BAKTAGenome Explorer: Phocaeicola abscessus (GCA_000312445.1)
Select a Genome:
|
BAKTA Annotations for GCA_000312445.1
|
Search & Sort all 4267 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | HE997183.1 | GCA000312445_01198 | gene | open | 440153-441265 | |||
| 2502 | HE997183.1 | GCA000312445_01199 | gene | open | 441293-441775 | |||
| 2503 | HE997183.1 | GCA000312445_01200 | gene | open | 441815-444187 | |||
| 2504 | HE997183.1 | GCA000312445_01201 | gene | open | 444433-446772 | |||
| 2505 | HE997183.1 | GCA000312445_01202 | gene | open | 446784-448154 | degT | ||
| 2506 | HE997183.1 | GCA000312445_01203 | gene | open | 448213-449595 | |||
| 2507 | HE997183.1 | GCA000312445_01204 | gene | open | 449625-450995 | |||
| 2508 | HE997183.1 | GCA000312445_01205 | gene | open | 450998-452371 | spsC | ||
| 2509 | HE997183.1 | GCA000312445_01206 | gene | open | 452382-454121 | |||
| 2510 | HE997183.1 | GCA000312445_01207 | gene | open | 456226-459309 | |||
| 2511 | HE997183.1 | GCA000312445_01208 | gene | open | 460188-463277 | |||
| 2512 | HE997183.1 | GCA000312445_01209 | gene | open | 463564-464268 | |||
| 2513 | HE997183.1 | GCA000312445_01210 | gene | open | 464425-466098 | |||
| 2514 | HE997183.1 | GCA000312445_01211 | gene | open | 466101-468941 | |||
| 2515 | HE997183.1 | GCA000312445_01212 | gene | open | 468982-470253 | |||
| 2516 | HE997183.1 | GCA000312445_01213 | gene | open | 470280-470825 | |||
| 2517 | HE997183.1 | GCA000312445_01214 | gene | open | 470855-471001 | |||
| 2518 | HE997183.1 | GCA000312445_01215 | gene | open | 471001-471147 | |||
| 2519 | HE997183.1 | GCA000312445_01216 | gene | open | 471322-472104 | |||
| 2520 | HE997183.1 | GCA000312445_01217 | gene | open | 472070-473833 | |||
| 2521 | HE997183.1 | GCA000312445_01218 | gene | open | 474229-474666 | |||
| 2522 | HE997183.1 | GCA000312445_01219 | gene | open | 475610-476635 | |||
| 2523 | HE997183.1 | GCA000312445_01220 | gene | open | 476635-477678 | |||
| 2524 | HE997183.1 | GCA000312445_01221 | gene | open | 477686-479056 | |||
| 2525 | HE997183.1 | GCA000312445_01222 | gene | open | 479072-479317 | |||
| 2526 | HE997183.1 | GCA000312445_01223 | gene | open | 479324-480805 | |||
| 2527 | HE997183.1 | GCA000312445_01224 | gene | open | 481372-483114 | |||
| 2528 | HE997183.1 | GCA000312445_01225 | gene | open | 483134-484768 | |||
| 2529 | HE997183.1 | GCA000312445_01226 | gene | open | 484832-486499 | |||
| 2530 | HE997183.1 | GCA000312445_01227 | gene | open | 486569-487168 | |||
| 2531 | HE997183.1 | GCA000312445_01228 | gene | open | 487370-487954 | |||
| 2532 | HE997183.1 | GCA000312445_01229 | gene | open | 487976-488476 | |||
| 2533 | HE997183.1 | GCA000312445_01230 | gene | open | 488487-488972 | |||
| 2534 | HE997183.1 | GCA000312445_01231 | gene | open | 489261-491849 | clpB | ||
| 2535 | HE997183.1 | GCA000312445_01232 | gene | open | 492058-492474 | |||
| 2536 | HE997183.1 | GCA000312445_01233 | gene | open | 492541-493140 | coaE | ||
| 2537 | HE997183.1 | GCA000312445_01234 | gene | open | 493161-494180 | |||
| 2538 | HE997183.1 | GCA000312445_01235 | gene | open | 494187-494510 | yajC | ||
| 2539 | HE997183.1 | GCA000312445_01236 | gene | open | 494542-495468 | nusB | ||
| 2540 | HE997183.1 | GCA000312445_01237 | gene | open | 495669-496091 | |||
| 2541 | HE997183.1 | GCA000312445_01238 | gene | open | 496268-496903 | |||
| 2542 | HE997183.1 | GCA000312445_01239 | gene | open | 496916-497479 | pth | ||
| 2543 | HE997183.1 | GCA000312445_01240 | gene | open | 497481-497918 | |||
| 2544 | HE997183.1 | GCA000312445_01241 | gene | open | 498238-498588 | padR | ||
| 2545 | HE997183.1 | GCA000312445_01242 | gene | open | 498607-500271 | pspC | ||
| 2546 | HE997183.1 | GCA000312445_01243 | gene | open | 500280-500549 | |||
| 2547 | HE997183.1 | GCA000312445_01244 | gene | open | 500963-501127 | |||
| 2548 | HE997183.1 | GCA000312445_01245 | gene | open | 501191-503974 | |||
| 2549 | HE997183.1 | GCA000312445_01246 | gene | open | 504144-504533 | |||
| 2550 | HE997183.1 | GCA000312445_01247 | gene | open | 504512-504808 | |||
| 2551 | HE997183.1 | GCA000312445_01248 | gene | open | 504995-505207 | |||
| 2552 | HE997183.1 | GCA000312445_01249 | gene | open | 505221-505493 | |||
| 2553 | HE997183.1 | GCA000312445_01250 | gene | open | 505365-506036 | |||
| 2554 | HE997183.1 | GCA000312445_01251 | gene | open | 506037-507332 | |||
| 2555 | HE997183.1 | GCA000312445_01252 | gene | open | 507427-508524 | gcvT | ||
| 2556 | HE997183.1 | GCA000312445_01253 | gene | open | 508546-509766 | pepT | ||
| 2557 | HE997183.1 | GCA000312445_01254 | gene | open | 509866-511272 | |||
| 2558 | HE997183.1 | GCA000312445_01257 | gene | open | 511588-511695 | |||
| 2559 | HE997183.1 | GCA000312445_01258 | gene | open | 511774-512310 | |||
| 2560 | HE997183.1 | GCA000312445_01259 | gene | open | 512312-513265 | |||
| 2561 | HE997183.1 | GCA000312445_01260 | gene | open | 513268-513819 | |||
| 2562 | HE997183.1 | GCA000312445_01261 | gene | open | 513773-514447 | |||
| 2563 | HE997183.1 | GCA000312445_01262 | gene | open | 514460-515026 | mntP | ||
| 2564 | HE997183.1 | GCA000312445_01263 | gene | open | 515031-516053 | |||
| 2565 | HE997183.1 | GCA000312445_01264 | gene | open | 516201-517124 | |||
| 2566 | HE997183.1 | GCA000312445_01265 | gene | open | 517302-518702 | |||
| 2567 | HE997183.1 | GCA000312445_01266 | gene | open | 519029-520549 | |||
| 2568 | HE997183.1 | GCA000312445_01267 | gene | open | 520887-521564 | |||
| 2569 | HE997183.1 | GCA000312445_01268 | gene | open | 521593-523632 | |||
| 2570 | HE997183.1 | GCA000312445_01269 | gene | open | 523646-524110 | |||
| 2571 | HE997183.1 | GCA000312445_01270 | gene | open | 524114-524566 | |||
| 2572 | HE997183.1 | GCA000312445_01271 | gene | open | 524569-526212 | |||
| 2573 | HE997183.1 | GCA000312445_01272 | gene | open | 526460-526702 | |||
| 2574 | HE997183.1 | GCA000312445_01273 | gene | open | 526743-527864 | recF | ||
| 2575 | HE997183.1 | GCA000312445_01274 | gene | open | 528011-528688 | |||
