BAKTAGenome Explorer: Lentilactobacillus buchneri (GCA_000298115.2)
Select a Genome:
|
BAKTA Annotations for GCA_000298115.2
|
Search & Sort all 5062 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CP003043.1 | GCA000298115_00895 | gene | open | 922493-922856 | ssrA | ||
| 2 | CP003043.1 | GCA000298115_00895 | tmRNA | open | 922493-922856 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | CP003043.1 | rep_origin | open | 1613-1801 | ||||
| 4 | CP003043.1 | GCA000298115_00680 | gene | open | 732388-733962 | rrs | ||
| 5 | CP003043.1 | GCA000298115_00683 | gene | open | 734407-737327 | rrl | ||
| 6 | CP003043.1 | GCA000298115_00684 | gene | open | 737404-737520 | rrf | ||
| 7 | CP003043.1 | GCA000298115_00816 | gene | open | 854070-855644 | rrs | ||
| 8 | CP003043.1 | GCA000298115_00819 | gene | open | 856089-859009 | rrl | ||
| 9 | CP003043.1 | GCA000298115_00820 | gene | open | 859086-859202 | rrf | ||
| 10 | CP003043.1 | GCA000298115_01212 | gene | open | 1209632-1210004 | RNaseP_bact_b | ||
| 11 | CP003043.1 | GCA000298115_01504 | gene | open | 1494810-1494896 | Bacteria_small_SRP | ||
| 12 | CP003043.1 | GCA000298115_01613 | gene | open | 1592475-1592591 | rrf | ||
| 13 | CP003043.1 | GCA000298115_01614 | gene | open | 1592668-1595588 | rrl | ||
| 14 | CP003043.1 | GCA000298115_01615 | gene | open | 1595813-1597387 | rrs | ||
| 15 | CP003043.1 | GCA000298115_01683 | gene | open | 1673324-1673440 | rrf | ||
| 16 | CP003043.1 | GCA000298115_01684 | gene | open | 1673517-1676437 | rrl | ||
| 17 | CP003043.1 | GCA000298115_01685 | gene | open | 1676662-1678236 | rrs | ||
| 18 | CP003043.1 | GCA000298115_02202 | gene | open | 2236884-2237006 | Ref68 | ||
| 19 | CP003043.1 | GCA000298115_02255 | gene | open | 2301453-2301569 | rrf | ||
| 20 | CP003043.1 | GCA000298115_02256 | gene | open | 2301646-2304567 | rrl | ||
| 21 | CP003043.1 | GCA000298115_02257 | gene | open | 2304791-2306365 | rrs | ||
| 22 | CP003043.1 | GCA000298115_02290 | gene | open | 2345437-2345526 | ratA | ||
| 23 | CP003043.1 | GCA000298115_01212 | ncRNA | open | 1209632-1210004 | Bacterial RNase P class B | ||
| 24 | CP003043.1 | GCA000298115_01504 | ncRNA | open | 1494810-1494896 | Bacterial small signal recognition particle RNA | ||
| 25 | CP003043.1 | GCA000298115_02202 | ncRNA | open | 2236884-2237006 | Enterococcus sRNA 68 (Lacto-3 RNA) | ||
| 26 | CP003043.1 | GCA000298115_02290 | ncRNA | open | 2345437-2345526 | ratA | RNA anti-toxin A | |
| 27 | CP003043.1 | regulatory_region | open | 53546-53785 | T-box leader | |||
| 28 | CP003043.1 | regulatory_region | open | 98634-98876 | T-box leader | |||
| 29 | CP003043.1 | regulatory_region | open | 114356-114450 | TPP riboswitch aptamer (THI element) | |||
| 30 | CP003043.1 | regulatory_region | open | 259780-260021 | T-box leader | |||
| 31 | CP003043.1 | regulatory_region | open | 281081-281310 | T-box leader | |||
| 32 | CP003043.1 | regulatory_region | open | 318108-318207 | TPP riboswitch aptamer (THI element) | |||
| 33 | CP003043.1 | regulatory_region | open | 341379-341485 | PyrR binding site | |||
| 34 | CP003043.1 | regulatory_region | open | 629492-629582 | TPP riboswitch aptamer (THI element) | |||
| 35 | CP003043.1 | regulatory_region | open | 676460-676833 | cspA thermoregulator | |||
| 36 | CP003043.1 | regulatory_region | open | 714630-714883 | T-box leader | |||
| 37 | CP003043.1 | regulatory_region | open | 784817-785071 | T-box leader | |||
| 38 | CP003043.1 | regulatory_region | open | 871305-871541 | T-box leader | |||
| 39 | CP003043.1 | regulatory_region | open | 1022512-1022720 | T-box leader | |||
| 40 | CP003043.1 | regulatory_region | open | 1163242-1163363 | FMN riboswitch aptamer (RFN element) | |||
| 41 | CP003043.1 | regulatory_region | open | 1223953-1224067 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 42 | CP003043.1 | regulatory_region | open | 1283498-1283580 | Ribosomal protein L21 leader | |||
| 43 | CP003043.1 | regulatory_region | open | 1307277-1307493 | T-box leader | |||
| 44 | CP003043.1 | regulatory_region | open | 1324087-1324224 | Ribosomal protein L20 leader | |||
| 45 | CP003043.1 | regulatory_region | open | 1392102-1392303 | T-box leader | |||
| 46 | CP003043.1 | regulatory_region | open | 1396343-1396426 | SAM-III riboswitch aptamer (SMK box) | |||
| 47 | CP003043.1 | regulatory_region | open | 1508642-1508760 | Ribosomal protein L10 leader | |||
| 48 | CP003043.1 | regulatory_region | open | 1754252-1754309 | Ribosomal protein L13 leader | |||
| 49 | CP003043.1 | regulatory_region | open | 1793546-1793717 | Lysine riboswitch aptamer | |||
| 50 | CP003043.1 | regulatory_region | open | 2042012-2042101 | TPP riboswitch aptamer (THI element) | |||
| 51 | CP003043.1 | regulatory_region | open | 2073274-2073455 | Lysine riboswitch aptamer | |||
| 52 | CP003043.1 | regulatory_region | open | 2137951-2138366 | cspA thermoregulator | |||
| 53 | CP003043.1 | regulatory_region | open | 2193665-2193798 | FMN riboswitch aptamer (RFN element) | |||
| 54 | CP003043.1 | regulatory_region | open | 2257044-2257228 | Cobalamin riboswitch aptamer | |||
| 55 | CP003043.1 | regulatory_region | open | 2292161-2292253 | TPP riboswitch aptamer (THI element) | |||
| 56 | CP003043.1 | regulatory_region | open | 2299238-2299403 | M-box riboswitch aptamer (ykoK leader) | |||
| 57 | CP003043.1 | regulatory_region | open | 2340302-2340569 | T-box leader | |||
| 58 | CP003043.1 | regulatory_region | open | 2394716-2394814 | TPP riboswitch aptamer (THI element) | |||
| 59 | CP003043.1 | regulatory_region | open | 2456719-2456968 | T-box leader | |||
| 60 | CP003043.1 | regulatory_region | open | 2483732-2483824 | TPP riboswitch aptamer (THI element) | |||
| 61 | CP003043.1 | GCA000298115_00680 | rRNA | open | 732388-733962 | rrs | 16S ribosomal RNA | |
| 62 | CP003043.1 | GCA000298115_00683 | rRNA | open | 734407-737327 | rrl | 23S ribosomal RNA | |
| 63 | CP003043.1 | GCA000298115_00684 | rRNA | open | 737404-737520 | rrf | 5S ribosomal RNA | |
| 64 | CP003043.1 | GCA000298115_00816 | rRNA | open | 854070-855644 | rrs | 16S ribosomal RNA | |
| 65 | CP003043.1 | GCA000298115_00819 | rRNA | open | 856089-859009 | rrl | 23S ribosomal RNA | |
| 66 | CP003043.1 | GCA000298115_00820 | rRNA | open | 859086-859202 | rrf | 5S ribosomal RNA | |
| 67 | CP003043.1 | GCA000298115_01613 | rRNA | open | 1592475-1592591 | rrf | 5S ribosomal RNA | |
| 68 | CP003043.1 | GCA000298115_01614 | rRNA | open | 1592668-1595588 | rrl | 23S ribosomal RNA | |
| 69 | CP003043.1 | GCA000298115_01615 | rRNA | open | 1595813-1597387 | rrs | 16S ribosomal RNA | |
| 70 | CP003043.1 | GCA000298115_01683 | rRNA | open | 1673324-1673440 | rrf | 5S ribosomal RNA | |
| 71 | CP003043.1 | GCA000298115_01684 | rRNA | open | 1673517-1676437 | rrl | 23S ribosomal RNA | |
| 72 | CP003043.1 | GCA000298115_01685 | rRNA | open | 1676662-1678236 | rrs | 16S ribosomal RNA | |
| 73 | CP003043.1 | GCA000298115_02255 | rRNA | open | 2301453-2301569 | rrf | 5S ribosomal RNA | |
| 74 | CP003043.1 | GCA000298115_02256 | rRNA | open | 2301646-2304567 | rrl | 23S ribosomal RNA | |
| 75 | CP003043.1 | GCA000298115_02257 | rRNA | open | 2304791-2306365 | rrs | 16S ribosomal RNA | |
| 76 | CP003043.1 | repeat_region | open | 115858-116509 | CRISPR array with 11 repeats of length 28%2C consensus sequence GTATTCCCCACGTACGTAGGGGTGATCC and spacer length 33 | |||
| 77 | CP003043.1 | repeat_region | open | 126412-127082 | CRISPR array with 11 repeats of length 28%2C consensus sequence GTATTCCCCACGTGTGTAGGGGTAATCC and spacer length 33 | |||
