HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria polysaccharea (GCA_000193775.2)

Select a Genome:
BAKTA Annotations for GCA_000193775.2
Genome Selected: Neisseria polysaccharea
ContigsBases CDSrRNA tmRNAtRNA
288 2,169,528 2009 3 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4146 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4146 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 AEPH01000038.1 GCA000193775_01713 gene open 169604-170083 lptE
1002 AEPH01000038.1 GCA000193775_01714 gene open 170135-170914 pgeF
1003 AEPH01000038.1 GCA000193775_01715 gene open 171368-172330 yfeH
1004 AEPH01000038.1 GCA000193775_01716 gene open 172504-173574 rluD
1005 AEPH01000038.1 GCA000193775_01717 gene open 173627-174430 bamD
1006 AEPH01000038.1 GCA000193775_01718 gene open 174665-176884 comA
1007 AEPH01000038.1 GCA000193775_01719 gene open 177218-177559
1008 AEPH01000038.1 GCA000193775_01720 gene open 177652-178854 trpB
1009 AEPH01000038.1 GCA000193775_01721 gene open 178937-179245 mug
1010 AEPH01000038.1 GCA000193775_01722 gene open 179811-180590 rsmA
1011 AEPH01000038.1 GCA000193775_01723 gene open 180606-180722
1012 AEPH01000038.1 GCA000193775_01724 gene open 180742-181491 glnQ
1013 AEPH01000038.1 GCA000193775_01725 gene open 181560-181919
1014 AEPH01000038.1 GCA000193775_01726 gene open 181924-183675 folC
1015 AEPH01000038.1 GCA000193775_01727 gene open 183688-184677
1016 AEPH01000038.1 GCA000193775_01728 gene open 184746-185243
1017 AEPH01000038.1 GCA000193775_01729 gene open 185451-186995 purF
1018 AEPH01000038.1 GCA000193775_01730 gene open 187095-187586 greB
1019 AEPH01000038.1 GCA000193775_01731 gene open 187645-188271
1020 AEPH01000038.1 GCA000193775_01732 gene open 188735-189040 uvrD
1021 AEPH01000038.1 GCA000193775_01733 gene open 189019-189624
1022 AEPH01000038.1 GCA000193775_01734 gene open 189670-191619
1023 AEPH01000038.1 GCA000193775_01735 gene open 191630-192193
1024 AEPH01000038.1 GCA000193775_01736 gene open 192190-193245
1025 AEPH01000038.1 GCA000193775_01737 gene open 193242-193649
1026 AEPH01000038.1 GCA000193775_01738 gene open 193707-194336
1027 AEPH01000038.1 GCA000193775_01739 gene open 194337-195476
1028 AEPH01000038.1 GCA000193775_01740 gene open 195460-196827
1029 AEPH01000038.1 GCA000193775_01741 gene open 196837-198969
1030 AEPH01000038.1 GCA000193775_01742 gene open 199175-199561
1031 AEPH01000038.1 GCA000193775_01743 gene open 199655-200029
1032 AEPH01000038.1 GCA000193775_01744 gene open 200042-201469
1033 AEPH01000038.1 GCA000193775_01745 gene open 201466-201648
1034 AEPH01000038.1 GCA000193775_01746 gene open 201641-202255
1035 AEPH01000038.1 GCA000193775_01747 gene open 202296-202721
1036 AEPH01000038.1 GCA000193775_01748 gene open 202721-203146
1037 AEPH01000038.1 GCA000193775_01749 gene open 203188-204090
1038 AEPH01000038.1 GCA000193775_01750 gene open 204113-205186
1039 AEPH01000038.1 GCA000193775_01751 gene open 205386-205880
1040 AEPH01000038.1 GCA000193775_01752 gene open 206107-207453
1041 AEPH01000038.1 GCA000193775_01753 gene open 207446-208999
1042 AEPH01000038.1 GCA000193775_01754 gene open 209077-210699
1043 AEPH01000038.1 GCA000193775_01755 gene open 210711-211223
1044 AEPH01000038.1 GCA000193775_01756 gene open 211220-211726
1045 AEPH01000038.1 GCA000193775_01757 gene open 211729-211926
1046 AEPH01000038.1 GCA000193775_01758 gene open 211923-212189
1047 AEPH01000038.1 GCA000193775_01759 gene open 212201-212542
1048 AEPH01000038.1 GCA000193775_01760 gene open 212539-213171
1049 AEPH01000038.1 GCA000193775_01761 gene open 213143-213379
1050 AEPH01000038.1 GCA000193775_01762 gene open 213382-213546
1051 AEPH01000038.1 GCA000193775_01763 gene open 213549-213722
1052 AEPH01000038.1 GCA000193775_01764 gene open 213719-214264 amiC
1053 AEPH01000038.1 GCA000193775_01765 gene open 214407-215354
1054 AEPH01000038.1 GCA000193775_01766 gene open 215451-215891
1055 AEPH01000038.1 GCA000193775_01767 gene open 215891-216292 gemA
1056 AEPH01000038.1 GCA000193775_01768 gene open 216708-216875
1057 AEPH01000038.1 GCA000193775_01769 gene open 217072-217662
1058 AEPH01000038.1 GCA000193775_01770 gene open 217666-217842
1059 AEPH01000038.1 GCA000193775_01771 gene open 217846-218061
1060 AEPH01000038.1 GCA000193775_01772 gene open 218220-218738
1061 AEPH01000038.1 GCA000193775_01773 gene open 218762-219250
1062 AEPH01000038.1 GCA000193775_01774 gene open 219247-219720
1063 AEPH01000038.1 GCA000193775_01775 gene open 219717-219914
1064 AEPH01000038.1 GCA000193775_01776 gene open 219914-220081
1065 AEPH01000038.1 GCA000193775_01777 gene open 220322-220435
1066 AEPH01000038.1 GCA000193775_01778 gene open 220425-220664
1067 AEPH01000038.1 GCA000193775_01779 gene open 220692-220934
1068 AEPH01000038.1 GCA000193775_01780 gene open 220950-221864
1069 AEPH01000038.1 GCA000193775_01781 gene open 221900-223882
1070 AEPH01000038.1 GCA000193775_01782 gene open 223884-224060
1071 AEPH01000038.1 GCA000193775_01783 gene open 224168-224563
1072 AEPH01000038.1 GCA000193775_01784 gene open 224795-225184
1073 AEPH01000038.1 GCA000193775_01533 gene open 7253-7342 trnS
1074 AEPH01000038.1 GCA000193775_01534 gene open 7420-7510 trnS
1075 AEPH01000038.1 GCA000193775_01558 gene open 30720-30795 trnQ
1076 AEPH01000038.1 GCA000193775_01564 gene open 36285-36360 trnT
1077 AEPH01000038.1 GCA000193775_01565 gene open 36395-36470 trnT