| 2576 | HE997183.1 | GCA000312445_01275 | gene | open | 528942-529439 | ribH | ||
| 2577 | HE997183.1 | GCA000312445_01276 | gene | open | 529593-530393 | |||
| 2578 | HE997183.1 | GCA000312445_01277 | gene | open | 530401-530808 | secG | ||
| 2579 | HE997183.1 | GCA000312445_01278 | gene | open | 530814-531641 | |||
| 2580 | HE997183.1 | GCA000312445_01279 | gene | open | 531655-532179 | lptE | ||
| 2581 | HE997183.1 | GCA000312445_01280 | gene | open | 532157-533467 | |||
| 2582 | HE997183.1 | GCA000312445_01281 | gene | open | 533491-533727 | |||
| 2583 | HE997183.1 | GCA000312445_01282 | gene | open | 533785-534681 | pfkB | ||
| 2584 | HE997183.1 | GCA000312445_01283 | gene | open | 534704-535903 | fucP | ||
| 2585 | HE997183.1 | GCA000312445_01284 | gene | open | 535914-536630 | |||
| 2586 | HE997183.1 | GCA000312445_01285 | gene | open | 536620-537693 | |||
| 2587 | HE997183.1 | GCA000312445_01286 | gene | open | 537683-538639 | |||
| 2588 | HE997183.1 | GCA000312445_01287 | gene | open | 538623-539492 | |||
| 2589 | HE997183.1 | GCA000312445_01288 | gene | open | 539499-540209 | |||
| 2590 | HE997183.1 | GCA000312445_01289 | gene | open | 540214-541320 | pdxA | ||
| 2591 | HE997183.1 | GCA000312445_01290 | gene | open | 541349-542422 | |||
| 2592 | HE997183.1 | GCA000312445_01291 | gene | open | 542424-543488 | rlmN | ||
| 2593 | HE997183.1 | GCA000312445_01292 | gene | open | 543619-543864 | |||
| 2594 | HE997183.1 | GCA000312445_01293 | gene | open | 543857-544222 | |||
| 2595 | HE997183.1 | GCA000312445_01294 | gene | open | 544311-544511 | |||
| 2596 | HE997183.1 | GCA000312445_01295 | gene | open | 544729-545220 | |||
| 2597 | HE997183.1 | GCA000312445_01296 | gene | open | 545600-546610 | |||
| 2598 | HE997183.1 | GCA000312445_01297 | gene | open | 546633-547148 | |||
| 2599 | HE997183.1 | GCA000312445_01298 | gene | open | 547707-549686 | |||
| 2600 | HE997183.1 | GCA000312445_01299 | gene | open | 549713-550318 | nosL | ||
| 2601 | HE997183.1 | GCA000312445_01300 | gene | open | 550322-550864 | |||
| 2602 | HE997183.1 | GCA000312445_01301 | gene | open | 550990-552177 | nosD | ||
| 2603 | HE997183.1 | GCA000312445_01302 | gene | open | 552174-552890 | |||
| 2604 | HE997183.1 | GCA000312445_01303 | gene | open | 552874-553641 | |||
| 2605 | HE997183.1 | GCA000312445_01304 | gene | open | 553929-555023 | |||
| 2606 | HE997183.1 | GCA000312445_01305 | gene | open | 555026-556087 | |||
| 2607 | HE997183.1 | GCA000312445_01306 | gene | open | 556091-557566 | lptB | ||
| 2608 | HE997183.1 | GCA000312445_01307 | gene | open | 557603-558508 | hlyD | ||
| 2609 | HE997183.1 | GCA000312445_01308 | gene | open | 558541-559779 | |||
| 2610 | HE997183.1 | GCA000312445_01309 | gene | open | 559949-560857 | |||
| 2611 | HE997183.1 | GCA000312445_01310 | gene | open | 560854-561282 | |||
| 2612 | HE997183.1 | GCA000312445_01311 | gene | open | 561491-562150 | |||
| 2613 | HE997183.1 | GCA000312445_01312 | gene | open | 562391-562759 | |||
| 2614 | HE997183.1 | GCA000312445_01313 | gene | open | 563192-563776 | pfkB | ||
| 2615 | HE997183.1 | GCA000312445_01314 | gene | open | 563935-564681 | hagB | ||
| 2616 | HE997183.1 | GCA000312445_01315 | gene | open | 565139-565378 | |||
| 2617 | HE997183.1 | GCA000312445_01316 | gene | open | 565469-566410 | |||
| 2618 | HE997183.1 | GCA000312445_01317 | gene | open | 566432-566875 | |||
| 2619 | HE997183.1 | GCA000312445_01318 | gene | open | 566963-567523 | |||
| 2620 | HE997183.1 | GCA000312445_01319 | gene | open | 567530-573295 | |||
| 2621 | HE997183.1 | GCA000312445_01320 | gene | open | 573511-574806 | |||
| 2622 | HE997183.1 | GCA000312445_01321 | gene | open | 574939-575775 | folP | ||
| 2623 | HE997183.1 | GCA000312445_01322 | gene | open | 575786-576547 | cdaA | ||
| 2624 | HE997183.1 | GCA000312445_01323 | gene | open | 576544-577566 | |||
| 2625 | HE997183.1 | GCA000312445_01324 | gene | open | 577550-578452 | |||
| 2626 | HE997183.1 | GCA000312445_01325 | gene | open | 578619-579632 | pta | ||
| 2627 | HE997183.1 | GCA000312445_01326 | gene | open | 579700-580911 | |||
| 2628 | HE997183.1 | GCA000312445_01327 | gene | open | 581666-584038 | |||
| 2629 | HE997183.1 | GCA000312445_00833 | gene | open | 6448-6522 | trnP | ||
| 2630 | HE997183.1 | GCA000312445_00840 | gene | open | 14945-15018 | trnR | ||
| 2631 | HE997183.1 | GCA000312445_00841 | gene | open | 15053-15126 | trnR | ||
| 2632 | HE997183.1 | GCA000312445_00866 | gene | open | 47717-47790 | trnD | ||
| 2633 | HE997183.1 | GCA000312445_00867 | gene | open | 47822-47895 | trnD | ||
| 2634 | HE997183.1 | GCA000312445_00886 | gene | open | 71407-71478 | trnR | ||
| 2635 | HE997183.1 | GCA000312445_00918 | gene | open | 101368-101439 | trnC | ||
| 2636 | HE997183.1 | GCA000312445_00923 | gene | open | 107945-108018 | trnR | ||
| 2637 | HE997183.1 | GCA000312445_00940 | gene | open | 127732-127818 | trnS | ||
| 2638 | HE997183.1 | GCA000312445_00941 | gene | open | 127831-127903 | trnE | ||
| 2639 | HE997183.1 | GCA000312445_00965 | gene | open | 154629-154701 | trnK | ||
| 2640 | HE997183.1 | GCA000312445_01037 | gene | open | 239939-240011 | trnG | ||
| 2641 | HE997183.1 | GCA000312445_01156 | gene | open | 380659-380745 | trnS | ||
| 2642 | HE997183.1 | GCA000312445_01162 | gene | open | 388177-388248 | trnE | ||
| 2643 | HE997183.1 | GCA000312445_01255 | gene | open | 511444-511517 | trnT | ||
| 2644 | HE997183.1 | GCA000312445_00833 | tRNA | open | 6448-6522 | trnP | tRNA-Pro(tgg) | |
| 2645 | HE997183.1 | GCA000312445_00840 | tRNA | open | 14945-15018 | trnR | tRNA-Arg(acg) | |
| 2646 | HE997183.1 | GCA000312445_00841 | tRNA | open | 15053-15126 | trnR | tRNA-Arg(acg) | |
| 2647 | HE997183.1 | GCA000312445_00866 | tRNA | open | 47717-47790 | trnD | tRNA-Asp(gtc) | |
| 2648 | HE997183.1 | GCA000312445_00867 | tRNA | open | 47822-47895 | trnD | tRNA-Asp(gtc) | |
| 2649 | HE997183.1 | GCA000312445_00886 | tRNA | open | 71407-71478 | trnR | tRNA-Arg(ccg) | |
| 2650 | HE997183.1 | GCA000312445_00918 | tRNA | open | 101368-101439 | trnC | tRNA-Cys(gca) | |