| 78 | CP003043.1 | repeat_region | open | 128332-129712 | CRISPR array with 23 repeats of length 28%2C consensus sequence GTATTCCCCACGTACGTAGGGGTGATCC and spacer length 33 | |||
| 79 | CP003043.1 | repeat_region | open | 1941839-1942875 | CRISPR array with 14 repeats of length 36%2C consensus sequence GGGTTTAACCTTATTGATTTAACATCCTTCTAAAAC and spacer length 40 | |||
| 80 | CP003043.1 | GCA000298115_00001 | CDS | open | 1-132 | _na 43_aa | hypothetical protein | |
| 81 | CP003043.1 | GCA000298115_00002 | CDS | open | 263-1612 | _na 449_aa | dnaA | chromosomal replication initiator protein DnaA |
| 82 | CP003043.1 | GCA000298115_00003 | CDS | open | 1802-2941 | _na 379_aa | dnaN | DNA polymerase III subunit beta |
| 83 | CP003043.1 | GCA000298115_00004 | CDS | open | 3245-3475 | _na 76_aa | ybcJ | S4 domain-containing protein YaaA |
| 84 | CP003043.1 | GCA000298115_00005 | CDS | open | 3472-4590 | _na 372_aa | recF | DNA replication/repair protein RecF |
| 85 | CP003043.1 | GCA000298115_00006 | CDS | open | 4606-6549 | _na 647_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 86 | CP003043.1 | GCA000298115_00007 | CDS | open | 6624-9176 | _na 850_aa | gyrA | DNA gyrase subunit A |
| 87 | CP003043.1 | GCA000298115_00008 | CDS | open | 9363-10472 | _na 369_aa | lldD | L-lactate oxidase |
| 88 | CP003043.1 | GCA000298115_00009 | CDS | open | 10678-10869 | _na 63_aa | hypothetical protein | |
| 89 | CP003043.1 | GCA000298115_00010 | CDS | open | 11271-11567 | _na 98_aa | rpsF | 30S ribosomal protein S6 |
| 90 | CP003043.1 | GCA000298115_00011 | CDS | open | 11602-12168 | _na 188_aa | ssb | Single-stranded DNA-binding protein |
| 91 | CP003043.1 | GCA000298115_00012 | CDS | open | 12205-12444 | _na 79_aa | rpsR | 30S ribosomal protein S18 |
| 92 | CP003043.1 | GCA000298115_00013 | CDS | open | 12546-13961 | _na 471_aa | nhaC | Na+/H+ antiporter NhaC |
| 93 | CP003043.1 | GCA000298115_00014 | CDS | open | 14592-15983 | _na 463_aa | ansP | Amino acid permease/ SLC12A domain-containing protein |
| 94 | CP003043.1 | GCA000298115_00015 | CDS | open | 16179-18191 | _na 670_aa | gdpP | Cyclic-di-AMP phosphodiesterase |
| 95 | CP003043.1 | GCA000298115_00016 | CDS | open | 18231-18683 | _na 150_aa | rplI | 50S ribosomal protein L9 |
| 96 | CP003043.1 | GCA000298115_00017 | CDS | open | 18843-20225 | _na 460_aa | dnaB | replicative DNA helicase |
| 97 | CP003043.1 | GCA000298115_00018 | CDS | open | 20421-21725 | _na 434_aa | yhgE | ABC-2 type transporter transmembrane domain-containing protein |
| 98 | CP003043.1 | GCA000298115_00019 | CDS | open | 21871-22533 | _na 220_aa | acrR | HTH tetR-type domain-containing protein |
| 99 | CP003043.1 | GCA000298115_00021 | CDS | open | 22879-23595 | _na 238_aa | yycF | response regulator YycF |
| 100 | CP003043.1 | GCA000298115_00022 | CDS | open | 23634-25487 | _na 617_aa | walK | cell wall metabolism sensor histidine kinase WalK |
| 101 | CP003043.1 | GCA000298115_00023 | CDS | open | 25477-26775 | _na 432_aa | yycH | Regulatory protein YycH domain-containing protein |
| 102 | CP003043.1 | GCA000298115_00024 | CDS | open | 26792-27622 | _na 276_aa | yycI | Regulatory protein YycH-like domain-containing protein |
| 103 | CP003043.1 | GCA000298115_00025 | CDS | open | 27643-28446 | _na 267_aa | phnP | Zn-dependent hydrolase%2C beta-lactamase superfamily |
| 104 | CP003043.1 | GCA000298115_00026 | CDS | open | 28539-29798 | _na 419_aa | degQ | Trypsin-like serine protease |
| 105 | CP003043.1 | GCA000298115_00027 | CDS | open | 29985-32162 | _na 725_aa | slpB | Surface layer protein SlpB |
| 106 | CP003043.1 | GCA000298115_00028 | CDS | open | 32239-32379 | _na 46_aa | hypothetical protein | |
| 107 | CP003043.1 | GCA000298115_00029 | CDS | open | 32968-33447 | _na 159_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 108 | CP003043.1 | GCA000298115_00030 | CDS | open | 33537-34544 | _na 335_aa | ligW | Amidohydrolase-related domain-containing protein |
| 109 | CP003043.1 | GCA000298115_00031 | CDS | open | 34560-34862 | _na 100_aa | DUF2316 domain-containing protein | |
| 110 | CP003043.1 | GCA000298115_00032 | CDS | open | 34867-35283 | _na 138_aa | marR | HTH marR-type domain-containing protein |
| 111 | CP003043.1 | GCA000298115_00033 | CDS | open | 35404-36369 | _na 321_aa | Putative glyoxylate reductase | |
| 112 | CP003043.1 | GCA000298115_00034 | CDS | open | 36470-36871 | _na 133_aa | hxlR | HTH-type transcriptional activator hxlR |
| 113 | CP003043.1 | GCA000298115_00035 | CDS | open | 36989-37576 | _na 195_aa | DUF4352 domain-containing protein | |
| 114 | CP003043.1 | GCA000298115_00036 | CDS | open | 37662-38429 | _na 255_aa | fabG | Short-chain alcohol dehydrogenase |
| 115 | CP003043.1 | GCA000298115_00037 | CDS | open | 38536-39000 | _na 154_aa | fldA | Flavodoxin-like domain-containing protein |
| 116 | CP003043.1 | GCA000298115_00038 | CDS | open | 39061-39291 | _na 76_aa | yiaG | HTH cro/C1-type domain-containing protein |
| 117 | CP003043.1 | GCA000298115_00039 | CDS | open | 39486-41138 | _na 550_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 118 | CP003043.1 | GCA000298115_00040 | CDS | open | 41159-42235 | _na 358_aa | frvX | Aminopeptidase I zinc metalloprotease |
| 119 | CP003043.1 | GCA000298115_00041 | CDS | open | 42254-43021 | _na 255_aa | puuD | Putative glutamine amidotransferase |
| 120 | CP003043.1 | GCA000298115_00042 | CDS | open | 43077-45377 | _na 766_aa | yicI | Alpha-glucosidase |
| 121 | CP003043.1 | GCA000298115_00043 | CDS | open | 45483-46313 | _na 276_aa | TPM domain-containing protein | |
| 122 | CP003043.1 | GCA000298115_00044 | CDS | open | 46480-47148 | _na 222_aa | Golgi phosphoprotein 3 (GPP34) | |
| 123 | CP003043.1 | GCA000298115_00045 | CDS | open | 47305-48327 | _na 340_aa | hypothetical protein | |
| 124 | CP003043.1 | GCA000298115_00046 | CDS | open | 48703-48909 | _na 68_aa | hypothetical protein | |
| 125 | CP003043.1 | GCA000298115_00047 | CDS | open | 49421-50611 | _na 396_aa | Imidazolonepropionase related amidohydrolase | |
| 126 | CP003043.1 | GCA000298115_00048 | CDS | open | 50651-51835 | _na 394_aa | Imidazolonepropionase related amidohydrolase | |
| 127 | CP003043.1 | GCA000298115_00049 | CDS | open | 51875-53479 | _na 534_aa | ABC-type oligopeptide transport system%2C periplasmic component | |
| 128 | CP003043.1 | GCA000298115_00050 | CDS | open | 54137-55027 | _na 296_aa | fadB | 3-hydroxyacyl-CoA dehydrogenase |
| 129 | CP003043.1 | GCA000298115_00051 | CDS | open | 55206-56402 | _na 398_aa | ldhA | NAD-dependent formate dehydrogenase |
| 130 | CP003043.1 | GCA000298115_00052 | CDS | open | 56533-57246 | _na 237_aa | budA | acetolactate decarboxylase |
| 131 | CP003043.1 | GCA000298115_00053 | CDS | open | 57259-58935 | _na 558_aa | alsS | acetolactate synthase AlsS |
| 132 | CP003043.1 | GCA000298115_00054 | CDS | open | 59048-59494 | _na 148_aa | marR | HTH marR-type domain-containing protein |
| 133 | CP003043.1 | GCA000298115_00055 | CDS | open | 59581-60588 | _na 335_aa | kdgR | HTH-type transcriptional regulator KdgR |
| 134 | CP003043.1 | GCA000298115_00056 | CDS | open | 60664-61707 | _na 347_aa | 3-carboxymuconate cyclase | |
| 135 | CP003043.1 | GCA000298115_00057 | CDS | open | 61736-63016 | _na 426_aa | Citrate transporter-like domain-containing protein | |
| 136 | CP003043.1 | GCA000298115_00058 | CDS | open | 63278-64018 | _na 246_aa | Sugar phosphate isomerase/epimerase | |
| 137 | CP003043.1 | GCA000298115_00059 | CDS | open | 64042-64824 | _na 260_aa | 2-deoxy-D-gluconate 3-dehydrogenase | |
| 138 | CP003043.1 | GCA000298115_00060 | CDS | open | 64843-65784 | _na 313_aa | Glycerate dehydrogenase | |
| 139 | CP003043.1 | GCA000298115_00061 | CDS | open | 65858-66706 | _na 282_aa | 2%2C5-didehydrogluconate reductase | |