1078 AEPH01000038.1 GCA000193775_01675 gene open 138059-138133 trnE
1079 AEPH01000038.1 GCA000193775_01676 gene open 138151-138227 trnR
1080 AEPH01000038.1 GCA000193775_01699 gene open 158750-158826 trnV
1081 AEPH01000038.1 GCA000193775_01533 tRNA open 7253-7342 trnS tRNA-Ser(cga)
1082 AEPH01000038.1 GCA000193775_01534 tRNA open 7420-7510 trnS tRNA-Ser(tga)
1083 AEPH01000038.1 GCA000193775_01558 tRNA open 30720-30795 trnQ tRNA-Gln(ttg)
1084 AEPH01000038.1 GCA000193775_01564 tRNA open 36285-36360 trnT tRNA-Thr(tgt)
1085 AEPH01000038.1 GCA000193775_01565 tRNA open 36395-36470 trnT tRNA-Thr(tgt)
1086 AEPH01000038.1 GCA000193775_01675 tRNA open 138059-138133 trnE tRNA-Glu(ttc)
1087 AEPH01000038.1 GCA000193775_01676 tRNA open 138151-138227 trnR tRNA-Arg(acg)
1088 AEPH01000038.1 GCA000193775_01699 tRNA open 158750-158826 trnV tRNA-Val(gac)
1089 AEPH01000039.1 GCA000193775_01524 CDS open 232-438 _na     68_aa opacity family porin
1090 AEPH01000039.1 GCA000193775_01525 CDS open 607-864 _na     85_aa hypothetical protein
1091 AEPH01000039.1 GCA000193775_01524 gene open 232-438
1092 AEPH01000039.1 GCA000193775_01525 gene open 607-864
1093 AEPH01000040.1 GCA000193775_01514 CDS open 38-475 _na     145_aa hypothetical protein
1094 AEPH01000040.1 GCA000193775_01515 CDS open 656-1060 _na     134_aa hypothetical protein
1095 AEPH01000040.1 GCA000193775_01516 CDS open 1057-1620 _na     187_aa hypothetical protein
1096 AEPH01000040.1 GCA000193775_01517 CDS open 1893-2207 _na     104_aa hypothetical protein
1097 AEPH01000040.1 GCA000193775_01518 CDS open 2234-2761 _na     175_aa CPW-WPC domain protein
1098 AEPH01000040.1 GCA000193775_01519 CDS open 2730-3416 _na     228_aa hypothetical protein
1099 AEPH01000040.1 GCA000193775_01520 CDS open 3607-4080 _na     157_aa hypothetical protein
1100 AEPH01000040.1 GCA000193775_01521 CDS open 4082-4336 _na     84_aa hypothetical protein
1101 AEPH01000040.1 GCA000193775_01522 CDS open 5072-5263 _na     63_aa hypothetical protein
1102 AEPH01000040.1 GCA000193775_01523 CDS open 5966-6385 _na     139_aa hypothetical protein
1103 AEPH01000040.1 GCA000193775_01514 gene open 38-475
1104 AEPH01000040.1 GCA000193775_01515 gene open 656-1060
1105 AEPH01000040.1 GCA000193775_01516 gene open 1057-1620
1106 AEPH01000040.1 GCA000193775_01517 gene open 1893-2207
1107 AEPH01000040.1 GCA000193775_01518 gene open 2234-2761
1108 AEPH01000040.1 GCA000193775_01519 gene open 2730-3416
1109 AEPH01000040.1 GCA000193775_01520 gene open 3607-4080
1110 AEPH01000040.1 GCA000193775_01521 gene open 4082-4336
1111 AEPH01000040.1 GCA000193775_01522 gene open 5072-5263
1112 AEPH01000040.1 GCA000193775_01523 gene open 5966-6385
1113 AEPH01000042.1 GCA000193775_01510 CDS open 194-421 _na     75_aa hypothetical protein
1114 AEPH01000042.1 GCA000193775_01511 CDS open 1004-1123 _na     39_aa hypothetical protein
1115 AEPH01000042.1 GCA000193775_01512 CDS open 1210-1503 _na     97_aa SMI1 / KNR4 family protein
1116 AEPH01000042.1 GCA000193775_01513 CDS open 1619-1918 _na     99_aa hypothetical protein
1117 AEPH01000042.1 GCA000193775_01510 gene open 194-421
1118 AEPH01000042.1 GCA000193775_01511 gene open 1004-1123
1119 AEPH01000042.1 GCA000193775_01512 gene open 1210-1503
1120 AEPH01000042.1 GCA000193775_01513 gene open 1619-1918
1121 AEPH01000043.1 repeat_region open 5494-5672 CRISPR array with 3 repeats of length 35%2C consensus sequence TGGTTTCAACACACAGCCGCCTAGAGGCGGCTGAG and spacer length 31
1122 AEPH01000043.1 GCA000193775_01452 CDS open 182-3019 _na     945_aa lbpA lactoferrin/transferrin-binding protein LbpA
1123 AEPH01000043.1 GCA000193775_01453 CDS open 3016-4614 _na     532_aa Lactoferrin binding protein B
1124 AEPH01000043.1 GCA000193775_01454 CDS open 4761-5207 _na     148_aa hypothetical protein
1125 AEPH01000043.1 GCA000193775_01455 CDS open 5309-5470 _na     53_aa hypothetical protein
1126 AEPH01000043.1 GCA000193775_01456 CDS open 5848-6189 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
1127 AEPH01000043.1 GCA000193775_01457 CDS open 6196-7209 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
1128 AEPH01000043.1 GCA000193775_01458 CDS open 8687-9643 _na     318_aa era GTPase Era
1129 AEPH01000043.1 GCA000193775_01459 CDS open 9658-10377 _na     239_aa rnc ribonuclease III
1130 AEPH01000043.1 GCA000193775_01460 CDS open 10545-10868 _na     107_aa DUF2185 domain-containing protein
1131 AEPH01000043.1 GCA000193775_01461 CDS open 10918-11394 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
1132 AEPH01000043.1 GCA000193775_01462 CDS open 11472-11897 _na     141_aa nusB transcription antitermination factor NusB
1133 AEPH01000043.1 GCA000193775_01463 CDS open 12043-12525 _na     160_aa hypothetical protein
1134 AEPH01000043.1 GCA000193775_01464 CDS open 12544-13578 _na     344_aa pyrC dihydroorotase
1135 AEPH01000043.1 GCA000193775_01465 CDS open 13639-14232 _na     197_aa Lipoprotein
1136 AEPH01000043.1 GCA000193775_01466 CDS open 14245-14469 _na     74_aa tusA Putative sulfur carrier protein NMB0681
1137 AEPH01000043.1 GCA000193775_01467 CDS open 14577-15188 _na     203_aa CNP1-like family protein
1138 AEPH01000043.1 GCA000193775_01468 CDS open 15247-16119 _na     290_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1139 AEPH01000043.1 GCA000193775_01469 CDS open 16157-16942 _na     261_aa trpA tryptophan synthase subunit alpha
