BAKTAGenome Explorer: Neisseria lactamica (GCA_000180595.1)
Select a Genome:
|
BAKTA Annotations for GCA_000180595.1
|
Search & Sort all 3926 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CACL01000024.1 | GCA000180595_00222 | gene | open | 14322-15914 | |||
| 3502 | CACL01000024.1 | GCA000180595_00223 | gene | open | 15907-17424 | |||
| 3503 | CACL01000024.1 | GCA000180595_00224 | gene | open | 17529-18281 | rsmJ | ||
| 3504 | CACL01000024.1 | GCA000180595_00225 | gene | open | 19026-19232 | |||
| 3505 | CACL01000024.1 | GCA000180595_00226 | gene | open | 19318-20487 | metZ | ||
| 3506 | CACL01000024.1 | GCA000180595_00227 | gene | open | 20632-21402 | |||
| 3507 | CACL01000024.1 | GCA000180595_00228 | gene | open | 21502-21753 | |||
| 3508 | CACL01000024.1 | GCA000180595_00229 | gene | open | 21805-22611 | hisJ | ||
| 3509 | CACL01000024.1 | GCA000180595_00230 | gene | open | 23599-24144 | |||
| 3510 | CACL01000025.1 | GCA000180595_00184 | CDS | open | 9-308 | _na 99_aa | hypothetical protein | |
| 3511 | CACL01000025.1 | GCA000180595_00185 | CDS | open | 697-1131 | _na 144_aa | hypothetical protein | |
| 3512 | CACL01000025.1 | GCA000180595_00186 | CDS | open | 2017-2541 | _na 174_aa | ssb | Single-stranded DNA-binding protein |
| 3513 | CACL01000025.1 | GCA000180595_00187 | CDS | open | 2545-3930 | _na 461_aa | araJ | Drug resistance translocase family protein |
| 3514 | CACL01000025.1 | GCA000180595_00188 | CDS | open | 4038-4661 | _na 207_aa | mltE | Transglycosylase |
| 3515 | CACL01000025.1 | GCA000180595_00189 | CDS | open | 4868-5236 | _na 122_aa | HTH cro/C1-type domain-containing protein | |
| 3516 | CACL01000025.1 | GCA000180595_00190 | CDS | open | 5396-5596 | _na 66_aa | Lipoprotein | |
| 3517 | CACL01000025.1 | GCA000180595_00191 | CDS | open | 5977-6258 | _na 93_aa | factor H binding protein domain-containing protein | |
| 3518 | CACL01000025.1 | GCA000180595_00192 | CDS | open | 6372-8021 | _na 549_aa | Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein | |
| 3519 | CACL01000025.1 | GCA000180595_00193 | CDS | open | 8184-9692 | _na 502_aa | ppx | exopolyphosphatase |
| 3520 | CACL01000025.1 | GCA000180595_00194 | CDS | open | 9901-10245 | _na 114_aa | Ag473 family lipoprotein | |
| 3521 | CACL01000025.1 | GCA000180595_00195 | CDS | open | 10563-11108 | _na 181_aa | Lipoprotein | |
| 3522 | CACL01000025.1 | GCA000180595_00196 | CDS | open | 11189-12199 | _na 336_aa | trpS | tryptophan--tRNA ligase |
| 3523 | CACL01000025.1 | GCA000180595_00197 | CDS | open | 12460-15033 | _na 857_aa | clpB | ATP-dependent chaperone ClpB |
| 3524 | CACL01000025.1 | GCA000180595_00198 | CDS | open | 15105-16319 | _na 404_aa | aspB | Putative 8-amino-7-oxononanoate synthase |
| 3525 | CACL01000025.1 | GCA000180595_00199 | CDS | open | 16408-16617 | _na 69_aa | pptA | Tautomerase |
| 3526 | CACL01000025.1 | GCA000180595_00200 | CDS | open | 16968-17456 | _na 162_aa | Glutamate dehydrogenase | |
| 3527 | CACL01000025.1 | GCA000180595_00201 | CDS | open | 17552-18238 | _na 228_aa | gdhA | Glutamate dehydrogenase |
| 3528 | CACL01000025.1 | GCA000180595_00202 | CDS | open | 18635-19342 | _na 235_aa | gph | phosphoglycolate phosphatase |
| 3529 | CACL01000025.1 | GCA000180595_00203 | CDS | open | 19399-19860 | _na 153_aa | recX | recombination regulator RecX |
| 3530 | CACL01000025.1 | GCA000180595_00204 | CDS | open | 19934-20095 | _na 53_aa | Cytochrome c oxidase subunit 2A | |
| 3531 | CACL01000025.1 | GCA000180595_00205 | CDS | open | 20248-20730 | _na 160_aa | yciA | Acyl-CoA hydrolase |
| 3532 | CACL01000025.1 | GCA000180595_00206 | CDS | open | 21129-22169 | _na 346_aa | Peptidase | |
| 3533 | CACL01000025.1 | GCA000180595_00207 | CDS | open | 22272-23018 | _na 248_aa | surE | 5'/3'-nucleotidase SurE |
| 3534 | CACL01000025.1 | GCA000180595_00208 | CDS | open | 23035-23586 | _na 183_aa | terC | Membrane protein%2C TerC family/CBS domain/transporter associated domain protein |
| 3535 | CACL01000025.1 | GCA000180595_00184 | gene | open | 9-308 | |||
| 3536 | CACL01000025.1 | GCA000180595_00185 | gene | open | 697-1131 | |||
| 3537 | CACL01000025.1 | GCA000180595_00186 | gene | open | 2017-2541 | ssb | ||
| 3538 | CACL01000025.1 | GCA000180595_00187 | gene | open | 2545-3930 | araJ | ||
| 3539 | CACL01000025.1 | GCA000180595_00188 | gene | open | 4038-4661 | mltE | ||
| 3540 | CACL01000025.1 | GCA000180595_00189 | gene | open | 4868-5236 | |||
| 3541 | CACL01000025.1 | GCA000180595_00190 | gene | open | 5396-5596 | |||
| 3542 | CACL01000025.1 | GCA000180595_00191 | gene | open | 5977-6258 | |||
| 3543 | CACL01000025.1 | GCA000180595_00192 | gene | open | 6372-8021 | |||
| 3544 | CACL01000025.1 | GCA000180595_00193 | gene | open | 8184-9692 | ppx | ||
| 3545 | CACL01000025.1 | GCA000180595_00194 | gene | open | 9901-10245 | |||
| 3546 | CACL01000025.1 | GCA000180595_00195 | gene | open | 10563-11108 | |||
| 3547 | CACL01000025.1 | GCA000180595_00196 | gene | open | 11189-12199 | trpS | ||
| 3548 | CACL01000025.1 | GCA000180595_00197 | gene | open | 12460-15033 | clpB | ||
| 3549 | CACL01000025.1 | GCA000180595_00198 | gene | open | 15105-16319 | aspB | ||
| 3550 | CACL01000025.1 | GCA000180595_00199 | gene | open | 16408-16617 | pptA | ||
| 3551 | CACL01000025.1 | GCA000180595_00200 | gene | open | 16968-17456 | |||
| 3552 | CACL01000025.1 | GCA000180595_00201 | gene | open | 17552-18238 | gdhA | ||
