BAKTAGenome Explorer: Porphyromonas uenonis (GCA_000174775.1)
Select a Genome:
|
BAKTA Annotations for GCA_000174775.1
|
Search & Sort all 3883 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | ACLR01000034.1 | GCA000174775_01732 | gene | open | 59034-59558 | |||
| 502 | ACLR01000034.1 | GCA000174775_01733 | gene | open | 59597-60103 | |||
| 503 | ACLR01000034.1 | GCA000174775_01734 | gene | open | 60606-61289 | hmuY | ||
| 504 | ACLR01000034.1 | GCA000174775_01735 | gene | open | 61338-62951 | |||
| 505 | ACLR01000034.1 | GCA000174775_01736 | gene | open | 62967-64172 | |||
| 506 | ACLR01000034.1 | GCA000174775_01737 | gene | open | 64264-65607 | |||
| 507 | ACLR01000034.1 | GCA000174775_01738 | gene | open | 65650-68646 | |||
| 508 | ACLR01000034.1 | GCA000174775_01739 | gene | open | 69289-70071 | cdaA | ||
| 509 | ACLR01000034.1 | GCA000174775_01740 | gene | open | 70097-71005 | folP | ||
| 510 | ACLR01000034.1 | GCA000174775_01741 | gene | open | 71088-72569 | |||
| 511 | ACLR01000034.1 | GCA000174775_01742 | gene | open | 72750-72902 | rpmF | ||
| 512 | ACLR01000034.1 | GCA000174775_01743 | gene | open | 72948-73478 | |||
| 513 | ACLR01000034.1 | GCA000174775_01744 | gene | open | 73704-73789 | trnL | ||
| 514 | ACLR01000034.1 | GCA000174775_01744 | tRNA | open | 73704-73789 | trnL | tRNA-Leu(taa) | |
| 515 | ACLR01000035.1 | GCA000174775_01679 | CDS | open | 23-616 | _na 197_aa | Integrase core domain protein | |
| 516 | ACLR01000035.1 | GCA000174775_01679 | gene | open | 23-616 | |||
| 517 | ACLR01000036.1 | GCA000174775_01678 | CDS | open | 224-352 | _na 42_aa | hypothetical protein | |
| 518 | ACLR01000036.1 | GCA000174775_01678 | gene | open | 224-352 | |||
| 519 | ACLR01000037.1 | GCA000174775_01677 | CDS | open | 241-558 | _na 105_aa | hypothetical protein | |
| 520 | ACLR01000037.1 | GCA000174775_01677 | gene | open | 241-558 | |||
| 521 | ACLR01000040.1 | GCA000174775_01675 | CDS | open | 504-821 | _na 105_aa | hypothetical protein | |
| 522 | ACLR01000040.1 | GCA000174775_01676 | CDS | open | 833-1582 | _na 249_aa | hypothetical protein | |
| 523 | ACLR01000040.1 | GCA000174775_01675 | gene | open | 504-821 | |||
| 524 | ACLR01000040.1 | GCA000174775_01676 | gene | open | 833-1582 | |||
| 525 | ACLR01000041.1 | GCA000174775_01674 | CDS | open | 197-1636 | _na 479_aa | Leucine Rich Repeat protein | |
| 526 | ACLR01000041.1 | GCA000174775_01674 | gene | open | 197-1636 | |||
| 527 | ACLR01000042.1 | GCA000174775_01673 | CDS | open | 32-160 | _na 42_aa | hypothetical protein | |
| 528 | ACLR01000042.1 | GCA000174775_01673 | gene | open | 32-160 | |||
| 529 | ACLR01000045.1 | GCA000174775_01672 | CDS | open | 7-357 | _na 116_aa | hypothetical protein | |
| 530 | ACLR01000045.1 | GCA000174775_01672 | gene | open | 7-357 | |||
| 531 | ACLR01000047.1 | GCA000174775_01650 | gene | open | 2640-2836 | Bacteroidales-1 | ||
| 532 | ACLR01000047.1 | GCA000174775_01650 | ncRNA | open | 2640-2836 | Bacteroidales-1 6S-Bacteroidales RNA suggested | ||
| 533 | ACLR01000047.1 | GCA000174775_01648 | CDS | open | 737-877 | _na 46_aa | hypothetical protein | |
| 534 | ACLR01000047.1 | GCA000174775_01649 | CDS | open | 1199-2629 | _na 476_aa | cls | cardiolipin synthase |
| 535 | ACLR01000047.1 | GCA000174775_01651 | CDS | open | 3078-3710 | _na 210_aa | UPF0056 inner membrane protein | |
| 536 | ACLR01000047.1 | GCA000174775_01652 | CDS | open | 3844-6141 | _na 765_aa | Leucine Rich Repeat protein | |
| 537 | ACLR01000047.1 | GCA000174775_01653 | CDS | open | 6155-8671 | _na 838_aa | Leucine Rich Repeat protein | |
| 538 | ACLR01000047.1 | GCA000174775_01654 | CDS | open | 9340-10542 | _na 400_aa | megL | methionine gamma-lyase |
| 539 | ACLR01000047.1 | GCA000174775_01655 | CDS | open | 10717-11301 | _na 194_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 540 | ACLR01000047.1 | GCA000174775_01656 | CDS | open | 11298-12893 | _na 531_aa | Peptidase%2C S41 family | |
| 541 | ACLR01000047.1 | GCA000174775_01657 | CDS | open | 12929-13417 | _na 162_aa | CMP/dCMP deaminase zinc-binding protein | |
| 542 | ACLR01000047.1 | GCA000174775_01658 | CDS | open | 13533-14273 | _na 246_aa | SIMPL domain-containing protein | |
| 543 | ACLR01000047.1 | GCA000174775_01659 | CDS | open | 14328-15275 | _na 315_aa | trxB | thioredoxin-disulfide reductase |
| 544 | ACLR01000047.1 | GCA000174775_01660 | CDS | open | 15473-15748 | _na 91_aa | hypothetical protein | |
| 545 | ACLR01000047.1 | GCA000174775_01661 | CDS | open | 15778-16623 | _na 281_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 546 | ACLR01000047.1 | GCA000174775_01662 | CDS | open | 16643-18787 | _na 714_aa | recQ | ATP-dependent DNA helicase RecQ |
| 547 | ACLR01000047.1 | GCA000174775_01663 | CDS | open | 18738-20519 | _na 593_aa | recJ | single-stranded-DNA-specific exonuclease RecJ |
| 548 | ACLR01000047.1 | GCA000174775_01664 | CDS | open | 20853-22382 | _na 509_aa | Ribonuclease%2C Rne/Rng family | |
| 549 | ACLR01000047.1 | GCA000174775_01665 | CDS | open | 22963-23052 | _na 29_aa | Mitochondrial mRNA-processing protein COX24 C-terminal domain-containing protein | |
| 550 | ACLR01000047.1 | GCA000174775_01666 | CDS | open | 23154-23426 | _na 90_aa | DNA-binding protein HU | |
| 551 | ACLR01000047.1 | GCA000174775_01668 | CDS | open | 23820-24071 | _na 83_aa | rpsT | 30S ribosomal protein S20 |
| 552 | ACLR01000047.1 | GCA000174775_01670 | CDS | open | 24407-25285 | _na 292_aa | NAD kinase | |
| 553 | ACLR01000047.1 | GCA000174775_01671 | CDS | open | 25730-28252 | _na 840_aa | feoB | ferrous iron transport protein B |
| 554 | ACLR01000047.1 | GCA000174775_01648 | gene | open | 737-877 | |||
| 555 | ACLR01000047.1 | GCA000174775_01649 | gene | open | 1199-2629 | cls | ||
| 556 | ACLR01000047.1 | GCA000174775_01651 | gene | open | 3078-3710 | |||
| 557 | ACLR01000047.1 | GCA000174775_01652 | gene | open | 3844-6141 | |||
| 558 | ACLR01000047.1 | GCA000174775_01653 | gene | open | 6155-8671 | |||
| 559 | ACLR01000047.1 | GCA000174775_01654 | gene | open | 9340-10542 | megL | ||
| 560 | ACLR01000047.1 | GCA000174775_01655 | gene | open | 10717-11301 | |||
| 561 | ACLR01000047.1 | GCA000174775_01656 | gene | open | 11298-12893 | |||
| 562 | ACLR01000047.1 | GCA000174775_01657 | gene | open | 12929-13417 | |||
| 563 | ACLR01000047.1 | GCA000174775_01658 | gene | open | 13533-14273 | |||