1140 AEPH01000043.1 GCA000193775_01471 CDS open 17498-18013 _na     171_aa 3-deoxy-manno-octulosonate cytidylyltransferase
1141 AEPH01000043.1 GCA000193775_01472 CDS open 18036-18797 _na     253_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
1142 AEPH01000043.1 GCA000193775_01473 CDS open 18794-18976 _na     60_aa trm112 UPF0434 protein NMA0874
1143 AEPH01000043.1 GCA000193775_01474 CDS open 19199-19774 _na     191_aa DUF2059 domain-containing protein
1144 AEPH01000043.1 GCA000193775_01475 CDS open 19886-20425 _na     179_aa hypothetical protein
1145 AEPH01000043.1 GCA000193775_01476 CDS open 20470-21546 _na     358_aa lpxK tetraacyldisaccharide 4'-kinase
1146 AEPH01000043.1 GCA000193775_01477 CDS open 21546-21818 _na     90_aa Integral membrane protein
1147 AEPH01000043.1 GCA000193775_01478 CDS open 21907-23187 _na     426_aa sfcA Malic enzyme
1148 AEPH01000043.1 GCA000193775_01479 CDS open 23409-24029 _na     206_aa tmk dTMP kinase
1149 AEPH01000043.1 GCA000193775_01480 CDS open 24089-25084 _na     331_aa mltG Endolytic murein transglycosylase
1150 AEPH01000043.1 GCA000193775_01481 CDS open 25168-25740 _na     190_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
1151 AEPH01000043.1 GCA000193775_01482 CDS open 25935-27221 _na     428_aa ftsN Cell division protein ZipA
1152 AEPH01000043.1 GCA000193775_01483 CDS open 27331-29826 _na     831_aa ligA NAD-dependent DNA ligase LigA
1153 AEPH01000043.1 GCA000193775_01484 CDS open 29883-31058 _na     391_aa hemW radical SAM family heme chaperone HemW
1154 AEPH01000043.1 GCA000193775_01485 CDS open 31244-31822 _na     192_aa opacity family porin
1155 AEPH01000043.1 GCA000193775_01486 CDS open 31971-32360 _na     129_aa ridA Ribonuclease%2C putative
1156 AEPH01000043.1 GCA000193775_01487 CDS open 32437-33267 _na     276_aa apaH symmetrical bis(5'-nucleosyl)-tetraphosphatase
1157 AEPH01000043.1 GCA000193775_01488 CDS open 33282-34739 _na     485_aa trkG Trk system potassium uptake protein
1158 AEPH01000043.1 GCA000193775_01490 CDS open 35138-35596 _na     152_aa nudB dihydroneopterin triphosphate diphosphatase
1159 AEPH01000043.1 GCA000193775_01491 CDS open 35698-36231 _na     177_aa ppa Inorganic pyrophosphatase
1160 AEPH01000043.1 GCA000193775_01492 CDS open 36369-36602 _na     77_aa NGO_0222 family membrane protein
1161 AEPH01000043.1 GCA000193775_01493 CDS open 36595-37194 _na     199_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
1162 AEPH01000043.1 GCA000193775_01494 CDS open 37370-38239 _na     289_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
1163 AEPH01000043.1 GCA000193775_01495 CDS open 38258-39634 _na     458_aa argH argininosuccinate lyase
1164 AEPH01000043.1 GCA000193775_01496 CDS open 39692-40162 _na     156_aa DUF4375 domain-containing protein
1165 AEPH01000043.1 GCA000193775_01497 CDS open 40461-41456 _na     331_aa Major ferric iron binding protein
1166 AEPH01000043.1 GCA000193775_01498 CDS open 41521-43038 _na     505_aa ABC transporter%2C permease protein
1167 AEPH01000043.1 GCA000193775_01499 CDS open 43060-44124 _na     354_aa Fe(3+)-transporting ATPase
1168 AEPH01000043.1 GCA000193775_01500 CDS open 44365-45867 _na     500_aa pta phosphate acetyltransferase
1169 AEPH01000043.1 GCA000193775_01501 CDS open 45998-46636 _na     212_aa hisH imidazole glycerol phosphate synthase subunit HisH
1170 AEPH01000043.1 GCA000193775_01502 CDS open 46669-47406 _na     245_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
1171 AEPH01000043.1 GCA000193775_01503 CDS open 47419-48186 _na     255_aa hisF Imidazole glycerol phosphate synthase subunit HisF
1172 AEPH01000043.1 GCA000193775_01504 CDS open 48217-48612 _na     131_aa hisI phosphoribosyl-AMP cyclohydrolase
1173 AEPH01000043.1 GCA000193775_01505 CDS open 48719-50314 _na     531_aa prfC peptide chain release factor 3
1174 AEPH01000043.1 GCA000193775_01506 CDS open 50555-50938 _na     127_aa DUF305 domain-containing protein
1175 AEPH01000043.1 GCA000193775_01507 CDS open 51314-51592 _na     92_aa Transferase
1176 AEPH01000043.1 GCA000193775_01508 CDS open 51671-52207 _na     178_aa Transferase
1177 AEPH01000043.1 GCA000193775_01509 CDS open 52248-52772 _na     174_aa glycosyl transferase
1178 AEPH01000043.1 GCA000193775_01452 gene open 182-3019 lbpA
1179 AEPH01000043.1 GCA000193775_01453 gene open 3016-4614
1180 AEPH01000043.1 GCA000193775_01454 gene open 4761-5207
1181 AEPH01000043.1 GCA000193775_01455 gene open 5309-5470
1182 AEPH01000043.1 GCA000193775_01456 gene open 5848-6189 cas2
1183 AEPH01000043.1 GCA000193775_01457 gene open 6196-7209 cas1c
1184 AEPH01000043.1 GCA000193775_01458 gene open 8687-9643 era
1185 AEPH01000043.1 GCA000193775_01459 gene open 9658-10377 rnc
1186 AEPH01000043.1 GCA000193775_01460 gene open 10545-10868
1187 AEPH01000043.1 GCA000193775_01461 gene open 10918-11394 ribH
1188 AEPH01000043.1 GCA000193775_01462 gene open 11472-11897 nusB
1189 AEPH01000043.1 GCA000193775_01463 gene open 12043-12525
1190 AEPH01000043.1 GCA000193775_01464 gene open 12544-13578 pyrC
1191 AEPH01000043.1 GCA000193775_01465 gene open 13639-14232
1192 AEPH01000043.1 GCA000193775_01466 gene open 14245-14469 tusA
1193 AEPH01000043.1 GCA000193775_01467 gene open 14577-15188
1194 AEPH01000043.1 GCA000193775_01468 gene open 15247-16119 accD
1195 AEPH01000043.1 GCA000193775_01469 gene open 16157-16942 trpA
1196 AEPH01000043.1 GCA000193775_01471 gene open 17498-18013