| 3553 | CACL01000025.1 | GCA000180595_00202 | gene | open | 18635-19342 | gph | ||
| 3554 | CACL01000025.1 | GCA000180595_00203 | gene | open | 19399-19860 | recX | ||
| 3555 | CACL01000025.1 | GCA000180595_00204 | gene | open | 19934-20095 | |||
| 3556 | CACL01000025.1 | GCA000180595_00205 | gene | open | 20248-20730 | yciA | ||
| 3557 | CACL01000025.1 | GCA000180595_00206 | gene | open | 21129-22169 | |||
| 3558 | CACL01000025.1 | GCA000180595_00207 | gene | open | 22272-23018 | surE | ||
| 3559 | CACL01000025.1 | GCA000180595_00208 | gene | open | 23035-23586 | terC | ||
| 3560 | CACL01000026.1 | GCA000180595_00179 | gene | open | 14211-14272 | porB | ||
| 3561 | CACL01000026.1 | GCA000180595_00179 | ncRNA | open | 14211-14272 | porB | porB RNA | |
| 3562 | CACL01000026.1 | GCA000180595_00164 | CDS | open | 61-561 | _na 166_aa | ABC transporter permease%2C enterobactin | |
| 3563 | CACL01000026.1 | GCA000180595_00165 | CDS | open | 718-1797 | _na 359_aa | apbC | iron-sulfur cluster carrier protein ApbC |
| 3564 | CACL01000026.1 | GCA000180595_00167 | CDS | open | 2118-2339 | _na 73_aa | hypothetical protein | |
| 3565 | CACL01000026.1 | GCA000180595_00168 | CDS | open | 2978-3418 | _na 146_aa | hpaR | homoprotocatechuate degradation operon regulator HpaR |
| 3566 | CACL01000026.1 | GCA000180595_00169 | CDS | open | 3533-4033 | _na 166_aa | hpaC | 4-hydroxyphenylacetate 3-monooxygenase%2C reductase component |
| 3567 | CACL01000026.1 | GCA000180595_00170 | CDS | open | 4051-4746 | _na 231_aa | murU | N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU |
| 3568 | CACL01000026.1 | GCA000180595_00171 | CDS | open | 4780-5211 | _na 143_aa | ribN | EamA domain-containing protein |
| 3569 | CACL01000026.1 | GCA000180595_00172 | CDS | open | 5386-7062 | _na 558_aa | fhs | formate--tetrahydrofolate ligase |
| 3570 | CACL01000026.1 | GCA000180595_00173 | CDS | open | 7122-8171 | _na 349_aa | Bestrophin | |
| 3571 | CACL01000026.1 | GCA000180595_00174 | CDS | open | 8248-9339 | _na 363_aa | ychF | redox-regulated ATPase YchF |
| 3572 | CACL01000026.1 | GCA000180595_00175 | CDS | open | 9376-9801 | _na 141_aa | hypothetical protein | |
| 3573 | CACL01000026.1 | GCA000180595_00176 | CDS | open | 9855-11480 | _na 541_aa | LipO-oligosaccharide acyltransferase | |
| 3574 | CACL01000026.1 | GCA000180595_00177 | CDS | open | 11542-12837 | _na 431_aa | tyrS | tyrosine--tRNA ligase |
| 3575 | CACL01000026.1 | GCA000180595_00178 | CDS | open | 13181-13984 | _na 267_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 3576 | CACL01000026.1 | GCA000180595_00180 | CDS | open | 14323-15336 | _na 337_aa | porB | trimeric porin PorB |
| 3577 | CACL01000026.1 | GCA000180595_00181 | CDS | open | 15957-16706 | _na 249_aa | Opa protein | |
| 3578 | CACL01000026.1 | GCA000180595_00182 | CDS | open | 17115-18035 | _na 306_aa | ribF | bifunctional riboflavin kinase/FAD synthetase |
| 3579 | CACL01000026.1 | GCA000180595_00183 | CDS | open | 18177-20966 | _na 929_aa | ileS | isoleucine--tRNA ligase |
| 3580 | CACL01000026.1 | GCA000180595_00164 | gene | open | 61-561 | |||
| 3581 | CACL01000026.1 | GCA000180595_00165 | gene | open | 718-1797 | apbC | ||
| 3582 | CACL01000026.1 | GCA000180595_00167 | gene | open | 2118-2339 | |||
| 3583 | CACL01000026.1 | GCA000180595_00168 | gene | open | 2978-3418 | hpaR | ||
| 3584 | CACL01000026.1 | GCA000180595_00169 | gene | open | 3533-4033 | hpaC | ||
| 3585 | CACL01000026.1 | GCA000180595_00170 | gene | open | 4051-4746 | murU | ||
| 3586 | CACL01000026.1 | GCA000180595_00171 | gene | open | 4780-5211 | ribN | ||
| 3587 | CACL01000026.1 | GCA000180595_00172 | gene | open | 5386-7062 | fhs | ||
| 3588 | CACL01000026.1 | GCA000180595_00173 | gene | open | 7122-8171 | |||
| 3589 | CACL01000026.1 | GCA000180595_00174 | gene | open | 8248-9339 | ychF | ||
| 3590 | CACL01000026.1 | GCA000180595_00175 | gene | open | 9376-9801 | |||
| 3591 | CACL01000026.1 | GCA000180595_00176 | gene | open | 9855-11480 | |||
| 3592 | CACL01000026.1 | GCA000180595_00177 | gene | open | 11542-12837 | tyrS | ||
| 3593 | CACL01000026.1 | GCA000180595_00178 | gene | open | 13181-13984 | truA | ||
| 3594 | CACL01000026.1 | GCA000180595_00180 | gene | open | 14323-15336 | porB | ||
| 3595 | CACL01000026.1 | GCA000180595_00181 | gene | open | 15957-16706 | |||
| 3596 | CACL01000026.1 | GCA000180595_00182 | gene | open | 17115-18035 | ribF | ||
| 3597 | CACL01000026.1 | GCA000180595_00183 | gene | open | 18177-20966 | ileS | ||
| 3598 | CACL01000026.1 | GCA000180595_00166 | gene | open | 2007-2082 | trnK | ||
| 3599 | CACL01000026.1 | GCA000180595_00166 | tRNA | open | 2007-2082 | trnK | tRNA-Lys(ttt) | |
| 3600 | CACL01000027.1 | GCA000180595_00144 | CDS | open | 422-1654 | _na 410_aa | araJ | Bcr/CflA family efflux transporter |
| 3601 | CACL01000027.1 | GCA000180595_00145 | CDS | open | 1730-2818 | _na 362_aa | pheA | prephenate dehydratase |
| 3602 | CACL01000027.1 | GCA000180595_00146 | CDS | open | 2855-3646 | _na 263_aa | recO | DNA repair protein RecO |
| 3603 | CACL01000027.1 | GCA000180595_00147 | CDS | open | 3670-4398 | _na 242_aa | pdxJ | pyridoxine 5'-phosphate synthase |
| 3604 | CACL01000027.1 | GCA000180595_00148 | CDS | open | 4447-4824 | _na 125_aa | acpS | Holo-[acyl-carrier-protein] synthase |
| 3605 | CACL01000027.1 | GCA000180595_00149 | CDS | open | 4868-5710 | _na 280_aa | 8-oxo-dGTP diphosphatase | |