| 140 | CP003043.1 | GCA000298115_00062 | CDS | open | 66823-67086 | _na 87_aa | hypothetical protein | |
| 141 | CP003043.1 | GCA000298115_00063 | CDS | open | 67358-68266 | _na 302_aa | lysR | Transcriptional regulator%2C LysR family |
| 142 | CP003043.1 | GCA000298115_00064 | CDS | open | 68630-69967 | _na 445_aa | Citrate/H+ symporter%2C CitMHS family | |
| 143 | CP003043.1 | GCA000298115_00065 | CDS | open | 70023-71351 | _na 442_aa | glucarate dehydratase | |
| 144 | CP003043.1 | GCA000298115_00066 | CDS | open | 71404-72741 | _na 445_aa | glucarate dehydratase | |
| 145 | CP003043.1 | GCA000298115_00067 | CDS | open | 72761-73741 | _na 326_aa | D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding protein | |
| 146 | CP003043.1 | GCA000298115_00068 | CDS | open | 73799-74830 | _na 343_aa | araC | Transcriptional regulator%2C AraC family |
| 147 | CP003043.1 | GCA000298115_00069 | CDS | open | 74970-76295 | _na 441_aa | Sugar transport protein | |
| 148 | CP003043.1 | GCA000298115_00070 | CDS | open | 76270-77853 | _na 527_aa | Alpha-L-rhamnosidase | |
| 149 | CP003043.1 | GCA000298115_00071 | CDS | open | 77856-79148 | _na 430_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 150 | CP003043.1 | GCA000298115_00072 | CDS | open | 79184-81166 | _na 660_aa | Alpha-L-rhamnosidase | |
| 151 | CP003043.1 | GCA000298115_00073 | CDS | open | 81601-82782 | _na 393_aa | NADH-dependent flavin oxidoreductase | |
| 152 | CP003043.1 | GCA000298115_00074 | CDS | open | 83140-83889 | _na 249_aa | Sugar phosphate isomerase/epimerase | |
| 153 | CP003043.1 | GCA000298115_00075 | CDS | open | 83894-85186 | _na 430_aa | Citrate transporter | |
| 154 | CP003043.1 | GCA000298115_00076 | CDS | open | 85229-86191 | _na 320_aa | 2-dehydro-3-deoxygluconokinase | |
| 155 | CP003043.1 | GCA000298115_00077 | CDS | open | 86191-86817 | _na 208_aa | 3-hexulose-6-phosphate synthase | |
| 156 | CP003043.1 | GCA000298115_00078 | CDS | open | 86817-87359 | _na 180_aa | 3-hexulose-6-phosphate isomerase | |
| 157 | CP003043.1 | GCA000298115_00079 | CDS | open | 87371-88021 | _na 216_aa | 2-dehydro-3-deoxyphosphogluconate aldolase / 4-hydroxy-2-oxoglutarate aldolase | |
| 158 | CP003043.1 | GCA000298115_00080 | CDS | open | 88159-89160 | _na 333_aa | lacI | Transcriptional regulator%2C LacI family |
| 159 | CP003043.1 | GCA000298115_00081 | CDS | open | 89615-90319 | _na 234_aa | ABC-type oligopeptide transport system%2C periplasmic component | |
| 160 | CP003043.1 | GCA000298115_00082 | CDS | open | 90316-91230 | _na 304_aa | ABC-type oligopeptide transport system%2C periplasmic component | |
| 161 | CP003043.1 | GCA000298115_00083 | CDS | open | 91243-93183 | _na 646_aa | Dipeptidyl aminopeptidase/acylaminoacyl-peptidase | |
| 162 | CP003043.1 | GCA000298115_00084 | CDS | open | 93286-94476 | _na 396_aa | Na+/glutamate symporter | |
| 163 | CP003043.1 | GCA000298115_00085 | CDS | open | 94673-95857 | _na 394_aa | Imidazolonepropionase related amidohydrolase | |
| 164 | CP003043.1 | GCA000298115_00086 | CDS | open | 95906-97108 | _na 400_aa | Imidazolonepropionase related amidohydrolase | |
| 165 | CP003043.1 | GCA000298115_00087 | CDS | open | 97120-98448 | _na 442_aa | Acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase-like protein | |
| 166 | CP003043.1 | GCA000298115_00088 | CDS | open | 98941-99774 | _na 277_aa | Lipoprotein | |
| 167 | CP003043.1 | GCA000298115_00089 | CDS | open | 99791-100867 | _na 358_aa | metN | Methionine import ATP-binding protein metN |
| 168 | CP003043.1 | GCA000298115_00090 | CDS | open | 100867-101565 | _na 232_aa | Putative ABC-type methionine transporter%2C permease component | |
| 169 | CP003043.1 | GCA000298115_00091 | CDS | open | 101597-102745 | _na 382_aa | putative succinyl-diaminopimelate desuccinylase | |
| 170 | CP003043.1 | GCA000298115_00092 | CDS | open | 103138-104421 | _na 427_aa | D-galactonate transporter | |
| 171 | CP003043.1 | GCA000298115_00093 | CDS | open | 104472-105311 | _na 279_aa | BD-FAE-like domain-containing protein | |
| 172 | CP003043.1 | GCA000298115_00094 | CDS | open | 105327-106934 | _na 535_aa | Transcriptional regulator of the purine degradation operon | |
| 173 | CP003043.1 | GCA000298115_00095 | CDS | open | 107140-110172 | _na 1010_aa | fdrA | Acyl-CoA synthetase FdrA |
| 174 | CP003043.1 | GCA000298115_00096 | CDS | open | 110182-111012 | _na 276_aa | DUF2877 domain-containing protein | |
| 175 | CP003043.1 | GCA000298115_00097 | CDS | open | 111066-112025 | _na 319_aa | arcC | carbamate kinase |
| 176 | CP003043.1 | GCA000298115_00098 | CDS | open | 112148-112714 | _na 188_aa | DUF1097 domain-containing protein | |
| 177 | CP003043.1 | GCA000298115_00099 | CDS | open | 112977-114233 | _na 418_aa | Putative cytosine deaminase | |
| 178 | CP003043.1 | GCA000298115_00100 | CDS | open | 114518-115507 | _na 329_aa | IS30 family transposase | |
| 179 | CP003043.1 | GCA000298115_00101 | CDS | open | 116930-119689 | _na 919_aa | CRISPR-associated helicase cas3 | |
| 180 | CP003043.1 | GCA000298115_00102 | CDS | open | 119682-121418 | _na 578_aa | Putative CRISPR system CASCADE complex protein | |
| 181 | CP003043.1 | GCA000298115_00103 | CDS | open | 121443-122045 | _na 200_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 182 | CP003043.1 | GCA000298115_00104 | CDS | open | 122045-123124 | _na 359_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 183 | CP003043.1 | GCA000298115_00105 | CDS | open | 123105-123857 | _na 250_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 184 | CP003043.1 | GCA000298115_00106 | CDS | open | 123870-124538 | _na 222_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 185 | CP003043.1 | GCA000298115_00107 | CDS | open | 124542-125495 | _na 317_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 186 | CP003043.1 | GCA000298115_00108 | CDS | open | 125492-126382 | _na 296_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 187 | CP003043.1 | GCA000298115_00109 | CDS | open | 127183-128031 | _na 282_aa | Protein tyrosine/serine phosphatase | |
| 188 | CP003043.1 | GCA000298115_00110 | CDS | open | 130218-131810 | _na 530_aa | Amidase | |
| 189 | CP003043.1 | GCA000298115_00111 | CDS | open | 132035-132775 | _na 246_aa | Potassium/ion channel protein | |
| 190 | CP003043.1 | GCA000298115_00112 | CDS | open | 133226-134716 | _na 496_aa | GTPase subunit of restriction endonuclease | |
| 191 | CP003043.1 | GCA000298115_00113 | CDS | open | 134727-136082 | _na 451_aa | 5-methylcytosine restriction system component-like protein | |
| 192 | CP003043.1 | GCA000298115_00114 | CDS | open | 136561-136806 | _na 81_aa | DUF4190 domain-containing protein | |
| 193 | CP003043.1 | GCA000298115_00115 | CDS | open | 136915-137340 | _na 141_aa | Ltp family lipoprotein | |
| 194 | CP003043.1 | GCA000298115_00116 | CDS | open | 137480-137791 | _na 103_aa | mazG | MazG nucleotide pyrophosphohydrolase domain protein |
| 195 | CP003043.1 | GCA000298115_00117 | CDS | open | 137809-139554 | _na 581_aa | GIY-YIG domain-containing protein | |
| 196 | CP003043.1 | GCA000298115_00118 | CDS | open | 139605-140912 | _na 435_aa | apeA | ApeA N-terminal domain-containing protein |
| 197 | CP003043.1 | GCA000298115_00119 | CDS | open | 141107-142633 | _na 508_aa | Membrane-associated phospholipid phosphatase | |
| 198 | CP003043.1 | GCA000298115_00120 | CDS | open | 142630-142878 | _na 82_aa | hypothetical protein | |
| 199 | CP003043.1 | GCA000298115_00121 | CDS | open | 143412-145841 | _na 809_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 200 | CP003043.1 | GCA000298115_00122 | CDS | open | 146373-148436 | _na 687_aa | DUF5776 domain-containing protein | |