1197 AEPH01000043.1 GCA000193775_01472 gene open 18036-18797 kdsB
1198 AEPH01000043.1 GCA000193775_01473 gene open 18794-18976 trm112
1199 AEPH01000043.1 GCA000193775_01474 gene open 19199-19774
1200 AEPH01000043.1 GCA000193775_01475 gene open 19886-20425
1201 AEPH01000043.1 GCA000193775_01476 gene open 20470-21546 lpxK
1202 AEPH01000043.1 GCA000193775_01477 gene open 21546-21818
1203 AEPH01000043.1 GCA000193775_01478 gene open 21907-23187 sfcA
1204 AEPH01000043.1 GCA000193775_01479 gene open 23409-24029 tmk
1205 AEPH01000043.1 GCA000193775_01480 gene open 24089-25084 mltG
1206 AEPH01000043.1 GCA000193775_01481 gene open 25168-25740 ampD
1207 AEPH01000043.1 GCA000193775_01482 gene open 25935-27221 ftsN
1208 AEPH01000043.1 GCA000193775_01483 gene open 27331-29826 ligA
1209 AEPH01000043.1 GCA000193775_01484 gene open 29883-31058 hemW
1210 AEPH01000043.1 GCA000193775_01485 gene open 31244-31822
1211 AEPH01000043.1 GCA000193775_01486 gene open 31971-32360 ridA
1212 AEPH01000043.1 GCA000193775_01487 gene open 32437-33267 apaH
1213 AEPH01000043.1 GCA000193775_01488 gene open 33282-34739 trkG
1214 AEPH01000043.1 GCA000193775_01490 gene open 35138-35596 nudB
1215 AEPH01000043.1 GCA000193775_01491 gene open 35698-36231 ppa
1216 AEPH01000043.1 GCA000193775_01492 gene open 36369-36602
1217 AEPH01000043.1 GCA000193775_01493 gene open 36595-37194 rdgB
1218 AEPH01000043.1 GCA000193775_01494 gene open 37370-38239 galU
1219 AEPH01000043.1 GCA000193775_01495 gene open 38258-39634 argH
1220 AEPH01000043.1 GCA000193775_01496 gene open 39692-40162
1221 AEPH01000043.1 GCA000193775_01497 gene open 40461-41456
1222 AEPH01000043.1 GCA000193775_01498 gene open 41521-43038
1223 AEPH01000043.1 GCA000193775_01499 gene open 43060-44124
1224 AEPH01000043.1 GCA000193775_01500 gene open 44365-45867 pta
1225 AEPH01000043.1 GCA000193775_01501 gene open 45998-46636 hisH
1226 AEPH01000043.1 GCA000193775_01502 gene open 46669-47406 hisA
1227 AEPH01000043.1 GCA000193775_01503 gene open 47419-48186 hisF
1228 AEPH01000043.1 GCA000193775_01504 gene open 48217-48612 hisI
1229 AEPH01000043.1 GCA000193775_01505 gene open 48719-50314 prfC
1230 AEPH01000043.1 GCA000193775_01506 gene open 50555-50938
1231 AEPH01000043.1 GCA000193775_01507 gene open 51314-51592
1232 AEPH01000043.1 GCA000193775_01508 gene open 51671-52207
1233 AEPH01000043.1 GCA000193775_01509 gene open 52248-52772
1234 AEPH01000043.1 GCA000193775_01470 gene open 17215-17307 trnS
1235 AEPH01000043.1 GCA000193775_01489 gene open 34853-34929 trnP
1236 AEPH01000043.1 GCA000193775_01470 tRNA open 17215-17307 trnS tRNA-Ser(gct)
1237 AEPH01000043.1 GCA000193775_01489 tRNA open 34853-34929 trnP tRNA-Pro(ggg)
1238 AEPH01000044.1 GCA000193775_01441 CDS open 992-2497 _na     501_aa Fido domain-containing protein
1239 AEPH01000044.1 GCA000193775_01442 CDS open 2534-3670 _na     378_aa Putative transposase family protein
1240 AEPH01000044.1 GCA000193775_01443 CDS open 4071-5324 _na     417_aa hipA Type II toxin-antitoxin system HipA family toxin
1241 AEPH01000044.1 GCA000193775_01444 CDS open 5747-7153 _na     468_aa dnaB replicative DNA helicase
1242 AEPH01000044.1 GCA000193775_01445 CDS open 7260-8369 _na     369_aa repM replication initiation protein RepM
1243 AEPH01000044.1 GCA000193775_01446 CDS open 10137-10397 _na     86_aa hypothetical protein
1244 AEPH01000044.1 GCA000193775_01447 CDS open 10398-11075 _na     225_aa parA ParA family partition ATPase
1245 AEPH01000044.1 GCA000193775_01448 CDS open 11279-11524 _na     81_aa transposase
1246 AEPH01000044.1 GCA000193775_01449 CDS open 11543-11719 _na     58_aa hypothetical protein
1247 AEPH01000044.1 GCA000193775_01450 CDS open 12101-12577 _na     158_aa hypothetical protein
1248 AEPH01000044.1 GCA000193775_01451 CDS open 12582-13130 _na     182_aa RHS repeat-associated core domain-containing protein
1249 AEPH01000044.1 GCA000193775_01441 gene open 992-2497
1250 AEPH01000044.1 GCA000193775_01442 gene open 2534-3670
1251 AEPH01000044.1 GCA000193775_01443 gene open 4071-5324 hipA
1252 AEPH01000044.1 GCA000193775_01444 gene open 5747-7153 dnaB
1253 AEPH01000044.1 GCA000193775_01445 gene open 7260-8369 repM
1254 AEPH01000044.1 GCA000193775_01446 gene open 10137-10397
1255 AEPH01000044.1 GCA000193775_01447 gene open 10398-11075 parA
1256 AEPH01000044.1 GCA000193775_01448 gene open 11279-11524
1257 AEPH01000044.1 GCA000193775_01449 gene open 11543-11719
1258 AEPH01000044.1 GCA000193775_01450 gene open 12101-12577
1259 AEPH01000044.1 GCA000193775_01451 gene open 12582-13130
1260 AEPH01000045.1 GCA000193775_01424 CDS open 206-757 _na     183_aa tagF type VI secretion system-associated protein TagF
1261 AEPH01000045.1 GCA000193775_01425 CDS open 762-1829 _na     355_aa tssA type VI secretion system protein TssA
1262 AEPH01000045.1 GCA000193775_01426 CDS open 1897-2415 _na     172_aa tssB type VI secretion system contractile sheath small subunit
1263 AEPH01000045.1 GCA000193775_01427 CDS open 2449-3948 _na     499_aa tssC type VI secretion system contractile sheath large subunit
1264 AEPH01000045.1 GCA000193775_01428 CDS open 4036-4518 _na     160_aa Hemolysin-coregulated protein (putative)
1265 AEPH01000045.1 GCA000193775_01429 CDS open 4679-5494 _na     271_aa impE ImpE protein
1266 AEPH01000045.1 GCA000193775_01430 CDS open 5528-6040 _na     170_aa tssE type VI secretion system baseplate subunit TssE