| 3606 | CACL01000027.1 | GCA000180595_00150 | CDS | open | 5703-6125 | _na 140_aa | Secreted protein | |
| 3607 | CACL01000027.1 | GCA000180595_00151 | CDS | open | 6174-7316 | _na 380_aa | rlmL | Ribosomal RNA large subunit methyltransferase L |
| 3608 | CACL01000027.1 | GCA000180595_00152 | CDS | open | 7374-8624 | _na 416_aa | amiC | N-acetylmuramoyl-L-alanine amidase AmiC |
| 3609 | CACL01000027.1 | GCA000180595_00153 | CDS | open | 8621-9082 | _na 153_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 3610 | CACL01000027.1 | GCA000180595_00154 | CDS | open | 9269-10081 | _na 270_aa | murI | glutamate racemase |
| 3611 | CACL01000027.1 | GCA000180595_00155 | CDS | open | 10839-11795 | _na 318_aa | tnp | IS110 family ISNgo3 transposase |
| 3612 | CACL01000027.1 | GCA000180595_00156 | CDS | open | 12010-13197 | _na 395_aa | zot | Zona occludens toxin N-terminal domain-containing protein |
| 3613 | CACL01000027.1 | GCA000180595_00157 | CDS | open | 13198-13482 | _na 94_aa | DUF2523 domain-containing protein | |
| 3614 | CACL01000027.1 | GCA000180595_00158 | CDS | open | 13526-14011 | _na 161_aa | hypothetical protein | |
| 3615 | CACL01000027.1 | GCA000180595_00159 | CDS | open | 13934-15367 | _na 477_aa | tspB | T cell/B cell stimulating protein TspB |
| 3616 | CACL01000027.1 | GCA000180595_00160 | CDS | open | 15408-15698 | _na 96_aa | hypothetical protein | |
| 3617 | CACL01000027.1 | GCA000180595_00161 | CDS | open | 15817-16116 | _na 99_aa | Inner membrane protein | |
| 3618 | CACL01000027.1 | GCA000180595_00162 | CDS | open | 16144-16374 | _na 76_aa | Periplasmic protein | |
| 3619 | CACL01000027.1 | GCA000180595_00163 | CDS | open | 16612-16812 | _na 66_aa | Phage associated protein | |
| 3620 | CACL01000027.1 | GCA000180595_00144 | gene | open | 422-1654 | araJ | ||
| 3621 | CACL01000027.1 | GCA000180595_00145 | gene | open | 1730-2818 | pheA | ||
| 3622 | CACL01000027.1 | GCA000180595_00146 | gene | open | 2855-3646 | recO | ||
| 3623 | CACL01000027.1 | GCA000180595_00147 | gene | open | 3670-4398 | pdxJ | ||
| 3624 | CACL01000027.1 | GCA000180595_00148 | gene | open | 4447-4824 | acpS | ||
| 3625 | CACL01000027.1 | GCA000180595_00149 | gene | open | 4868-5710 | |||
| 3626 | CACL01000027.1 | GCA000180595_00150 | gene | open | 5703-6125 | |||
| 3627 | CACL01000027.1 | GCA000180595_00151 | gene | open | 6174-7316 | rlmL | ||
| 3628 | CACL01000027.1 | GCA000180595_00152 | gene | open | 7374-8624 | amiC | ||
| 3629 | CACL01000027.1 | GCA000180595_00153 | gene | open | 8621-9082 | tsaE | ||
| 3630 | CACL01000027.1 | GCA000180595_00154 | gene | open | 9269-10081 | murI | ||
| 3631 | CACL01000027.1 | GCA000180595_00155 | gene | open | 10839-11795 | tnp | ||
| 3632 | CACL01000027.1 | GCA000180595_00156 | gene | open | 12010-13197 | zot | ||
| 3633 | CACL01000027.1 | GCA000180595_00157 | gene | open | 13198-13482 | |||
| 3634 | CACL01000027.1 | GCA000180595_00158 | gene | open | 13526-14011 | |||
| 3635 | CACL01000027.1 | GCA000180595_00159 | gene | open | 13934-15367 | tspB | ||
| 3636 | CACL01000027.1 | GCA000180595_00160 | gene | open | 15408-15698 | |||
| 3637 | CACL01000027.1 | GCA000180595_00161 | gene | open | 15817-16116 | |||
| 3638 | CACL01000027.1 | GCA000180595_00162 | gene | open | 16144-16374 | |||
| 3639 | CACL01000027.1 | GCA000180595_00163 | gene | open | 16612-16812 | |||
| 3640 | CACL01000028.1 | GCA000180595_00124 | gene | open | 1-551 | rrs | ||
| 3641 | CACL01000028.1 | GCA000180595_00124 | rRNA | open | 1-551 | rrs | 16S ribosomal RNA | |
| 3642 | CACL01000028.1 | GCA000180595_00125 | CDS | open | 1134-2597 | _na 487_aa | Hep/Hag repeat protein | |
| 3643 | CACL01000028.1 | GCA000180595_00126 | CDS | open | 2732-3244 | _na 170_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 3644 | CACL01000028.1 | GCA000180595_00127 | CDS | open | 3472-4155 | _na 227_aa | ybhL | putative protein NMB2020 |
| 3645 | CACL01000028.1 | GCA000180595_00128 | CDS | open | 4313-4579 | _na 88_aa | yggX | oxidative damage protection protein |
| 3646 | CACL01000028.1 | GCA000180595_00129 | CDS | open | 4654-5160 | _na 168_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 3647 | CACL01000028.1 | GCA000180595_00130 | CDS | open | 5178-5564 | _na 128_aa | rsfS | ribosome silencing factor |
| 3648 | CACL01000028.1 | GCA000180595_00131 | CDS | open | 5665-6264 | _na 199_aa | hypothetical protein | |
| 3649 | CACL01000028.1 | GCA000180595_00132 | CDS | open | 6286-6897 | _na 203_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 3650 | CACL01000028.1 | GCA000180595_00133 | CDS | open | 6894-7481 | _na 195_aa | Carbonic anhydrase | |
| 3651 | CACL01000028.1 | GCA000180595_00134 | CDS | open | 7510-9051 | _na 513_aa | fbpB | Putative transporter |
| 3652 | CACL01000028.1 | GCA000180595_00135 | CDS | open | 9277-10200 | _na 307_aa | thrB | homoserine kinase |
| 3653 | CACL01000028.1 | GCA000180595_00136 | CDS | open | 10230-10946 | _na 238_aa | ubiG | bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG |
| 3654 | CACL01000028.1 | GCA000180595_00137 | CDS | open | 11006-12352 | _na 448_aa | sdaC | Aromatic amino acid permease |
| 3655 | CACL01000028.1 | GCA000180595_00138 | CDS | open | 12505-13077 | _na 190_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 3656 | CACL01000028.1 | GCA000180595_00139 | CDS | open | 13121-13558 | _na 145_aa | rfaB | Glycosyltransferase involved in cell wall bisynthesis |