| 2651 | HE997183.1 | GCA000312445_00923 | tRNA | open | 107945-108018 | trnR | tRNA-Arg(tct) | |
| 2652 | HE997183.1 | GCA000312445_00940 | tRNA | open | 127732-127818 | trnS | tRNA-Ser(gct) | |
| 2653 | HE997183.1 | GCA000312445_00941 | tRNA | open | 127831-127903 | trnE | tRNA-Glu(ctc) | |
| 2654 | HE997183.1 | GCA000312445_00965 | tRNA | open | 154629-154701 | trnK | tRNA-Lys(ctt) | |
| 2655 | HE997183.1 | GCA000312445_01037 | tRNA | open | 239939-240011 | trnG | tRNA-Gly(ccc) | |
| 2656 | HE997183.1 | GCA000312445_01156 | tRNA | open | 380659-380745 | trnS | tRNA-Ser(cga) | |
| 2657 | HE997183.1 | GCA000312445_01162 | tRNA | open | 388177-388248 | trnE | tRNA-Glu(ttc) | |
| 2658 | HE997183.1 | GCA000312445_01255 | tRNA | open | 511444-511517 | trnT | tRNA-Thr(tgt) | |
| 2659 | HE997184.1 | repeat_region | open | 328402-331873 | CRISPR array with 54 repeats of length 29%2C consensus sequence CTTTTAATCGTACTTAGTAGAATTGAAAT and spacer length 35 | |||
| 2660 | HE997184.1 | GCA000312445_01328 | CDS | open | 114-1730 | _na 538_aa | ABC transporter%2C ATP-binding protein | |
| 2661 | HE997184.1 | GCA000312445_01329 | CDS | open | 1902-2534 | _na 210_aa | grpE | Protein GrpE |
| 2662 | HE997184.1 | GCA000312445_01330 | CDS | open | 2546-3715 | _na 389_aa | dnaJ | molecular chaperone DnaJ |
| 2663 | HE997184.1 | GCA000312445_01331 | CDS | open | 3719-5011 | _na 430_aa | tetrahydrofolate synthase | |
| 2664 | HE997184.1 | GCA000312445_01332 | CDS | open | 5105-6202 | _na 365_aa | Aldose 1-epimerase | |
| 2665 | HE997184.1 | GCA000312445_01333 | CDS | open | 6236-7561 | _na 441_aa | Transporter%2C major facilitator family protein | |
| 2666 | HE997184.1 | GCA000312445_01334 | CDS | open | 7603-8757 | _na 384_aa | galK | galactokinase |
| 2667 | HE997184.1 | GCA000312445_01335 | CDS | open | 9649-12735 | _na 1028_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 2668 | HE997184.1 | GCA000312445_01336 | CDS | open | 12749-14407 | _na 552_aa | Starch-binding protein%2C SusD-like family | |
| 2669 | HE997184.1 | GCA000312445_01337 | CDS | open | 14476-15657 | _na 393_aa | Calcineurin-like phosphoesterase family protein | |
| 2670 | HE997184.1 | GCA000312445_01338 | CDS | open | 15848-17515 | _na 555_aa | putative transporter | |
| 2671 | HE997184.1 | GCA000312445_01339 | CDS | open | 17756-19606 | _na 616_aa | mutA | methylmalonyl-CoA mutase small subunit |
| 2672 | HE997184.1 | GCA000312445_01340 | CDS | open | 19634-21796 | _na 720_aa | scpA | methylmalonyl-CoA mutase |
| 2673 | HE997184.1 | GCA000312445_01341 | CDS | open | 22027-23085 | _na 352_aa | Putative lipoprotein | |
| 2674 | HE997184.1 | GCA000312445_01342 | CDS | open | 23114-23263 | _na 49_aa | hypothetical protein | |
| 2675 | HE997184.1 | GCA000312445_01343 | CDS | open | 23306-23458 | _na 50_aa | hypothetical protein | |
| 2676 | HE997184.1 | GCA000312445_01344 | CDS | open | 23949-24728 | _na 259_aa | Cytochrome c assembly protein | |
| 2677 | HE997184.1 | GCA000312445_01345 | CDS | open | 24725-25915 | _na 396_aa | ResB-like domain protein | |
| 2678 | HE997184.1 | GCA000312445_01346 | CDS | open | 25941-26870 | _na 309_aa | Xylose isomerase-like TIM barrel domain protein | |
| 2679 | HE997184.1 | GCA000312445_01347 | CDS | open | 26892-28265 | _na 457_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 2680 | HE997184.1 | GCA000312445_01348 | CDS | open | 28290-29831 | _na 513_aa | NapC/NirT cytochrome c family%2C N-terminal domain protein | |
| 2681 | HE997184.1 | GCA000312445_01349 | CDS | open | 29987-31159 | _na 390_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 2682 | HE997184.1 | GCA000312445_01350 | CDS | open | 31398-32492 | _na 364_aa | PF07610 family protein | |
| 2683 | HE997184.1 | GCA000312445_01351 | CDS | open | 32498-33595 | _na 365_aa | meaB | methylmalonyl Co-A mutase-associated GTPase MeaB |
| 2684 | HE997184.1 | GCA000312445_01352 | CDS | open | 33808-34710 | _na 300_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 2685 | HE997184.1 | GCA000312445_01353 | CDS | open | 34700-35485 | _na 261_aa | cmk | (d)CMP kinase |
| 2686 | HE997184.1 | GCA000312445_01354 | CDS | open | 35532-36263 | _na 243_aa | tonB | TonB protein%2C C-terminal domain protein |
| 2687 | HE997184.1 | GCA000312445_01355 | CDS | open | 36515-37495 | _na 326_aa | Polyprenyl synthetase | |
| 2688 | HE997184.1 | GCA000312445_01356 | CDS | open | 37495-38283 | _na 262_aa | tatD | Hydrolase%2C TatD family |
| 2689 | HE997184.1 | GCA000312445_01358 | CDS | open | 38598-39383 | _na 261_aa | Transporter%2C MotA/TolQ/ExbB proton channel family protein | |
| 2690 | HE997184.1 | GCA000312445_01359 | CDS | open | 39392-39859 | _na 155_aa | hypothetical protein | |
| 2691 | HE997184.1 | GCA000312445_01360 | CDS | open | 39900-40493 | _na 197_aa | Transport energizing protein%2C ExbD/TolR family | |
| 2692 | HE997184.1 | GCA000312445_01361 | CDS | open | 40526-40957 | _na 143_aa | Transport energizing protein%2C ExbD/TolR family | |
| 2693 | HE997184.1 | GCA000312445_01362 | CDS | open | 41008-41553 | _na 181_aa | Acetyltransferase (GNAT) domain protein | |
| 2694 | HE997184.1 | GCA000312445_01363 | CDS | open | 41554-42843 | _na 429_aa | IgA Peptidase M64 | |
| 2695 | HE997184.1 | GCA000312445_01364 | CDS | open | 43096-43572 | _na 158_aa | asnC | Transcriptional regulator%2C AsnC family |
| 2696 | HE997184.1 | GCA000312445_01365 | CDS | open | 43612-44124 | _na 170_aa | Dihydrofolate reductase | |
| 2697 | HE997184.1 | GCA000312445_01366 | CDS | open | 44146-44940 | _na 264_aa | thymidylate synthase | |
| 2698 | HE997184.1 | GCA000312445_01367 | CDS | open | 44975-46243 | _na 422_aa | Alpha-L-fucosidase | |
| 2699 | HE997184.1 | GCA000312445_01368 | CDS | open | 46680-48086 | _na 468_aa | NOL1/NOP2/sun family protein | |
| 2700 | HE997184.1 | GCA000312445_01369 | CDS | open | 48104-50233 | _na 709_aa | DNA topoisomerase | |
| 2701 | HE997184.1 | GCA000312445_01370 | CDS | open | 50283-51545 | _na 420_aa | Cna protein B-type domain protein | |
