS483517.1 | GCA000154405_00897 | gene | open | 203428-204237 | mcbB | ||
| 1545 | DS483517.1 | GCA000154405_00898 | gene | open | 204245-204802 | |||
| 1546 | DS483517.1 | GCA000154405_00899 | gene | open | 204806-205813 | ycaO | ||
| 1547 | DS483517.1 | GCA000154405_00900 | gene | open | 205823-206839 | ycaO | ||
| 1548 | DS483517.1 | GCA000154405_00901 | gene | open | 206851-207750 | |||
| 1549 | DS483517.1 | GCA000154405_00902 | gene | open | 207743-208555 | |||
| 1550 | DS483517.1 | GCA000154405_00903 | gene | open | 208565-209272 | |||
| 1551 | DS483517.1 | GCA000154405_00904 | gene | open | 209987-210991 | dppD | ||
| 1552 | DS483517.1 | GCA000154405_00905 | gene | open | 210991-211926 | yejF | ||
| 1553 | DS483517.1 | GCA000154405_00906 | gene | open | 211928-212884 | opp4B | ||
| 1554 | DS483517.1 | GCA000154405_00907 | gene | open | 212901-213815 | dppC | ||
| 1555 | DS483517.1 | GCA000154405_00908 | gene | open | 214074-214382 | |||
| 1556 | DS483517.1 | GCA000154405_00909 | gene | open | 215397-215813 | |||
| 1557 | DS483517.1 | GCA000154405_00910 | gene | open | 216050-216532 | greA | ||
| 1558 | DS483517.1 | GCA000154405_00911 | gene | open | 216544-218025 | lysS | ||
| 1559 | DS483517.1 | GCA000154405_00912 | gene | open | 218035-218349 | |||
| 1560 | DS483517.1 | GCA000154405_00913 | gene | open | 218362-219552 | wecE | ||
| 1561 | DS483517.1 | GCA000154405_00914 | gene | open | 219555-220439 | galU | ||
| 1562 | DS483517.1 | GCA000154405_00915 | gene | open | 220442-222268 | flaA1 | ||
| 1563 | DS483517.1 | GCA000154405_00916 | gene | open | 222379-222627 | |||
| 1564 | DS483517.1 | GCA000154405_00917 | gene | open | 222686-223606 | pyrB | ||
| 1565 | DS483517.1 | GCA000154405_00918 | gene | open | 223606-224049 | |||
| 1566 | DS483517.1 | GCA000154405_00919 | gene | open | 224033-225220 | allB | ||
| 1567 | DS483517.1 | GCA000154405_00920 | gene | open | 225220-226074 | pyrF | ||
| 1568 | DS483517.1 | GCA000154405_00921 | gene | open | 226064-226792 | mcr1 | ||
| 1569 | DS483517.1 | GCA000154405_00922 | gene | open | 226792-227688 | pyrD | ||
| 1570 | DS483517.1 | GCA000154405_00923 | gene | open | 227698-228279 | pyrE | ||
| 1571 | DS483517.1 | GCA000154405_00924 | gene | open | 228777-232352 | |||
| 1572 | DS483517.1 | GCA000154405_00925 | gene | open | 233927-234793 | |||
| 1573 | DS483517.1 | GCA000154405_00926 | gene | open | 234849-236075 | purD | ||
| 1574 | DS483517.1 | GCA000154405_00927 | gene | open | 236353-239748 | lolE | ||
| 1575 | DS483517.1 | GCA000154405_00928 | gene | open | 239969-240916 | wcaG | ||
| 1576 | DS483517.1 | GCA000154405_00929 | gene | open | 240938-242122 | bioF | ||
| 1577 | DS483517.1 | GCA000154405_00930 | gene | open | 242414-244030 | degQ | ||
| 1578 | DS483517.1 | GCA000154405_00931 | gene | open | 244141-244533 | |||
| 1579 | DS483517.1 | GCA000154405_00932 | gene | open | 244530-244628 | |||
| 1580 | DS483517.1 | GCA000154405_00933 | gene | open | 244980-246722 | srmB | ||
| 1581 | DS483517.1 | GCA000154405_00934 | gene | open | 246738-247442 | spoU | ||
| 1582 | DS483517.1 | GCA000154405_00935 | gene | open | 248836-249054 | |||
| 1583 | DS483517.1 | GCA000154405_00937 | gene | open | 249571-250497 | |||
| 1584 | DS483517.1 | GCA000154405_00938 | gene | open | 250436-250651 | |||
| 1585 | DS483517.1 | GCA000154405_00939 | gene | open | 250796-251398 | elyC | ||
| 1586 | DS483517.1 | GCA000154405_00940 | gene | open | 251408-251893 | msrC | ||
| 1587 | DS483517.1 | GCA000154405_00941 | gene | open | 252000-252371 | |||
| 1588 | DS483517.1 | GCA000154405_00942 | gene | open | 252646-253587 | pip | ||
| 1589 | DS483517.1 | GCA000154405_00943 | gene | open | 253707-253946 | sWEET | ||
| 1590 | DS483517.1 | GCA000154405_00944 | gene | open | 254013-254396 | hicB | ||
| 1591 | DS483517.1 | GCA000154405_00945 | gene | open | 254597-255637 | |||
| 1592 | DS483517.1 | GCA000154405_00946 | gene | open | 255671-256117 | |||
| 1593 | DS483517.1 | GCA000154405_00947 | gene | open | 256127-256588 | irrE | ||
| 1594 | DS483517.1 | GCA000154405_00948 | gene | open | 256773-257552 | mazF | ||
| 1595 | DS483517.1 | GCA000154405_00949 | gene | open | 257557-257919 | |||
| 1596 | DS483517.1 | GCA000154405_00950 | gene | open | 258072-258290 | |||
| 1597 | DS483517.1 | GCA000154405_00951 | gene | open | 258323-258526 | |||
| 1598 | DS483517.1 | GCA000154405_00952 | gene | open | 258519-258899 | |||
| 1599 | DS483517.1 | GCA000154405_00953 | gene | open | 258970-259179 | |||
| 1600 | DS483517.1 | GCA000154405_00954 | gene | open | 259169-259354 | |||
| 1601 | DS483517.1 | GCA000154405_00955 | gene | open | 259556-259942 | |||
| 1602 | DS483517.1 | GCA000154405_00956 | gene | open | 259942-260220 | |||
| 1603 | DS483517.1 | GCA000154405_00957 | gene | open | 260204-260464 | |||
| 1604 | DS483517.1 | GCA000154405_00958 | gene | open | 260493-260912 | |||
| 1605 | DS483517.1 | GCA000154405_00959 | gene | open | 260921-261799 | |||
| 1606 | DS483517.1 | GCA000154405_00960 | gene | open | 261810-262124 | |||
| 1607 | DS483517.1 | GCA000154405_00961 | gene | open | 262141-262551 | |||
| 1608 | DS483517.1 | GCA000154405_00962 | gene | open | 262781-263623 | |||
| 1609 | DS483517.1 | GCA000154405_00963 | gene | open | 263620-264402 | |||