| 3657 | CACL01000028.1 | GCA000180595_00140 | CDS | open | 13785-14348 | _na 187_aa | gmhB | D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase |
| 3658 | CACL01000028.1 | GCA000180595_00141 | CDS | open | 14379-15122 | _na 247_aa | plsC | 1-acyl-SN-glycerol-3-phosphate acyltransferase |
| 3659 | CACL01000028.1 | GCA000180595_00142 | CDS | open | 15119-15808 | _na 229_aa | YgjP-like metallopeptidase domain-containing protein | |
| 3660 | CACL01000028.1 | GCA000180595_00143 | CDS | open | 15835-16038 | _na 67_aa | hypothetical protein | |
| 3661 | CACL01000028.1 | GCA000180595_00125 | gene | open | 1134-2597 | |||
| 3662 | CACL01000028.1 | GCA000180595_00126 | gene | open | 2732-3244 | coaD | ||
| 3663 | CACL01000028.1 | GCA000180595_00127 | gene | open | 3472-4155 | ybhL | ||
| 3664 | CACL01000028.1 | GCA000180595_00128 | gene | open | 4313-4579 | yggX | ||
| 3665 | CACL01000028.1 | GCA000180595_00129 | gene | open | 4654-5160 | rlmH | ||
| 3666 | CACL01000028.1 | GCA000180595_00130 | gene | open | 5178-5564 | rsfS | ||
| 3667 | CACL01000028.1 | GCA000180595_00131 | gene | open | 5665-6264 | |||
| 3668 | CACL01000028.1 | GCA000180595_00132 | gene | open | 6286-6897 | nadD | ||
| 3669 | CACL01000028.1 | GCA000180595_00133 | gene | open | 6894-7481 | |||
| 3670 | CACL01000028.1 | GCA000180595_00134 | gene | open | 7510-9051 | fbpB | ||
| 3671 | CACL01000028.1 | GCA000180595_00135 | gene | open | 9277-10200 | thrB | ||
| 3672 | CACL01000028.1 | GCA000180595_00136 | gene | open | 10230-10946 | ubiG | ||
| 3673 | CACL01000028.1 | GCA000180595_00137 | gene | open | 11006-12352 | sdaC | ||
| 3674 | CACL01000028.1 | GCA000180595_00138 | gene | open | 12505-13077 | |||
| 3675 | CACL01000028.1 | GCA000180595_00139 | gene | open | 13121-13558 | rfaB | ||
| 3676 | CACL01000028.1 | GCA000180595_00140 | gene | open | 13785-14348 | gmhB | ||
| 3677 | CACL01000028.1 | GCA000180595_00141 | gene | open | 14379-15122 | plsC | ||
| 3678 | CACL01000028.1 | GCA000180595_00142 | gene | open | 15119-15808 | |||
| 3679 | CACL01000028.1 | GCA000180595_00143 | gene | open | 15835-16038 | |||
| 3680 | CACL01000029.1 | GCA000180595_00116 | CDS | open | 37-2853 | _na 938_aa | autotransporter outer membrane beta-barrel domain-containing protein | |
| 3681 | CACL01000029.1 | GCA000180595_00117 | CDS | open | 3217-4629 | _na 470_aa | trkA | Trk system potassium transporter TrkA |
| 3682 | CACL01000029.1 | GCA000180595_00118 | CDS | open | 4727-6250 | _na 507_aa | ttdA | Fumarate hydratase class I |
| 3683 | CACL01000029.1 | GCA000180595_00119 | CDS | open | 7017-7655 | _na 212_aa | forC | 2Fe-2S iron-sulfur cluster binding domain protein |
| 3684 | CACL01000029.1 | GCA000180595_00120 | CDS | open | 7655-9283 | _na 542_aa | nadB | FAD-dependent oxidoreductase 2 FAD binding domain-containing protein |
| 3685 | CACL01000029.1 | GCA000180595_00121 | CDS | open | 9280-10533 | _na 417_aa | nuoF | NADH dehydrogenase |
| 3686 | CACL01000029.1 | GCA000180595_00122 | CDS | open | 11054-12505 | _na 483_aa | citT | Integral membrane transport protein |
| 3687 | CACL01000029.1 | GCA000180595_00123 | CDS | open | 13055-13339 | _na 94_aa | GIY-YIG domain-containing protein | |
| 3688 | CACL01000029.1 | GCA000180595_00116 | gene | open | 37-2853 | |||
| 3689 | CACL01000029.1 | GCA000180595_00117 | gene | open | 3217-4629 | trkA | ||
| 3690 | CACL01000029.1 | GCA000180595_00118 | gene | open | 4727-6250 | ttdA | ||
| 3691 | CACL01000029.1 | GCA000180595_00119 | gene | open | 7017-7655 | forC | ||
| 3692 | CACL01000029.1 | GCA000180595_00120 | gene | open | 7655-9283 | nadB | ||
| 3693 | CACL01000029.1 | GCA000180595_00121 | gene | open | 9280-10533 | nuoF | ||
| 3694 | CACL01000029.1 | GCA000180595_00122 | gene | open | 11054-12505 | citT | ||
| 3695 | CACL01000029.1 | GCA000180595_00123 | gene | open | 13055-13339 | |||
| 3696 | CACL01000030.1 | GCA000180595_00101 | CDS | open | 350-607 | _na 85_aa | hypothetical protein | |
| 3697 | CACL01000030.1 | GCA000180595_00102 | CDS | open | 908-1354 | _na 148_aa | pilE | Class II pilin PilE |
| 3698 | CACL01000030.1 | GCA000180595_00103 | CDS | open | 1914-2480 | _na 188_aa | mntP | Putative manganese efflux pump MntP |
| 3699 | CACL01000030.1 | GCA000180595_00104 | CDS | open | 2906-4942 | _na 678_aa | dcp | oligopeptidase A |
| 3700 | CACL01000030.1 | GCA000180595_00105 | CDS | open | 5030-5902 | _na 290_aa | mscS | Mechanosensitive ion channel MscS domain-containing protein |
| 3701 | CACL01000030.1 | GCA000180595_00106 | CDS | open | 6166-8556 | _na 796_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 3702 | CACL01000030.1 | GCA000180595_00107 | CDS | open | 8652-10037 | _na 461_aa | sdaA | L-serine ammonia-lyase |
| 3703 | CACL01000030.1 | GCA000180595_00108 | CDS | open | 10117-11058 | _na 313_aa | nlaXM | Type II methyltransferase M-NlaX |
| 3704 | CACL01000030.1 | GCA000180595_00109 | CDS | open | 11059-11457 | _na 132_aa | EcoRII C-terminal domain protein | |
| 3705 | CACL01000030.1 | GCA000180595_00110 | CDS | open | 11529-12533 | _na 334_aa | nlaIIIM | Type II methyltransferase M-NlaIII |
| 3706 | CACL01000030.1 | GCA000180595_00111 | CDS | open | 12530-13090 | _na 186_aa | nlaIIIR | Type II restriction enzyme NlaIII |
| 3707 | CACL01000030.1 | GCA000180595_00101 | gene | open | 350-607 | |||
| 3708 | CACL01000030.1 | GCA000180595_00102 | gene | open | 908-1354 | pilE | ||
| 3709 | CACL01000030.1 | GCA000180595_00103 | gene | open | 1914-2480 | mntP | ||