| 564 | ACLR01000047.1 | GCA000174775_01659 | gene | open | 14328-15275 | trxB | ||
| 565 | ACLR01000047.1 | GCA000174775_01660 | gene | open | 15473-15748 | |||
| 566 | ACLR01000047.1 | GCA000174775_01661 | gene | open | 15778-16623 | ispE | ||
| 567 | ACLR01000047.1 | GCA000174775_01662 | gene | open | 16643-18787 | recQ | ||
| 568 | ACLR01000047.1 | GCA000174775_01663 | gene | open | 18738-20519 | recJ | ||
| 569 | ACLR01000047.1 | GCA000174775_01664 | gene | open | 20853-22382 | |||
| 570 | ACLR01000047.1 | GCA000174775_01665 | gene | open | 22963-23052 | |||
| 571 | ACLR01000047.1 | GCA000174775_01666 | gene | open | 23154-23426 | |||
| 572 | ACLR01000047.1 | GCA000174775_01668 | gene | open | 23820-24071 | rpsT | ||
| 573 | ACLR01000047.1 | GCA000174775_01670 | gene | open | 24407-25285 | |||
| 574 | ACLR01000047.1 | GCA000174775_01671 | gene | open | 25730-28252 | feoB | ||
| 575 | ACLR01000047.1 | GCA000174775_01667 | gene | open | 23671-23742 | trnE | ||
| 576 | ACLR01000047.1 | GCA000174775_01669 | gene | open | 24144-24215 | trnE | ||
| 577 | ACLR01000047.1 | GCA000174775_01667 | tRNA | open | 23671-23742 | trnE | tRNA-Glu(ttc) | |
| 578 | ACLR01000047.1 | GCA000174775_01669 | tRNA | open | 24144-24215 | trnE | tRNA-Glu(ctc) | |
| 579 | ACLR01000049.1 | GCA000174775_01646 | CDS | open | 638-2239 | _na 533_aa | Minor fimbrium subunit Mfa1 C-terminal domain-containing protein | |
| 580 | ACLR01000049.1 | GCA000174775_01647 | CDS | open | 2239-2331 | _na 30_aa | hypothetical protein | |
| 581 | ACLR01000049.1 | GCA000174775_01646 | gene | open | 638-2239 | |||
| 582 | ACLR01000049.1 | GCA000174775_01647 | gene | open | 2239-2331 | |||
| 583 | ACLR01000053.1 | GCA000174775_01645 | CDS | open | 23-466 | _na 147_aa | Transposase%2C IS116/IS110/IS902 family | |
| 584 | ACLR01000053.1 | GCA000174775_01645 | gene | open | 23-466 | |||
| 585 | ACLR01000054.1 | GCA000174775_01633 | CDS | open | 443-1513 | _na 356_aa | YWFCY domain-containing protein | |
| 586 | ACLR01000054.1 | GCA000174775_01634 | CDS | open | 1563-1985 | _na 140_aa | hypothetical protein | |
| 587 | ACLR01000054.1 | GCA000174775_01635 | CDS | open | 1827-3110 | _na 427_aa | Relaxase/mobilization nuclease domain protein | |
| 588 | ACLR01000054.1 | GCA000174775_01636 | CDS | open | 3110-3487 | _na 125_aa | Bacterial mobilisation domain-containing protein | |
| 589 | ACLR01000054.1 | GCA000174775_01637 | CDS | open | 4116-4907 | _na 263_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 590 | ACLR01000054.1 | GCA000174775_01638 | CDS | open | 4904-5449 | _na 181_aa | traC | Conjugative transposon protein TraC |
| 591 | ACLR01000054.1 | GCA000174775_01639 | CDS | open | 5446-6201 | _na 251_aa | Conjugal transfer protein | |
| 592 | ACLR01000054.1 | GCA000174775_01640 | CDS | open | 6256-6573 | _na 105_aa | traE | Conjugative transposon protein TraE |
| 593 | ACLR01000054.1 | GCA000174775_01641 | CDS | open | 6573-6899 | _na 108_aa | traF | Conjugative transposon protein TraF |
| 594 | ACLR01000054.1 | GCA000174775_01642 | CDS | open | 6896-9415 | _na 839_aa | traG | Conjugation system ATPase%2C TraG family |
| 595 | ACLR01000054.1 | GCA000174775_01643 | CDS | open | 9442-10071 | _na 209_aa | Conjugal transfer protein | |
| 596 | ACLR01000054.1 | GCA000174775_01644 | CDS | open | 10104-11141 | _na 345_aa | traJ | conjugative transposon protein TraJ |
| 597 | ACLR01000054.1 | GCA000174775_01633 | gene | open | 443-1513 | |||
| 598 | ACLR01000054.1 | GCA000174775_01634 | gene | open | 1563-1985 | |||
| 599 | ACLR01000054.1 | GCA000174775_01635 | gene | open | 1827-3110 | |||
| 600 | ACLR01000054.1 | GCA000174775_01636 | gene | open | 3110-3487 | |||
| 601 | ACLR01000054.1 | GCA000174775_01637 | gene | open | 4116-4907 | |||
| 602 | ACLR01000054.1 | GCA000174775_01638 | gene | open | 4904-5449 | traC | ||
| 603 | ACLR01000054.1 | GCA000174775_01639 | gene | open | 5446-6201 | |||
| 604 | ACLR01000054.1 | GCA000174775_01640 | gene | open | 6256-6573 | traE | ||
| 605 | ACLR01000054.1 | GCA000174775_01641 | gene | open | 6573-6899 | traF | ||
| 606 | ACLR01000054.1 | GCA000174775_01642 | gene | open | 6896-9415 | traG | ||
| 607 | ACLR01000054.1 | GCA000174775_01643 | gene | open | 9442-10071 | |||
| 608 | ACLR01000054.1 | GCA000174775_01644 | gene | open | 10104-11141 | traJ | ||
| 609 | ACLR01000056.1 | GCA000174775_01632 | CDS | open | 142-336 | _na 64_aa | Transposase | |
| 610 | ACLR01000056.1 | GCA000174775_01632 | gene | open | 142-336 | |||
| 611 | ACLR01000059.1 | GCA000174775_01574 | CDS | open | 741-1655 | _na 304_aa | 3-hydroxybutyryl-CoA dehydrogenase | |
| 612 | ACLR01000059.1 | GCA000174775_01575 | CDS | open | 1689-2600 | _na 303_aa | ribonuclease Z | |
| 613 | ACLR01000059.1 | GCA000174775_01576 | CDS | open | 2634-4178 | _na 514_aa | Polysaccharide biosynthesis protein | |
| 614 | ACLR01000059.1 | GCA000174775_01577 | CDS | open | 4503-5414 | _na 303_aa | Cold-shock DNA-binding domain protein | |
| 615 | ACLR01000059.1 | GCA000174775_01578 | CDS | open | 5441-6493 | _na 350_aa | Lipoprotein | |
| 616 | ACLR01000059.1 | GCA000174775_01579 | CDS | open | 6501-7574 | _na 357_aa | pdxA | 4-hydroxythreonine-4-phosphate dehydrogenase PdxA |
| 617 | ACLR01000059.1 | GCA000174775_01580 | CDS | open | 7596-8561 | _na 321_aa | hypothetical protein | |
| 618 | ACLR01000059.1 | GCA000174775_01581 | CDS | open | 8566-11874 | _na 1102_aa | DNA 3'-5' helicase | |
| 619 | ACLR01000059.1 | GCA000174775_01582 | CDS | open | 11988-12335 | _na 115_aa | rpsF | 30S ribosomal protein S6 |
| 620 | ACLR01000059.1 | GCA000174775_01583 | CDS | open | 12339-12605 | _na 88_aa | rpsR | 30S ribosomal protein S18 |
| 621 | ACLR01000059.1 | GCA000174775_01584 | CDS | open | 12631-13197 | _na 188_aa | rplI | 50S ribosomal protein L9 |
| 622 | ACLR01000059.1 | GCA000174775_01585 | CDS | open | 13555-15753 | _na 732_aa | RelA/SpoT family protein | |
| 623 | ACLR01000059.1 | GCA000174775_01586 | CDS | open | 15899-16279 | _na 126_aa | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase | |
| 624 | ACLR01000059.1 | GCA000174775_01587 | CDS | open | 16303-17400 | _na 365_aa | 3-deoxy-7-phosphoheptulonate synthase | |
| 625 | ACLR01000059.1 | GCA000174775_01588 | CDS | open | 18032-18751 | _na 239_aa | Phosphonate-transporting ATPase | |