| 201 | CP003043.1 | GCA000298115_00123 | CDS | open | 148632-150137 | _na 501_aa | hypothetical protein | |
| 202 | CP003043.1 | GCA000298115_00124 | CDS | open | 150568-151464 | _na 298_aa | fadB | 3-hydroxyacyl-CoA dehydrogenase |
| 203 | CP003043.1 | GCA000298115_00125 | CDS | open | 151681-153579 | _na 632_aa | Peptidase S53 propeptide | |
| 204 | CP003043.1 | GCA000298115_00126 | CDS | open | 153791-154471 | _na 226_aa | PAS domain-containing protein | |
| 205 | CP003043.1 | GCA000298115_00127 | CDS | open | 154706-156061 | _na 451_aa | ampC | Beta-lactamase class C related penicillin binding protein |
| 206 | CP003043.1 | GCA000298115_00128 | CDS | open | 156389-157582 | _na 397_aa | ampC | Beta-lactamase class C related penicillin binding protein |
| 207 | CP003043.1 | GCA000298115_00129 | CDS | open | 157674-157817 | _na 47_aa | D-Ala-teichoic acid biosynthesis protein | |
| 208 | CP003043.1 | GCA000298115_00130 | CDS | open | 157832-159358 | _na 508_aa | dltA | D-alanine--poly(phosphoribitol) ligase subunit DltA |
| 209 | CP003043.1 | GCA000298115_00131 | CDS | open | 159355-160572 | _na 405_aa | dltB | D-alanyl-lipoteichoic acid biosynthesis protein DltB |
| 210 | CP003043.1 | GCA000298115_00132 | CDS | open | 160592-160825 | _na 77_aa | dltC | D-alanine--poly(phosphoribitol) ligase subunit DltC |
| 211 | CP003043.1 | GCA000298115_00133 | CDS | open | 160822-161619 | _na 265_aa | dltD | D-alanyl-lipoteichoic acid biosynthesis protein DltD |
| 212 | CP003043.1 | GCA000298115_00134 | CDS | open | 161654-162100 | _na 148_aa | hypothetical protein | |
| 213 | CP003043.1 | GCA000298115_00135 | CDS | open | 162120-163430 | _na 436_aa | ampC | GW domain-containing protein |
| 214 | CP003043.1 | GCA000298115_00136 | CDS | open | 163563-164078 | _na 171_aa | hypothetical protein | |
| 215 | CP003043.1 | GCA000298115_00137 | CDS | open | 164084-164785 | _na 233_aa | lolD | ABC transporter domain-containing protein |
| 216 | CP003043.1 | GCA000298115_00138 | CDS | open | 164902-165495 | _na 197_aa | Nucleoside-diphosphate-sugar epimerase | |
| 217 | CP003043.1 | GCA000298115_00139 | CDS | open | 165951-166352 | _na 133_aa | crcB | Fluoride-specific ion channel FluC |
| 218 | CP003043.1 | GCA000298115_00140 | CDS | open | 166349-166705 | _na 118_aa | crcB | Fluoride-specific ion channel FluC |
| 219 | CP003043.1 | GCA000298115_00141 | CDS | open | 166705-167586 | _na 293_aa | DUF2179 domain-containing protein | |
| 220 | CP003043.1 | GCA000298115_00142 | CDS | open | 167839-169386 | _na 515_aa | yfcC | YfcC family protein |
| 221 | CP003043.1 | GCA000298115_00143 | CDS | open | 169536-169952 | _na 138_aa | yhfA | OsmC family protein |
| 222 | CP003043.1 | GCA000298115_00144 | CDS | open | 169963-171594 | _na 543_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 223 | CP003043.1 | GCA000298115_00145 | CDS | open | 171807-173474 | _na 555_aa | amyA | Oligo-1%2C6-glucosidase |
| 224 | CP003043.1 | GCA000298115_00146 | CDS | open | 173499-174890 | _na 463_aa | melB | MFS transporter |
| 225 | CP003043.1 | GCA000298115_00147 | CDS | open | 175266-175454 | _na 62_aa | HTH lacI-type domain-containing protein | |
| 226 | CP003043.1 | GCA000298115_00148 | CDS | open | 175451-176251 | _na 266_aa | purR | HTH lacI-type domain-containing protein |
| 227 | CP003043.1 | GCA000298115_00149 | CDS | open | 176492-177646 | _na 384_aa | Multidrug-efflux transporter | |
| 228 | CP003043.1 | GCA000298115_00150 | CDS | open | 177643-177936 | _na 97_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 229 | CP003043.1 | GCA000298115_00151 | CDS | open | 178143-179480 | _na 445_aa | Putative chromosome segregation ATPase | |
| 230 | CP003043.1 | GCA000298115_00152 | CDS | open | 179662-180756 | _na 364_aa | Zn-dependent benzyl alcohol dehydrogenase | |
| 231 | CP003043.1 | GCA000298115_00153 | CDS | open | 180827-181072 | _na 81_aa | Lactococcin 972 family bacteriocin | |
| 232 | CP003043.1 | GCA000298115_00154 | CDS | open | 181180-181767 | _na 195_aa | udg4 | Uracil-DNA glycosylase-like domain-containing protein |
| 233 | CP003043.1 | GCA000298115_00155 | CDS | open | 181900-182334 | _na 144_aa | arsC | arsenate reductase (thioredoxin) |
| 234 | CP003043.1 | GCA000298115_00156 | CDS | open | 182766-184166 | _na 466_aa | ansP | Amino acid permease/ SLC12A domain-containing protein |
| 235 | CP003043.1 | GCA000298115_00157 | CDS | open | 184231-185160 | _na 309_aa | uRH1 | Pyrimidine-specific ribonucleoside hydrolase RihB |
| 236 | CP003043.1 | GCA000298115_00158 | CDS | open | 185250-186209 | _na 319_aa | fadB | L-gulonate 3-dehydrogenase |
| 237 | CP003043.1 | GCA000298115_00159 | CDS | open | 186363-186485 | _na 40_aa | hypothetical protein | |
| 238 | CP003043.1 | GCA000298115_00160 | CDS | open | 187059-187589 | _na 176_aa | Acid-resistance membrane protein | |
| 239 | CP003043.1 | GCA000298115_00161 | CDS | open | 187666-188415 | _na 249_aa | sfsA | DNA/RNA nuclease SfsA |
| 240 | CP003043.1 | GCA000298115_00162 | CDS | open | 188596-189243 | _na 215_aa | ugpQ | Glycerophosphodiester phosphodiesterase |
| 241 | CP003043.1 | GCA000298115_00163 | CDS | open | 189398-191329 | _na 643_aa | Peptidase S53 domain-containing protein | |
| 242 | CP003043.1 | GCA000298115_00164 | CDS | open | 191413-191622 | _na 69_aa | yozG | Cro/CI transcriptional regulator |
| 243 | CP003043.1 | GCA000298115_00165 | CDS | open | 191640-192218 | _na 192_aa | Integral membrane protein | |
| 244 | CP003043.1 | GCA000298115_00166 | CDS | open | 192563-193651 | _na 362_aa | malK | Glycerol-3-phosphate-transporting ATPase |
| 245 | CP003043.1 | GCA000298115_00167 | CDS | open | 193644-194606 | _na 320_aa | ugpA | ABC transmembrane type-1 domain-containing protein |
| 246 | CP003043.1 | GCA000298115_00168 | CDS | open | 194606-195436 | _na 276_aa | ugpE | ABC transmembrane type-1 domain-containing protein |
| 247 | CP003043.1 | GCA000298115_00169 | CDS | open | 195436-196797 | _na 453_aa | ugpB | Glycerol-3-phosphate ABC transporter substrate-binding protein |
| 248 | CP003043.1 | GCA000298115_00170 | CDS | open | 196887-197582 | _na 231_aa | ugpQ | Glycerophosphodiester phosphodiesterase |
| 249 | CP003043.1 | GCA000298115_00171 | CDS | open | 197638-199284 | _na 548_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 250 | CP003043.1 | GCA000298115_00172 | CDS | open | 199698-200561 | _na 287_aa | aRA1 | 2%2C5-didehydrogluconate reductase |
| 251 | CP003043.1 | GCA000298115_00173 | CDS | open | 200606-200911 | _na 101_aa | hypothetical protein | |
| 252 | CP003043.1 | GCA000298115_00174 | CDS | open | 201091-202065 | _na 324_aa | hemH | ferrochelatase |
| 253 | CP003043.1 | GCA000298115_00175 | CDS | open | 202043-203371 | _na 442_aa | mntH | Nramp family divalent metal transporter |
| 254 | CP003043.1 | GCA000298115_00176 | CDS | open | 203413-204174 | _na 253_aa | wrbA | Putative NAD(P)H-dependent FMN-containing oxidoreductase YwqN |
| 255 | CP003043.1 | GCA000298115_00177 | CDS | open | 204356-205735 | _na 459_aa | hypothetical protein | |
| 256 | CP003043.1 | GCA000298115_00178 | CDS | open | 206104-207903 | _na 599_aa | ddpA | ABC transporter periplasmic protein |
| 257 | CP003043.1 | GCA000298115_00179 | CDS | open | 208123-208659 | _na 178_aa | hypothetical protein | |
| 258 | CP003043.1 | GCA000298115_00180 | CDS | open | 208652-208942 | _na 96_aa | hypothetical protein | |
| 259 | CP003043.1 | GCA000298115_00181 | CDS | open | 208939-209367 | _na 142_aa | soxR | HTH merR-type domain-containing protein |