| 3710 | CACL01000030.1 | GCA000180595_00104 | gene | open | 2906-4942 | dcp | ||
| 3711 | CACL01000030.1 | GCA000180595_00105 | gene | open | 5030-5902 | mscS | ||
| 3712 | CACL01000030.1 | GCA000180595_00106 | gene | open | 6166-8556 | gyrB | ||
| 3713 | CACL01000030.1 | GCA000180595_00107 | gene | open | 8652-10037 | sdaA | ||
| 3714 | CACL01000030.1 | GCA000180595_00108 | gene | open | 10117-11058 | nlaXM | ||
| 3715 | CACL01000030.1 | GCA000180595_00109 | gene | open | 11059-11457 | |||
| 3716 | CACL01000030.1 | GCA000180595_00110 | gene | open | 11529-12533 | nlaIIIM | ||
| 3717 | CACL01000030.1 | GCA000180595_00111 | gene | open | 12530-13090 | nlaIIIR | ||
| 3718 | CACL01000030.1 | GCA000180595_00112 | gene | open | 13859-13935 | trnD | ||
| 3719 | CACL01000030.1 | GCA000180595_00113 | gene | open | 13968-14043 | trnV | ||
| 3720 | CACL01000030.1 | GCA000180595_00114 | gene | open | 14083-14159 | trnD | ||
| 3721 | CACL01000030.1 | GCA000180595_00115 | gene | open | 14192-14267 | trnV | ||
| 3722 | CACL01000030.1 | GCA000180595_00112 | tRNA | open | 13859-13935 | trnD | tRNA-Asp(gtc) | |
| 3723 | CACL01000030.1 | GCA000180595_00113 | tRNA | open | 13968-14043 | trnV | tRNA-Val(tac) | |
| 3724 | CACL01000030.1 | GCA000180595_00114 | tRNA | open | 14083-14159 | trnD | tRNA-Asp(gtc) | |
| 3725 | CACL01000030.1 | GCA000180595_00115 | tRNA | open | 14192-14267 | trnV | tRNA-Val(tac) | |
| 3726 | CACL01000031.1 | GCA000180595_00086 | CDS | open | 245-928 | _na 227_aa | dedA | VTT domain-containing protein |
| 3727 | CACL01000031.1 | GCA000180595_00087 | CDS | open | 1117-2451 | _na 444_aa | glmM | phosphoglucosamine mutase |
| 3728 | CACL01000031.1 | GCA000180595_00088 | CDS | open | 2581-3432 | _na 283_aa | Dihydropteroate synthase | |
| 3729 | CACL01000031.1 | GCA000180595_00089 | CDS | open | 3664-5766 | _na 700_aa | asmA | AsmA domain-containing protein |
| 3730 | CACL01000031.1 | GCA000180595_00090 | CDS | open | 5831-7315 | _na 494_aa | ubiD | 4-hydroxy-3-polyprenylbenzoate decarboxylase |
| 3731 | CACL01000031.1 | GCA000180595_00091 | CDS | open | 7340-7855 | _na 171_aa | DUF2199 domain-containing protein | |
| 3732 | CACL01000031.1 | GCA000180595_00092 | CDS | open | 7862-8407 | _na 181_aa | Integral membrane protein | |
| 3733 | CACL01000031.1 | GCA000180595_00093 | CDS | open | 8482-8727 | _na 81_aa | acpP | acyl carrier protein |
| 3734 | CACL01000031.1 | GCA000180595_00094 | CDS | open | 8739-8999 | _na 86_aa | acpP | Acyl carrier protein |
| 3735 | CACL01000031.1 | GCA000180595_00095 | CDS | open | 8996-9754 | _na 252_aa | plsC | Acyltransferase family protein |
| 3736 | CACL01000031.1 | GCA000180595_00096 | CDS | open | 9747-10502 | _na 251_aa | Beta-ketoacyl synthase-like N-terminal domain-containing protein | |
| 3737 | CACL01000031.1 | GCA000180595_00097 | CDS | open | 10691-11182 | _na 163_aa | Thioester dehydrase | |
| 3738 | CACL01000031.1 | GCA000180595_00098 | CDS | open | 11220-11948 | _na 242_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 3739 | CACL01000031.1 | GCA000180595_00099 | CDS | open | 11945-13180 | _na 411_aa | beta-ketoacyl-ACP synthase | |
| 3740 | CACL01000031.1 | GCA000180595_00100 | CDS | open | 13242-13757 | _na 171_aa | 4'-phosphopantetheinyl transferase domain-containing protein | |
| 3741 | CACL01000031.1 | GCA000180595_00086 | gene | open | 245-928 | dedA | ||
| 3742 | CACL01000031.1 | GCA000180595_00087 | gene | open | 1117-2451 | glmM | ||
| 3743 | CACL01000031.1 | GCA000180595_00088 | gene | open | 2581-3432 | |||
| 3744 | CACL01000031.1 | GCA000180595_00089 | gene | open | 3664-5766 | asmA | ||
| 3745 | CACL01000031.1 | GCA000180595_00090 | gene | open | 5831-7315 | ubiD | ||
| 3746 | CACL01000031.1 | GCA000180595_00091 | gene | open | 7340-7855 | |||
| 3747 | CACL01000031.1 | GCA000180595_00092 | gene | open | 7862-8407 | |||
| 3748 | CACL01000031.1 | GCA000180595_00093 | gene | open | 8482-8727 | acpP | ||
| 3749 | CACL01000031.1 | GCA000180595_00094 | gene | open | 8739-8999 | acpP | ||
| 3750 | CACL01000031.1 | GCA000180595_00095 | gene | open | 8996-9754 | plsC | ||
| 3751 | CACL01000031.1 | GCA000180595_00096 | gene | open | 9747-10502 | |||
| 3752 | CACL01000031.1 | GCA000180595_00097 | gene | open | 10691-11182 | |||
| 3753 | CACL01000031.1 | GCA000180595_00098 | gene | open | 11220-11948 | fabG | ||
| 3754 | CACL01000031.1 | GCA000180595_00099 | gene | open | 11945-13180 | |||
| 3755 | CACL01000031.1 | GCA000180595_00100 | gene | open | 13242-13757 | |||
| 3756 | CACL01000032.1 | repeat_region | open | 206-977 | CRISPR array with 12 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTAGAGGCGGCTGA and spacer length 34 | |||
| 3757 | CACL01000032.1 | GCA000180595_00073 | CDS | open | 1157-1450 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3758 | CACL01000032.1 | GCA000180595_00074 | CDS | open | 1505-2518 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 3759 | CACL01000032.1 | GCA000180595_00075 | CDS | open | 3690-4625 | _na 311_aa | era | GTPase Era |
| 3760 | CACL01000032.1 | GCA000180595_00076 | CDS | open | 4660-5379 | _na 239_aa | rnc | ribonuclease III |
| 3761 | CACL01000032.1 | GCA000180595_00077 | CDS | open | 5546-5869 | _na 107_aa | DUF2185 domain-containing protein | |
| 3762 | CACL01000032.1 | GCA000180595_00078 | CDS | open | 5917-6393 | _na 158_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 3763 | CACL01000032.1 | GCA000180595_00079 | CDS | open | 6471-6896 | _na 141_aa | nusB | transcription antitermination factor NusB |