1267 AEPH01000045.1 GCA000193775_01431 CDS open 6037-8013 _na     658_aa tssF type VI secretion system baseplate subunit TssF
1268 AEPH01000045.1 GCA000193775_01432 CDS open 8010-9050 _na     346_aa tssG type VI secretion system baseplate subunit TssG
1269 AEPH01000045.1 GCA000193775_01433 CDS open 9141-11792 _na     883_aa tssH type VI secretion system ATPase TssH
1270 AEPH01000045.1 GCA000193775_01434 CDS open 11984-12562 _na     192_aa tssJ type VI secretion system lipoprotein TssJ
1271 AEPH01000045.1 GCA000193775_01435 CDS open 12588-13931 _na     447_aa tssK type VI secretion system baseplate subunit TssK
1272 AEPH01000045.1 GCA000193775_01436 CDS open 13956-15221 _na     421_aa icmH type IVB secretion system protein IcmH/DotU
1273 AEPH01000045.1 GCA000193775_01437 CDS open 15253-18810 _na     1185_aa tssM type VI secretion system membrane subunit TssM
1274 AEPH01000045.1 GCA000193775_01438 CDS open 18953-21226 _na     757_aa vgrG1 Actin cross-linking toxin VgrG1
1275 AEPH01000045.1 GCA000193775_01439 CDS open 21239-21796 _na     185_aa DUF2169 domain-containing protein
1276 AEPH01000045.1 GCA000193775_01440 CDS open 21829-22374 _na     181_aa DUF2169 domain-containing protein
1277 AEPH01000045.1 GCA000193775_01424 gene open 206-757 tagF
1278 AEPH01000045.1 GCA000193775_01425 gene open 762-1829 tssA
1279 AEPH01000045.1 GCA000193775_01426 gene open 1897-2415 tssB
1280 AEPH01000045.1 GCA000193775_01427 gene open 2449-3948 tssC
1281 AEPH01000045.1 GCA000193775_01428 gene open 4036-4518
1282 AEPH01000045.1 GCA000193775_01429 gene open 4679-5494 impE
1283 AEPH01000045.1 GCA000193775_01430 gene open 5528-6040 tssE
1284 AEPH01000045.1 GCA000193775_01431 gene open 6037-8013 tssF
1285 AEPH01000045.1 GCA000193775_01432 gene open 8010-9050 tssG
1286 AEPH01000045.1 GCA000193775_01433 gene open 9141-11792 tssH
1287 AEPH01000045.1 GCA000193775_01434 gene open 11984-12562 tssJ
1288 AEPH01000045.1 GCA000193775_01435 gene open 12588-13931 tssK
1289 AEPH01000045.1 GCA000193775_01436 gene open 13956-15221 icmH
1290 AEPH01000045.1 GCA000193775_01437 gene open 15253-18810 tssM
1291 AEPH01000045.1 GCA000193775_01438 gene open 18953-21226 vgrG1
1292 AEPH01000045.1 GCA000193775_01439 gene open 21239-21796
1293 AEPH01000045.1 GCA000193775_01440 gene open 21829-22374
1294 AEPH01000046.1 GCA000193775_01329 gene open 29819-29998 6S
1295 AEPH01000046.1 GCA000193775_01349 gene open 49076-49234 nrrF
1296 AEPH01000046.1 GCA000193775_01329 ncRNA open 29819-29998 6S / SsrS RNA
1297 AEPH01000046.1 GCA000193775_01349 ncRNA open 49076-49234 nrrF NrrF RNA
1298 AEPH01000046.1 regulatory_region open 14378-14477 TPP riboswitch aptamer (THI element)
1299 AEPH01000046.1 regulatory_region open 43391-43495 TPP riboswitch aptamer (THI element)
1300 AEPH01000046.1 GCA000193775_01295 CDS open 80-742 _na     220_aa rluA Pseudouridine synthase RsuA/RluA-like domain-containing protein
1301 AEPH01000046.1 GCA000193775_01296 CDS open 780-1280 _na     166_aa coaD pantetheine-phosphate adenylyltransferase
1302 AEPH01000046.1 GCA000193775_01297 CDS open 1509-2192 _na     227_aa ybhL putative protein NMB2020
1303 AEPH01000046.1 GCA000193775_01298 CDS open 2349-2615 _na     88_aa yggX oxidative damage protection protein
1304 AEPH01000046.1 GCA000193775_01299 CDS open 2690-3196 _na     168_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
1305 AEPH01000046.1 GCA000193775_01300 CDS open 3214-3600 _na     128_aa rsfS ribosome silencing factor
1306 AEPH01000046.1 GCA000193775_01301 CDS open 3659-4264 _na     201_aa nadD nicotinate-nucleotide adenylyltransferase
1307 AEPH01000046.1 GCA000193775_01302 CDS open 4261-4860 _na     199_aa Carbonate dehydratase
1308 AEPH01000046.1 GCA000193775_01303 CDS open 4889-6430 _na     513_aa ABC transporter permease subunit
1309 AEPH01000046.1 GCA000193775_01304 CDS open 6675-7592 _na     305_aa thrB homoserine kinase
1310 AEPH01000046.1 GCA000193775_01305 CDS open 7628-8344 _na     238_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
1311 AEPH01000046.1 GCA000193775_01306 CDS open 8405-9751 _na     448_aa sdaC Aromatic amino acid permease
1312 AEPH01000046.1 GCA000193775_01307 CDS open 9884-10447 _na     187_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
1313 AEPH01000046.1 GCA000193775_01308 CDS open 10476-11219 _na     247_aa plsC 1-acyl-SN-glycerol-3-phosphate acyltransferase
1314 AEPH01000046.1 GCA000193775_01309 CDS open 11216-11905 _na     229_aa YgjP-like metallopeptidase domain-containing protein
1315 AEPH01000046.1 GCA000193775_01310 CDS open 11941-12228 _na     95_aa hypothetical protein
1316 AEPH01000046.1 GCA000193775_01311 CDS open 12386-14287 _na     633_aa thiC phosphomethylpyrimidine synthase ThiC
1317 AEPH01000046.1 GCA000193775_01313 CDS open 14885-15760 _na     291_aa yjhB Nudix hydrolase domain-containing protein
1318 AEPH01000046.1 GCA000193775_01314 CDS open 15769-16707 _na     312_aa potA ABC transporter ATP-binding protein
1319 AEPH01000046.1 GCA000193775_01315 CDS open 16829-18604 _na     591_aa ptsA Phosphoenolpyruvate-protein phosphotransferase
1320 AEPH01000046.1 GCA000193775_01316 CDS open 18604-18873 _na     89_aa ptsH Phosphocarrier%2C HPr family
1321 AEPH01000046.1 GCA000193775_01317 CDS open 18942-19379 _na     145_aa PTS system fructose IIA component
1322 AEPH01000046.1 GCA000193775_01318 CDS open 19461-20024 _na     187_aa hptA hypoxanthine-guanine phosphoribosyltransferase