| 2702 | HE997184.1 | GCA000312445_01371 | CDS | open | 51745-52185 | _na 146_aa | Histone-like DNA-binding protein | |
| 2703 | HE997184.1 | GCA000312445_01372 | CDS | open | 52641-54419 | _na 592_aa | ABC transporter%2C ATP-binding protein | |
| 2704 | HE997184.1 | GCA000312445_01373 | CDS | open | 54438-56171 | _na 577_aa | ABC transporter%2C ATP-binding protein | |
| 2705 | HE997184.1 | GCA000312445_01374 | CDS | open | 56228-57049 | _na 273_aa | Leucine carboxyl methyltransferase | |
| 2706 | HE997184.1 | GCA000312445_01375 | CDS | open | 57004-57102 | _na 32_aa | hypothetical protein | |
| 2707 | HE997184.1 | GCA000312445_01376 | CDS | open | 57307-59172 | _na 621_aa | Starch-binding protein%2C SusD-like family | |
| 2708 | HE997184.1 | GCA000312445_01377 | CDS | open | 59188-62220 | _na 1010_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 2709 | HE997184.1 | GCA000312445_01378 | CDS | open | 62471-64363 | _na 630_aa | Glutamine amidotransferase domain protein | |
| 2710 | HE997184.1 | GCA000312445_01379 | CDS | open | 64602-65471 | _na 289_aa | Chromosome segregation protein SMC | |
| 2711 | HE997184.1 | GCA000312445_01380 | CDS | open | 65824-67290 | _na 488_aa | Outer membrane efflux protein | |
| 2712 | HE997184.1 | GCA000312445_01381 | CDS | open | 67297-68283 | _na 328_aa | hlyD | HlyD family secretion protein |
| 2713 | HE997184.1 | GCA000312445_01382 | CDS | open | 68290-69465 | _na 391_aa | ABC-2 family transporter protein | |
| 2714 | HE997184.1 | GCA000312445_01383 | CDS | open | 69477-70715 | _na 412_aa | ABC-2 family transporter protein | |
| 2715 | HE997184.1 | GCA000312445_01384 | CDS | open | 70797-72629 | _na 610_aa | ABC transporter transmembrane region | |
| 2716 | HE997184.1 | GCA000312445_01385 | CDS | open | 72657-74423 | _na 588_aa | GDSL-like Lipase/Acylhydrolase family protein | |
| 2717 | HE997184.1 | GCA000312445_01386 | CDS | open | 74670-77234 | _na 854_aa | Alpha-glucan phosphorylase | |
| 2718 | HE997184.1 | GCA000312445_01387 | CDS | open | 77260-78933 | _na 557_aa | Starch synthase catalytic domain protein | |
| 2719 | HE997184.1 | GCA000312445_01388 | CDS | open | 79096-80190 | _na 364_aa | trpS | tryptophan--tRNA ligase |
| 2720 | HE997184.1 | GCA000312445_01389 | CDS | open | 80479-83700 | _na 1073_aa | carB | carbamoyl-phosphate synthase large subunit |
| 2721 | HE997184.1 | GCA000312445_01390 | CDS | open | 83796-84563 | _na 255_aa | Calcineurin-like phosphoesterase family protein | |
| 2722 | HE997184.1 | GCA000312445_01391 | CDS | open | 84570-84890 | _na 106_aa | Putative FeS assembly SUF system protein | |
| 2723 | HE997184.1 | GCA000312445_01392 | CDS | open | 84926-85612 | _na 228_aa | radC | DNA repair protein RadC |
| 2724 | HE997184.1 | GCA000312445_01393 | CDS | open | 85663-86652 | _na 329_aa | Glycosyltransferase-like protein%2C family 2 | |
| 2725 | HE997184.1 | GCA000312445_01394 | CDS | open | 86768-87331 | _na 187_aa | efp | elongation factor P |
| 2726 | HE997184.1 | GCA000312445_01395 | CDS | open | 87604-87759 | _na 51_aa | rpmH | 50S ribosomal protein L34 |
| 2727 | HE997184.1 | GCA000312445_01396 | CDS | open | 87924-89081 | _na 385_aa | Transporter%2C major facilitator family protein | |
| 2728 | HE997184.1 | GCA000312445_01397 | CDS | open | 89084-89977 | _na 297_aa | pfkB | Carbohydrate kinase%2C PfkB family |
| 2729 | HE997184.1 | GCA000312445_01398 | CDS | open | 90290-91747 | _na 485_aa | Xaa-His dipeptidase | |
| 2730 | HE997184.1 | GCA000312445_01399 | CDS | open | 91731-92750 | _na 339_aa | Membrane protein%2C PF03706 family | |
| 2731 | HE997184.1 | GCA000312445_01400 | CDS | open | 92901-93731 | _na 276_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 2732 | HE997184.1 | GCA000312445_01401 | CDS | open | 93728-95068 | _na 446_aa | mgtE | magnesium transporter |
| 2733 | HE997184.1 | GCA000312445_01402 | CDS | open | 95183-97114 | _na 643_aa | PF03993 domain protein | |
| 2734 | HE997184.1 | GCA000312445_01404 | CDS | open | 97790-98149 | _na 119_aa | rsfS | ribosome silencing factor |
| 2735 | HE997184.1 | GCA000312445_01405 | CDS | open | 98167-100164 | _na 665_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 2736 | HE997184.1 | GCA000312445_01406 | CDS | open | 100154-100993 | _na 279_aa | Phosphatidate cytidylyltransferase | |
| 2737 | HE997184.1 | GCA000312445_01407 | CDS | open | 100973-102121 | _na 382_aa | lpxB | lipid-A-disaccharide synthase |
| 2738 | HE997184.1 | GCA000312445_01408 | CDS | open | 102121-102888 | _na 255_aa | surE | 5'/3'-nucleotidase SurE |
| 2739 | HE997184.1 | GCA000312445_01409 | CDS | open | 103141-103908 | _na 255_aa | parA | AAA domain-containing protein |
| 2740 | HE997184.1 | GCA000312445_01410 | CDS | open | 103910-104794 | _na 294_aa | ParB-like protein | |
| 2741 | HE997184.1 | GCA000312445_01411 | CDS | open | 104798-105610 | _na 270_aa | DUF5683 domain-containing protein | |
| 2742 | HE997184.1 | GCA000312445_01412 | CDS | open | 105620-106897 | _na 425_aa | Transglycosylase SLT domain protein | |
| 2743 | HE997184.1 | GCA000312445_01413 | CDS | open | 106980-109262 | _na 760_aa | RelA/SpoT family protein | |
| 2744 | HE997184.1 | GCA000312445_01414 | CDS | open | 109263-109613 | _na 116_aa | merR | MerR HTH family regulatory protein |
| 2745 | HE997184.1 | GCA000312445_01415 | CDS | open | 109627-110595 | _na 322_aa | Peptidase%2C M23 family | |
| 2746 | HE997184.1 | GCA000312445_01416 | CDS | open | 110724-113342 | _na 872_aa | alaS | alanine--tRNA ligase |
| 2747 | HE997184.1 | GCA000312445_01417 | CDS | open | 113434-114621 | _na 395_aa | ATP-grasp domain protein | |
| 2748 | HE997184.1 | GCA000312445_01418 | CDS | open | 114887-117790 | _na 967_aa | Cna protein B-type domain protein | |
| 2749 | HE997184.1 | GCA000312445_01419 | CDS | open | 117864-118274 | _na 136_aa | Transmembrane protein | |
| 2750 | HE997184.1 | GCA000312445_01420 | CDS | open | 118412-119470 | _na 352_aa | aroB | 3-dehydroquinate synthase |
| 2751 | HE997184.1 | GCA000312445_01422 | CDS | open | 120849-121820 | _na 323_aa | Putative enoyl-[acyl-carrier-protein] reductase II | |