| 3764 | CACL01000032.1 | GCA000180595_00080 | CDS | open | 7042-7524 | _na 160_aa | hypothetical protein | |
| 3765 | CACL01000032.1 | GCA000180595_00081 | CDS | open | 7543-8577 | _na 344_aa | pyrC | dihydroorotase |
| 3766 | CACL01000032.1 | GCA000180595_00082 | CDS | open | 8940-9164 | _na 74_aa | tusA | Putative sulfur carrier protein NMB0681 |
| 3767 | CACL01000032.1 | GCA000180595_00083 | CDS | open | 9273-9866 | _na 197_aa | clpB | Clp protease ClpB |
| 3768 | CACL01000032.1 | GCA000180595_00084 | CDS | open | 9941-10813 | _na 290_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 3769 | CACL01000032.1 | GCA000180595_00085 | CDS | open | 10851-11534 | _na 227_aa | trpA | tryptophan synthase subunit alpha |
| 3770 | CACL01000032.1 | GCA000180595_00073 | gene | open | 1157-1450 | cas2 | ||
| 3771 | CACL01000032.1 | GCA000180595_00074 | gene | open | 1505-2518 | cas1c | ||
| 3772 | CACL01000032.1 | GCA000180595_00075 | gene | open | 3690-4625 | era | ||
| 3773 | CACL01000032.1 | GCA000180595_00076 | gene | open | 4660-5379 | rnc | ||
| 3774 | CACL01000032.1 | GCA000180595_00077 | gene | open | 5546-5869 | |||
| 3775 | CACL01000032.1 | GCA000180595_00078 | gene | open | 5917-6393 | ribH | ||
| 3776 | CACL01000032.1 | GCA000180595_00079 | gene | open | 6471-6896 | nusB | ||
| 3777 | CACL01000032.1 | GCA000180595_00080 | gene | open | 7042-7524 | |||
| 3778 | CACL01000032.1 | GCA000180595_00081 | gene | open | 7543-8577 | pyrC | ||
| 3779 | CACL01000032.1 | GCA000180595_00082 | gene | open | 8940-9164 | tusA | ||
| 3780 | CACL01000032.1 | GCA000180595_00083 | gene | open | 9273-9866 | clpB | ||
| 3781 | CACL01000032.1 | GCA000180595_00084 | gene | open | 9941-10813 | accD | ||
| 3782 | CACL01000032.1 | GCA000180595_00085 | gene | open | 10851-11534 | trpA | ||
| 3783 | CACL01000033.1 | GCA000180595_00060 | CDS | open | 244-336 | _na 30_aa | hypothetical protein | |
| 3784 | CACL01000033.1 | GCA000180595_00061 | CDS | open | 345-512 | _na 55_aa | hypothetical protein | |
| 3785 | CACL01000033.1 | GCA000180595_00062 | CDS | open | 463-648 | _na 61_aa | Immunity protein 40 domain-containing protein | |
| 3786 | CACL01000033.1 | GCA000180595_00063 | CDS | open | 722-955 | _na 77_aa | hypothetical protein | |
| 3787 | CACL01000033.1 | GCA000180595_00064 | CDS | open | 996-1229 | _na 77_aa | Glutaredoxin-like protein | |
| 3788 | CACL01000033.1 | GCA000180595_00065 | CDS | open | 1754-2617 | _na 287_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 3789 | CACL01000033.1 | GCA000180595_00066 | CDS | open | 2823-3686 | _na 287_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 3790 | CACL01000033.1 | GCA000180595_00067 | CDS | open | 3923-6043 | _na 706_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 3791 | CACL01000033.1 | GCA000180595_00068 | CDS | open | 6117-6785 | _na 222_aa | dsbD | Urease accessory protein UreH-like transmembrane domain-containing protein |
| 3792 | CACL01000033.1 | GCA000180595_00069 | CDS | open | 6782-7096 | _na 104_aa | Lipoprotein | |
| 3793 | CACL01000033.1 | GCA000180595_00070 | CDS | open | 7287-7574 | _na 95_aa | barS | MafI |
| 3794 | CACL01000033.1 | GCA000180595_00071 | CDS | open | 7676-8605 | _na 309_aa | Phasyl DNA replicon protein arp | |
| 3795 | CACL01000033.1 | GCA000180595_00072 | CDS | open | 8618-9109 | _na 163_aa | hypothetical protein | |
| 3796 | CACL01000033.1 | GCA000180595_00060 | gene | open | 244-336 | |||
| 3797 | CACL01000033.1 | GCA000180595_00061 | gene | open | 345-512 | |||
| 3798 | CACL01000033.1 | GCA000180595_00062 | gene | open | 463-648 | |||
| 3799 | CACL01000033.1 | GCA000180595_00063 | gene | open | 722-955 | |||
| 3800 | CACL01000033.1 | GCA000180595_00064 | gene | open | 996-1229 | |||
| 3801 | CACL01000033.1 | GCA000180595_00065 | gene | open | 1754-2617 | rfbD | ||
| 3802 | CACL01000033.1 | GCA000180595_00066 | gene | open | 2823-3686 | purC | ||
| 3803 | CACL01000033.1 | GCA000180595_00067 | gene | open | 3923-6043 | pnp | ||
| 3804 | CACL01000033.1 | GCA000180595_00068 | gene | open | 6117-6785 | dsbD | ||
| 3805 | CACL01000033.1 | GCA000180595_00069 | gene | open | 6782-7096 | |||
| 3806 | CACL01000033.1 | GCA000180595_00070 | gene | open | 7287-7574 | barS | ||
| 3807 | CACL01000033.1 | GCA000180595_00071 | gene | open | 7676-8605 | |||
| 3808 | CACL01000033.1 | GCA000180595_00072 | gene | open | 8618-9109 | |||
| 3809 | CACL01000034.1 | GCA000180595_00053 | CDS | open | 577-702 | _na 41_aa | hypothetical protein | |
| 3810 | CACL01000034.1 | GCA000180595_00054 | CDS | open | 987-1895 | _na 302_aa | efeB | Peroxidase |
| 3811 | CACL01000034.1 | GCA000180595_00055 | CDS | open | 1976-5590 | _na 1204_aa | recB | exodeoxyribonuclease V subunit beta |
| 3812 | CACL01000034.1 | GCA000180595_00056 | CDS | open | 5629-5988 | _na 119_aa | pspE | Putative phage shock protein E |
| 3813 | CACL01000034.1 | GCA000180595_00057 | CDS | open | 6120-6599 | _na 159_aa | DUF302 domain-containing protein | |
| 3814 | CACL01000034.1 | GCA000180595_00058 | CDS | open | 6870-8249 | _na 459_aa | radA | DNA repair protein RadA |
| 3815 | CACL01000034.1 | GCA000180595_00059 | CDS | open | 8439-8732 | _na 97_aa | uroporphyrinogen decarboxylase family protein | |
| 3816 | CACL01000034.1 | GCA000180595_00053 | gene | open | 577-702 | |||
| 3817 | CACL01000034.1 | GCA000180595_00054 | gene | open | 987-1895 | efeB | ||