| 626 | ACLR01000059.1 | GCA000174775_01589 | CDS | open | 18767-20047 | _na 426_aa | ABC3 transporter permease protein domain-containing protein | |
| 627 | ACLR01000059.1 | GCA000174775_01590 | CDS | open | 20076-21335 | _na 419_aa | ABC3 transporter permease protein domain-containing protein | |
| 628 | ACLR01000059.1 | GCA000174775_01591 | CDS | open | 21381-22493 | _na 370_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 629 | ACLR01000059.1 | GCA000174775_01592 | CDS | open | 22519-23871 | _na 450_aa | Outer membrane efflux protein | |
| 630 | ACLR01000059.1 | GCA000174775_01593 | CDS | open | 24044-24961 | _na 305_aa | ABC transporter related protein | |
| 631 | ACLR01000059.1 | GCA000174775_01594 | CDS | open | 24958-25833 | _na 291_aa | ABC transporter permease | |
| 632 | ACLR01000059.1 | GCA000174775_01595 | CDS | open | 25853-26242 | _na 129_aa | gntR | Transcriptional regulator%2C GntR family |
| 633 | ACLR01000059.1 | GCA000174775_01596 | CDS | open | 26613-27038 | _na 141_aa | 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase | |
| 634 | ACLR01000059.1 | GCA000174775_01597 | CDS | open | 27040-27645 | _na 201_aa | 7-carboxy-7-deazaguanine synthase | |
| 635 | ACLR01000059.1 | GCA000174775_01598 | CDS | open | 27979-29658 | _na 559_aa | OmpA/MotB domain protein | |
| 636 | ACLR01000059.1 | GCA000174775_01599 | CDS | open | 29679-30245 | _na 188_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 637 | ACLR01000059.1 | GCA000174775_01600 | CDS | open | 30257-31402 | _na 381_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 638 | ACLR01000059.1 | GCA000174775_01601 | CDS | open | 31399-31956 | _na 185_aa | Fumarylacetoacetate (FAA) hydrolase | |
| 639 | ACLR01000059.1 | GCA000174775_01602 | CDS | open | 31993-32640 | _na 215_aa | rpe | ribulose-phosphate 3-epimerase |
| 640 | ACLR01000059.1 | GCA000174775_01603 | CDS | open | 32683-34203 | _na 506_aa | ComEC/Rec2-related protein | |
| 641 | ACLR01000059.1 | GCA000174775_01604 | CDS | open | 34451-37258 | _na 935_aa | TonB-dependent receptor plug | |
| 642 | ACLR01000059.1 | GCA000174775_01605 | CDS | open | 37280-38590 | _na 436_aa | DUF4876 domain-containing protein | |
| 643 | ACLR01000059.1 | GCA000174775_01606 | CDS | open | 38881-40197 | _na 438_aa | DUF4876 domain-containing protein | |
| 644 | ACLR01000059.1 | GCA000174775_01607 | CDS | open | 40235-41815 | _na 526_aa | DUF6850 domain-containing protein | |
| 645 | ACLR01000059.1 | GCA000174775_01608 | CDS | open | 41856-44297 | _na 813_aa | hypothetical protein | |
| 646 | ACLR01000059.1 | GCA000174775_01609 | CDS | open | 44419-45012 | _na 197_aa | Lipoprotein | |
| 647 | ACLR01000059.1 | GCA000174775_01610 | CDS | open | 45039-45620 | _na 193_aa | PepSY-associated TM helix domain protein | |
| 648 | ACLR01000059.1 | GCA000174775_01611 | CDS | open | 45657-46541 | _na 294_aa | ABC transporter related protein | |
| 649 | ACLR01000059.1 | GCA000174775_01612 | CDS | open | 46552-47223 | _na 223_aa | Tat pathway signal sequence domain protein | |
| 650 | ACLR01000059.1 | GCA000174775_01613 | CDS | open | 47230-48264 | _na 344_aa | DUF4857 domain-containing protein | |
| 651 | ACLR01000059.1 | GCA000174775_01614 | CDS | open | 48739-49176 | _na 145_aa | hypothetical protein | |
| 652 | ACLR01000059.1 | GCA000174775_01615 | CDS | open | 49239-50429 | _na 396_aa | kbl | glycine C-acetyltransferase |
| 653 | ACLR01000059.1 | GCA000174775_01616 | CDS | open | 50573-51784 | _na 403_aa | Erythronate-4-phosphate dehydrogenase | |
| 654 | ACLR01000059.1 | GCA000174775_01617 | CDS | open | 52529-53278 | _na 249_aa | Tetratricopeptide repeat protein | |
| 655 | ACLR01000059.1 | GCA000174775_01618 | CDS | open | 53295-55328 | _na 677_aa | uvrB | excinuclease ABC subunit UvrB |
| 656 | ACLR01000059.1 | GCA000174775_01619 | CDS | open | 55333-55707 | _na 124_aa | folB | dihydroneopterin aldolase |
| 657 | ACLR01000059.1 | GCA000174775_01620 | CDS | open | 55733-56971 | _na 412_aa | L-serine ammonia-lyase | |
| 658 | ACLR01000059.1 | GCA000174775_01621 | CDS | open | 57580-58452 | _na 290_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 659 | ACLR01000059.1 | GCA000174775_01622 | CDS | open | 58464-59462 | _na 332_aa | Thioredoxin domain-containing protein | |
| 660 | ACLR01000059.1 | GCA000174775_01623 | CDS | open | 59564-60241 | _na 225_aa | ompA | OmpA family protein |
| 661 | ACLR01000059.1 | GCA000174775_01624 | CDS | open | 60304-61287 | _na 327_aa | Dihydroorotate dehydrogenase 2 | |
| 662 | ACLR01000059.1 | GCA000174775_01626 | CDS | open | 61869-62939 | _na 356_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 663 | ACLR01000059.1 | GCA000174775_01627 | CDS | open | 62984-63532 | _na 182_aa | RNA polymerase sigma factor | |
| 664 | ACLR01000059.1 | GCA000174775_01628 | CDS | open | 63618-64064 | _na 148_aa | hypothetical protein | |
| 665 | ACLR01000059.1 | GCA000174775_01629 | CDS | open | 64090-64563 | _na 157_aa | Periplasmic heavy metal sensor | |
| 666 | ACLR01000059.1 | GCA000174775_01631 | CDS | open | 64870-65091 | _na 73_aa | hypothetical protein | |
| 667 | ACLR01000059.1 | GCA000174775_01574 | gene | open | 741-1655 | |||
| 668 | ACLR01000059.1 | GCA000174775_01575 | gene | open | 1689-2600 | |||
| 669 | ACLR01000059.1 | GCA000174775_01576 | gene | open | 2634-4178 | |||
| 670 | ACLR01000059.1 | GCA000174775_01577 | gene | open | 4503-5414 | |||
| 671 | ACLR01000059.1 | GCA000174775_01578 | gene | open | 5441-6493 | |||
| 672 | ACLR01000059.1 | GCA000174775_01579 | gene | open | 6501-7574 | pdxA | ||
| 673 | ACLR01000059.1 | GCA000174775_01580 | gene | open | 7596-8561 | |||
| 674 | ACLR01000059.1 | GCA000174775_01581 | gene | open | 8566-11874 | |||
| 675 | ACLR01000059.1 | GCA000174775_01582 | gene | open | 11988-12335 | rpsF | ||
| 676 | ACLR01000059.1 | GCA000174775_01583 | gene | open | 12339-12605 | rpsR | ||
| 677 | ACLR01000059.1 | GCA000174775_01584 | gene | open | 12631-13197 | rplI | ||
| 678 | ACLR01000059.1 | GCA000174775_01585 | gene | open | 13555-15753 | |||
| 679 | ACLR01000059.1 | GCA000174775_01586 | gene | open | 15899-16279 | |||
| 680 | ACLR01000059.1 | GCA000174775_01587 | gene | open | 16303-17400 | |||
| 681 | ACLR01000059.1 | GCA000174775_01588 | gene | open | 18032-18751 | |||
| 682 | ACLR01000059.1 | GCA000174775_01589 | gene | open | 18767-20047 | |||