| 1610 | DS483517.1 | GCA000154405_00964 | gene | open | 264408-264599 | |||
| 1611 | DS483517.1 | GCA000154405_00965 | gene | open | 264596-265093 | recU | ||
| 1612 | DS483517.1 | GCA000154405_00966 | gene | open | 265139-265300 | |||
| 1613 | DS483517.1 | GCA000154405_00967 | gene | open | 265370-265813 | rinA | ||
| 1614 | DS483517.1 | GCA000154405_00968 | gene | open | 265991-266302 | |||
| 1615 | DS483517.1 | GCA000154405_00969 | gene | open | 266421-266777 | |||
| 1616 | DS483517.1 | GCA000154405_00970 | gene | open | 266774-268453 | |||
| 1617 | DS483517.1 | GCA000154405_00971 | gene | open | 268466-269662 | |||
| 1618 | DS483517.1 | GCA000154405_00972 | gene | open | 269652-270671 | |||
| 1619 | DS483517.1 | GCA000154405_00973 | gene | open | 270680-271804 | |||
| 1620 | DS483517.1 | GCA000154405_00974 | gene | open | 271828-272154 | |||
| 1621 | DS483517.1 | GCA000154405_00975 | gene | open | 272164-272427 | |||
| 1622 | DS483517.1 | GCA000154405_00976 | gene | open | 272427-272723 | |||
| 1623 | DS483517.1 | GCA000154405_00977 | gene | open | 272725-273198 | |||
| 1624 | DS483517.1 | GCA000154405_00978 | gene | open | 273191-273556 | |||
| 1625 | DS483517.1 | GCA000154405_00979 | gene | open | 273556-274155 | |||
| 1626 | DS483517.1 | GCA000154405_00980 | gene | open | 274166-274495 | |||
| 1627 | DS483517.1 | GCA000154405_00981 | gene | open | 274504-274761 | |||
| 1628 | DS483517.1 | GCA000154405_00982 | gene | open | 274796-276763 | |||
| 1629 | DS483517.1 | GCA000154405_00983 | gene | open | 276767-277396 | |||
| 1630 | DS483517.1 | GCA000154405_00984 | gene | open | 277396-278985 | |||
| 1631 | DS483517.1 | GCA000154405_00985 | gene | open | 278985-280736 | |||
| 1632 | DS483517.1 | GCA000154405_00986 | gene | open | 280747-281370 | |||
| 1633 | DS483517.1 | GCA000154405_00987 | gene | open | 281491-281790 | |||
| 1634 | DS483517.1 | GCA000154405_00988 | gene | open | 281813-282079 | |||
| 1635 | DS483517.1 | GCA000154405_00989 | gene | open | 282126-282335 | |||
| 1636 | DS483517.1 | GCA000154405_00990 | gene | open | 282348-283286 | |||
| 1637 | DS483517.1 | GCA000154405_00991 | gene | open | 283312-283779 | |||
| 1638 | DS483517.1 | GCA000154405_00992 | gene | open | 283884-284000 | |||
| 1639 | DS483517.1 | GCA000154405_00993 | gene | open | 284357-285244 | fba1 | ||
| 1640 | DS483517.1 | GCA000154405_00994 | gene | open | 285445-285942 | |||
| 1641 | DS483517.1 | GCA000154405_00995 | gene | open | 286106-286327 | abrB | ||
| 1642 | DS483517.1 | GCA000154405_00996 | gene | open | 286317-287447 | menH | ||
| 1643 | DS483517.1 | GCA000154405_00997 | gene | open | 287480-288238 | |||
| 1644 | DS483517.1 | GCA000154405_00998 | gene | open | 288293-288736 | tmcA | ||
| 1645 | DS483517.1 | GCA000154405_00999 | gene | open | 288871-289146 | |||
| 1646 | DS483517.1 | GCA000154405_01000 | gene | open | 289262-289546 | |||
| 1647 | DS483517.1 | GCA000154405_01001 | gene | open | 289592-290083 | |||
| 1648 | DS483517.1 | GCA000154405_01002 | gene | open | 290113-290499 | |||
| 1649 | DS483517.1 | GCA000154405_01003 | gene | open | 290525-291163 | glxA | ||
| 1650 | DS483517.1 | GCA000154405_01004 | gene | open | 291758-292534 | |||
| 1651 | DS483517.1 | GCA000154405_01005 | gene | open | 293084-293677 | |||
| 1652 | DS483517.1 | GCA000154405_01006 | gene | open | 293682-295019 | mepA | ||
| 1653 | DS483517.1 | GCA000154405_01007 | gene | open | 295472-295729 | |||
| 1654 | DS483517.1 | GCA000154405_01008 | gene | open | 295746-296378 | ycaP | ||
| 1655 | DS483517.1 | GCA000154405_01009 | gene | open | 296546-297394 | |||
| 1656 | DS483517.1 | GCA000154405_01010 | gene | open | 297565-298092 | |||
| 1657 | DS483517.1 | GCA000154405_01011 | gene | open | 298116-298775 | |||
| 1658 | DS483517.1 | GCA000154405_01012 | gene | open | 298820-299512 | ubiG | ||
| 1659 | DS483517.1 | GCA000154405_01013 | gene | open | 299653-300294 | fsa | ||
| 1660 | DS483517.1 | GCA000154405_01014 | gene | open | 300307-301287 | glpX | ||
| 1661 | DS483517.1 | GCA000154405_01015 | gene | open | 301289-302593 | rho | ||
| 1662 | DS483517.1 | GCA000154405_01016 | gene | open | 302631-303092 | fldA | ||
| 1663 | DS483517.1 | GCA000154405_01017 | gene | open | 303560-304069 | |||
| 1664 | DS483517.1 | GCA000154405_01018 | gene | open | 304660-305925 | uraA | ||
| 1665 | DS483517.1 | GCA000154405_01019 | gene | open | 305988-306113 | |||
| 1666 | DS483517.1 | GCA000154405_01020 | gene | open | 306301-307893 | mdlB | ||
| 1667 | DS483517.1 | GCA000154405_01021 | gene | open | 308391-309884 | yjeM | ||
| 1668 | DS483517.1 | GCA000154405_01022 | gene | open | 310030-310644 | fmnP | ||
| 1669 | DS483517.1 | GCA000154405_01023 | gene | open | 311021-314653 | |||
| 1670 | DS483517.1 | GCA000154405_01024 | gene | open | 315029-315844 | hgdB | ||
| 1671 | DS483517.1 | GCA000154405_01025 | gene | open | 315866-317140 | hgdB | ||
| 1672 | DS483517.1 | GCA000154405_01026 | gene | open | 317140-317394 | |||
| 1673 | DS483517.1 | GCA000154405_01027 | gene | open | 317511-317963 | |||
| 1674 | DS483517.1 | GCA000154405_01028 | gene | open | 317981-318415 | |||
| 1675 | DS483517.1 | GCA000154405_01029 | gene | open | 318511-319581 | |||
| 1676 | DS483517.1 | GCA000154405_01030 | gene | open | 319591-320070 | cdnL | ||