| 2752 | HE997184.1 | GCA000312445_01423 | CDS | open | 121926-123191 | _na 421_aa | PF06439 domain protein | |
| 2753 | HE997184.1 | GCA000312445_01424 | CDS | open | 123240-124505 | _na 421_aa | Transporter%2C major facilitator family protein | |
| 2754 | HE997184.1 | GCA000312445_01425 | CDS | open | 124738-126246 | _na 502_aa | Succinate CoA transferase | |
| 2755 | HE997184.1 | GCA000312445_01426 | CDS | open | 126955-127545 | _na 196_aa | UPF0301 protein HMPREF9012_0033 | |
| 2756 | HE997184.1 | GCA000312445_01427 | CDS | open | 127553-128086 | _na 177_aa | Acetyltransferase (GNAT) domain protein | |
| 2757 | HE997184.1 | GCA000312445_01428 | CDS | open | 128083-128541 | _na 152_aa | Transmembrane protein | |
| 2758 | HE997184.1 | GCA000312445_01429 | CDS | open | 128552-129205 | _na 217_aa | recR | recombination mediator RecR |
| 2759 | HE997184.1 | GCA000312445_01430 | CDS | open | 129268-130749 | _na 493_aa | Transporter%2C SSS family | |
| 2760 | HE997184.1 | GCA000312445_01431 | CDS | open | 130715-131314 | _na 199_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 2761 | HE997184.1 | GCA000312445_01432 | CDS | open | 131692-134622 | _na 976_aa | Fibronectin type-III domain-containing protein | |
| 2762 | HE997184.1 | GCA000312445_01433 | CDS | open | 134633-135967 | _na 444_aa | Transporter%2C major facilitator family protein | |
| 2763 | HE997184.1 | GCA000312445_01434 | CDS | open | 136039-136872 | _na 277_aa | murQ | N-acetylmuramic acid 6-phosphate etherase |
| 2764 | HE997184.1 | GCA000312445_01435 | CDS | open | 136884-137465 | _na 193_aa | hypothetical protein | |
| 2765 | HE997184.1 | GCA000312445_01436 | CDS | open | 137646-138428 | _na 260_aa | Metal cation transporter%2C ZIP domain protein | |
| 2766 | HE997184.1 | GCA000312445_01437 | CDS | open | 138467-139513 | _na 348_aa | bifunctional methionine sulfoxide reductase B/A protein | |
| 2767 | HE997184.1 | GCA000312445_01438 | CDS | open | 139864-141270 | _na 468_aa | Amidohydrolase family protein | |
| 2768 | HE997184.1 | GCA000312445_01439 | CDS | open | 141317-142327 | _na 336_aa | PF10035 family protein | |
| 2769 | HE997184.1 | GCA000312445_01445 | CDS | open | 143156-144319 | _na 387_aa | nspC | carboxynorspermidine decarboxylase |
| 2770 | HE997184.1 | GCA000312445_01446 | CDS | open | 144334-146658 | _na 774_aa | DNA 3'-5' helicase | |
| 2771 | HE997184.1 | GCA000312445_01447 | CDS | open | 146983-148053 | _na 356_aa | Putative lipoprotein | |
| 2772 | HE997184.1 | GCA000312445_01448 | CDS | open | 148082-148228 | _na 48_aa | hypothetical protein | |
| 2773 | HE997184.1 | GCA000312445_01449 | CDS | open | 148703-149644 | _na 313_aa | ribose-phosphate diphosphokinase | |
| 2774 | HE997184.1 | GCA000312445_01450 | CDS | open | 149814-150899 | _na 361_aa | PF14289 domain protein | |
| 2775 | HE997184.1 | GCA000312445_01451 | CDS | open | 151074-151841 | _na 255_aa | DUF6261 domain-containing protein | |
| 2776 | HE997184.1 | GCA000312445_01452 | CDS | open | 152336-153637 | _na 433_aa | Fimbrillin-A associated anchor protein Mfa1 and Mfa2 | |
| 2777 | HE997184.1 | GCA000312445_01453 | CDS | open | 153664-153798 | _na 44_aa | hypothetical protein | |
| 2778 | HE997184.1 | GCA000312445_01454 | CDS | open | 153841-154818 | _na 325_aa | Glucokinase | |
| 2779 | HE997184.1 | GCA000312445_01455 | CDS | open | 154962-155678 | _na 238_aa | ABC transporter%2C ATP-binding protein | |
| 2780 | HE997184.1 | GCA000312445_01456 | CDS | open | 155684-156943 | _na 419_aa | MacB-like periplasmic core domain protein | |
| 2781 | HE997184.1 | GCA000312445_01457 | CDS | open | 156945-158186 | _na 413_aa | MacB-like periplasmic core domain protein | |
| 2782 | HE997184.1 | GCA000312445_01458 | CDS | open | 158216-159313 | _na 365_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 2783 | HE997184.1 | GCA000312445_01459 | CDS | open | 159310-160635 | _na 441_aa | Outer membrane efflux protein | |
| 2784 | HE997184.1 | GCA000312445_01460 | CDS | open | 160913-163273 | _na 786_aa | feoB | ferrous iron transport protein B |
| 2785 | HE997184.1 | GCA000312445_01461 | CDS | open | 163373-165835 | _na 820_aa | Peptidase%2C S9A/B/C family%2C catalytic domain protein | |
| 2786 | HE997184.1 | GCA000312445_01462 | CDS | open | 166115-166981 | _na 288_aa | hypothetical protein | |
| 2787 | HE997184.1 | GCA000312445_01463 | CDS | open | 167294-167488 | _na 64_aa | HTH cro/C1-type domain-containing protein | |
| 2788 | HE997184.1 | GCA000312445_01464 | CDS | open | 167692-168708 | _na 338_aa | Histidine kinase | |
| 2789 | HE997184.1 | GCA000312445_01465 | CDS | open | 168705-169454 | _na 249_aa | LytTr DNA-binding domain protein | |
| 2790 | HE997184.1 | GCA000312445_01466 | CDS | open | 169466-169816 | _na 116_aa | Lipoprotein | |
| 2791 | HE997184.1 | GCA000312445_01467 | CDS | open | 169978-171597 | _na 539_aa | Lipoprotein | |
| 2792 | HE997184.1 | GCA000312445_01468 | CDS | open | 171603-172160 | _na 185_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 2793 | HE997184.1 | GCA000312445_01469 | CDS | open | 172324-172743 | _na 139_aa | Bacterial mobilisation domain-containing protein | |
| 2794 | HE997184.1 | GCA000312445_01470 | CDS | open | 172945-173526 | _na 193_aa | DUF3408 domain-containing protein | |
| 2795 | HE997184.1 | GCA000312445_01471 | CDS | open | 173568-173882 | _na 104_aa | Helix-turn-helix domain-containing protein | |
| 2796 | HE997184.1 | GCA000312445_01472 | CDS | open | 173886-174155 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 2797 | HE997184.1 | GCA000312445_01473 | CDS | open | 174815-175300 | _na 161_aa | DUF1896 domain-containing protein | |
| 2798 | HE997184.1 | GCA000312445_01474 | CDS | open | 175355-176638 | _na 427_aa | Tyr recombinase domain-containing protein | |
| 2799 | HE997184.1 | GCA000312445_01475 | CDS | open | 176651-177904 | _na 417_aa | Tyr recombinase domain-containing protein | |
| 2800 | HE997184.1 | GCA000312445_01476 | CDS | open | 178297-179478 | _na 393_aa | beta-galactosidase | |