| 683 | ACLR01000059.1 | GCA000174775_01590 | gene | open | 20076-21335 | |||
| 684 | ACLR01000059.1 | GCA000174775_01591 | gene | open | 21381-22493 | |||
| 685 | ACLR01000059.1 | GCA000174775_01592 | gene | open | 22519-23871 | |||
| 686 | ACLR01000059.1 | GCA000174775_01593 | gene | open | 24044-24961 | |||
| 687 | ACLR01000059.1 | GCA000174775_01594 | gene | open | 24958-25833 | |||
| 688 | ACLR01000059.1 | GCA000174775_01595 | gene | open | 25853-26242 | gntR | ||
| 689 | ACLR01000059.1 | GCA000174775_01596 | gene | open | 26613-27038 | |||
| 690 | ACLR01000059.1 | GCA000174775_01597 | gene | open | 27040-27645 | |||
| 691 | ACLR01000059.1 | GCA000174775_01598 | gene | open | 27979-29658 | |||
| 692 | ACLR01000059.1 | GCA000174775_01599 | gene | open | 29679-30245 | rfbC | ||
| 693 | ACLR01000059.1 | GCA000174775_01600 | gene | open | 30257-31402 | rfbB | ||
| 694 | ACLR01000059.1 | GCA000174775_01601 | gene | open | 31399-31956 | |||
| 695 | ACLR01000059.1 | GCA000174775_01602 | gene | open | 31993-32640 | rpe | ||
| 696 | ACLR01000059.1 | GCA000174775_01603 | gene | open | 32683-34203 | |||
| 697 | ACLR01000059.1 | GCA000174775_01604 | gene | open | 34451-37258 | |||
| 698 | ACLR01000059.1 | GCA000174775_01605 | gene | open | 37280-38590 | |||
| 699 | ACLR01000059.1 | GCA000174775_01606 | gene | open | 38881-40197 | |||
| 700 | ACLR01000059.1 | GCA000174775_01607 | gene | open | 40235-41815 | |||
| 701 | ACLR01000059.1 | GCA000174775_01608 | gene | open | 41856-44297 | |||
| 702 | ACLR01000059.1 | GCA000174775_01609 | gene | open | 44419-45012 | |||
| 703 | ACLR01000059.1 | GCA000174775_01610 | gene | open | 45039-45620 | |||
| 704 | ACLR01000059.1 | GCA000174775_01611 | gene | open | 45657-46541 | |||
| 705 | ACLR01000059.1 | GCA000174775_01612 | gene | open | 46552-47223 | |||
| 706 | ACLR01000059.1 | GCA000174775_01613 | gene | open | 47230-48264 | |||
| 707 | ACLR01000059.1 | GCA000174775_01614 | gene | open | 48739-49176 | |||
| 708 | ACLR01000059.1 | GCA000174775_01615 | gene | open | 49239-50429 | kbl | ||
| 709 | ACLR01000059.1 | GCA000174775_01616 | gene | open | 50573-51784 | |||
| 710 | ACLR01000059.1 | GCA000174775_01617 | gene | open | 52529-53278 | |||
| 711 | ACLR01000059.1 | GCA000174775_01618 | gene | open | 53295-55328 | uvrB | ||
| 712 | ACLR01000059.1 | GCA000174775_01619 | gene | open | 55333-55707 | folB | ||
| 713 | ACLR01000059.1 | GCA000174775_01620 | gene | open | 55733-56971 | |||
| 714 | ACLR01000059.1 | GCA000174775_01621 | gene | open | 57580-58452 | rfbA | ||
| 715 | ACLR01000059.1 | GCA000174775_01622 | gene | open | 58464-59462 | |||
| 716 | ACLR01000059.1 | GCA000174775_01623 | gene | open | 59564-60241 | ompA | ||
| 717 | ACLR01000059.1 | GCA000174775_01624 | gene | open | 60304-61287 | |||
| 718 | ACLR01000059.1 | GCA000174775_01626 | gene | open | 61869-62939 | |||
| 719 | ACLR01000059.1 | GCA000174775_01627 | gene | open | 62984-63532 | |||
| 720 | ACLR01000059.1 | GCA000174775_01628 | gene | open | 63618-64064 | |||
| 721 | ACLR01000059.1 | GCA000174775_01629 | gene | open | 64090-64563 | |||
| 722 | ACLR01000059.1 | GCA000174775_01631 | gene | open | 64870-65091 | |||
| 723 | ACLR01000059.1 | GCA000174775_01625 | gene | open | 61401-61473 | trnF | ||
| 724 | ACLR01000059.1 | GCA000174775_01630 | gene | open | 64700-64774 | trnP | ||
| 725 | ACLR01000059.1 | GCA000174775_01625 | tRNA | open | 61401-61473 | trnF | tRNA-Phe(gaa) | |
| 726 | ACLR01000059.1 | GCA000174775_01630 | tRNA | open | 64700-64774 | trnP | tRNA-Pro(tgg) | |
| 727 | ACLR01000060.1 | GCA000174775_01573 | CDS | open | 54-191 | _na 45_aa | Transposase%2C IS116/IS110/IS902 family | |
| 728 | ACLR01000060.1 | GCA000174775_01573 | gene | open | 54-191 | |||
| 729 | ACLR01000061.1 | GCA000174775_01561 | CDS | open | 888-1772 | _na 294_aa | araC | Transcriptional regulator%2C AraC family |
| 730 | ACLR01000061.1 | GCA000174775_01562 | CDS | open | 2414-2554 | _na 46_aa | hypothetical protein | |
| 731 | ACLR01000061.1 | GCA000174775_01563 | CDS | open | 2969-3169 | _na 66_aa | pspC | PspC domain protein |
| 732 | ACLR01000061.1 | GCA000174775_01564 | CDS | open | 3200-3868 | _na 222_aa | marR | Transcriptional regulator%2C MarR family |
| 733 | ACLR01000061.1 | GCA000174775_01565 | CDS | open | 3904-5715 | _na 603_aa | AMP-binding enzyme | |
| 734 | ACLR01000061.1 | GCA000174775_01566 | CDS | open | 5951-6916 | _na 321_aa | prfB | peptide chain release factor 2 |
| 735 | ACLR01000061.1 | GCA000174775_01567 | CDS | open | 6930-8747 | _na 605_aa | DNA topoisomerase | |
| 736 | ACLR01000061.1 | GCA000174775_01568 | CDS | open | 8772-9416 | _na 214_aa | nth | endonuclease III |
| 737 | ACLR01000061.1 | GCA000174775_01569 | CDS | open | 9431-10456 | _na 341_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 738 | ACLR01000061.1 | GCA000174775_01570 | CDS | open | 10560-10904 | _na 114_aa | Secretion system C-terminal sorting domain-containing protein | |
| 739 | ACLR01000061.1 | GCA000174775_01571 | CDS | open | 11120-11269 | _na 49_aa | hypothetical protein | |
| 740 | ACLR01000061.1 | GCA000174775_01572 | CDS | open | 11710-12300 | _na 196_aa | Leucine Rich Repeat protein | |
| 741 | ACLR01000061.1 | GCA000174775_01561 | gene | open | 888-1772 | araC | ||
| 742 | ACLR01000061.1 | GCA000174775_01562 | gene | open | 2414-2554 | |||
| 743 | ACLR01000061.1 | GCA000174775_01563 | gene | open | 2969-3169 | pspC | ||
| 744 | ACLR01000061.1 | GCA000174775_01564 | gene | open | 3200-3868 | marR | ||
| 745 | ACLR01000061.1 | GCA000174775_01565 | gene | open | 3904-5715 | |||
| 746 | ACLR01000061.1 | GCA000174775_01566 | gene | open | 5951-6916 | prfB | ||
| 747 | ACLR01000061.1 | GCA000174775_01567 | gene | open | 6930-8747 | |||
| 748 | ACLR01000061.1 | GCA000174775_01568 | gene | open | 8772-9416 | nth | ||
| 749 | ACLR01000061.1 | GCA000174775_01569 | gene | open | 9431-10456 | pheS | ||
| 750 | ACLR01000061.1 | GCA000174775_01570 | gene | open | 10560-10904 | |||
| 751 | ACLR01000061.1 | GCA000174775_01571 | gene | open | 11120-11269 | |||
| 752 | ACLR01000061.1 | GCA000174775_01572 | gene | open | 11710-12300 | |||
| 753 | ACLR01000061.1 | GCA000174775_01560 | gene | open | 425-497 | trnK | ||
| 754 | ACLR01000061.1 | GCA000174775_01560 | tRNA | open | 425-497 | trnK | tRNA-Lys(ctt) | |