| 260 | CP003043.1 | GCA000298115_00182 | CDS | open | 209454-210458 | _na 334_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 261 | CP003043.1 | GCA000298115_00183 | CDS | open | 210603-210998 | _na 131_aa | hypothetical protein | |
| 262 | CP003043.1 | GCA000298115_00184 | CDS | open | 211231-211965 | _na 244_aa | tauE | putative membrane transporter protein |
| 263 | CP003043.1 | GCA000298115_00185 | CDS | open | 212136-212867 | _na 243_aa | soxR | HTH merR-type domain-containing protein |
| 264 | CP003043.1 | GCA000298115_00186 | CDS | open | 212908-213765 | _na 285_aa | fN3K | Fructosamine-3-kinase |
| 265 | CP003043.1 | GCA000298115_00187 | CDS | open | 213903-215096 | _na 397_aa | fadH | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein |
| 266 | CP003043.1 | GCA000298115_00188 | CDS | open | 215121-216503 | _na 460_aa | sdhA | flavocytochrome c |
| 267 | CP003043.1 | GCA000298115_00189 | CDS | open | 216615-216836 | _na 73_aa | hypothetical protein | |
| 268 | CP003043.1 | GCA000298115_00190 | CDS | open | 216964-217872 | _na 302_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 269 | CP003043.1 | GCA000298115_00191 | CDS | open | 217967-218446 | _na 159_aa | dps | Ferritin/DPS protein domain-containing protein |
| 270 | CP003043.1 | GCA000298115_00192 | CDS | open | 218547-219887 | _na 446_aa | araJ | Putative proline/betaine transporter |
| 271 | CP003043.1 | GCA000298115_00193 | CDS | open | 220088-220768 | _na 226_aa | yigB | YjjG family noncanonical pyrimidine nucleotidase |
| 272 | CP003043.1 | GCA000298115_00194 | CDS | open | 220926-221636 | _na 236_aa | budA | acetolactate decarboxylase |
| 273 | CP003043.1 | GCA000298115_00195 | CDS | open | 222053-223438 | _na 461_aa | proP | Putative metabolite transport protein CsbC |
| 274 | CP003043.1 | GCA000298115_00196 | CDS | open | 223584-224270 | _na 228_aa | yajL | DJ-1/PfpI domain-containing protein |
| 275 | CP003043.1 | GCA000298115_00197 | CDS | open | 224480-225391 | _na 303_aa | rbbA | ABC transporter domain-containing protein |
| 276 | CP003043.1 | GCA000298115_00198 | CDS | open | 225393-226169 | _na 258_aa | ABC transporter permease | |
| 277 | CP003043.1 | GCA000298115_00199 | CDS | open | 226406-227551 | _na 381_aa | chb | Glycoside hydrolase family 20 catalytic domain-containing protein |
| 278 | CP003043.1 | GCA000298115_00200 | CDS | open | 227566-228780 | _na 404_aa | Intercellular adhesion protein | |
| 279 | CP003043.1 | GCA000298115_00201 | CDS | open | 228783-229094 | _na 103_aa | hypothetical protein | |
| 280 | CP003043.1 | GCA000298115_00202 | CDS | open | 229075-229965 | _na 296_aa | pgaB | Intercellular adhesion protein |
| 281 | CP003043.1 | GCA000298115_00203 | CDS | open | 230013-230465 | _na 150_aa | DUF3290 domain-containing protein | |
| 282 | CP003043.1 | GCA000298115_00204 | CDS | open | 230467-231105 | _na 212_aa | ycaP | DUF421 domain-containing protein |
| 283 | CP003043.1 | GCA000298115_00205 | CDS | open | 231311-232486 | _na 391_aa | aspB | Aminotransferase |
| 284 | CP003043.1 | GCA000298115_00206 | CDS | open | 232601-234040 | _na 479_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 285 | CP003043.1 | GCA000298115_00207 | CDS | open | 234311-234433 | _na 40_aa | hypothetical protein | |
| 286 | CP003043.1 | GCA000298115_00208 | CDS | open | 234454-236148 | _na 564_aa | oleate hydratase | |
| 287 | CP003043.1 | GCA000298115_00209 | CDS | open | 236492-237427 | _na 311_aa | araC | Bifunctional transcriptional activator/DNA repair enzyme AdaA |
| 288 | CP003043.1 | GCA000298115_00210 | CDS | open | 237776-237916 | _na 46_aa | hypothetical protein | |
| 289 | CP003043.1 | GCA000298115_00211 | CDS | open | 238422-239768 | _na 448_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 290 | CP003043.1 | GCA000298115_00212 | CDS | open | 240066-241529 | _na 487_aa | hisJ | ABC transmembrane type-1 domain-containing protein |
| 291 | CP003043.1 | GCA000298115_00213 | CDS | open | 241607-242863 | _na 418_aa | argE | Succinyl-diaminopimelate desuccinylase |
| 292 | CP003043.1 | GCA000298115_00214 | CDS | open | 242870-244036 | _na 388_aa | abgB | Peptidase M20 dimerisation domain-containing protein |
| 293 | CP003043.1 | GCA000298115_00215 | CDS | open | 244235-244786 | _na 183_aa | lemA | LemA family protein |
| 294 | CP003043.1 | GCA000298115_00216 | CDS | open | 244803-245807 | _na 334_aa | htpX | Heat shock protein HtpX |
| 295 | CP003043.1 | GCA000298115_00217 | CDS | open | 245885-247810 | _na 641_aa | zntA | P-type Cu(+) transporter |
| 296 | CP003043.1 | GCA000298115_00218 | CDS | open | 247810-248082 | _na 90_aa | EfeO-type cupredoxin-like domain-containing protein | |
| 297 | CP003043.1 | GCA000298115_00219 | CDS | open | 248098-248466 | _na 122_aa | EfeO-type cupredoxin-like domain-containing protein | |
| 298 | CP003043.1 | GCA000298115_00220 | CDS | open | 248999-250000 | _na 333_aa | panE | 2-dehydropantoate 2-reductase |
| 299 | CP003043.1 | GCA000298115_00221 | CDS | open | 249988-250830 | _na 280_aa | pheA2 | prephenate dehydratase |
| 300 | CP003043.1 | GCA000298115_00222 | CDS | open | 251060-252007 | _na 315_aa | frsA | Alpha beta fold family hydrolase |
| 301 | CP003043.1 | GCA000298115_00223 | CDS | open | 252241-253995 | _na 584_aa | spxB | pyruvate oxidase |
| 302 | CP003043.1 | GCA000298115_00224 | CDS | open | 254356-254760 | _na 134_aa | Surface layer protein A domain-containing protein | |
| 303 | CP003043.1 | GCA000298115_00225 | CDS | open | 254879-255625 | _na 248_aa | fabG | Short chain dehydrogenase |
| 304 | CP003043.1 | GCA000298115_00226 | CDS | open | 255695-255976 | _na 93_aa | pucR | PucR C-terminal helix-turn-helix domain-containing protein |
| 305 | CP003043.1 | GCA000298115_00227 | CDS | open | 255973-256887 | _na 304_aa | Sugar diacid utilization regulator | |
| 306 | CP003043.1 | GCA000298115_00228 | CDS | open | 257452-258426 | _na 324_aa | ldhA | Putative glyoxylate reductase |
| 307 | CP003043.1 | GCA000298115_00229 | CDS | open | 258619-258840 | _na 73_aa | hypothetical protein | |
| 308 | CP003043.1 | GCA000298115_00230 | CDS | open | 258853-259173 | _na 106_aa | Peptidase C39 domain-containing protein | |
| 309 | CP003043.1 | GCA000298115_00231 | CDS | open | 259373-259597 | _na 74_aa | xRE | HTH cro/C1-type domain-containing protein |
| 310 | CP003043.1 | GCA000298115_00232 | CDS | open | 260195-260422 | _na 75_aa | hypothetical protein | |
| 311 | CP003043.1 | GCA000298115_00233 | CDS | open | 260364-261599 | _na 411_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 312 | CP003043.1 | GCA000298115_00234 | CDS | open | 261690-262307 | _na 205_aa | pncA | Isochorismatase |
| 313 | CP003043.1 | GCA000298115_00235 | CDS | open | 262511-263179 | _na 222_aa | N-acetylmuramoyl-L-alanine amidase domain-containing protein | |
| 314 | CP003043.1 | GCA000298115_00236 | CDS | open | 263274-264176 | _na 300_aa | Manganese ABC transporter substrate-binding lipoprotein | |
| 315 | CP003043.1 | GCA000298115_00237 | CDS | open | 264255-265397 | _na 380_aa | acm | Lysozyme |
| 316 | CP003043.1 | GCA000298115_00238 | CDS | open | 265473-265670 | _na 65_aa | Integral membrane protein | |
| 317 | CP003043.1 | GCA000298115_00239 | CDS | open | 265687-266637 | _na 316_aa | araC | HTH araC/xylS-type domain-containing protein |
| 318 | CP003043.1 | GCA000298115_00240 | CDS | open | 267046-268464 | _na 472_aa | melB | Transporter%2C major facilitator family protein |
| 319 | CP003043.1 | GCA000298115_00241 | CDS | open | 268504-270474 | _na 656_aa | hybA1 | Non-reducing end beta-L-arabinofuranosidase |
| 320 | CP003043.1 | GCA000298115_00242 | CDS | open | 270852-271325 | _na 157_aa | Major facilitator superfamily transporter | |