1323 AEPH01000046.1 GCA000193775_01319 CDS open 20093-20917 _na     274_aa cDC9 DNA ligase
1324 AEPH01000046.1 GCA000193775_01320 CDS open 21008-21640 _na     210_aa gloB Glyoxalase II family protein
1325 AEPH01000046.1 GCA000193775_01321 CDS open 21846-23630 _na     594_aa rmuC DNA recombination protein RmuC
1326 AEPH01000046.1 GCA000193775_01322 CDS open 23969-24757 _na     262_aa cYT1 Ubiquinol--cytochrome c reductase%2C cytochrome c1
1327 AEPH01000046.1 GCA000193775_01323 CDS open 24772-26121 _na     449_aa petB Cytochrome b
1328 AEPH01000046.1 GCA000193775_01324 CDS open 26140-26721 _na     193_aa petA ubiquinol-cytochrome c reductase iron-sulfur subunit
1329 AEPH01000046.1 GCA000193775_01325 CDS open 26844-27593 _na     249_aa Nif3-like dinuclear metal center hexameric protein
1330 AEPH01000046.1 GCA000193775_01326 CDS open 27724-28653 _na     309_aa metR HTH-type transcriptional regulator MetR
1331 AEPH01000046.1 GCA000193775_01327 CDS open 28808-29200 _na     130_aa rpsI 30S ribosomal protein S9
1332 AEPH01000046.1 GCA000193775_01328 CDS open 29210-29641 _na     143_aa rplM 50S ribosomal protein L13
1333 AEPH01000046.1 GCA000193775_01330 CDS open 30004-30309 _na     101_aa zapA Cell division protein ZapA
1334 AEPH01000046.1 GCA000193775_01331 CDS open 30320-30649 _na     109_aa BZIP transcription factor
1335 AEPH01000046.1 GCA000193775_01332 CDS open 30704-31693 _na     329_aa gpsA Glycerol-3-phosphate dehydrogenase [NAD(P)+]
1336 AEPH01000046.1 GCA000193775_01333 CDS open 31816-34518 _na     900_aa ppc phosphoenolpyruvate carboxylase
1337 AEPH01000046.1 GCA000193775_01334 CDS open 34594-35058 _na     154_aa hypothetical protein
1338 AEPH01000046.1 GCA000193775_01335 CDS open 35864-36088 _na     74_aa slyX Protein SlyX-like protein
1339 AEPH01000046.1 GCA000193775_01336 CDS open 36089-37477 _na     462_aa yuiF Histidine permease YuiF
1340 AEPH01000046.1 GCA000193775_01337 CDS open 37563-38384 _na     273_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1341 AEPH01000046.1 GCA000193775_01338 CDS open 38659-39558 _na     299_aa amino acid ABC transporter substrate-binding protein
1342 AEPH01000046.1 GCA000193775_01339 CDS open 39632-40363 _na     243_aa glnQ Glutamine transport ATP-binding protein GlnQ
1343 AEPH01000046.1 GCA000193775_01340 CDS open 40365-41033 _na     222_aa hisM ABC transporter permease%2C amino acid
1344 AEPH01000046.1 GCA000193775_01341 CDS open 41023-41682 _na     219_aa hisM ABC transporter permease%2C amino acid
1345 AEPH01000046.1 GCA000193775_01342 CDS open 41832-43274 _na     480_aa tldD metalloprotease TldD
1346 AEPH01000046.1 GCA000193775_01343 CDS open 43560-44795 _na     411_aa cytX Putative hydroxymethylpyrimidine transporter CytX
1347 AEPH01000046.1 GCA000193775_01344 CDS open 44792-45901 _na     369_aa dadA D-amino-acid oxidase
1348 AEPH01000046.1 GCA000193775_01345 CDS open 45912-46535 _na     207_aa thiE thiamine phosphate synthase
1349 AEPH01000046.1 GCA000193775_01346 CDS open 46671-47318 _na     215_aa DUF4304 domain-containing protein
1350 AEPH01000046.1 GCA000193775_01347 CDS open 47433-47627 _na     64_aa thiS sulfur carrier protein ThiS
1351 AEPH01000046.1 GCA000193775_01348 CDS open 47703-48491 _na     262_aa thiG Thiazole synthase
1352 AEPH01000046.1 GCA000193775_01350 CDS open 49246-50112 _na     288_aa Sporulation and cell division repeat protein
1353 AEPH01000046.1 GCA000193775_01351 CDS open 50124-51902 _na     592_aa birA bifunctional biotin--[acetyl-CoA-carboxylase] ligase/type III pantothenate kinase
1354 AEPH01000046.1 GCA000193775_01352 CDS open 51899-52405 _na     168_aa rfaE D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase
1355 AEPH01000046.1 GCA000193775_01356 CDS open 53114-53968 _na     284_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
1356 AEPH01000046.1 GCA000193775_01357 CDS open 54030-54611 _na     193_aa yckC RDD domain-containing protein
1357 AEPH01000046.1 GCA000193775_01358 CDS open 54786-55901 _na     371_aa Aspartate-semialdehyde dehydrogenase
1358 AEPH01000046.1 GCA000193775_01359 CDS open 55995-56525 _na     176_aa Serine hydrolase family protein
1359 AEPH01000046.1 GCA000193775_01360 CDS open 56535-56879 _na     114_aa Expressed protein
1360 AEPH01000046.1 GCA000193775_01361 CDS open 56866-57645 _na     259_aa xthA exodeoxyribonuclease III
1361 AEPH01000046.1 GCA000193775_01362 CDS open 57733-59154 _na     473_aa cysS cysteine--tRNA ligase
1362 AEPH01000046.1 GCA000193775_01363 CDS open 59170-60222 _na     350_aa ngoBIR Type II restriction enzyme NgoBI
1363 AEPH01000046.1 GCA000193775_01364 CDS open 60219-61166 _na     315_aa dcm Cytosine-specific methyltransferase
1364 AEPH01000046.1 GCA000193775_01365 CDS open 61220-62374 _na     384_aa obgE GTPase ObgE
1365 AEPH01000046.1 GCA000193775_01366 CDS open 62654-63184 _na     176_aa cybB Cytochrome b
1366 AEPH01000046.1 GCA000193775_01367 CDS open 63219-64094 _na     291_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
1367 AEPH01000046.1 GCA000193775_01368 CDS open 64245-64592 _na     115_aa yraN YraN family protein
1368 AEPH01000046.1 GCA000193775_01369 CDS open 64597-65190 _na     197_aa gmhA phosphoheptose isomerase
1369 AEPH01000046.1 GCA000193775_01370 CDS open 65254-65862 _na     202_aa osmY Hemolysin
1370 AEPH01000046.1 GCA000193775_01371 CDS open 65870-66520 _na     216_aa Similar to Apopolysialoglycoprotein (PSGP)