| 755 | ACLR01000063.1 | GCA000174775_01558 | CDS | open | 68-418 | _na 116_aa | hypothetical protein | |
| 756 | ACLR01000063.1 | GCA000174775_01559 | CDS | open | 411-617 | _na 68_aa | hypothetical protein | |
| 757 | ACLR01000063.1 | GCA000174775_01558 | gene | open | 68-418 | |||
| 758 | ACLR01000063.1 | GCA000174775_01559 | gene | open | 411-617 | |||
| 759 | ACLR01000065.1 | GCA000174775_01557 | CDS | open | 158-262 | _na 34_aa | hypothetical protein | |
| 760 | ACLR01000065.1 | GCA000174775_01557 | gene | open | 158-262 | |||
| 761 | ACLR01000067.1 | GCA000174775_01556 | CDS | open | 12-221 | _na 69_aa | hypothetical protein | |
| 762 | ACLR01000067.1 | GCA000174775_01556 | gene | open | 12-221 | |||
| 763 | ACLR01000069.1 | repeat_region | open | 41548-42328 | CRISPR array with 12 repeats of length 32%2C consensus sequence TCGCACCCCACACGGGGTGCGTGAATTGAAAC and spacer length 35 | |||
| 764 | ACLR01000069.1 | GCA000174775_01512 | CDS | open | 115-1335 | _na 406_aa | purB | adenylosuccinate lyase |
| 765 | ACLR01000069.1 | GCA000174775_01513 | CDS | open | 1508-2926 | _na 472_aa | Pseudouridine synthase | |
| 766 | ACLR01000069.1 | GCA000174775_01514 | CDS | open | 2955-4370 | _na 471_aa | asnS | asparagine--tRNA ligase |
| 767 | ACLR01000069.1 | GCA000174775_01515 | CDS | open | 4453-5766 | _na 437_aa | UPF0597 protein Poras_0072 | |
| 768 | ACLR01000069.1 | GCA000174775_01516 | CDS | open | 5790-6329 | _na 179_aa | Forkhead-associated protein | |
| 769 | ACLR01000069.1 | GCA000174775_01517 | CDS | open | 6818-7990 | _na 390_aa | Putative cytochrome d ubiquinol oxidase%2C subunit II | |
| 770 | ACLR01000069.1 | GCA000174775_01518 | CDS | open | 8019-9650 | _na 543_aa | Bacterial cytochrome ubiquinol oxidase | |
| 771 | ACLR01000069.1 | GCA000174775_01519 | CDS | open | 9668-9949 | _na 93_aa | DUF4492 domain-containing protein | |
| 772 | ACLR01000069.1 | GCA000174775_01520 | CDS | open | 10046-10555 | _na 169_aa | Arginine repressor | |
| 773 | ACLR01000069.1 | GCA000174775_01521 | CDS | open | 10802-11740 | _na 312_aa | Ribose-phosphate pyrophosphokinase | |
| 774 | ACLR01000069.1 | GCA000174775_01522 | CDS | open | 11886-12701 | _na 271_aa | yfiO | Outer membrane assembly lipoprotein YfiO |
| 775 | ACLR01000069.1 | GCA000174775_01523 | CDS | open | 12760-13095 | _na 111_aa | DNA-directed RNA polymerase | |
| 776 | ACLR01000069.1 | GCA000174775_01524 | CDS | open | 13128-13589 | _na 153_aa | DUF4293 domain-containing protein | |
| 777 | ACLR01000069.1 | GCA000174775_01525 | CDS | open | 13654-15156 | _na 500_aa | IMP dehydrogenase | |
| 778 | ACLR01000069.1 | GCA000174775_01526 | CDS | open | 15234-16175 | _na 313_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 779 | ACLR01000069.1 | GCA000174775_01527 | CDS | open | 16188-16820 | _na 210_aa | DUF4294 domain-containing protein | |
| 780 | ACLR01000069.1 | GCA000174775_01528 | CDS | open | 16939-17787 | _na 282_aa | Putative auto-transporter adhesin head GIN domain-containing protein | |
| 781 | ACLR01000069.1 | GCA000174775_01529 | CDS | open | 17806-18177 | _na 123_aa | Septum formation initiator | |
| 782 | ACLR01000069.1 | GCA000174775_01530 | CDS | open | 18221-18598 | _na 125_aa | Tat pathway signal sequence domain protein | |
| 783 | ACLR01000069.1 | GCA000174775_01531 | CDS | open | 18608-19633 | _na 341_aa | RNA pseudouridine synthase | |
| 784 | ACLR01000069.1 | GCA000174775_01532 | CDS | open | 19655-21727 | _na 690_aa | Cytochrome C biogenesis protein transmembrane region | |
| 785 | ACLR01000069.1 | GCA000174775_01533 | CDS | open | 21895-22395 | _na 166_aa | flavodoxin | |
| 786 | ACLR01000069.1 | GCA000174775_01534 | CDS | open | 22450-22809 | _na 119_aa | DUF2023 domain-containing protein | |
| 787 | ACLR01000069.1 | GCA000174775_01535 | CDS | open | 23109-23363 | _na 84_aa | hypothetical protein | |
| 788 | ACLR01000069.1 | GCA000174775_01537 | CDS | open | 23788-24894 | _na 368_aa | N-acetylmuramoyl-L-alanine amidase | |
| 789 | ACLR01000069.1 | GCA000174775_01538 | CDS | open | 24911-25807 | _na 298_aa | Putative virulence factor Mce family protein | |
| 790 | ACLR01000069.1 | GCA000174775_01539 | CDS | open | 25822-26019 | _na 65_aa | hypothetical protein | |
| 791 | ACLR01000069.1 | GCA000174775_01540 | CDS | open | 26035-26565 | _na 176_aa | Chromate transport protein | |
| 792 | ACLR01000069.1 | GCA000174775_01541 | CDS | open | 26578-27180 | _na 200_aa | Chromate transport protein | |
| 793 | ACLR01000069.1 | GCA000174775_01542 | CDS | open | 27177-28526 | _na 449_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 794 | ACLR01000069.1 | GCA000174775_01543 | CDS | open | 28535-29554 | _na 339_aa | Glycosyltransferase%2C group 2 family protein | |
| 795 | ACLR01000069.1 | GCA000174775_01544 | CDS | open | 29737-30108 | _na 123_aa | Transmembrane signal peptide protein | |
| 796 | ACLR01000069.1 | GCA000174775_01545 | CDS | open | 30463-30948 | _na 161_aa | Glutathione peroxidase | |
| 797 | ACLR01000069.1 | GCA000174775_01546 | CDS | open | 30964-31419 | _na 151_aa | NfeD-like C-terminal domain-containing protein | |
| 798 | ACLR01000069.1 | GCA000174775_01547 | CDS | open | 31442-32458 | _na 338_aa | Band 7 protein | |
| 799 | ACLR01000069.1 | GCA000174775_01548 | CDS | open | 32511-33386 | _na 291_aa | fic | protein adenylyltransferase Fic |
| 800 | ACLR01000069.1 | GCA000174775_01549 | CDS | open | 33519-35837 | _na 772_aa | CRISPR-associated endonuclease Cas3-HD | |
| 801 | ACLR01000069.1 | GCA000174775_01550 | CDS | open | 35842-36558 | _na 238_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 802 | ACLR01000069.1 | GCA000174775_01551 | CDS | open | 36555-38402 | _na 615_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 803 | ACLR01000069.1 | GCA000174775_01552 | CDS | open | 38414-39277 | _na 287_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 804 | ACLR01000069.1 | GCA000174775_01553 | CDS | open | 39353-40030 | _na 225_aa | cas4 | CRISPR-associated protein Cas4 |
| 805 | ACLR01000069.1 | GCA000174775_01554 | CDS | open | 40027-41058 | _na 343_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 806 | ACLR01000069.1 | GCA000174775_01555 | CDS | open | 41058-41348 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 807 | ACLR01000069.1 | GCA000174775_01512 | gene | open | 115-1335 | purB | ||