| 3818 | CACL01000034.1 | GCA000180595_00055 | gene | open | 1976-5590 | recB | ||
| 3819 | CACL01000034.1 | GCA000180595_00056 | gene | open | 5629-5988 | pspE | ||
| 3820 | CACL01000034.1 | GCA000180595_00057 | gene | open | 6120-6599 | |||
| 3821 | CACL01000034.1 | GCA000180595_00058 | gene | open | 6870-8249 | radA | ||
| 3822 | CACL01000034.1 | GCA000180595_00059 | gene | open | 8439-8732 | |||
| 3823 | CACL01000035.1 | GCA000180595_00045 | CDS | open | 549-1355 | _na 268_aa | ypjD | Glutamate synthase [NADPH] small chain |
| 3824 | CACL01000035.1 | GCA000180595_00046 | CDS | open | 1575-2945 | _na 456_aa | ffh | signal recognition particle protein |
| 3825 | CACL01000035.1 | GCA000180595_00047 | CDS | open | 3204-3659 | _na 151_aa | Four-helix bundle copper-binding protein | |
| 3826 | CACL01000035.1 | GCA000180595_00048 | CDS | open | 3714-4319 | _na 201_aa | fMR2 | Nitroreductase domain-containing protein |
| 3827 | CACL01000035.1 | GCA000180595_00049 | CDS | open | 4369-4767 | _na 132_aa | doxX | DoxX family protein |
| 3828 | CACL01000035.1 | GCA000180595_00050 | CDS | open | 5253-5786 | _na 177_aa | lysR | LysR family transcriptional regulator |
| 3829 | CACL01000035.1 | GCA000180595_00051 | CDS | open | 5776-7077 | _na 433_aa | Deoxyribodipyrimidine photolyase | |
| 3830 | CACL01000035.1 | GCA000180595_00052 | CDS | open | 7183-7767 | _na 194_aa | IS5 family transposase | |
| 3831 | CACL01000035.1 | GCA000180595_00045 | gene | open | 549-1355 | ypjD | ||
| 3832 | CACL01000035.1 | GCA000180595_00046 | gene | open | 1575-2945 | ffh | ||
| 3833 | CACL01000035.1 | GCA000180595_00047 | gene | open | 3204-3659 | |||
| 3834 | CACL01000035.1 | GCA000180595_00048 | gene | open | 3714-4319 | fMR2 | ||
| 3835 | CACL01000035.1 | GCA000180595_00049 | gene | open | 4369-4767 | doxX | ||
| 3836 | CACL01000035.1 | GCA000180595_00050 | gene | open | 5253-5786 | lysR | ||
| 3837 | CACL01000035.1 | GCA000180595_00051 | gene | open | 5776-7077 | |||
| 3838 | CACL01000035.1 | GCA000180595_00052 | gene | open | 7183-7767 | |||
| 3839 | CACL01000036.1 | GCA000180595_00036 | CDS | open | 202-510 | _na 102_aa | hypothetical protein | |
| 3840 | CACL01000036.1 | GCA000180595_00037 | CDS | open | 512-781 | _na 89_aa | Phage associated protein | |
| 3841 | CACL01000036.1 | GCA000180595_00038 | CDS | open | 877-1101 | _na 74_aa | Tat pathway signal sequence domain protein | |
| 3842 | CACL01000036.1 | GCA000180595_00039 | CDS | open | 1111-1425 | _na 104_aa | hypothetical protein | |
| 3843 | CACL01000036.1 | GCA000180595_00040 | CDS | open | 1415-3154 | _na 579_aa | tspB | TspB protein |
| 3844 | CACL01000036.1 | GCA000180595_00041 | CDS | open | 3156-3437 | _na 93_aa | DUF2523 domain-containing protein | |
| 3845 | CACL01000036.1 | GCA000180595_00042 | CDS | open | 3450-4643 | _na 397_aa | Zonular occludens toxin family protein | |
| 3846 | CACL01000036.1 | GCA000180595_00043 | CDS | open | 5362-6309 | _na 315_aa | IS110 family transposase | |
| 3847 | CACL01000036.1 | GCA000180595_00044 | CDS | open | 6147-6719 | _na 190_aa | hypothetical protein | |
| 3848 | CACL01000036.1 | GCA000180595_00036 | gene | open | 202-510 | |||
| 3849 | CACL01000036.1 | GCA000180595_00037 | gene | open | 512-781 | |||
| 3850 | CACL01000036.1 | GCA000180595_00038 | gene | open | 877-1101 | |||
| 3851 | CACL01000036.1 | GCA000180595_00039 | gene | open | 1111-1425 | |||
| 3852 | CACL01000036.1 | GCA000180595_00040 | gene | open | 1415-3154 | tspB | ||
| 3853 | CACL01000036.1 | GCA000180595_00041 | gene | open | 3156-3437 | |||
| 3854 | CACL01000036.1 | GCA000180595_00042 | gene | open | 3450-4643 | |||
| 3855 | CACL01000036.1 | GCA000180595_00043 | gene | open | 5362-6309 | |||
| 3856 | CACL01000036.1 | GCA000180595_00044 | gene | open | 6147-6719 | |||
| 3857 | CACL01000037.1 | GCA000180595_00028 | CDS | open | 15-422 | _na 135_aa | hypothetical protein | |
| 3858 | CACL01000037.1 | GCA000180595_00029 | CDS | open | 675-1193 | _na 172_aa | Cell surface protein | |
| 3859 | CACL01000037.1 | GCA000180595_00030 | CDS | open | 1961-3169 | _na 402_aa | nicK | Replication initiation protein-like C-terminal domain-containing protein |
| 3860 | CACL01000037.1 | GCA000180595_00031 | CDS | open | 3190-3501 | _na 103_aa | Phage associated protein | |
| 3861 | CACL01000037.1 | GCA000180595_00032 | CDS | open | 3505-3705 | _na 66_aa | Phage associated protein | |
| 3862 | CACL01000037.1 | GCA000180595_00033 | CDS | open | 3931-4161 | _na 76_aa | Periplasmic protein | |
| 3863 | CACL01000037.1 | GCA000180595_00034 | CDS | open | 4189-4488 | _na 99_aa | Inner membrane protein | |
| 3864 | CACL01000037.1 | GCA000180595_00035 | CDS | open | 4851-6434 | _na 527_aa | tspB | IgG-binding virulence factor TspB family protein |
| 3865 | CACL01000037.1 | GCA000180595_00028 | gene | open | 15-422 | |||
| 3866 | CACL01000037.1 | GCA000180595_00029 | gene | open | 675-1193 | |||
| 3867 | CACL01000037.1 | GCA000180595_00030 | gene | open | 1961-3169 | nicK | ||
| 3868 | CACL01000037.1 | GCA000180595_00031 | gene | open | 3190-3501 | |||
| 3869 | CACL01000037.1 | GCA000180595_00032 | gene | open | 3505-3705 | |||
| 3870 | CACL01000037.1 | GCA000180595_00033 | gene | open | 3931-4161 | |||
| 3871 | CACL01000037.1 | GCA000180595_00034 | gene | open | 4189-4488 | |||
| 3872 | CACL01000037.1 | GCA000180595_00035 | gene | open | 4851-6434 | tspB | ||