| 1677 | DS483517.1 | GCA000154405_01033 | gene | open | 321473-321973 | fur | ||
| 1678 | DS483517.1 | GCA000154405_01034 | gene | open | 322300-322971 | znuC | ||
| 1679 | DS483517.1 | GCA000154405_01035 | gene | open | 322971-323774 | znuB | ||
| 1680 | DS483517.1 | GCA000154405_01036 | gene | open | 323877-324863 | lplA | ||
| 1681 | DS483517.1 | GCA000154405_01037 | gene | open | 324874-325728 | lipA | ||
| 1682 | DS483517.1 | GCA000154405_01038 | gene | open | 325839-326768 | pldB | ||
| 1683 | DS483517.1 | GCA000154405_01039 | gene | open | 326842-327417 | |||
| 1684 | DS483517.1 | GCA000154405_01040 | gene | open | 327802-329112 | nCS2 | ||
| 1685 | DS483517.1 | GCA000154405_01041 | gene | open | 329236-330828 | uup | ||
| 1686 | DS483517.1 | GCA000154405_01042 | gene | open | 330903-332276 | alsT | ||
| 1687 | DS483517.1 | GCA000154405_01043 | gene | open | 332640-333071 | |||
| 1688 | DS483517.1 | GCA000154405_01044 | gene | open | 333090-333788 | |||
| 1689 | DS483517.1 | GCA000154405_01045 | gene | open | 333804-334490 | |||
| 1690 | DS483517.1 | GCA000154405_01046 | gene | open | 334615-335634 | fadH | ||
| 1691 | DS483517.1 | GCA000154405_01047 | gene | open | 335789-337237 | gcvPB | ||
| 1692 | DS483517.1 | GCA000154405_01048 | gene | open | 337239-338582 | gcvPA | ||
| 1693 | DS483517.1 | GCA000154405_01049 | gene | open | 338609-339712 | gcvT | ||
| 1694 | DS483517.1 | GCA000154405_01050 | gene | open | 340389-341504 | |||
| 1695 | DS483517.1 | GCA000154405_01051 | gene | open | 341918-342295 | |||
| 1696 | DS483517.1 | GCA000154405_01052 | gene | open | 342306-342776 | |||
| 1697 | DS483517.1 | GCA000154405_01053 | gene | open | 342835-343587 | focA | ||
| 1698 | DS483517.1 | GCA000154405_01054 | gene | open | 343599-343961 | modE | ||
| 1699 | DS483517.1 | GCA000154405_01055 | gene | open | 344100-344435 | yurZ | ||
| 1700 | DS483517.1 | GCA000154405_01056 | gene | open | 344556-345248 | |||
| 1701 | DS483517.1 | GCA000154405_01057 | gene | open | 345632-346129 | queT | ||
| 1702 | DS483517.1 | GCA000154405_01058 | gene | open | 346293-347114 | uppP | ||
| 1703 | DS483517.1 | GCA000154405_01059 | gene | open | 347235-347813 | |||
| 1704 | DS483517.1 | GCA000154405_01060 | gene | open | 347869-348312 | |||
| 1705 | DS483517.1 | GCA000154405_01061 | gene | open | 348891-349415 | hpf | ||
| 1706 | DS483517.1 | GCA000154405_01062 | gene | open | 349582-350319 | ymfI | ||
| 1707 | DS483517.1 | GCA000154405_01063 | gene | open | 350430-351029 | rpsD | ||
| 1708 | DS483517.1 | GCA000154405_01064 | gene | open | 351135-352415 | brnQ | ||
| 1709 | DS483517.1 | GCA000154405_01065 | gene | open | 352694-354487 | pepF | ||
| 1710 | DS483517.1 | GCA000154405_01066 | gene | open | 354559-354876 | |||
| 1711 | DS483517.1 | GCA000154405_01067 | gene | open | 354886-355602 | azlC | ||
| 1712 | DS483517.1 | GCA000154405_01068 | gene | open | 355630-356238 | recR | ||
| 1713 | DS483517.1 | GCA000154405_01069 | gene | open | 356241-356582 | ybaB | ||
| 1714 | DS483517.1 | GCA000154405_01070 | gene | open | 356885-358039 | sERPIN | ||
| 1715 | DS483517.1 | GCA000154405_01071 | gene | open | 358090-359706 | dnaX | ||
| 1716 | DS483517.1 | GCA000154405_01074 | gene | open | 360074-360754 | yczE | ||
| 1717 | DS483517.1 | GCA000154405_01075 | gene | open | 360836-362014 | abgB | ||
| 1718 | DS483517.1 | GCA000154405_01076 | gene | open | 362367-363521 | sfcA | ||
| 1719 | DS483517.1 | GCA000154405_01077 | gene | open | 363694-365061 | radA | ||
| 1720 | DS483517.1 | GCA000154405_01078 | gene | open | 365101-365652 | |||
| 1721 | DS483517.1 | GCA000154405_01079 | gene | open | 365684-366109 | |||
| 1722 | DS483517.1 | GCA000154405_01080 | gene | open | 366408-367112 | lolD | ||
| 1723 | DS483517.1 | GCA000154405_01081 | gene | open | 367114-370335 | lolE | ||
| 1724 | DS483517.1 | GCA000154405_01082 | gene | open | 370354-370827 | |||
| 1725 | DS483517.1 | GCA000154405_01083 | gene | open | 370872-372452 | hsdM | ||
| 1726 | DS483517.1 | GCA000154405_01084 | gene | open | 372445-373698 | |||
| 1727 | DS483517.1 | GCA000154405_01085 | gene | open | 373761-374321 | |||
| 1728 | DS483517.1 | GCA000154405_01086 | gene | open | 374385-378050 | |||
| 1729 | DS483517.1 | GCA000154405_01087 | gene | open | 378047-378868 | draG | ||
| 1730 | DS483517.1 | GCA000154405_01088 | gene | open | 378869-381892 | |||
| 1731 | DS483517.1 | GCA000154405_01089 | gene | open | 382472-382663 | |||
| 1732 | DS483517.1 | GCA000154405_01090 | gene | open | 382671-383063 | |||
| 1733 | DS483517.1 | GCA000154405_01091 | gene | open | 383101-383790 | |||
| 1734 | DS483517.1 | GCA000154405_01092 | gene | open | 384245-385714 | gadA | ||
| 1735 | DS483517.1 | GCA000154405_01093 | gene | open | 385778-387262 | potE | ||
| 1736 | DS483517.1 | GCA000154405_01094 | gene | open | 387645-388538 | napF | ||
| 1737 | DS483517.1 | GCA000154405_01095 | gene | open | 389203-390060 | |||
| 1738 | DS483517.1 | GCA000154405_01096 | gene | open | 390114-390473 | |||
| 1739 | DS483517.1 | GCA000154405_01097 | gene | open | 390501-391262 | ubiE | ||
| 1740 | DS483517.1 | GCA000154405_01098 | gene | open | 391292-392206 | |||
| 1741 | DS483517.1 | GCA000154405_01099 | gene | open | 392256-392585 | |||
| 1742 | DS483517.1 | GCA000154405_01100 | gene | open | 392756-394204 | gltX | ||