| 808 | ACLR01000069.1 | GCA000174775_01513 | gene | open | 1508-2926 | |||
| 809 | ACLR01000069.1 | GCA000174775_01514 | gene | open | 2955-4370 | asnS | ||
| 810 | ACLR01000069.1 | GCA000174775_01515 | gene | open | 4453-5766 | |||
| 811 | ACLR01000069.1 | GCA000174775_01516 | gene | open | 5790-6329 | |||
| 812 | ACLR01000069.1 | GCA000174775_01517 | gene | open | 6818-7990 | |||
| 813 | ACLR01000069.1 | GCA000174775_01518 | gene | open | 8019-9650 | |||
| 814 | ACLR01000069.1 | GCA000174775_01519 | gene | open | 9668-9949 | |||
| 815 | ACLR01000069.1 | GCA000174775_01520 | gene | open | 10046-10555 | |||
| 816 | ACLR01000069.1 | GCA000174775_01521 | gene | open | 10802-11740 | |||
| 817 | ACLR01000069.1 | GCA000174775_01522 | gene | open | 11886-12701 | yfiO | ||
| 818 | ACLR01000069.1 | GCA000174775_01523 | gene | open | 12760-13095 | |||
| 819 | ACLR01000069.1 | GCA000174775_01524 | gene | open | 13128-13589 | |||
| 820 | ACLR01000069.1 | GCA000174775_01525 | gene | open | 13654-15156 | |||
| 821 | ACLR01000069.1 | GCA000174775_01526 | gene | open | 15234-16175 | miaA | ||
| 822 | ACLR01000069.1 | GCA000174775_01527 | gene | open | 16188-16820 | |||
| 823 | ACLR01000069.1 | GCA000174775_01528 | gene | open | 16939-17787 | |||
| 824 | ACLR01000069.1 | GCA000174775_01529 | gene | open | 17806-18177 | |||
| 825 | ACLR01000069.1 | GCA000174775_01530 | gene | open | 18221-18598 | |||
| 826 | ACLR01000069.1 | GCA000174775_01531 | gene | open | 18608-19633 | |||
| 827 | ACLR01000069.1 | GCA000174775_01532 | gene | open | 19655-21727 | |||
| 828 | ACLR01000069.1 | GCA000174775_01533 | gene | open | 21895-22395 | |||
| 829 | ACLR01000069.1 | GCA000174775_01534 | gene | open | 22450-22809 | |||
| 830 | ACLR01000069.1 | GCA000174775_01535 | gene | open | 23109-23363 | |||
| 831 | ACLR01000069.1 | GCA000174775_01537 | gene | open | 23788-24894 | |||
| 832 | ACLR01000069.1 | GCA000174775_01538 | gene | open | 24911-25807 | |||
| 833 | ACLR01000069.1 | GCA000174775_01539 | gene | open | 25822-26019 | |||
| 834 | ACLR01000069.1 | GCA000174775_01540 | gene | open | 26035-26565 | |||
| 835 | ACLR01000069.1 | GCA000174775_01541 | gene | open | 26578-27180 | |||
| 836 | ACLR01000069.1 | GCA000174775_01542 | gene | open | 27177-28526 | mtaB | ||
| 837 | ACLR01000069.1 | GCA000174775_01543 | gene | open | 28535-29554 | |||
| 838 | ACLR01000069.1 | GCA000174775_01544 | gene | open | 29737-30108 | |||
| 839 | ACLR01000069.1 | GCA000174775_01545 | gene | open | 30463-30948 | |||
| 840 | ACLR01000069.1 | GCA000174775_01546 | gene | open | 30964-31419 | |||
| 841 | ACLR01000069.1 | GCA000174775_01547 | gene | open | 31442-32458 | |||
| 842 | ACLR01000069.1 | GCA000174775_01548 | gene | open | 32511-33386 | fic | ||
| 843 | ACLR01000069.1 | GCA000174775_01549 | gene | open | 33519-35837 | |||
| 844 | ACLR01000069.1 | GCA000174775_01550 | gene | open | 35842-36558 | cas5c | ||
| 845 | ACLR01000069.1 | GCA000174775_01551 | gene | open | 36555-38402 | cas8c | ||
| 846 | ACLR01000069.1 | GCA000174775_01552 | gene | open | 38414-39277 | cas7c | ||
| 847 | ACLR01000069.1 | GCA000174775_01553 | gene | open | 39353-40030 | cas4 | ||
| 848 | ACLR01000069.1 | GCA000174775_01554 | gene | open | 40027-41058 | cas1c | ||
| 849 | ACLR01000069.1 | GCA000174775_01555 | gene | open | 41058-41348 | cas2 | ||
| 850 | ACLR01000069.1 | GCA000174775_01536 | gene | open | 23524-23596 | trnK | ||
| 851 | ACLR01000069.1 | GCA000174775_01536 | tRNA | open | 23524-23596 | trnK | tRNA-Lys(ttt) | |
| 852 | ACLR01000070.1 | GCA000174775_01511 | CDS | open | 341-610 | _na 89_aa | hypothetical protein | |
| 853 | ACLR01000070.1 | GCA000174775_01511 | gene | open | 341-610 | |||
| 854 | ACLR01000071.1 | GCA000174775_01509 | CDS | open | 9-284 | _na 91_aa | traK | Conjugative transposon TraK protein |
| 855 | ACLR01000071.1 | GCA000174775_01510 | CDS | open | 256-459 | _na 67_aa | secE | Preprotein translocase%2C SecE subunit |
| 856 | ACLR01000071.1 | GCA000174775_01509 | gene | open | 9-284 | traK | ||
| 857 | ACLR01000071.1 | GCA000174775_01510 | gene | open | 256-459 | secE | ||
| 858 | ACLR01000074.1 | GCA000174775_01507 | CDS | open | 97-234 | _na 45_aa | Transposase%2C IS116/IS110/IS902 family | |
| 859 | ACLR01000074.1 | GCA000174775_01508 | CDS | open | 501-695 | _na 64_aa | hypothetical protein | |
| 860 | ACLR01000074.1 | GCA000174775_01507 | gene | open | 97-234 | |||
| 861 | ACLR01000074.1 | GCA000174775_01508 | gene | open | 501-695 | |||
| 862 | ACLR01000075.1 | GCA000174775_01506 | CDS | open | 383-517 | _na 44_aa | Arc-like DNA binding domain-containing protein | |
| 863 | ACLR01000075.1 | GCA000174775_01506 | gene | open | 383-517 | |||
| 864 | ACLR01000078.1 | GCA000174775_01505 | CDS | open | 418-588 | _na 56_aa | hypothetical protein | |
| 865 | ACLR01000078.1 | GCA000174775_01505 | gene | open | 418-588 | |||
| 866 | ACLR01000080.1 | repeat_region | open | 42-982 | CRISPR array with 14 repeats of length 33%2C consensus sequence GTCGCACCCCACACGGGGTGCGTGAATTGAAAC and spacer length 34 | |||
| 867 | ACLR01000080.1 | GCA000174775_01504 | CDS | open | 1234-2355 | _na 373_aa | Polysaccharide biosynthesis protein | |
| 868 | ACLR01000080.1 | GCA000174775_01504 | gene | open | 1234-2355 | |||
| 869 | ACLR01000084.1 | GCA000174775_01503 | CDS | open | 320-496 | _na 58_aa | hypothetical protein | |
| 870 | ACLR01000084.1 | GCA000174775_01503 | gene | open | 320-496 | |||
| 871 | ACLR01000087.1 | GCA000174775_01502 | CDS | open | 96-539 | _na 147_aa | Transposase%2C IS116/IS110/IS902 family | |
| 872 | ACLR01000087.1 | GCA000174775_01502 | gene | open | 96-539 | |||
| 873 | ACLR01000088.1 | regulatory_region | open | 68179-68456 | Cobalamin riboswitch aptamer | |||
| 874 | ACLR01000088.1 | GCA000174775_01427 | CDS | open | 134-1813 | _na 559_aa | putative transporter | |
| 875 | ACLR01000088.1 | GCA000174775_01428 | CDS | open | 1817-2620 | _na 267_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 876 | ACLR01000088.1 | GCA000174775_01429 | CDS | open | 2791-4662 | _na 623_aa | mutA | methylmalonyl-CoA mutase small subunit |
| 877 | ACLR01000088.1 | GCA000174775_01430 | CDS | open | 4687-6843 | _na 718_aa | scpA | methylmalonyl-CoA mutase |
| 878 | ACLR01000088.1 | GCA000174775_01431 | CDS | open | 6989-8140 | _na 383_aa | lpxB | lipid-A-disaccharide synthase |