| 2801 | HE997184.1 | GCA000312445_01477 | CDS | open | 179607-180287 | _na 226_aa | DNA alkylation repair enzyme | |
| 2802 | HE997184.1 | GCA000312445_01478 | CDS | open | 180862-182004 | _na 380_aa | Aldose 1-epimerase | |
| 2803 | HE997184.1 | GCA000312445_01479 | CDS | open | 182132-184150 | _na 672_aa | Transketolase%2C thiamine pyrophosphate-binding domain protein | |
| 2804 | HE997184.1 | GCA000312445_01480 | CDS | open | 184147-184590 | _na 147_aa | rpiB | ribose 5-phosphate isomerase B |
| 2805 | HE997184.1 | GCA000312445_01481 | CDS | open | 184727-185827 | _na 366_aa | TBP-like domain protein | |
| 2806 | HE997184.1 | GCA000312445_01482 | CDS | open | 185943-186218 | _na 91_aa | Tetratricopeptide repeat protein | |
| 2807 | HE997184.1 | GCA000312445_01483 | CDS | open | 186229-186459 | _na 76_aa | ferredoxin family protein | |
| 2808 | HE997184.1 | GCA000312445_01484 | CDS | open | 186471-187556 | _na 361_aa | Pyruvate flavodoxin/ferredoxin oxidoreductase%2C thiamine diP-binding domain protein | |
| 2809 | HE997184.1 | GCA000312445_01485 | CDS | open | 187567-187731 | _na 54_aa | Transmembrane protein | |
| 2810 | HE997184.1 | GCA000312445_01486 | CDS | open | 187750-188562 | _na 270_aa | Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain protein | |
| 2811 | HE997184.1 | GCA000312445_01487 | CDS | open | 188568-189113 | _na 181_aa | Pyruvate/ketoisovalerate oxidoreductase catalytic domain-containing protein | |
| 2812 | HE997184.1 | GCA000312445_01488 | CDS | open | 189110-191230 | _na 706_aa | PF14121 domain protein | |
| 2813 | HE997184.1 | GCA000312445_01489 | CDS | open | 191242-192102 | _na 286_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 2814 | HE997184.1 | GCA000312445_01490 | CDS | open | 192173-193162 | _na 329_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 2815 | HE997184.1 | GCA000312445_01491 | CDS | open | 193172-194377 | _na 401_aa | PF14391 domain protein | |
| 2816 | HE997184.1 | GCA000312445_01492 | CDS | open | 194578-196218 | _na 546_aa | Transporter%2C Ompp1/FadL/TodX family | |
| 2817 | HE997184.1 | GCA000312445_01493 | CDS | open | 196287-197681 | _na 464_aa | Vitellogenin II | |
| 2818 | HE997184.1 | GCA000312445_01494 | CDS | open | 197869-198168 | _na 99_aa | Winged helix DNA-binding domain protein | |
| 2819 | HE997184.1 | GCA000312445_01495 | CDS | open | 198165-198785 | _na 206_aa | Putative membrane protein | |
| 2820 | HE997184.1 | GCA000312445_01496 | CDS | open | 199865-203500 | _na 1211_aa | Glycoside hydrolase%2C family 2%2C sugar binding domain protein | |
| 2821 | HE997184.1 | GCA000312445_01497 | CDS | open | 203916-204959 | _na 347_aa | ilvC | ketol-acid reductoisomerase |
| 2822 | HE997184.1 | GCA000312445_01498 | CDS | open | 205032-205784 | _na 250_aa | Acyl-ACP thioesterase | |
| 2823 | HE997184.1 | GCA000312445_01499 | CDS | open | 205768-206340 | _na 190_aa | ilvN | acetolactate synthase small subunit |
| 2824 | HE997184.1 | GCA000312445_01500 | CDS | open | 206354-208051 | _na 565_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 2825 | HE997184.1 | GCA000312445_01501 | CDS | open | 208068-209873 | _na 601_aa | ilvD | dihydroxy-acid dehydratase |
| 2826 | HE997184.1 | GCA000312445_01502 | CDS | open | 210347-210907 | _na 186_aa | Peptidyl-prolyl cis-trans isomerase | |
| 2827 | HE997184.1 | GCA000312445_01503 | CDS | open | 210951-212936 | _na 661_aa | PF12969 structural domain protein | |
| 2828 | HE997184.1 | GCA000312445_01504 | CDS | open | 212944-214470 | _na 508_aa | PF12969 structural domain protein | |
| 2829 | HE997184.1 | GCA000312445_01505 | CDS | open | 214582-215178 | _na 198_aa | RNA polymerase sigma-70 factor | |
| 2830 | HE997184.1 | GCA000312445_01506 | CDS | open | 215650-216618 | _na 322_aa | ketopantoate reductase family protein | |
| 2831 | HE997184.1 | GCA000312445_01507 | CDS | open | 216769-217455 | _na 228_aa | Methyltransferase domain protein | |
| 2832 | HE997184.1 | GCA000312445_01508 | CDS | open | 217698-217934 | _na 78_aa | hypothetical protein | |
| 2833 | HE997184.1 | GCA000312445_01509 | CDS | open | 218430-221687 | _na 1085_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 2834 | HE997184.1 | GCA000312445_01510 | CDS | open | 221690-223345 | _na 551_aa | Starch-binding protein%2C SusD-like family | |
| 2835 | HE997184.1 | GCA000312445_01511 | CDS | open | 223815-225932 | _na 705_aa | kamA | KamA family protein |
| 2836 | HE997184.1 | GCA000312445_01512 | CDS | open | 226110-228029 | _na 639_aa | dnaK | molecular chaperone DnaK |
| 2837 | HE997184.1 | GCA000312445_01513 | CDS | open | 228240-228794 | _na 184_aa | ORF5 | |
| 2838 | HE997184.1 | GCA000312445_01514 | CDS | open | 228883-231600 | _na 905_aa | alpha-L-rhamnosidase | |
| 2839 | HE997184.1 | GCA000312445_01515 | CDS | open | 231662-234772 | _na 1036_aa | Glycosyl hydrolase family 2%2C sugar binding domain protein | |
| 2840 | HE997184.1 | GCA000312445_01516 | CDS | open | 234849-236432 | _na 527_aa | Starch-binding protein%2C SusD-like family | |
| 2841 | HE997184.1 | GCA000312445_01517 | CDS | open | 236444-239596 | _na 1050_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 2842 | HE997184.1 | GCA000312445_01518 | CDS | open | 239957-240871 | _na 304_aa | endonuclease/exonuclease/phosphatase family protein | |
| 2843 | HE997184.1 | GCA000312445_01519 | CDS | open | 240905-242734 | _na 609_aa | RagB/SusD family nutrient uptake outer membrane protein | |
| 2844 | HE997184.1 | GCA000312445_01520 | CDS | open | 242754-246470 | _na 1238_aa | TonB-dependent receptor | |
| 2845 | HE997184.1 | GCA000312445_01521 | CDS | open | 246505-247722 | _na 405_aa | Sigma factor regulatory protein%2C FecR/PupR family | |
| 2846 | HE997184.1 | GCA000312445_01522 | CDS | open | 247805-248374 | _na 189_aa | Sigma-70%2C region 4 | |
| 2847 | HE997184.1 | GCA000312445_01523 | CDS | open | 248438-248587 | _na 49_aa | hypothetical protein | |
| 2848 | HE997184.1 | GCA000312445_01524 | CDS | open | 248753-249946 | _na 397_aa | Saccharopine dehydrogenase | |