| 321 | CP003043.1 | GCA000298115_00243 | CDS | open | 271325-272044 | _na 239_aa | Major facilitator superfamily permease | |
| 322 | CP003043.1 | GCA000298115_00244 | CDS | open | 272207-273214 | _na 335_aa | purR | HTH lacI-type domain-containing protein |
| 323 | CP003043.1 | GCA000298115_00245 | CDS | open | 273795-275606 | _na 603_aa | uidA | beta-glucuronidase |
| 324 | CP003043.1 | GCA000298115_00246 | CDS | open | 275701-278253 | _na 850_aa | xynC | Glycosyl hydrolase family 59 |
| 325 | CP003043.1 | GCA000298115_00247 | CDS | open | 278299-278871 | _na 190_aa | ppnN | Cytokinin riboside 5'-monophosphate phosphoribohydrolase |
| 326 | CP003043.1 | GCA000298115_00248 | CDS | open | 278996-279436 | _na 146_aa | yhbS | N-acetyltransferase domain-containing protein |
| 327 | CP003043.1 | GCA000298115_00249 | CDS | open | 279461-280663 | _na 400_aa | cynX | Major facilitator superfamily (MFS) profile domain-containing protein |
| 328 | CP003043.1 | GCA000298115_00250 | CDS | open | 281385-283004 | _na 539_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 329 | CP003043.1 | GCA000298115_00251 | CDS | open | 283023-283748 | _na 241_aa | puuD | Putative glutamine amidotransferase |
| 330 | CP003043.1 | GCA000298115_00252 | CDS | open | 283990-284904 | _na 304_aa | rhaT | EamA domain-containing protein |
| 331 | CP003043.1 | GCA000298115_00253 | CDS | open | 285046-286428 | _na 460_aa | Glutamate--cysteine ligase | |
| 332 | CP003043.1 | GCA000298115_00254 | CDS | open | 286569-287891 | _na 440_aa | gshA | Glutamate--cysteine ligase |
| 333 | CP003043.1 | GCA000298115_00255 | CDS | open | 288162-288800 | _na 212_aa | ybjT | NAD(P)-binding domain-containing protein |
| 334 | CP003043.1 | GCA000298115_00256 | CDS | open | 288819-289685 | _na 288_aa | aRA1 | Methylglyoxal reductase |
| 335 | CP003043.1 | GCA000298115_00257 | CDS | open | 289691-289999 | _na 102_aa | merR | MerR family transcriptional regulator |
| 336 | CP003043.1 | GCA000298115_00258 | CDS | open | 289996-290127 | _na 43_aa | hypothetical protein | |
| 337 | CP003043.1 | GCA000298115_00259 | CDS | open | 290287-291270 | _na 327_aa | yxeI | Choloylglycine hydrolase |
| 338 | CP003043.1 | GCA000298115_00260 | CDS | open | 291383-292123 | _na 246_aa | puuD | Gamma-glutamyl-gamma-aminobutyrate hydrolase family protein |
| 339 | CP003043.1 | GCA000298115_00261 | CDS | open | 292225-293601 | _na 458_aa | gshA | Glutamate--cysteine ligase |
| 340 | CP003043.1 | GCA000298115_00262 | CDS | open | 293754-295505 | _na 583_aa | mdlB | Multidrug ABC superfamily ATP binding cassette transporter |
| 341 | CP003043.1 | GCA000298115_00263 | CDS | open | 295505-297301 | _na 598_aa | mdlB | Multidrug ABC superfamily ATP binding cassette transporter |
| 342 | CP003043.1 | GCA000298115_00264 | CDS | open | 297385-297819 | _na 144_aa | ibpA | Acid shock protein |
| 343 | CP003043.1 | GCA000298115_00265 | CDS | open | 297982-298416 | _na 144_aa | ibpA | SHSP domain-containing protein |
| 344 | CP003043.1 | GCA000298115_00266 | CDS | open | 298676-299371 | _na 231_aa | Peptidase M10 metallopeptidase domain-containing protein | |
| 345 | CP003043.1 | GCA000298115_00267 | CDS | open | 299475-300179 | _na 234_aa | ccc1 | Integral membrane protein |
| 346 | CP003043.1 | GCA000298115_00268 | CDS | open | 300212-300892 | _na 226_aa | ccc1 | VIT family protein |
| 347 | CP003043.1 | GCA000298115_00269 | CDS | open | 301089-301838 | _na 249_aa | nfnB | Nitro/flavin reductase |
| 348 | CP003043.1 | GCA000298115_00270 | CDS | open | 302185-302847 | _na 220_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 349 | CP003043.1 | GCA000298115_00271 | CDS | open | 302828-303517 | _na 229_aa | hisM | ABC-type amino acid transport system%2C permease component |
| 350 | CP003043.1 | GCA000298115_00272 | CDS | open | 303510-304250 | _na 246_aa | glnQ | ABC transporter domain-containing protein |
| 351 | CP003043.1 | GCA000298115_00273 | CDS | open | 304271-305125 | _na 284_aa | hisJ | ABC transporter%2C substrate-binding protein%2C family 3 |
| 352 | CP003043.1 | GCA000298115_00274 | CDS | open | 305503-306771 | _na 422_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 353 | CP003043.1 | GCA000298115_00275 | CDS | open | 306813-307571 | _na 252_aa | aroD | 3-dehydroquinate dehydratase |
| 354 | CP003043.1 | GCA000298115_00276 | CDS | open | 307682-308698 | _na 338_aa | pgaB | NodB-like y domain-containing protein |
| 355 | CP003043.1 | GCA000298115_00277 | CDS | open | 309254-310891 | _na 545_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 356 | CP003043.1 | GCA000298115_00278 | CDS | open | 311264-311392 | _na 42_aa | hypothetical protein | |
| 357 | CP003043.1 | GCA000298115_00279 | CDS | open | 311349-312614 | _na 421_aa | hutI | Imidazolonepropionase |
| 358 | CP003043.1 | GCA000298115_00280 | CDS | open | 312967-313284 | _na 105_aa | pheA | Chorismate mutase domain-containing protein |
| 359 | CP003043.1 | GCA000298115_00281 | CDS | open | 313281-314450 | _na 389_aa | aroC | chorismate synthase |
| 360 | CP003043.1 | GCA000298115_00282 | CDS | open | 314460-315776 | _na 438_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 361 | CP003043.1 | GCA000298115_00283 | CDS | open | 315783-316634 | _na 283_aa | tyrA | Putative prephenate dehydrogenase |
| 362 | CP003043.1 | GCA000298115_00284 | CDS | open | 316646-317167 | _na 173_aa | aroK | Shikimate kinase |
| 363 | CP003043.1 | GCA000298115_00285 | CDS | open | 317169-318041 | _na 290_aa | aroE | Shikimate dehydrogenase (NADP(+)) |
| 364 | CP003043.1 | GCA000298115_00286 | CDS | open | 318246-318776 | _na 176_aa | thiW | energy coupling factor transporter S component ThiW |
| 365 | CP003043.1 | GCA000298115_00287 | CDS | open | 318763-319776 | _na 337_aa | purR | HTH lacI-type domain-containing protein |
| 366 | CP003043.1 | GCA000298115_00288 | CDS | open | 319944-321914 | _na 656_aa | melB | PTS EIIA type-1 domain-containing protein |
| 367 | CP003043.1 | GCA000298115_00289 | CDS | open | 321948-324173 | _na 741_aa | galA | Alpha-galactosidase |
| 368 | CP003043.1 | GCA000298115_00290 | CDS | open | 324252-324860 | _na 202_aa | wbbJ | Acetyltransferase |
| 369 | CP003043.1 | GCA000298115_00291 | CDS | open | 325033-326523 | _na 496_aa | proP | Major facilitator superfamily (MFS) profile domain-containing protein |
| 370 | CP003043.1 | GCA000298115_00292 | CDS | open | 326585-328429 | _na 614_aa | DNA-binding protein | |
| 371 | CP003043.1 | GCA000298115_00293 | CDS | open | 328512-329387 | _na 291_aa | degV | DegV family protein |
| 372 | CP003043.1 | GCA000298115_00294 | CDS | open | 329799-330887 | _na 362_aa | pfoR | Phosphotransferase system EIIC domain-containing protein |
| 373 | CP003043.1 | GCA000298115_00295 | CDS | open | 331377-331868 | _na 163_aa | Surface layer protein A domain-containing protein | |
| 374 | CP003043.1 | GCA000298115_00296 | CDS | open | 331946-332395 | _na 149_aa | hypothetical protein | |
| 375 | CP003043.1 | GCA000298115_00297 | CDS | open | 332688-333056 | _na 122_aa | mazF | Type II toxin-antitoxin system PemK/MazF family toxin |
| 376 | CP003043.1 | GCA000298115_00298 | CDS | open | 333049-333291 | _na 80_aa | mazE | type II toxin-antitoxin system PemI/MazE family antitoxin |
| 377 | CP003043.1 | GCA000298115_00299 | CDS | open | 333455-334048 | _na 197_aa | lepB | signal peptidase I |
| 378 | CP003043.1 | GCA000298115_00300 | CDS | open | 334264-334614 | _na 116_aa | Glycosyl hydrolase family 92 domain-containing protein | |
| 379 | CP003043.1 | GCA000298115_00301 | CDS | open | 334871-335692 | _na 273_aa | hypothetical protein | |
| 380 | CP003043.1 | GCA000298115_00302 | CDS | open | 335725-336168 | _na 147_aa | hypothetical protein | |