1371 AEPH01000046.1 GCA000193775_01372 CDS open 66560-67339 _na     259_aa map type I methionyl aminopeptidase
1372 AEPH01000046.1 GCA000193775_01373 CDS open 67493-67792 _na     99_aa RsaL-like HTH domain-containing protein
1373 AEPH01000046.1 GCA000193775_01374 CDS open 68030-68404 _na     124_aa Adhesin complex protein
1374 AEPH01000046.1 GCA000193775_01375 CDS open 68592-70058 _na     488_aa mqo malate:quinone oxidoreductase
1375 AEPH01000046.1 GCA000193775_01376 CDS open 70443-71033 _na     196_aa rimL N-acetyltransferase domain-containing protein
1376 AEPH01000046.1 GCA000193775_01377 CDS open 71094-71675 _na     193_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
1377 AEPH01000046.1 GCA000193775_01378 CDS open 71753-71995 _na     80_aa Integral membrane protein
1378 AEPH01000046.1 GCA000193775_01379 CDS open 72172-72900 _na     242_aa rpsB 30S ribosomal protein S2
1379 AEPH01000046.1 GCA000193775_01380 CDS open 73029-73883 _na     284_aa tsf translation elongation factor Ts
1380 AEPH01000046.1 GCA000193775_01381 CDS open 74208-74927 _na     239_aa pyrH UMP kinase
1381 AEPH01000046.1 GCA000193775_01382 CDS open 75297-75836 _na     179_aa Knr4/Smi1-like domain-containing protein
1382 AEPH01000046.1 GCA000193775_01383 CDS open 76190-78397 _na     735_aa uvrD DNA helicase II
1383 AEPH01000046.1 GCA000193775_01384 CDS open 78517-78762 _na     81_aa helix-turn-helix domain-containing protein
1384 AEPH01000046.1 GCA000193775_01385 CDS open 80168-80509 _na     113_aa hypothetical protein
1385 AEPH01000046.1 GCA000193775_01386 CDS open 80469-80708 _na     79_aa hypothetical protein
1386 AEPH01000046.1 GCA000193775_01387 CDS open 80749-81243 _na     164_aa DUF1436 domain-containing protein
1387 AEPH01000046.1 GCA000193775_01388 CDS open 81243-84014 _na     923_aa DUF6862 domain-containing protein
1388 AEPH01000046.1 GCA000193775_01389 CDS open 84765-85085 _na     106_aa hypothetical protein
1389 AEPH01000046.1 GCA000193775_01390 CDS open 85142-87934 _na     930_aa polA DNA polymerase I
1390 AEPH01000046.1 GCA000193775_01391 CDS open 88037-88519 _na     160_aa DUF2247 domain-containing protein
1391 AEPH01000046.1 GCA000193775_01392 CDS open 88564-88719 _na     51_aa Phage associated protein
1392 AEPH01000046.1 GCA000193775_01393 CDS open 88932-89255 _na     107_aa hypothetical protein
1393 AEPH01000046.1 GCA000193775_01394 CDS open 89569-90402 _na     277_aa nikM Nickel transport complex%2C NikM subunit%2C transmembrane
1394 AEPH01000046.1 GCA000193775_01395 CDS open 90579-90752 _na     57_aa ISXO2-like transposase domain-containing protein
1395 AEPH01000046.1 GCA000193775_01396 CDS open 91395-92405 _na     336_aa quinone-dependent dihydroorotate dehydrogenase
1396 AEPH01000046.1 GCA000193775_01397 CDS open 92636-92872 _na     78_aa acpP acyl carrier protein
1397 AEPH01000046.1 GCA000193775_01398 CDS open 93028-94275 _na     415_aa fabF beta-ketoacyl-ACP synthase II
1398 AEPH01000046.1 GCA000193775_01399 CDS open 94479-95693 _na     404_aa Major Facilitator Superfamily protein
1399 AEPH01000046.1 GCA000193775_01402 CDS open 96259-98238 _na     659_aa Glutathione-regulated potassium-efflux system protein
1400 AEPH01000046.1 GCA000193775_01403 CDS open 98387-99226 _na     279_aa rnfB Ferredoxin
1401 AEPH01000046.1 GCA000193775_01404 CDS open 99424-100455 _na     343_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1402 AEPH01000046.1 GCA000193775_01405 CDS open 100606-101331 _na     241_aa aat leucyl/phenylalanyl-tRNA--protein transferase
1403 AEPH01000046.1 GCA000193775_01406 CDS open 101401-101835 _na     144_aa fur ferric iron uptake transcriptional regulator
1404 AEPH01000046.1 GCA000193775_01407 CDS open 102062-102439 _na     125_aa bamE Outer membrane protein assembly factor BamE
1405 AEPH01000046.1 GCA000193775_01408 CDS open 102449-103258 _na     269_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
1406 AEPH01000046.1 GCA000193775_01409 CDS open 103701-104666 _na     321_aa IS110 family transposase
1407 AEPH01000046.1 GCA000193775_01410 CDS open 105344-105436 _na     30_aa hypothetical protein
1408 AEPH01000046.1 GCA000193775_01411 CDS open 105472-106641 _na     389_aa Zonular occludens toxin domain-containing protein
1409 AEPH01000046.1 GCA000193775_01412 CDS open 106644-106925 _na     93_aa DUF2523 domain-containing protein
1410 AEPH01000046.1 GCA000193775_01413 CDS open 106934-108451 _na     505_aa tspB IgG-binding virulence factor TspB family protein
1411 AEPH01000046.1 GCA000193775_01414 CDS open 108817-109125 _na     102_aa hypothetical protein
1412 AEPH01000046.1 GCA000193775_01415 CDS open 109141-109383 _na     80_aa Phage coat protein
1413 AEPH01000046.1 GCA000193775_01416 CDS open 109555-109752 _na     65_aa Phage associated protein
1414 AEPH01000046.1 GCA000193775_01417 CDS open 109757-110047 _na     96_aa Phage associated protein
1415 AEPH01000046.1 GCA000193775_01418 CDS open 110092-111438 _na     448_aa Replication initiation protein-like C-terminal domain-containing protein
1416 AEPH01000046.1 GCA000193775_01419 CDS open 111553-112014 _na     153_aa hypothetical protein
1417 AEPH01000046.1 GCA000193775_01420 CDS open 112338-112748 _na     136_aa Phage associated protein
1418 AEPH01000046.1 GCA000193775_01421 CDS open 113002-114174 _na     390_aa lpxB lipid-A-disaccharide synthase