| 879 | ACLR01000088.1 | GCA000174775_01432 | CDS | open | 8162-8926 | _na 254_aa | surE | 5'/3'-nucleotidase SurE |
| 880 | ACLR01000088.1 | GCA000174775_01433 | CDS | open | 8959-9504 | _na 181_aa | Peptidyl-prolyl cis-trans isomerase | |
| 881 | ACLR01000088.1 | GCA000174775_01434 | CDS | open | 9494-11047 | _na 517_aa | glycine--tRNA ligase | |
| 882 | ACLR01000088.1 | GCA000174775_01435 | CDS | open | 11132-11323 | _na 63_aa | hypothetical protein | |
| 883 | ACLR01000088.1 | GCA000174775_01436 | CDS | open | 11748-12935 | _na 395_aa | Cytosine-specific methyltransferase | |
| 884 | ACLR01000088.1 | GCA000174775_01437 | CDS | open | 12932-14767 | _na 611_aa | ATPase dynein-related AAA domain-containing protein | |
| 885 | ACLR01000088.1 | GCA000174775_01438 | CDS | open | 14794-16455 | _na 553_aa | LlaJI restriction endonuclease | |
| 886 | ACLR01000088.1 | GCA000174775_01439 | CDS | open | 16638-17090 | _na 150_aa | Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein | |
| 887 | ACLR01000088.1 | GCA000174775_01440 | CDS | open | 17406-18143 | _na 245_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 888 | ACLR01000088.1 | GCA000174775_01441 | CDS | open | 18157-19701 | _na 514_aa | Response regulator receiver protein | |
| 889 | ACLR01000088.1 | GCA000174775_01442 | CDS | open | 19713-20786 | _na 357_aa | Cytosine-specific methyltransferase | |
| 890 | ACLR01000088.1 | GCA000174775_01443 | CDS | open | 20773-21639 | _na 288_aa | NgoPII restriction endonuclease | |
| 891 | ACLR01000088.1 | GCA000174775_01444 | CDS | open | 21654-22736 | _na 360_aa | GDP-L-fucose synthase | |
| 892 | ACLR01000088.1 | GCA000174775_01445 | CDS | open | 22733-23809 | _na 358_aa | gmd | GDP-mannose 4%2C6-dehydratase |
| 893 | ACLR01000088.1 | GCA000174775_01446 | CDS | open | 23927-24037 | _na 36_aa | hypothetical protein | |
| 894 | ACLR01000088.1 | GCA000174775_01447 | CDS | open | 24201-26117 | _na 638_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 895 | ACLR01000088.1 | GCA000174775_01448 | CDS | open | 26145-27953 | _na 602_aa | uvrC | excinuclease ABC subunit UvrC |
| 896 | ACLR01000088.1 | GCA000174775_01449 | CDS | open | 27966-28418 | _na 150_aa | dtd | D-aminoacyl-tRNA deacylase |
| 897 | ACLR01000088.1 | GCA000174775_01450 | CDS | open | 28418-28792 | _na 124_aa | mazG | MazG nucleotide pyrophosphohydrolase |
| 898 | ACLR01000088.1 | GCA000174775_01451 | CDS | open | 28817-29683 | _na 288_aa | deoC | deoxyribose-phosphate aldolase |
| 899 | ACLR01000088.1 | GCA000174775_01452 | CDS | open | 29833-30621 | _na 262_aa | DegT/DnrJ/EryC1/StrS aminotransferase family protein | |
| 900 | ACLR01000088.1 | GCA000174775_01453 | CDS | open | 30614-30988 | _na 124_aa | hypothetical protein | |
| 901 | ACLR01000088.1 | GCA000174775_01454 | CDS | open | 31174-32586 | _na 470_aa | peptide chain release factor 3 | |
| 902 | ACLR01000088.1 | GCA000174775_01455 | CDS | open | 32877-35261 | _na 794_aa | TonB-dependent receptor | |
| 903 | ACLR01000088.1 | GCA000174775_01456 | CDS | open | 35301-36512 | _na 403_aa | Lipoprotein | |
| 904 | ACLR01000088.1 | GCA000174775_01457 | CDS | open | 36520-36924 | _na 134_aa | doxX | DoxX family protein |
| 905 | ACLR01000088.1 | GCA000174775_01458 | CDS | open | 37238-40213 | _na 991_aa | Leucine Rich Repeat protein | |
| 906 | ACLR01000088.1 | GCA000174775_01459 | CDS | open | 40473-41378 | _na 301_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 907 | ACLR01000088.1 | GCA000174775_01460 | CDS | open | 41434-42585 | _na 383_aa | Glycosyltransferase%2C group 1 family protein | |
| 908 | ACLR01000088.1 | GCA000174775_01461 | CDS | open | 42601-43101 | _na 166_aa | S4 domain protein | |
| 909 | ACLR01000088.1 | GCA000174775_01462 | CDS | open | 43109-43669 | _na 186_aa | pth | aminoacyl-tRNA hydrolase |
| 910 | ACLR01000088.1 | GCA000174775_01463 | CDS | open | 43726-44352 | _na 208_aa | NlpC/P60 family protein | |
| 911 | ACLR01000088.1 | GCA000174775_01464 | CDS | open | 44990-45184 | _na 64_aa | hypothetical protein | |
| 912 | ACLR01000088.1 | GCA000174775_01465 | CDS | open | 45200-46879 | _na 559_aa | Putative internalin-J | |
| 913 | ACLR01000088.1 | GCA000174775_01466 | CDS | open | 46972-48087 | _na 371_aa | ABC-2 type transporter | |
| 914 | ACLR01000088.1 | GCA000174775_01467 | CDS | open | 48105-49241 | _na 378_aa | ABC-2 type transporter | |
| 915 | ACLR01000088.1 | GCA000174775_01468 | CDS | open | 49356-49913 | _na 185_aa | DJ-1 family glyoxalase III | |
| 916 | ACLR01000088.1 | GCA000174775_01469 | CDS | open | 49974-50759 | _na 261_aa | tonB | TonB family domain protein |
| 917 | ACLR01000088.1 | GCA000174775_01470 | CDS | open | 50752-51150 | _na 132_aa | Biopolymer transport protein ExbD/TolR | |
| 918 | ACLR01000088.1 | GCA000174775_01471 | CDS | open | 51234-51908 | _na 224_aa | MotA/TolQ/ExbB proton channel | |
| 919 | ACLR01000088.1 | GCA000174775_01472 | CDS | open | 51932-52660 | _na 242_aa | pyridoxine 5'-phosphate synthase | |
| 920 | ACLR01000088.1 | GCA000174775_01473 | CDS | open | 52724-52957 | _na 77_aa | hypothetical protein | |
| 921 | ACLR01000088.1 | GCA000174775_01474 | CDS | open | 53079-54293 | _na 404_aa | Phosphate-selective porin O and P | |
| 922 | ACLR01000088.1 | GCA000174775_01475 | CDS | open | 54684-56033 | _na 449_aa | MATE efflux family protein | |
| 923 | ACLR01000088.1 | GCA000174775_01476 | CDS | open | 56035-56937 | _na 300_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 924 | ACLR01000088.1 | GCA000174775_01477 | CDS | open | 56934-57512 | _na 192_aa | DUF4924 domain-containing protein | |
| 925 | ACLR01000088.1 | GCA000174775_01478 | CDS | open | 57523-58731 | _na 402_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 926 | ACLR01000088.1 | GCA000174775_01479 | CDS | open | 58754-59089 | _na 111_aa | rbfA | 30S ribosome-binding factor RbfA |
| 927 | ACLR01000088.1 | GCA000174775_01480 | CDS | open | 59698-61863 | _na 721_aa | Repeat protein | |
| 928 | ACLR01000088.1 | GCA000174775_01481 | CDS | open | 62218-63576 | _na 452_aa | Acetaldehyde dehydrogenase (Acetylating) | |
| 929 | ACLR01000088.1 | GCA000174775_01482 | CDS | open | 63618-64733 | _na 371_aa | 4-hydroxybutyrate dehydrogenase | |
| 930 | ACLR01000088.1 | GCA000174775_01483 | CDS | open | 64749-66035 | _na 428_aa | 4-hydroxybutyrate coenzyme A transferase | |