| 1743 | DS483517.1 | GCA000154405_01101 | gene | open | 394218-395915 | |||
| 1744 | DS483517.1 | GCA000154405_01102 | gene | open | 396042-397769 | |||
| 1745 | DS483517.1 | GCA000154405_01103 | gene | open | 397815-398363 | lemA | ||
| 1746 | DS483517.1 | GCA000154405_01104 | gene | open | 398498-398974 | yehR | ||
| 1747 | DS483517.1 | GCA000154405_01105 | gene | open | 399207-399692 | yehR | ||
| 1748 | DS483517.1 | GCA000154405_01106 | gene | open | 399878-400840 | znuA | ||
| 1749 | DS483517.1 | GCA000154405_01107 | gene | open | 400909-401619 | znuC | ||
| 1750 | DS483517.1 | GCA000154405_01108 | gene | open | 401623-402507 | znuB | ||
| 1751 | DS483517.1 | GCA000154405_01109 | gene | open | 402504-403613 | znuB | ||
| 1752 | DS483517.1 | GCA000154405_01110 | gene | open | 403671-404165 | hisB1 | ||
| 1753 | DS483517.1 | GCA000154405_01111 | gene | open | 404452-405510 | afuA | ||
| 1754 | DS483517.1 | GCA000154405_01112 | gene | open | 405601-407286 | fbpB | ||
| 1755 | DS483517.1 | GCA000154405_01113 | gene | open | 407295-408365 | potA | ||
| 1756 | DS483517.1 | GCA000154405_01114 | gene | open | 408547-409131 | |||
| 1757 | DS483517.1 | GCA000154405_01115 | gene | open | 409303-409749 | |||
| 1758 | DS483517.1 | GCA000154405_01116 | gene | open | 409827-410426 | |||
| 1759 | DS483517.1 | GCA000154405_01117 | gene | open | 410607-411212 | |||
| 1760 | DS483517.1 | GCA000154405_01118 | gene | open | 411394-411912 | bioY | ||
| 1761 | DS483517.1 | GCA000154405_01119 | gene | open | 412113-412340 | acpP | ||
| 1762 | DS483517.1 | GCA000154405_01120 | gene | open | 412383-412820 | accB | ||
| 1763 | DS483517.1 | GCA000154405_01121 | gene | open | 412822-414189 | accC | ||
| 1764 | DS483517.1 | GCA000154405_01122 | gene | open | 414173-415039 | accD | ||
| 1765 | DS483517.1 | GCA000154405_01123 | gene | open | 415039-415956 | accA | ||
| 1766 | DS483517.1 | GCA000154405_01124 | gene | open | 415956-416903 | fabH | ||
| 1767 | DS483517.1 | GCA000154405_01125 | gene | open | 416913-417857 | fabK | ||
| 1768 | DS483517.1 | GCA000154405_01126 | gene | open | 417850-418929 | yrpB | ||
| 1769 | DS483517.1 | GCA000154405_01127 | gene | open | 418934-419830 | fabD | ||
| 1770 | DS483517.1 | GCA000154405_01128 | gene | open | 419823-420557 | fabG | ||
| 1771 | DS483517.1 | GCA000154405_01129 | gene | open | 420565-421797 | fabF | ||
| 1772 | DS483517.1 | GCA000154405_01130 | gene | open | 421799-422230 | fabZ | ||
| 1773 | DS483517.1 | GCA000154405_01131 | gene | open | 422251-423021 | birA2 | ||
| 1774 | DS483517.1 | GCA000154405_01132 | gene | open | 423128-423673 | marR | ||
| 1775 | DS483517.1 | GCA000154405_01133 | gene | open | 423774-424058 | gatC | ||
| 1776 | DS483517.1 | GCA000154405_01134 | gene | open | 424058-425464 | gatA | ||
| 1777 | DS483517.1 | GCA000154405_01135 | gene | open | 425466-426893 | gatB | ||
| 1778 | DS483517.1 | GCA000154405_01136 | gene | open | 426893-427495 | rdgB | ||
| 1779 | DS483517.1 | GCA000154405_01137 | gene | open | 427476-427946 | yfcE | ||
| 1780 | DS483517.1 | GCA000154405_01138 | gene | open | 428007-429038 | ldcA | ||
| 1781 | DS483517.1 | GCA000154405_01139 | gene | open | 429043-429360 | |||
| 1782 | DS483517.1 | GCA000154405_01140 | gene | open | 429775-430101 | |||
| 1783 | DS483517.1 | GCA000154405_01141 | gene | open | 430088-432031 | ntpI | ||
| 1784 | DS483517.1 | GCA000154405_01142 | gene | open | 432077-432562 | |||
| 1785 | DS483517.1 | GCA000154405_01143 | gene | open | 432597-433148 | ntpE | ||
| 1786 | DS483517.1 | GCA000154405_01144 | gene | open | 433162-434148 | ntpC | ||
| 1787 | DS483517.1 | GCA000154405_01145 | gene | open | 434132-434449 | ntpF | ||
| 1788 | DS483517.1 | GCA000154405_01146 | gene | open | 434466-436235 | ntpA | ||
| 1789 | DS483517.1 | GCA000154405_01147 | gene | open | 436228-437604 | ntpB | ||
| 1790 | DS483517.1 | GCA000154405_01148 | gene | open | 437618-438253 | ntpD | ||
| 1791 | DS483517.1 | GCA000154405_01149 | gene | open | 438844-439146 | |||
| 1792 | DS483517.1 | GCA000154405_01150 | gene | open | 439201-440061 | cof | ||
| 1793 | DS483517.1 | GCA000154405_01151 | gene | open | 440051-440491 | bcp | ||
| 1794 | DS483517.1 | GCA000154405_01152 | gene | open | 440491-441438 | yhcC | ||
| 1795 | DS483517.1 | GCA000154405_01153 | gene | open | 441438-442100 | sdaAB | ||
| 1796 | DS483517.1 | GCA000154405_01154 | gene | open | 442076-442990 | sdaAA | ||
| 1797 | DS483517.1 | GCA000154405_01156 | gene | open | 443454-444779 | rsxC | ||
| 1798 | DS483517.1 | GCA000154405_01157 | gene | open | 444790-446406 | rnfD | ||
| 1799 | DS483517.1 | GCA000154405_01158 | gene | open | 446406-446984 | rnfG | ||
| 1800 | DS483517.1 | GCA000154405_01159 | gene | open | 446995-447609 | rnfE | ||
| 1801 | DS483517.1 | GCA000154405_01160 | gene | open | 447609-448184 | rsxA | ||
| 1802 | DS483517.1 | GCA000154405_01161 | gene | open | 448195-449028 | rnfB | ||
| 1803 | DS483517.1 | GCA000154405_01162 | gene | open | 449177-451237 | fusA | ||
| 1804 | DS483517.1 | GCA000154405_01163 | gene | open | 451412-451999 | acrR | ||
| 1805 | DS483517.1 | GCA000154405_01164 | gene | open | 452425-454599 | |||
| 1806 | DS483517.1 | GCA000154405_01165 | gene | open | 454712-455668 | rluA | ||