| 381 | CP003043.1 | GCA000298115_00303 | CDS | open | 336355-336609 | _na 84_aa | hypothetical protein | |
| 382 | CP003043.1 | GCA000298115_00304 | CDS | open | 336624-336866 | _na 80_aa | Group-specific protein | |
| 383 | CP003043.1 | GCA000298115_00305 | CDS | open | 336931-339996 | _na 1021_aa | carB | carbamoyl-phosphate synthase large subunit |
| 384 | CP003043.1 | GCA000298115_00306 | CDS | open | 339996-341054 | _na 352_aa | carA | carbamoyl phosphate synthase small subunit |
| 385 | CP003043.1 | GCA000298115_00307 | CDS | open | 341619-342566 | _na 315_aa | pyrB | aspartate carbamoyltransferase catalytic subunit |
| 386 | CP003043.1 | GCA000298115_00308 | CDS | open | 342588-343862 | _na 424_aa | allB | dihydroorotase |
| 387 | CP003043.1 | GCA000298115_00309 | CDS | open | 343952-344503 | _na 183_aa | mutT | ADP-ribose pyrophosphatase |
| 388 | CP003043.1 | GCA000298115_00310 | CDS | open | 344625-344939 | _na 104_aa | emrE | Quaternary ammonium compound-resistance protein |
| 389 | CP003043.1 | GCA000298115_00311 | CDS | open | 345084-345494 | _na 136_aa | hicB | HicB-like antitoxin of toxin-antitoxin system domain-containing protein |
| 390 | CP003043.1 | GCA000298115_00312 | CDS | open | 345515-345688 | _na 57_aa | hicA | Addiction module toxin%2C HicA family |
| 391 | CP003043.1 | GCA000298115_00313 | CDS | open | 345883-347049 | _na 388_aa | serA | D-3-phosphoglycerate dehydrogenase |
| 392 | CP003043.1 | GCA000298115_00314 | CDS | open | 347061-348137 | _na 358_aa | serC | 3-phosphoserine/phosphohydroxythreonine transaminase |
| 393 | CP003043.1 | GCA000298115_00315 | CDS | open | 348505-349134 | _na 209_aa | phoE | Phosphoglycerate mutase |
| 394 | CP003043.1 | GCA000298115_00316 | CDS | open | 349206-349313 | _na 35_aa | hypothetical protein | |
| 395 | CP003043.1 | GCA000298115_00317 | CDS | open | 349519-351159 | _na 546_aa | oppA | Solute-binding protein family 5 domain-containing protein |
| 396 | CP003043.1 | GCA000298115_00318 | CDS | open | 351293-352219 | _na 308_aa | mdh | Putative L-lactate/malate dehydrogenase |
| 397 | CP003043.1 | GCA000298115_00319 | CDS | open | 352610-353680 | _na 356_aa | hypothetical protein | |
| 398 | CP003043.1 | GCA000298115_00320 | CDS | open | 353774-354718 | _na 314_aa | mdh | Putative L-lactate/malate dehydrogenase |
| 399 | CP003043.1 | GCA000298115_00321 | CDS | open | 354927-355331 | _na 134_aa | Integral membrane protein | |
| 400 | CP003043.1 | GCA000298115_00322 | CDS | open | 355359-355526 | _na 55_aa | hypothetical protein | |
| 401 | CP003043.1 | GCA000298115_00323 | CDS | open | 355523-356437 | _na 304_aa | menA | 1%2C4-dihydroxy-2-naphthoateoctaprenyltransferase |
| 402 | CP003043.1 | GCA000298115_00324 | CDS | open | 356506-357219 | _na 237_aa | ubiE | demethylmenaquinone methyltransferase |
| 403 | CP003043.1 | GCA000298115_00325 | CDS | open | 357500-358678 | _na 392_aa | aspB | Aminotransferase |
| 404 | CP003043.1 | GCA000298115_00326 | CDS | open | 358696-359688 | _na 330_aa | ldhA | D-lactate dehydrogenase |
| 405 | CP003043.1 | GCA000298115_00327 | CDS | open | 359689-360117 | _na 142_aa | Phosphotransferase system EIIC domain-containing protein | |
| 406 | CP003043.1 | GCA000298115_00328 | CDS | open | 360130-360438 | _na 102_aa | sdpI | SdpI family protein |
| 407 | CP003043.1 | GCA000298115_00329 | CDS | open | 360678-362003 | _na 441_aa | lpd | Glutathione-disulfide reductase |
| 408 | CP003043.1 | GCA000298115_00330 | CDS | open | 362183-362689 | _na 168_aa | nimA | Putative flavin-nucleotide-binding protein |
| 409 | CP003043.1 | GCA000298115_00331 | CDS | open | 362783-363016 | _na 77_aa | hypothetical protein | |
| 410 | CP003043.1 | GCA000298115_00332 | CDS | open | 363069-364025 | _na 318_aa | ABC transporter permease | |
| 411 | CP003043.1 | GCA000298115_00333 | CDS | open | 364253-365290 | _na 345_aa | lplA | lipoate--protein ligase |
| 412 | CP003043.1 | GCA000298115_00334 | CDS | open | 365473-367266 | _na 597_aa | mdlB | ABC transmembrane type-1 domain-containing protein |
| 413 | CP003043.1 | GCA000298115_00335 | CDS | open | 367790-368644 | _na 284_aa | Abi family protein | |
| 414 | CP003043.1 | GCA000298115_00336 | CDS | open | 368863-369345 | _na 160_aa | btuE | Glutathione peroxidase |
| 415 | CP003043.1 | GCA000298115_00337 | CDS | open | 369358-371919 | _na 853_aa | Antimicrobial peptide ABC transporter permease | |
| 416 | CP003043.1 | GCA000298115_00338 | CDS | open | 372042-372893 | _na 283_aa | Alpha/beta hydrolase | |
| 417 | CP003043.1 | GCA000298115_00339 | CDS | open | 373163-374278 | _na 371_aa | Extracellular protein | |
| 418 | CP003043.1 | GCA000298115_00340 | CDS | open | 374374-375438 | _na 354_aa | Extracellular protein | |
| 419 | CP003043.1 | GCA000298115_00341 | CDS | open | 375577-376101 | _na 174_aa | acrR | Transcriptional regulator%2C TetR family |
| 420 | CP003043.1 | GCA000298115_00342 | CDS | open | 376101-377165 | _na 354_aa | hrtB | Putative hemin transport system permease protein HrtB |
| 421 | CP003043.1 | GCA000298115_00343 | CDS | open | 377168-377863 | _na 231_aa | hrtA | Putative hemin import ATP-binding protein HrtA |
| 422 | CP003043.1 | GCA000298115_00344 | CDS | open | 378097-378468 | _na 123_aa | paaI | Aromatic compounds catabolism protein |
| 423 | CP003043.1 | GCA000298115_00345 | CDS | open | 378504-379325 | _na 273_aa | menB | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase |
| 424 | CP003043.1 | GCA000298115_00346 | CDS | open | 379334-380758 | _na 474_aa | menE | o-succinylbenzoate--CoA ligase |
| 425 | CP003043.1 | GCA000298115_00347 | CDS | open | 381029-382063 | _na 344_aa | ptcA | putrescine carbamoyltransferase |
| 426 | CP003043.1 | GCA000298115_00348 | CDS | open | 382097-383512 | _na 471_aa | potE | Putative glutamate/gamma-aminobutyrate antiporter |
| 427 | CP003043.1 | GCA000298115_00349 | CDS | open | 383545-384642 | _na 365_aa | aguA | agmatine deiminase |
| 428 | CP003043.1 | GCA000298115_00350 | CDS | open | 384654-385613 | _na 319_aa | arcC | carbamate kinase |
| 429 | CP003043.1 | GCA000298115_00351 | CDS | open | 385752-386840 | _na 362_aa | aguA | agmatine deiminase |
| 430 | CP003043.1 | GCA000298115_00352 | CDS | open | 386850-387635 | _na 261_aa | rpiR | HTH rpiR-type domain-containing protein |
| 431 | CP003043.1 | GCA000298115_00353 | CDS | open | 387740-389227 | _na 495_aa | hypothetical protein | |
| 432 | CP003043.1 | GCA000298115_00354 | CDS | open | 389354-389503 | _na 49_aa | rpmG | 50S ribosomal protein L33 |
| 433 | CP003043.1 | GCA000298115_00355 | CDS | open | 389628-391451 | _na 607_aa | zntA | Cd(2+)-exporting ATPase |
| 434 | CP003043.1 | GCA000298115_00356 | CDS | open | 391606-392475 | _na 289_aa | pdxI | Putative oxidoreductase YdbC |
| 435 | CP003043.1 | GCA000298115_00357 | CDS | open | 392719-394263 | _na 514_aa | gppA | Exopolyphosphatase |
| 436 | CP003043.1 | GCA000298115_00358 | CDS | open | 394260-396437 | _na 725_aa | ppk | RNA degradosome polyphosphate kinase |
| 437 | CP003043.1 | GCA000298115_00359 | CDS | open | 396437-397384 | _na 315_aa | ppx | exopolyphosphatase |
| 438 | CP003043.1 | GCA000298115_00360 | CDS | open | 397499-398602 | _na 367_aa | vanZ | VanZ-like domain-containing protein |
| 439 | CP003043.1 | GCA000298115_00361 | CDS | open | 398624-399691 | _na 355_aa | elyC | DUF218 domain-containing protein |
| 440 | CP003043.1 | GCA000298115_00362 | CDS | open | 399776-400186 | _na 136_aa | arsC | Arsenate reductase |
| 441 | CP003043.1 | GCA000298115_00363 | CDS | open | 400412-401530 | _na 372_aa | aspB | aminotransferase |