| 3873 | CACL01000038.1 | GCA000180595_00024 | CDS | open | 1254-3356 | _na 700_aa | transferrin-binding protein-like solute binding protein | |
| 3874 | CACL01000038.1 | GCA000180595_00025 | CDS | open | 3443-4405 | _na 320_aa | lactoferrin/transferrin family TonB-dependent receptor | |
| 3875 | CACL01000038.1 | GCA000180595_00026 | CDS | open | 4470-6191 | _na 573_aa | lactoferrin/transferrin family TonB-dependent receptor | |
| 3876 | CACL01000038.1 | GCA000180595_00027 | CDS | open | 6240-6605 | _na 121_aa | hypothetical protein | |
| 3877 | CACL01000038.1 | GCA000180595_00024 | gene | open | 1254-3356 | |||
| 3878 | CACL01000038.1 | GCA000180595_00025 | gene | open | 3443-4405 | |||
| 3879 | CACL01000038.1 | GCA000180595_00026 | gene | open | 4470-6191 | |||
| 3880 | CACL01000038.1 | GCA000180595_00027 | gene | open | 6240-6605 | |||
| 3881 | CACL01000039.1 | GCA000180595_00023 | gene | open | 6375-6465 | NmsRb | ||
| 3882 | CACL01000039.1 | GCA000180595_00023 | ncRNA | open | 6375-6465 | Neisseria metabolic switch regulator b (RcoF1/NgncR163) | ||
| 3883 | CACL01000039.1 | GCA000180595_00017 | CDS | open | 449-1366 | _na 305_aa | prmB | 50S ribosomal protein L3 N(5)-glutamine methyltransferase |
| 3884 | CACL01000039.1 | GCA000180595_00018 | CDS | open | 1378-2241 | _na 287_aa | ywqK | Periplasmic protein |
| 3885 | CACL01000039.1 | GCA000180595_00019 | CDS | open | 2366-2638 | _na 90_aa | aCT | ACT domain-containing protein |
| 3886 | CACL01000039.1 | GCA000180595_00020 | CDS | open | 2653-4008 | _na 451_aa | UPF0210 protein NMA1908 | |
| 3887 | CACL01000039.1 | GCA000180595_00021 | CDS | open | 4550-5608 | _na 352_aa | alr | alanine racemase |
| 3888 | CACL01000039.1 | GCA000180595_00022 | CDS | open | 5830-6294 | _na 154_aa | lrp | Leucine-responsive regulatory protein |
| 3889 | CACL01000039.1 | GCA000180595_00017 | gene | open | 449-1366 | prmB | ||
| 3890 | CACL01000039.1 | GCA000180595_00018 | gene | open | 1378-2241 | ywqK | ||
| 3891 | CACL01000039.1 | GCA000180595_00019 | gene | open | 2366-2638 | aCT | ||
| 3892 | CACL01000039.1 | GCA000180595_00020 | gene | open | 2653-4008 | |||
| 3893 | CACL01000039.1 | GCA000180595_00021 | gene | open | 4550-5608 | alr | ||
| 3894 | CACL01000039.1 | GCA000180595_00022 | gene | open | 5830-6294 | lrp | ||
| 3895 | CACL01000040.1 | GCA000180595_00013 | CDS | open | 522-887 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 3896 | CACL01000040.1 | GCA000180595_00014 | CDS | open | 1175-1930 | _na 251_aa | mntA | ABC transporter ATP-binding protein MntA |
| 3897 | CACL01000040.1 | GCA000180595_00015 | CDS | open | 1966-2841 | _na 291_aa | mntB | Manganese transport system membrane protein MntB |
| 3898 | CACL01000040.1 | GCA000180595_00016 | CDS | open | 2918-3523 | _na 201_aa | znuA | ABC transporter%2C substrate-binding protein |
| 3899 | CACL01000040.1 | GCA000180595_00013 | gene | open | 522-887 | rplS | ||
| 3900 | CACL01000040.1 | GCA000180595_00014 | gene | open | 1175-1930 | mntA | ||
| 3901 | CACL01000040.1 | GCA000180595_00015 | gene | open | 1966-2841 | mntB | ||
| 3902 | CACL01000040.1 | GCA000180595_00016 | gene | open | 2918-3523 | znuA | ||
| 3903 | CACL01000041.1 | GCA000180595_00008 | CDS | open | 21-221 | _na 66_aa | (2Fe-2S)-binding protein | |
| 3904 | CACL01000041.1 | GCA000180595_00009 | CDS | open | 401-928 | _na 175_aa | Tyr recombinase domain-containing protein | |
| 3905 | CACL01000041.1 | GCA000180595_00010 | CDS | open | 885-1277 | _na 130_aa | site-specific integrase | |
| 3906 | CACL01000041.1 | GCA000180595_00011 | CDS | open | 1327-1767 | _na 146_aa | bcp | thioredoxin-dependent peroxiredoxin |
| 3907 | CACL01000041.1 | GCA000180595_00012 | CDS | open | 2098-3036 | _na 312_aa | D-alanyl-D-alanine-endopeptidase | |
| 3908 | CACL01000041.1 | GCA000180595_00008 | gene | open | 21-221 | |||
| 3909 | CACL01000041.1 | GCA000180595_00009 | gene | open | 401-928 | |||
| 3910 | CACL01000041.1 | GCA000180595_00010 | gene | open | 885-1277 | |||
| 3911 | CACL01000041.1 | GCA000180595_00011 | gene | open | 1327-1767 | bcp | ||
| 3912 | CACL01000041.1 | GCA000180595_00012 | gene | open | 2098-3036 | |||
| 3913 | CACL01000042.1 | GCA000180595_00004 | CDS | open | 500-667 | _na 55_aa | Phage associated protein | |
| 3914 | CACL01000042.1 | GCA000180595_00005 | CDS | open | 826-1674 | _na 282_aa | Bro-N domain-containing protein | |
| 3915 | CACL01000042.1 | GCA000180595_00006 | CDS | open | 1797-1928 | _na 43_aa | Phage associated protein | |
| 3916 | CACL01000042.1 | GCA000180595_00007 | CDS | open | 2322-2507 | _na 61_aa | hypothetical protein | |
| 3917 | CACL01000042.1 | GCA000180595_00004 | gene | open | 500-667 | |||
| 3918 | CACL01000042.1 | GCA000180595_00005 | gene | open | 826-1674 | |||
| 3919 | CACL01000042.1 | GCA000180595_00006 | gene | open | 1797-1928 | |||
| 3920 | CACL01000042.1 | GCA000180595_00007 | gene | open | 2322-2507 | |||
| 3921 | CACL01000044.1 | GCA000180595_00001 | CDS | open | 16-285 | _na 89_aa | hupB | DNA-binding protein HU-beta |
| 3922 | CACL01000044.1 | GCA000180595_00002 | CDS | open | 436-870 | _na 144_aa | Phage associated protein | |
| 3923 | CACL01000044.1 | GCA000180595_00003 | CDS | open | 863-1957 | _na 364_aa | homoserine dehydrogenase | |
| 3924 | CACL01000044.1 | GCA000180595_00001 | gene | open | 16-285 | hupB | ||
| 3925 | CACL01000044.1 | GCA000180595_00002 | gene | open | 436-870 | |||
| 3926 | CACL01000044.1 | GCA000180595_00003 | gene | open | 863-1957 |