| 1807 | DS483517.1 | GCA000154405_01166 | gene | open | 455847-456017 | |||
| 1808 | DS483517.1 | GCA000154405_01167 | gene | open | 456373-456912 | |||
| 1809 | DS483517.1 | GCA000154405_01168 | gene | open | 456972-457421 | yhfF | ||
| 1810 | DS483517.1 | GCA000154405_01169 | gene | open | 457645-459471 | glmS | ||
| 1811 | DS483517.1 | GCA000154405_01170 | gene | open | 459518-460324 | cof | ||
| 1812 | DS483517.1 | GCA000154405_01171 | gene | open | 460333-461523 | gspE | ||
| 1813 | DS483517.1 | GCA000154405_01172 | gene | open | 461525-462613 | gspF | ||
| 1814 | DS483517.1 | GCA000154405_01173 | gene | open | 462635-463162 | |||
| 1815 | DS483517.1 | GCA000154405_01174 | gene | open | 463501-464784 | |||
| 1816 | DS483517.1 | GCA000154405_01175 | gene | open | 464781-465140 | |||
| 1817 | DS483517.1 | GCA000154405_01176 | gene | open | 465237-465965 | sufC | ||
| 1818 | DS483517.1 | GCA000154405_01177 | gene | open | 465980-467395 | sufB | ||
| 1819 | DS483517.1 | GCA000154405_01178 | gene | open | 467407-468438 | sufD | ||
| 1820 | DS483517.1 | GCA000154405_01179 | gene | open | 468440-469669 | csdA | ||
| 1821 | DS483517.1 | GCA000154405_01180 | gene | open | 469659-470084 | sufU | ||
| 1822 | DS483517.1 | GCA000154405_01181 | gene | open | 470133-470453 | ysdA | ||
| 1823 | DS483517.1 | GCA000154405_01182 | gene | open | 470820-474578 | rpoB | ||
| 1824 | DS483517.1 | GCA000154405_01183 | gene | open | 474593-478225 | rpoC | ||
| 1825 | DS483517.1 | GCA000154405_01184 | gene | open | 478277-479362 | murG | ||
| 1826 | DS483517.1 | GCA000154405_01185 | gene | open | 479431-479817 | |||
| 1827 | DS483517.1 | GCA000154405_01186 | gene | open | 480055-480708 | acrR | ||
| 1828 | DS483517.1 | GCA000154405_01187 | gene | open | 481108-482604 | betT | ||
| 1829 | DS483517.1 | GCA000154405_01188 | gene | open | 482629-483954 | |||
| 1830 | DS483517.1 | GCA000154405_01189 | gene | open | 483924-485270 | grdH | ||
| 1831 | DS483517.1 | GCA000154405_01190 | gene | open | 485648-487243 | mdlB | ||
| 1832 | DS483517.1 | GCA000154405_01191 | gene | open | 487285-488895 | mdlB | ||
| 1833 | DS483517.1 | GCA000154405_01193 | gene | open | 489184-490254 | prfA | ||
| 1834 | DS483517.1 | GCA000154405_01194 | gene | open | 490258-491163 | |||
| 1835 | DS483517.1 | GCA000154405_01195 | gene | open | 491166-491936 | ywaF | ||
| 1836 | DS483517.1 | GCA000154405_01196 | gene | open | 492025-492603 | mutT | ||
| 1837 | DS483517.1 | GCA000154405_01197 | gene | open | 492952-494505 | |||
| 1838 | DS483517.1 | GCA000154405_01198 | gene | open | 494813-495886 | ddlA | ||
| 1839 | DS483517.1 | GCA000154405_01199 | gene | open | 495889-497259 | murF | ||
| 1840 | DS483517.1 | GCA000154405_01200 | gene | open | 497261-498388 | pepD2 | ||
| 1841 | DS483517.1 | GCA000154405_01201 | gene | open | 498397-501303 | cym1 | ||
| 1842 | DS483517.1 | GCA000154405_01202 | gene | open | 501594-502763 | hgdB | ||
| 1843 | DS483517.1 | GCA000154405_01203 | gene | open | 502763-503518 | yjiL | ||
| 1844 | DS483517.1 | GCA000154405_01204 | gene | open | 503885-504724 | ispE | ||
| 1845 | DS483517.1 | GCA000154405_01205 | gene | open | 504726-505529 | murI | ||
| 1846 | DS483517.1 | GCA000154405_00936 | gene | open | 249244-249320 | trnP | ||
| 1847 | DS483517.1 | GCA000154405_01031 | gene | open | 321222-321305 | trnL | ||
| 1848 | DS483517.1 | GCA000154405_01032 | gene | open | 321311-321387 | trnH | ||
| 1849 | DS483517.1 | GCA000154405_01155 | gene | open | 443017-443102 | trnL | ||
| 1850 | DS483517.1 | GCA000154405_00936 | tRNA | open | 249244-249320 | trnP | tRNA-Pro(tgg) | |
| 1851 | DS483517.1 | GCA000154405_01031 | tRNA | open | 321222-321305 | trnL | tRNA-Leu(tag) | |
| 1852 | DS483517.1 | GCA000154405_01032 | tRNA | open | 321311-321387 | trnH | tRNA-His(gtg) | |
| 1853 | DS483517.1 | GCA000154405_01155 | tRNA | open | 443017-443102 | trnL | tRNA-Leu(gag) | |
| 1854 | DS483518.1 | GCA000154405_00041 | gene | open | 31571-31918 | ssrA | ||
| 1855 | DS483518.1 | GCA000154405_00041 | tmRNA | open | 31571-31918 | ssrA | transfer-messenger RNA%2C SsrA | |
| 1856 | DS483518.1 | GCA000154405_00001 | gene | open | 335-450 | rrf | ||
| 1857 | DS483518.1 | GCA000154405_00021 | gene | open | 14702-14777 | dfrA-dnaX | ||
| 1858 | DS483518.1 | GCA000154405_00119 | gene | open | 95581-95847 | Bacteria_large_SRP | ||
| 1859 | DS483518.1 | GCA000154405_00120 | gene | open | 95696-95794 | Bacteria_small_SRP | ||
| 1860 | DS483518.1 | GCA000154405_00122 | gene | open | 96333-96413 | skipping-rope | ||
| 1861 | DS483518.1 | GCA000154405_00141 | gene | open | 114830-114905 | dfrA-dnaX | ||
| 1862 | DS483518.1 | GCA000154405_00216 | gene | open | 186523-186598 | dfrA-dnaX | ||
| 1863 | DS483518.1 | GCA000154405_00217 | gene | open | 186611-186686 | dfrA-dnaX | ||
| 1864 | DS483518.1 | GCA000154405_00218 | gene | open | 186699-186774 | dfrA-dnaX | ||
| 1865 | DS483518.1 | GCA000154405_00318 | gene | open | 298288-298361 | dfrA-dnaX | ||
| 1866 | DS483518.1 | GCA000154405_00369 | gene | open | 359242-359318 | dfrA-dnaX | ||
| 1867 | DS483518.1 | GCA000154405_00490 | gene | open | 499149-499481 | RNaseP_bact_a | ||
| 1868 | DS483518.1 | GCA000154405_00605 | gene | open | 621904-621975 | dfrA-dnaX | ||