| 442 | CP003043.1 | GCA000298115_00364 | CDS | open | 401988-402887 | _na 299_aa | metF | methylenetetrahydrofolate reductase [NAD(P)H] |
| 443 | CP003043.1 | GCA000298115_00365 | CDS | open | 402865-405150 | _na 761_aa | metE | 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase |
| 444 | CP003043.1 | GCA000298115_00366 | CDS | open | 405419-405892 | _na 157_aa | luxS | S-ribosylhomocysteine lyase |
| 445 | CP003043.1 | GCA000298115_00367 | CDS | open | 406302-406955 | _na 217_aa | acrR | HTH tetR-type domain-containing protein |
| 446 | CP003043.1 | GCA000298115_00368 | CDS | open | 406965-408134 | _na 389_aa | yadH | ABC transmembrane type-2 domain-containing protein |
| 447 | CP003043.1 | GCA000298115_00369 | CDS | open | 408112-408849 | _na 245_aa | rbbA | ABC transporter ATP-binding protein |
| 448 | CP003043.1 | GCA000298115_00370 | CDS | open | 409151-410524 | _na 457_aa | fUI1 | Cytosine permease |
| 449 | CP003043.1 | GCA000298115_00371 | CDS | open | 410526-411125 | _na 199_aa | dotG | Pentapeptide repeat-containing protein |
| 450 | CP003043.1 | GCA000298115_00372 | CDS | open | 411308-412123 | _na 271_aa | ecfT | ABC transmembrane type-1 domain-containing protein |
| 451 | CP003043.1 | GCA000298115_00373 | CDS | open | 412111-413772 | _na 553_aa | rbbA | energy-coupling factor transporter ATPase |
| 452 | CP003043.1 | GCA000298115_00374 | CDS | open | 413762-414472 | _na 236_aa | ECF transporter S component | |
| 453 | CP003043.1 | GCA000298115_00375 | CDS | open | 414489-415535 | _na 348_aa | Fucose-binding lectin II | |
| 454 | CP003043.1 | GCA000298115_00376 | CDS | open | 415553-416251 | _na 232_aa | Transcobalamin-like C-terminal domain-containing protein | |
| 455 | CP003043.1 | GCA000298115_00377 | CDS | open | 416807-417772 | _na 321_aa | fixB | Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein |
| 456 | CP003043.1 | GCA000298115_00378 | CDS | open | 417786-418559 | _na 257_aa | fixA | Electron transfer flavoprotein small subunit |
| 457 | CP003043.1 | GCA000298115_00379 | CDS | open | 418573-419691 | _na 372_aa | Acyl-CoA dehydrogenase | |
| 458 | CP003043.1 | GCA000298115_00380 | CDS | open | 419868-420725 | _na 285_aa | hipB | HTH cro/C1-type domain-containing protein |
| 459 | CP003043.1 | GCA000298115_00381 | CDS | open | 420948-421862 | _na 304_aa | oca4 | Protein-tyrosine-phosphatase |
| 460 | CP003043.1 | GCA000298115_00382 | CDS | open | 421902-422495 | _na 197_aa | mdaB | Flavodoxin-like fold domain-containing protein |
| 461 | CP003043.1 | GCA000298115_00383 | CDS | open | 422611-423096 | _na 161_aa | marR | HTH marR-type domain-containing protein |
| 462 | CP003043.1 | GCA000298115_00384 | CDS | open | 423233-424825 | _na 530_aa | mntH | Nramp family divalent metal transporter |
| 463 | CP003043.1 | GCA000298115_00385 | CDS | open | 424898-425344 | _na 148_aa | uspA | Universal stress protein%2C UspA family protein |
| 464 | CP003043.1 | GCA000298115_00386 | CDS | open | 425425-426774 | _na 449_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 465 | CP003043.1 | GCA000298115_00387 | CDS | open | 426966-428390 | _na 474_aa | adhE | Succinate-semialdehyde dehydrogenase (NADP+) |
| 466 | CP003043.1 | GCA000298115_00388 | CDS | open | 428500-429405 | _na 301_aa | lCB5 | Diacylglycerol kinase |
| 467 | CP003043.1 | GCA000298115_00389 | CDS | open | 429451-429942 | _na 163_aa | Putative 7%2C8-dihydro-8-oxoguanine triphosphatase | |
| 468 | CP003043.1 | GCA000298115_00390 | CDS | open | 429939-430349 | _na 136_aa | hxlR | HTH hxlR-type domain-containing protein |
| 469 | CP003043.1 | GCA000298115_00391 | CDS | open | 430453-430962 | _na 169_aa | yajL | Intracellular protease C56%2C PfpI family |
| 470 | CP003043.1 | GCA000298115_00392 | CDS | open | 431059-432393 | _na 444_aa | amtB | Ammonium transporter |
| 471 | CP003043.1 | GCA000298115_00393 | CDS | open | 432676-433308 | _na 210_aa | ywnB | Flavin reductase |
| 472 | CP003043.1 | GCA000298115_00394 | CDS | open | 433675-435594 | _na 639_aa | zntA | Cd(2+)-exporting ATPase |
| 473 | CP003043.1 | GCA000298115_00395 | CDS | open | 435615-435836 | _na 73_aa | copZ | Copper chaperone |
| 474 | CP003043.1 | GCA000298115_00396 | CDS | open | 435846-436394 | _na 182_aa | dps | DNA protection during starvation protein |
| 475 | CP003043.1 | GCA000298115_00397 | CDS | open | 436837-437814 | _na 325_aa | Oxidoreductase | |
| 476 | CP003043.1 | GCA000298115_00398 | CDS | open | 438085-438573 | _na 162_aa | purE | N5-carboxyaminoimidazole ribonucleotide mutase |
| 477 | CP003043.1 | GCA000298115_00399 | CDS | open | 438554-439687 | _na 377_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 478 | CP003043.1 | GCA000298115_00400 | CDS | open | 439689-440420 | _na 243_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 479 | CP003043.1 | GCA000298115_00401 | CDS | open | 440420-440683 | _na 87_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 480 | CP003043.1 | GCA000298115_00402 | CDS | open | 440680-441363 | _na 227_aa | purQ | phosphoribosylformylglycinamidine synthase subunit PurQ |
| 481 | CP003043.1 | GCA000298115_00403 | CDS | open | 441356-443590 | _na 744_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 482 | CP003043.1 | GCA000298115_00404 | CDS | open | 443575-445017 | _na 480_aa | purF | amidophosphoribosyltransferase |
| 483 | CP003043.1 | GCA000298115_00405 | CDS | open | 445028-446044 | _na 338_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 484 | CP003043.1 | GCA000298115_00406 | CDS | open | 446041-446628 | _na 195_aa | purN | phosphoribosylglycinamide formyltransferase |
| 485 | CP003043.1 | GCA000298115_00407 | CDS | open | 446628-448157 | _na 509_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 486 | CP003043.1 | GCA000298115_00408 | CDS | open | 448621-449853 | _na 410_aa | purD | Phosphoribosylamine--glycine ligase |
| 487 | CP003043.1 | GCA000298115_00409 | CDS | open | 450051-450791 | _na 246_aa | yaaA | peroxide stress protein YaaA |
| 488 | CP003043.1 | GCA000298115_00410 | CDS | open | 450794-451672 | _na 292_aa | pepI | proline iminopeptidase |
| 489 | CP003043.1 | GCA000298115_00411 | CDS | open | 451895-452530 | _na 211_aa | gph | Putative phosphoglycolate phosphatase |
| 490 | CP003043.1 | GCA000298115_00412 | CDS | open | 452708-453958 | _na 416_aa | araJ | Major facilitator superfamily (MFS) profile domain-containing protein |
| 491 | CP003043.1 | GCA000298115_00413 | CDS | open | 454045-454410 | _na 121_aa | mazF | Type II toxin-antitoxin system PemK/MazF family toxin |
| 492 | CP003043.1 | GCA000298115_00414 | CDS | open | 454385-454615 | _na 76_aa | Antitoxin of toxin-antitoxin stability system | |
| 493 | CP003043.1 | GCA000298115_00415 | CDS | open | 454883-455602 | _na 239_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 494 | CP003043.1 | GCA000298115_00416 | CDS | open | 455592-456239 | _na 215_aa | pyrE | Orotate phosphoribosyltransferase |
| 495 | CP003043.1 | GCA000298115_00417 | CDS | open | 456229-457173 | _na 314_aa | pyrD | dihydroorotate oxidase |
| 496 | CP003043.1 | GCA000298115_00418 | CDS | open | 457277-459802 | _na 841_aa | uvrA | excinuclease ABC subunit UvrA |
| 497 | CP003043.1 | GCA000298115_00419 | CDS | open | 460082-461248 | _na 388_aa | nagC | ROK family protein |
| 498 | CP003043.1 | GCA000298115_00420 | CDS | open | 461674-462339 | _na 221_aa | Xylosidase | |
| 499 | CP003043.1 | GCA000298115_00421 | CDS | open | 462799-464100 | _na 433_aa | btlA | Major facilitator superfamily (MFS) profile domain-containing protein |
| 500 | CP003043.1 | GCA000298115_00422 | CDS | open | 464196-465524 | _na 442_aa | xynC | Glycosyl hydrolase family 30 TIM-barrel domain-containing protein |