| 2849 | HE997184.1 | GCA000312445_01525 | CDS | open | 249976-251004 | _na 342_aa | recA | recombinase RecA |
| 2850 | HE997184.1 | GCA000312445_01526 | CDS | open | 251267-251740 | _na 157_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 2851 | HE997184.1 | GCA000312445_01527 | CDS | open | 252030-252815 | _na 261_aa | terB | Tellurite resistance protein TerB |
| 2852 | HE997184.1 | GCA000312445_01528 | CDS | open | 252819-253433 | _na 204_aa | Glutathione peroxidase | |
| 2853 | HE997184.1 | GCA000312445_01529 | CDS | open | 253606-254709 | _na 367_aa | Iron-sulfur cluster carrier protein | |
| 2854 | HE997184.1 | GCA000312445_01530 | CDS | open | 254759-255517 | _na 252_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 2855 | HE997184.1 | GCA000312445_01531 | CDS | open | 255589-256608 | _na 339_aa | branched-chain amino acid aminotransferase | |
| 2856 | HE997184.1 | GCA000312445_01532 | CDS | open | 256684-256899 | _na 71_aa | xseB | exodeoxyribonuclease VII small subunit |
| 2857 | HE997184.1 | GCA000312445_01533 | CDS | open | 256899-258203 | _na 434_aa | xseA | exodeoxyribonuclease VII large subunit |
| 2858 | HE997184.1 | GCA000312445_01534 | CDS | open | 258210-259571 | _na 453_aa | Peptidase%2C S8/S53 family | |
| 2859 | HE997184.1 | GCA000312445_01535 | CDS | open | 259684-261057 | _na 457_aa | mepA | Multidrug export protein MepA |
| 2860 | HE997184.1 | GCA000312445_01536 | CDS | open | 261408-261770 | _na 120_aa | Glyoxalase-like domain protein | |
| 2861 | HE997184.1 | GCA000312445_01537 | CDS | open | 261999-262592 | _na 197_aa | tetR | Transcriptional regulator%2C TetR family |
| 2862 | HE997184.1 | GCA000312445_01538 | CDS | open | 262589-263623 | _na 344_aa | Nitroreductase | |
| 2863 | HE997184.1 | GCA000312445_01539 | CDS | open | 263839-264051 | _na 70_aa | hypothetical protein | |
| 2864 | HE997184.1 | GCA000312445_01540 | CDS | open | 263996-264907 | _na 303_aa | dinD | DNA damage-inducible protein D |
| 2865 | HE997184.1 | GCA000312445_01541 | CDS | open | 264944-265504 | _na 186_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 2866 | HE997184.1 | GCA000312445_01542 | CDS | open | 265520-266050 | _na 176_aa | HXXEE domain-containing protein | |
| 2867 | HE997184.1 | GCA000312445_01543 | CDS | open | 266076-266864 | _na 262_aa | Methyltransferase type 12 | |
| 2868 | HE997184.1 | GCA000312445_01544 | CDS | open | 266894-267211 | _na 105_aa | tfoX | TfoX N-terminal domain protein |
| 2869 | HE997184.1 | GCA000312445_01545 | CDS | open | 267425-268057 | _na 210_aa | AAA domain protein | |
| 2870 | HE997184.1 | GCA000312445_01546 | CDS | open | 268069-269445 | _na 458_aa | Xaa-Pro aminopeptidase | |
| 2871 | HE997184.1 | GCA000312445_01547 | CDS | open | 269567-270184 | _na 205_aa | GHMP kinase C-terminal domain protein | |
| 2872 | HE997184.1 | GCA000312445_01548 | CDS | open | 270438-272213 | _na 591_aa | sppA | signal peptide peptidase SppA |
| 2873 | HE997184.1 | GCA000312445_01549 | CDS | open | 272217-273335 | _na 372_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 2874 | HE997184.1 | GCA000312445_01550 | CDS | open | 273280-274107 | _na 275_aa | purine-nucleoside phosphorylase | |
| 2875 | HE997184.1 | GCA000312445_01551 | CDS | open | 274091-275134 | _na 347_aa | thiL | thiamine-phosphate kinase |
| 2876 | HE997184.1 | GCA000312445_01552 | CDS | open | 275377-276393 | _na 338_aa | Endoribonuclease L-PSP | |
| 2877 | HE997184.1 | GCA000312445_01553 | CDS | open | 276400-277086 | _na 228_aa | Outer membrane protein beta-barrel domain protein | |
| 2878 | HE997184.1 | GCA000312445_01554 | CDS | open | 277245-278129 | _na 294_aa | Glycoside hydrolase%2C family 25 | |
| 2879 | HE997184.1 | GCA000312445_01555 | CDS | open | 278274-279899 | _na 541_aa | diphosphate--fructose-6-phosphate 1-phosphotransferase | |
| 2880 | HE997184.1 | GCA000312445_01556 | CDS | open | 280108-280326 | _na 72_aa | hypothetical protein | |
| 2881 | HE997184.1 | GCA000312445_01557 | CDS | open | 280323-280868 | _na 181_aa | Acyltransferase | |
| 2882 | HE997184.1 | GCA000312445_01558 | CDS | open | 280930-281232 | _na 100_aa | hypothetical protein | |
| 2883 | HE997184.1 | GCA000312445_01559 | CDS | open | 281246-282010 | _na 254_aa | Hydrolase%2C carbon-nitrogen family | |
| 2884 | HE997184.1 | GCA000312445_01560 | CDS | open | 282776-283555 | _na 259_aa | DUF6261 domain-containing protein | |
| 2885 | HE997184.1 | GCA000312445_01561 | CDS | open | 283656-284378 | _na 240_aa | TonB-dependent receptor plug domain-containing protein | |
| 2886 | HE997184.1 | GCA000312445_01562 | CDS | open | 284450-286897 | _na 815_aa | TonB-dependent receptor-like beta-barrel domain-containing protein | |
| 2887 | HE997184.1 | GCA000312445_01563 | CDS | open | 286913-288475 | _na 520_aa | Starch-binding protein%2C SusD-like family | |
| 2888 | HE997184.1 | GCA000312445_01564 | CDS | open | 288740-290008 | _na 422_aa | ResB-like domain protein | |
| 2889 | HE997184.1 | GCA000312445_01565 | CDS | open | 290005-290793 | _na 262_aa | Cytochrome c assembly protein | |
| 2890 | HE997184.1 | GCA000312445_01566 | CDS | open | 290778-291443 | _na 221_aa | NigD-like protein | |
| 2891 | HE997184.1 | GCA000312445_01567 | CDS | open | 291447-292604 | _na 385_aa | Acyltransferase | |
| 2892 | HE997184.1 | GCA000312445_01568 | CDS | open | 292601-293590 | _na 329_aa | D-alanine--D-alanine ligase | |
| 2893 | HE997184.1 | GCA000312445_01569 | CDS | open | 293587-294663 | _na 358_aa | Pseudouridine synthase | |
| 2894 | HE997184.1 | GCA000312445_01570 | CDS | open | 294675-295304 | _na 209_aa | PASTA domain protein | |
| 2895 | HE997184.1 | GCA000312445_01571 | CDS | open | 295666-296559 | _na 297_aa | Electron transfer flavoprotein domain protein | |
| 2896 | HE997184.1 | GCA000312445_01572 | CDS | open | 296564-297583 | _na 339_aa | Electron transfer flavoprotein domain protein | |
| 2897 | HE997184.1 | GCA000312445_01573 | CDS | open | 297583-299289 | _na 568_aa | Acyl-CoA dehydrogenase domain protein | |