| 1869 | DS483518.1 | GCA000154405_00733 | gene | open | 725724-725839 | rrf | ||
| 1870 | DS483518.1 | GCA000154405_00021 | ncRNA | open | 14702-14777 | dfrA-dnaX RNA | ||
| 1871 | DS483518.1 | GCA000154405_00119 | ncRNA | open | 95581-95847 | Bacterial large signal recognition particle RNA | ||
| 1872 | DS483518.1 | GCA000154405_00120 | ncRNA | open | 95696-95794 | Bacterial small signal recognition particle RNA | ||
| 1873 | DS483518.1 | GCA000154405_00122 | ncRNA | open | 96333-96413 | skipping-rope RNA | ||
| 1874 | DS483518.1 | GCA000154405_00141 | ncRNA | open | 114830-114905 | dfrA-dnaX RNA | ||
| 1875 | DS483518.1 | GCA000154405_00216 | ncRNA | open | 186523-186598 | dfrA-dnaX RNA | ||
| 1876 | DS483518.1 | GCA000154405_00217 | ncRNA | open | 186611-186686 | dfrA-dnaX RNA | ||
| 1877 | DS483518.1 | GCA000154405_00218 | ncRNA | open | 186699-186774 | dfrA-dnaX RNA | ||
| 1878 | DS483518.1 | GCA000154405_00318 | ncRNA | open | 298288-298361 | dfrA-dnaX RNA | ||
| 1879 | DS483518.1 | GCA000154405_00369 | ncRNA | open | 359242-359318 | dfrA-dnaX RNA | ||
| 1880 | DS483518.1 | GCA000154405_00490 | ncRNA | open | 499149-499481 | Bacterial RNase P class A | ||
| 1881 | DS483518.1 | GCA000154405_00605 | ncRNA | open | 621904-621975 | dfrA-dnaX RNA | ||
| 1882 | DS483518.1 | regulatory_region | open | 194726-194842 | Ribosomal protein L10 leader | |||
| 1883 | DS483518.1 | regulatory_region | open | 209999-210036 | Selenocysteine insertion sequence 4 | |||
| 1884 | DS483518.1 | regulatory_region | open | 396945-397127 | T-box leader | |||
| 1885 | DS483518.1 | regulatory_region | open | 532798-532835 | Selenocysteine insertion sequence 4 | |||
| 1886 | DS483518.1 | GCA000154405_00001 | rRNA | open | 335-450 | rrf | 5S ribosomal RNA | |
| 1887 | DS483518.1 | GCA000154405_00733 | rRNA | open | 725724-725839 | rrf | 5S ribosomal RNA | |
| 1888 | DS483518.1 | repeat_region | open | 246208-247585 | CRISPR array with 21 repeats of length 30%2C consensus sequence GTTTAAATAGAAACATACTGTAATGTAAAT and spacer length 35 | |||
| 1889 | DS483518.1 | repeat_region | open | 250160-250858 | CRISPR array with 11 repeats of length 30%2C consensus sequence GTTTAAATAGAAACATACTGTAATGTAAAT and spacer length 35 | |||
| 1890 | DS483518.1 | GCA000154405_00005 | CDS | open | 862-1503 | _na 213_aa | queH | Epoxyqueuosine reductase QueH |
| 1891 | DS483518.1 | GCA000154405_00007 | CDS | open | 1706-3250 | _na 514_aa | cls | cardiolipin synthase |
| 1892 | DS483518.1 | GCA000154405_00008 | CDS | open | 3409-4152 | _na 247_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 1893 | DS483518.1 | GCA000154405_00009 | CDS | open | 4139-4648 | _na 169_aa | tHEP1 | Nucleoside-triphosphatase |
| 1894 | DS483518.1 | GCA000154405_00010 | CDS | open | 4641-5108 | _na 155_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 1895 | DS483518.1 | GCA000154405_00011 | CDS | open | 5105-5524 | _na 139_aa | hypothetical protein | |
| 1896 | DS483518.1 | GCA000154405_00012 | CDS | open | 5517-6245 | _na 242_aa | Type VII secretion system protein EssD-like domain-containing protein | |
| 1897 | DS483518.1 | GCA000154405_00013 | CDS | open | 6391-7122 | _na 243_aa | rbbA | 3-dehydroquinate dehydratase |
| 1898 | DS483518.1 | GCA000154405_00014 | CDS | open | 7109-8809 | _na 566_aa | ABC transporter permease | |
| 1899 | DS483518.1 | GCA000154405_00015 | CDS | open | 8876-10357 | _na 493_aa | pncB | nicotinate phosphoribosyltransferase |
| 1900 | DS483518.1 | GCA000154405_00016 | CDS | open | 10377-11156 | _na 259_aa | Phage prohead protease%2C HK97 family | |
| 1901 | DS483518.1 | GCA000154405_00017 | CDS | open | 11418-12446 | _na 342_aa | znuA | ABC transporter substrate-binding protein |
| 1902 | DS483518.1 | GCA000154405_00018 | CDS | open | 12446-13117 | _na 223_aa | znuC | ABC transporter domain-containing protein |
| 1903 | DS483518.1 | GCA000154405_00019 | CDS | open | 13110-13928 | _na 272_aa | znuB | ABC transporter |
| 1904 | DS483518.1 | GCA000154405_00020 | CDS | open | 13921-14601 | _na 226_aa | ycgQ | DUF1980 domain-containing protein |
| 1905 | DS483518.1 | GCA000154405_00022 | CDS | open | 14841-15341 | _na 166_aa | folA | dihydrofolate reductase |
| 1906 | DS483518.1 | GCA000154405_00023 | CDS | open | 15345-16139 | _na 264_aa | srtB | class B sortase |
| 1907 | DS483518.1 | GCA000154405_00024 | CDS | open | 16254-17231 | _na 325_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 1908 | DS483518.1 | GCA000154405_00025 | CDS | open | 17231-18040 | _na 269_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 1909 | DS483518.1 | GCA000154405_00026 | CDS | open | 18050-18862 | _na 270_aa | licD | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase |
| 1910 | DS483518.1 | GCA000154405_00027 | CDS | open | 18882-20390 | _na 502_aa | rfbX | Polysaccharide biosynthesis protein |
| 1911 | DS483518.1 | GCA000154405_00028 | CDS | open | 20507-22285 | _na 592_aa | licC | Choline kinase |
| 1912 | DS483518.1 | GCA000154405_00029 | CDS | open | 22478-23323 | _na 281_aa | ecfA2 | energy-coupling factor transporter ATPase |
| 1913 | DS483518.1 | GCA000154405_00030 | CDS | open | 23323-24177 | _na 284_aa | ecfA2 | energy-coupling factor transporter ATPase |
| 1914 | DS483518.1 | GCA000154405_00031 | CDS | open | 24177-24995 | _na 272_aa | ecfT | Transporter |