1419 AEPH01000046.1 GCA000193775_01422 CDS open 114222-115214 _na     330_aa rluA Pseudouridine synthase
1420 AEPH01000046.1 GCA000193775_01423 CDS open 115682-118465 _na     927_aa Ribonuclease E
1421 AEPH01000046.1 GCA000193775_01295 gene open 80-742 rluA
1422 AEPH01000046.1 GCA000193775_01296 gene open 780-1280 coaD
1423 AEPH01000046.1 GCA000193775_01297 gene open 1509-2192 ybhL
1424 AEPH01000046.1 GCA000193775_01298 gene open 2349-2615 yggX
1425 AEPH01000046.1 GCA000193775_01299 gene open 2690-3196 rlmH
1426 AEPH01000046.1 GCA000193775_01300 gene open 3214-3600 rsfS
1427 AEPH01000046.1 GCA000193775_01301 gene open 3659-4264 nadD
1428 AEPH01000046.1 GCA000193775_01302 gene open 4261-4860
1429 AEPH01000046.1 GCA000193775_01303 gene open 4889-6430
1430 AEPH01000046.1 GCA000193775_01304 gene open 6675-7592 thrB
1431 AEPH01000046.1 GCA000193775_01305 gene open 7628-8344 ubiG
1432 AEPH01000046.1 GCA000193775_01306 gene open 8405-9751 sdaC
1433 AEPH01000046.1 GCA000193775_01307 gene open 9884-10447 gmhB
1434 AEPH01000046.1 GCA000193775_01308 gene open 10476-11219 plsC
1435 AEPH01000046.1 GCA000193775_01309 gene open 11216-11905
1436 AEPH01000046.1 GCA000193775_01310 gene open 11941-12228
1437 AEPH01000046.1 GCA000193775_01311 gene open 12386-14287 thiC
1438 AEPH01000046.1 GCA000193775_01313 gene open 14885-15760 yjhB
1439 AEPH01000046.1 GCA000193775_01314 gene open 15769-16707 potA
1440 AEPH01000046.1 GCA000193775_01315 gene open 16829-18604 ptsA
1441 AEPH01000046.1 GCA000193775_01316 gene open 18604-18873 ptsH
1442 AEPH01000046.1 GCA000193775_01317 gene open 18942-19379
1443 AEPH01000046.1 GCA000193775_01318 gene open 19461-20024 hptA
1444 AEPH01000046.1 GCA000193775_01319 gene open 20093-20917 cDC9
1445 AEPH01000046.1 GCA000193775_01320 gene open 21008-21640 gloB
1446 AEPH01000046.1 GCA000193775_01321 gene open 21846-23630 rmuC
1447 AEPH01000046.1 GCA000193775_01322 gene open 23969-24757 cYT1
1448 AEPH01000046.1 GCA000193775_01323 gene open 24772-26121 petB
1449 AEPH01000046.1 GCA000193775_01324 gene open 26140-26721 petA
1450 AEPH01000046.1 GCA000193775_01325 gene open 26844-27593
1451 AEPH01000046.1 GCA000193775_01326 gene open 27724-28653 metR
1452 AEPH01000046.1 GCA000193775_01327 gene open 28808-29200 rpsI
1453 AEPH01000046.1 GCA000193775_01328 gene open 29210-29641 rplM
1454 AEPH01000046.1 GCA000193775_01330 gene open 30004-30309 zapA
1455 AEPH01000046.1 GCA000193775_01331 gene open 30320-30649
1456 AEPH01000046.1 GCA000193775_01332 gene open 30704-31693 gpsA
1457 AEPH01000046.1 GCA000193775_01333 gene open 31816-34518 ppc
1458 AEPH01000046.1 GCA000193775_01334 gene open 34594-35058
1459 AEPH01000046.1 GCA000193775_01335 gene open 35864-36088 slyX
1460 AEPH01000046.1 GCA000193775_01336 gene open 36089-37477 yuiF
1461 AEPH01000046.1 GCA000193775_01337 gene open 37563-38384 prmC
1462 AEPH01000046.1 GCA000193775_01338 gene open 38659-39558
1463 AEPH01000046.1 GCA000193775_01339 gene open 39632-40363 glnQ
1464 AEPH01000046.1 GCA000193775_01340 gene open 40365-41033 hisM
1465 AEPH01000046.1 GCA000193775_01341 gene open 41023-41682 hisM
1466 AEPH01000046.1 GCA000193775_01342 gene open 41832-43274 tldD
1467 AEPH01000046.1 GCA000193775_01343 gene open 43560-44795 cytX
1468 AEPH01000046.1 GCA000193775_01344 gene open 44792-45901 dadA
1469 AEPH01000046.1 GCA000193775_01345 gene open 45912-46535 thiE
1470 AEPH01000046.1 GCA000193775_01346 gene open 46671-47318
1471 AEPH01000046.1 GCA000193775_01347 gene open 47433-47627 thiS
1472 AEPH01000046.1 GCA000193775_01348 gene open 47703-48491 thiG
1473 AEPH01000046.1 GCA000193775_01350 gene open 49246-50112
1474 AEPH01000046.1 GCA000193775_01351 gene open 50124-51902 birA
1475 AEPH01000046.1 GCA000193775_01352 gene open 51899-52405 rfaE
1476 AEPH01000046.1 GCA000193775_01356 gene open 53114-53968 folD
1477 AEPH01000046.1 GCA000193775_01357 gene open 54030-54611 yckC
1478 AEPH01000046.1 GCA000193775_01358 gene open 54786-55901
1479 AEPH01000046.1 GCA000193775_01359 gene open 55995-56525
1480 AEPH01000046.1 GCA000193775_01360 gene open 56535-56879
1481 AEPH01000046.1 GCA000193775_01361 gene open 56866-57645 xthA
1482 AEPH01000046.1 GCA000193775_01362 gene open 57733-59154 cysS
1483 AEPH01000046.1 GCA000193775_01363 gene open 59170-60222 ngoBIR
1484 AEPH01000046.1 GCA000193775_01364 gene open 60219-61166 dcm
1485 AEPH01000046.1 GCA000193775_01365 gene open 61220-62374 obgE
1486 AEPH01000046.1 GCA000193775_01366 gene open 62654-63184 cybB
1487 AEPH01000046.1 GCA000193775_01367 gene open 63219-64094 rsmI
1488 AEPH01000046.1 GCA000193775_01368 gene open 64245-64592 yraN
1489 AEPH01000046.1 GCA000193775_01369 gene open 64597-65190 gmhA
1490 AEPH01000046.1 GCA000193775_01370 gene open 65254-65862 osmY
1491 AEPH01000046.1 GCA000193775_01371 gene open 65870-66520
1492 AEPH01000046.1 GCA000193775_01372 gene open 66560-67339 map
1493 AEPH01000046.1 GCA000193775_01373 gene open 67493-67792
1494 AEPH01000046.1 GCA000193775_01374 gene open 68030-68404
1495 AEPH01000046.1 GCA000193775_01375 gene open 68592-70058 mqo
1496 AEPH01000046.1 GCA000193775_01376 gene open 70443-71033 rimL
1497 AEPH01000046.1 GCA000193775_01377 gene open 71094-71675 fAU1
1498 AEPH01000046.1 GCA000193775_01378 gene open 71753-71995
1499 AEPH01000046.1 GCA000193775_01379 gene open 72172-72900 rpsB
1500 AEPH01000046.1 GCA000193775_01380 gene open 73029-73883 tsf