| 931 | ACLR01000088.1 | GCA000174775_01484 | CDS | open | 66148-66441 | _na 97_aa | nifU | Nitrogen-fixing NifU domain-containing protein |
| 932 | ACLR01000088.1 | GCA000174775_01485 | CDS | open | 66454-67929 | _na 491_aa | Gamma-aminobutyrate metabolism dehydratase/isomerase | |
| 933 | ACLR01000088.1 | GCA000174775_01487 | CDS | open | 68843-69091 | _na 82_aa | hypothetical protein | |
| 934 | ACLR01000088.1 | GCA000174775_01488 | CDS | open | 69241-70236 | _na 331_aa | trpS | tryptophan--tRNA ligase |
| 935 | ACLR01000088.1 | GCA000174775_01489 | CDS | open | 70282-70755 | _na 157_aa | DUF3127 domain-containing protein | |
| 936 | ACLR01000088.1 | GCA000174775_01490 | CDS | open | 70775-71254 | _na 159_aa | Ribosomal RNA large subunit methyltransferase H | |
| 937 | ACLR01000088.1 | GCA000174775_01491 | CDS | open | 71268-71621 | _na 117_aa | PAS fold-4 domain-containing protein | |
| 938 | ACLR01000088.1 | GCA000174775_01492 | CDS | open | 71624-71848 | _na 74_aa | hypothetical protein | |
| 939 | ACLR01000088.1 | GCA000174775_01493 | CDS | open | 71870-72805 | _na 311_aa | Putative mannose-6-phosphate isomerase%2C class I | |
| 940 | ACLR01000088.1 | GCA000174775_01494 | CDS | open | 72802-73413 | _na 203_aa | DUF3109 domain-containing protein | |
| 941 | ACLR01000088.1 | GCA000174775_01495 | CDS | open | 73431-74804 | _na 457_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 942 | ACLR01000088.1 | GCA000174775_01496 | CDS | open | 74791-76050 | _na 419_aa | GDSL-like protein | |
| 943 | ACLR01000088.1 | GCA000174775_01497 | CDS | open | 75995-77581 | _na 528_aa | MBOAT family protein | |
| 944 | ACLR01000088.1 | GCA000174775_01498 | CDS | open | 77963-80341 | _na 792_aa | Peptidase S1 domain-containing protein | |
| 945 | ACLR01000088.1 | GCA000174775_01499 | CDS | open | 80380-81222 | _na 280_aa | fumarate hydratase | |
| 946 | ACLR01000088.1 | GCA000174775_01500 | CDS | open | 81234-81791 | _na 185_aa | Fe-S-containing hydro-lyase | |
| 947 | ACLR01000088.1 | GCA000174775_01501 | CDS | open | 81934-82068 | _na 44_aa | hypothetical protein | |
| 948 | ACLR01000088.1 | GCA000174775_01427 | gene | open | 134-1813 | |||
| 949 | ACLR01000088.1 | GCA000174775_01428 | gene | open | 1817-2620 | lptB | ||
| 950 | ACLR01000088.1 | GCA000174775_01429 | gene | open | 2791-4662 | mutA | ||
| 951 | ACLR01000088.1 | GCA000174775_01430 | gene | open | 4687-6843 | scpA | ||
| 952 | ACLR01000088.1 | GCA000174775_01431 | gene | open | 6989-8140 | lpxB | ||
| 953 | ACLR01000088.1 | GCA000174775_01432 | gene | open | 8162-8926 | surE | ||
| 954 | ACLR01000088.1 | GCA000174775_01433 | gene | open | 8959-9504 | |||
| 955 | ACLR01000088.1 | GCA000174775_01434 | gene | open | 9494-11047 | |||
| 956 | ACLR01000088.1 | GCA000174775_01435 | gene | open | 11132-11323 | |||
| 957 | ACLR01000088.1 | GCA000174775_01436 | gene | open | 11748-12935 | |||
| 958 | ACLR01000088.1 | GCA000174775_01437 | gene | open | 12932-14767 | |||
| 959 | ACLR01000088.1 | GCA000174775_01438 | gene | open | 14794-16455 | |||
| 960 | ACLR01000088.1 | GCA000174775_01439 | gene | open | 16638-17090 | |||
| 961 | ACLR01000088.1 | GCA000174775_01440 | gene | open | 17406-18143 | tsaE | ||
| 962 | ACLR01000088.1 | GCA000174775_01441 | gene | open | 18157-19701 | |||
| 963 | ACLR01000088.1 | GCA000174775_01442 | gene | open | 19713-20786 | |||
| 964 | ACLR01000088.1 | GCA000174775_01443 | gene | open | 20773-21639 | |||
| 965 | ACLR01000088.1 | GCA000174775_01444 | gene | open | 21654-22736 | |||
| 966 | ACLR01000088.1 | GCA000174775_01445 | gene | open | 22733-23809 | gmd | ||
| 967 | ACLR01000088.1 | GCA000174775_01446 | gene | open | 23927-24037 | |||
| 968 | ACLR01000088.1 | GCA000174775_01447 | gene | open | 24201-26117 | mnmG | ||
| 969 | ACLR01000088.1 | GCA000174775_01448 | gene | open | 26145-27953 | uvrC | ||
| 970 | ACLR01000088.1 | GCA000174775_01449 | gene | open | 27966-28418 | dtd | ||
| 971 | ACLR01000088.1 | GCA000174775_01450 | gene | open | 28418-28792 | mazG | ||
| 972 | ACLR01000088.1 | GCA000174775_01451 | gene | open | 28817-29683 | deoC | ||
| 973 | ACLR01000088.1 | GCA000174775_01452 | gene | open | 29833-30621 | |||
| 974 | ACLR01000088.1 | GCA000174775_01453 | gene | open | 30614-30988 | |||
| 975 | ACLR01000088.1 | GCA000174775_01454 | gene | open | 31174-32586 | |||
| 976 | ACLR01000088.1 | GCA000174775_01455 | gene | open | 32877-35261 | |||
| 977 | ACLR01000088.1 | GCA000174775_01456 | gene | open | 35301-36512 | |||
| 978 | ACLR01000088.1 | GCA000174775_01457 | gene | open | 36520-36924 | doxX | ||
| 979 | ACLR01000088.1 | GCA000174775_01458 | gene | open | 37238-40213 | |||
| 980 | ACLR01000088.1 | GCA000174775_01459 | gene | open | 40473-41378 | |||
| 981 | ACLR01000088.1 | GCA000174775_01460 | gene | open | 41434-42585 | |||
| 982 | ACLR01000088.1 | GCA000174775_01461 | gene | open | 42601-43101 | |||
| 983 | ACLR01000088.1 | GCA000174775_01462 | gene | open | 43109-43669 | pth | ||
| 984 | ACLR01000088.1 | GCA000174775_01463 | gene | open | 43726-44352 | |||
| 985 | ACLR01000088.1 | GCA000174775_01464 | gene | open | 44990-45184 | |||
| 986 | ACLR01000088.1 | GCA000174775_01465 | gene | open | 45200-46879 | |||
| 987 | ACLR01000088.1 | GCA000174775_01466 | gene | open | 46972-48087 | |||
| 988 | ACLR01000088.1 | GCA000174775_01467 | gene | open | 48105-49241 | |||
| 989 | ACLR01000088.1 | GCA000174775_01468 | gene | open | 49356-49913 | |||
| 990 | ACLR01000088.1 | GCA000174775_01469 | gene | open | 49974-50759 | tonB | ||
| 991 | ACLR01000088.1 | GCA000174775_01470 | gene | open | 50752-51150 | |||
| 992 | ACLR01000088.1 | GCA000174775_01471 | gene | open | 51234-51908 | |||
| 993 | ACLR01000088.1 | GCA000174775_01472 | gene | open | 51932-52660 | |||
| 994 | ACLR01000088.1 | GCA000174775_01473 | gene | open | 52724-52957 | |||
| 995 | ACLR01000088.1 | GCA000174775_01474 | gene | open | 53079-54293 | |||
| 996 | ACLR01000088.1 | GCA000174775_01475 | gene | open | 54684-56033 | |||
| 997 | ACLR01000088.1 | GCA000174775_01476 | gene | open | 56035-56937 | rfbD | ||
| 998 | ACLR01000088.1 | GCA000174775_01477 | gene | open | 56934-57512 | |||
| 999 | ACLR01000088.1 | GCA000174775_01478 | gene | open | 57523-58731 | |||
| 1000 | ACLR01000088.1 | GCA000174775_01479 | gene | open | 58754-59089 | rbfA |