| 1915 | DS483518.1 | GCA000154405_00032 | CDS | open | 25013-26746 | _na 577_aa | rqcH | Rqc2-like protein RqcH |
| 1916 | DS483518.1 | GCA000154405_00033 | CDS | open | 27129-27422 | _na 97_aa | hypothetical protein | |
| 1917 | DS483518.1 | GCA000154405_00034 | CDS | open | 27317-28060 | _na 247_aa | YeeE/YedE family protein | |
| 1918 | DS483518.1 | GCA000154405_00035 | CDS | open | 28391-28945 | _na 184_aa | Chemotaxis protein | |
| 1919 | DS483518.1 | GCA000154405_00036 | CDS | open | 29129-29284 | _na 51_aa | hypothetical protein | |
| 1920 | DS483518.1 | GCA000154405_00037 | CDS | open | 29653-30078 | _na 141_aa | Antitoxin SocA-like Panacea domain-containing protein | |
| 1921 | DS483518.1 | GCA000154405_00038 | CDS | open | 30071-30448 | _na 125_aa | hypothetical protein | |
| 1922 | DS483518.1 | GCA000154405_00039 | CDS | open | 30544-31005 | _na 153_aa | hypothetical protein | |
| 1923 | DS483518.1 | GCA000154405_00040 | CDS | open | 31062-31256 | _na 64_aa | crAss001_48 related protein | |
| 1924 | DS483518.1 | GCA000154405_00042 | CDS | open | 31995-32384 | _na 129_aa | hypothetical protein | |
| 1925 | DS483518.1 | GCA000154405_00043 | CDS | open | 32562-32897 | _na 111_aa | TM2 domain-containing protein | |
| 1926 | DS483518.1 | GCA000154405_00044 | CDS | open | 32901-33281 | _na 126_aa | DUF2752 domain-containing protein | |
| 1927 | DS483518.1 | GCA000154405_00045 | CDS | open | 33423-34307 | _na 294_aa | yicC | YicC family protein |
| 1928 | DS483518.1 | GCA000154405_00046 | CDS | open | 34321-34893 | _na 190_aa | gmk | guanylate kinase |
| 1929 | DS483518.1 | GCA000154405_00047 | CDS | open | 34906-35103 | _na 65_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 1930 | DS483518.1 | GCA000154405_00048 | CDS | open | 35105-36286 | _na 393_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 1931 | DS483518.1 | GCA000154405_00049 | CDS | open | 36280-38676 | _na 798_aa | priA | primosomal protein N' |
| 1932 | DS483518.1 | GCA000154405_00050 | CDS | open | 38686-39180 | _na 164_aa | def | peptide deformylase |
| 1933 | DS483518.1 | GCA000154405_00051 | CDS | open | 39180-40103 | _na 307_aa | fmt | methionyl-tRNA formyltransferase |
| 1934 | DS483518.1 | GCA000154405_00052 | CDS | open | 40103-41407 | _na 434_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 1935 | DS483518.1 | GCA000154405_00053 | CDS | open | 41686-42075 | _na 129_aa | Bleomycin resistance protein | |
| 1936 | DS483518.1 | GCA000154405_00054 | CDS | open | 42204-42968 | _na 254_aa | ubiE | Methyltransferase domain protein |
| 1937 | DS483518.1 | GCA000154405_00055 | CDS | open | 43470-43898 | _na 142_aa | gloA | VOC domain-containing protein |
| 1938 | DS483518.1 | GCA000154405_00056 | CDS | open | 44155-44418 | _na 87_aa | DUF2087 domain-containing protein | |
| 1939 | DS483518.1 | GCA000154405_00057 | CDS | open | 44435-44914 | _na 159_aa | N-acetyltransferase domain-containing protein | |
| 1940 | DS483518.1 | GCA000154405_00058 | CDS | open | 45036-46175 | _na 379_aa | Transporter%2C major facilitator family protein | |
| 1941 | DS483518.1 | GCA000154405_00059 | CDS | open | 46199-47116 | _na 305_aa | yhcC | TIGR01212 family radical SAM protein |
| 1942 | DS483518.1 | GCA000154405_00060 | CDS | open | 47118-48176 | _na 352_aa | mreB | Cell shape-determining protein MreB |
| 1943 | DS483518.1 | GCA000154405_00061 | CDS | open | 48433-49725 | _na 430_aa | Oxidoreductase DRL-like catalytic domain-containing protein | |
| 1944 | DS483518.1 | GCA000154405_00062 | CDS | open | 49734-50750 | _na 338_aa | Organic solvent tolerance-like N-terminal domain-containing protein | |
| 1945 | DS483518.1 | GCA000154405_00063 | CDS | open | 50762-51034 | _na 90_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 1946 | DS483518.1 | GCA000154405_00064 | CDS | open | 51027-51857 | _na 276_aa | mscS | Transporter |
| 1947 | DS483518.1 | GCA000154405_00065 | CDS | open | 51850-52059 | _na 69_aa | PF06107 family protein | |
| 1948 | DS483518.1 | GCA000154405_00066 | CDS | open | 52071-52589 | _na 172_aa | nfnB | Nitroreductase |
| 1949 | DS483518.1 | GCA000154405_00067 | CDS | open | 52606-53301 | _na 231_aa | alkD | DNA alkylation repair enzyme |
| 1950 | DS483518.1 | GCA000154405_00068 | CDS | open | 53423-54265 | _na 280_aa | ydeE | AraC family transcriptional regulator |
| 1951 | DS483518.1 | GCA000154405_00069 | CDS | open | 54451-54948 | _na 165_aa | DUF1579 domain-containing protein | |
| 1952 | DS483518.1 | GCA000154405_00070 | CDS | open | 55161-56768 | _na 535_aa | ABC transporter%2C ATP-binding protein | |
| 1953 | DS483518.1 | GCA000154405_00071 | CDS | open | 56976-58025 | _na 349_aa | prfB | peptide chain release factor 2 |
| 1954 | DS483518.1 | GCA000154405_00072 | CDS | open | 58030-58125 | _na 31_aa | DUF4044 domain-containing protein | |
| 1955 | DS483518.1 | GCA000154405_00073 | CDS | open | 58125-58742 | _na 205_aa | recX | Regulatory protein RecX |
| 1956 | DS483518.1 | GCA000154405_00074 | CDS | open | 58739-59026 | _na 95_aa | yhbQ | Endonuclease |
| 1957 | DS483518.1 | GCA000154405_00075 | CDS | open | 59023-59841 | _na 272_aa | Viral A-type inclusion protein | |
| 1958 | DS483518.1 | GCA000154405_00076 | CDS | open | 59851-60072 | _na 73_aa | Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein | |
| 1959 | DS483518.1 | GCA000154405_00077 | CDS | open | 60074-60850 | _na 258_aa | dnaJ | DnaJ domain-containing protein |
| 1960 | DS483518.1 | GCA000154405_00078 | CDS | open | 60928-62139 | _na 403_aa | pepT | peptidase T |
| 1961 | DS483518.1 | GCA000154405_00079 | CDS | open | 62141-63529 | _na 462_aa | pepD2 | Xaa-His dipeptidase |
| 1962 | DS483518.1 | GCA000154405_00080 | CDS | open | 63650-64624 | _na 324_aa | folP | dihydropteroate synthase |
| 1963 | DS483518.1 | GCA000154405_00081 | CDS | open | 64633-65100 | _na 155_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1964 | DS483518.1 | GCA000154405_00082 | CDS | open | 65181-65879 | _na 232_aa | deoD | purine-nucleoside phosphorylase |
| 1965 | DS483518.1 | GCA000154405_00083 | CDS | open | 65879-66523 | _na 214_aa | deoC | deoxyribose-phosphate aldolase |
| 1966 | DS483518.1 | GCA000154405_00084 | CDS | open | 66633-67709 | _na 358_aa | msrB | bifunctional methionine sulfoxide reductase B/A protein |
| 1967 | DS483518.1 | GCA000154405_00085 | CDS | open | 67957-69411 | _na 484_aa | alsT | Amino acid carrier protein |
| 1968 | DS483518.1 | GCA000154405_00086 | CDS | open | 69617-71236 | _na 539_aa | flgJ | Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase |
| 1969 | DS483518.1 | GCA000154405_00087 | CDS | open | 71237-72166 | _na 309_aa | rhaT | Membrane protein |
| 1970 | DS483518.1 | GCA000154405_00088 | CDS | open | 72282-72800 | _na 172_aa | CoA-binding domain-containing protein | |
| 1971 | DS483518.1 | GCA000154405_00089 | CDS | open | 72933-73427 | _na 164_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 1972 | DS483518.1 | GCA000154405_00090 | CDS | open | 73435-74037 | _na 200_aa | ruvA | Holliday junction branch migration protein RuvA |
| 1973 | DS483518.1 | GCA000154405_00091 | CDS | open | 74046-75053 | _na 335_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 1974 | DS483518.1 | GCA000154405_00092 | CDS | open | 75212-76255 | _na 347_aa | queA | tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA |
| 1975 | DS483518.1 | GCA000154405_00093 | CDS | open | 76255-77373 | _na 372_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 1976 | DS483518.1 | GCA000154405_00094 | CDS | open | 77376-78062 | _na 228_aa | Membrane protein | |
| 1977 | DS483518.1 | GCA000154405_00095 | CDS | open | 78079-79194 | _na 371_aa | ABC transporter | |
| 1978 | DS483518.1 | GCA000154405_00096 | CDS | open | 79184-80236 | _na 350_aa | yadH | ABC transporter |
| 1979 | DS483518.1 | GCA000154405_00097 | CDS | open | 80236-81165 | _na 309_aa | rbbA | ABC transporter ATP-binding protein |
| 1980 | DS483518.1 | GCA000154405_00098 | CDS | open | 81331-82377 | _na 348_aa | comP | histidine kinase |
| 1981 | DS483518.1 | GCA000154405_00099 | CDS | open | 82358-82957 | _na 199_aa | citB | LuxR family transcriptional regulator |
| 1982 | DS483518.1 | GCA000154405_00100 | CDS | open | 82974-83420 | _na 148_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 1983 | DS483518.1 | GCA000154405_00101 | CDS | open | 83496-84731 | _na 411_aa | gltP | Sodium:dicarboxylate symporter |
| 1984 | DS483518.1 | GCA000154405_00102 | CDS | open | 85056-85394 | _na 112_aa | yloU | Asp23/Gls24 family envelope stress response protein |
| 1985 | DS483518.1 | GCA000154405_00103 | CDS | open | 85404-85808 | _na 134_aa | nusB | transcription antitermination factor NusB |
| 1986 | DS483518.1 | GCA000154405_00104 | CDS | open | 85834-86178 | _na 114_aa | eamA | EamA domain-containing protein |
| 1987 | DS483518.1 | GCA000154405_00105 | CDS | open | 86194-87393 | _na 399_aa | xseA | exodeoxyribonuclease VII large subunit |
| 1988 | DS483518.1 | GCA000154405_00106 | CDS | open | 87383-87640 | _na 85_aa | xseB | exodeoxyribonuclease VII small subunit |
| 1989 | DS483518.1 | GCA000154405_00107 | CDS | open | 87640-88488 | _na 282_aa | ispA | Geranyl transferase |
| 1990 | DS483518.1 | GCA000154405_00108 | CDS | open | 88488-89222 | _na 244_aa | yqxC | Ribosomal RNA large subunit methyltransferase J |
| 1991 | DS483518.1 | GCA000154405_00109 | CDS | open | 89231-89683 | _na 150_aa | argR | Arginine repressor |
| 1992 | DS483518.1 | GCA000154405_00110 | CDS | open | 89691-91409 | _na 572_aa | recN | DNA repair protein RecN |
| 1993 | DS483518.1 | GCA000154405_00111 | CDS | open | 91394-91912 | _na 172_aa | yjhB | DNA mismatch repair protein MutT |
| 1994 | DS483518.1 | GCA000154405_00112 | CDS | open | 91914-92525 | _na 203_aa | Peptidase%2C M50 family | |
| 1995 | DS483518.1 | GCA000154405_00113 | CDS | open | 92525-93259 | _na 244_aa | scpA | Segregation and condensation protein A |
| 1996 | DS483518.1 | GCA000154405_00114 | CDS | open | 93252-93836 | _na 194_aa | scpB | SMC-Scp complex subunit ScpB |
| 1997 | DS483518.1 | GCA000154405_00115 | CDS | open | 93823-94515 | _na 230_aa | rsuA | Pseudouridine synthase |
| 1998 | DS483518.1 | GCA000154405_00116 | CDS | open | 94515-94901 | _na 128_aa | N-acetyltransferase domain-containing protein | |
| 1999 | DS483518.1 | GCA000154405_00117 | CDS | open | 94885-95436 | _na 183_aa | rmsH | rRNA methyltransferase |
| 2000 | DS483518.1 | GCA000154405_00121 | CDS | open | 95946-96302 | _na 118_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 3 domain-containing protein |