| 2898 | HE997184.1 | GCA000312445_01574 | CDS | open | 299986-302247 | _na 753_aa | TonB-dependent receptor | |
| 2899 | HE997184.1 | GCA000312445_01575 | CDS | open | 302259-302861 | _na 200_aa | pnuC | nicotinamide riboside transporter PnuC |
| 2900 | HE997184.1 | GCA000312445_01576 | CDS | open | 302858-303490 | _na 210_aa | thiamine diphosphokinase | |
| 2901 | HE997184.1 | GCA000312445_01577 | CDS | open | 303514-304197 | _na 227_aa | Lipoprotein%2C PF05643 family | |
| 2902 | HE997184.1 | GCA000312445_01578 | CDS | open | 304194-304538 | _na 114_aa | Putative lipoprotein | |
| 2903 | HE997184.1 | GCA000312445_01579 | CDS | open | 304538-304873 | _na 111_aa | Putative lipoprotein | |
| 2904 | HE997184.1 | GCA000312445_01580 | CDS | open | 304870-305796 | _na 308_aa | csgG | Curli production assembly/transport component CsgG |
| 2905 | HE997184.1 | GCA000312445_01581 | CDS | open | 306151-307053 | _na 300_aa | metA | homoserine O-succinyltransferase |
| 2906 | HE997184.1 | GCA000312445_01582 | CDS | open | 307172-307642 | _na 156_aa | trxA | thioredoxin |
| 2907 | HE997184.1 | GCA000312445_01583 | CDS | open | 307876-308841 | _na 321_aa | N-succinylornithine carbamoyltransferase | |
| 2908 | HE997184.1 | GCA000312445_01584 | CDS | open | 308902-309693 | _na 263_aa | Cof-like hydrolase | |
| 2909 | HE997184.1 | GCA000312445_01585 | CDS | open | 309704-311890 | _na 728_aa | Putative alpha-1%2C2-mannosidase | |
| 2910 | HE997184.1 | GCA000312445_01586 | CDS | open | 311932-312150 | _na 72_aa | hypothetical protein | |
| 2911 | HE997184.1 | GCA000312445_01587 | CDS | open | 312155-312949 | _na 264_aa | cas6 | CRISPR-associated endoribonuclease Cas6 |
| 2912 | HE997184.1 | GCA000312445_01588 | CDS | open | 312966-313616 | _na 216_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 2913 | HE997184.1 | GCA000312445_01589 | CDS | open | 313632-315569 | _na 645_aa | CRISPR-associated protein Csh1 | |
| 2914 | HE997184.1 | GCA000312445_01590 | CDS | open | 315581-316495 | _na 304_aa | type I CRISPR-associated protein Cas7 | |
| 2915 | HE997184.1 | GCA000312445_01591 | CDS | open | 316531-317304 | _na 257_aa | cas5b | type I-B CRISPR-associated protein Cas5b |
| 2916 | HE997184.1 | GCA000312445_01592 | CDS | open | 317288-320068 | _na 926_aa | CRISPR-associated helicase/endonuclease Cas3 | |
| 2917 | HE997184.1 | GCA000312445_01593 | CDS | open | 320068-320598 | _na 176_aa | cas4 | CRISPR-associated protein Cas4 |
| 2918 | HE997184.1 | GCA000312445_01594 | CDS | open | 320645-322240 | _na 531_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 2919 | HE997184.1 | GCA000312445_01595 | CDS | open | 322221-322646 | _na 141_aa | CRISPR system Cms protein Csm2 | |
| 2920 | HE997184.1 | GCA000312445_01596 | CDS | open | 322652-323344 | _na 230_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 2921 | HE997184.1 | GCA000312445_01597 | CDS | open | 323341-324354 | _na 337_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 2922 | HE997184.1 | GCA000312445_01598 | CDS | open | 324293-325972 | _na 559_aa | CRISPR system Cms protein Csm5 | |
| 2923 | HE997184.1 | GCA000312445_01599 | CDS | open | 325969-326916 | _na 315_aa | DUF6602 domain-containing protein | |
| 2924 | HE997184.1 | GCA000312445_01600 | CDS | open | 326913-327929 | _na 338_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 2925 | HE997184.1 | GCA000312445_01601 | CDS | open | 327929-328192 | _na 87_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2926 | HE997184.1 | GCA000312445_01602 | CDS | open | 331921-333594 | _na 557_aa | AMP-binding enzyme | |
| 2927 | HE997184.1 | GCA000312445_01603 | CDS | open | 333599-334153 | _na 184_aa | Cupin domain protein | |
| 2928 | HE997184.1 | GCA000312445_01604 | CDS | open | 334235-334528 | _na 97_aa | hypothetical protein | |
| 2929 | HE997184.1 | GCA000312445_01605 | CDS | open | 334615-334752 | _na 45_aa | tetR | Transcriptional regulator%2C TetR domain protein |
| 2930 | HE997184.1 | GCA000312445_01606 | CDS | open | 334850-335758 | _na 302_aa | Glycyl-radical enzyme activating protein | |
| 2931 | HE997184.1 | GCA000312445_01607 | CDS | open | 335767-338166 | _na 799_aa | hypD | trans-4-hydroxy-L-proline dehydratase |
| 2932 | HE997184.1 | GCA000312445_01608 | CDS | open | 338251-339123 | _na 290_aa | Putative lipoprotein | |
| 2933 | HE997184.1 | GCA000312445_01609 | CDS | open | 339135-340760 | _na 541_aa | pruA | L-glutamate gamma-semialdehyde dehydrogenase |
| 2934 | HE997184.1 | GCA000312445_01610 | CDS | open | 340912-342198 | _na 428_aa | Multiple inositol polyphosphate phosphatase 1 | |
| 2935 | HE997184.1 | GCA000312445_01611 | CDS | open | 342205-342996 | _na 263_aa | thiF | ThiF family protein |
| 2936 | HE997184.1 | GCA000312445_01612 | CDS | open | 343034-344194 | _na 386_aa | dinB | DNA polymerase IV |
| 2937 | HE997184.1 | GCA000312445_01613 | CDS | open | 344265-345620 | _na 451_aa | MATE efflux family protein | |
| 2938 | HE997184.1 | GCA000312445_01614 | CDS | open | 345617-346357 | _na 246_aa | Biotin-(Acetyl-CoA-carboxylase) ligase | |
| 2939 | HE997184.1 | GCA000312445_01615 | CDS | open | 346376-346741 | _na 121_aa | UPF0102 protein HMPREF9012_0460 | |
| 2940 | HE997184.1 | GCA000312445_01616 | CDS | open | 346830-347264 | _na 144_aa | tRNA-specific adenosine deaminase | |
| 2941 | HE997184.1 | GCA000312445_01617 | CDS | open | 347267-347494 | _na 75_aa | DUF4834 domain-containing protein | |
| 2942 | HE997184.1 | GCA000312445_01618 | CDS | open | 347507-348223 | _na 238_aa | Putative CDP-diacylglycerol-serine O-phosphatidyltransferase | |
| 2943 | HE997184.1 | GCA000312445_01619 | CDS | open | 348233-348994 | _na 253_aa | phosphatidylserine decarboxylase family protein | |
| 2944 | HE997184.1 | GCA000312445_01620 | CDS | open | 349187-352984 | _na 1265_aa | dnaE | DNA polymerase III subunit alpha |
| 2945 | HE997184.1 | GCA000312445_01621 | CDS | open | 353071-353385 | _na 104_aa | trxA | thioredoxin |
| 2946 | HE997184.1 | GCA000312445_01622 | CDS | open | 353410-353742 | _na 110_aa | Self-protective colicin-like immunity | |
| 2947 | HE997184.1 | GCA000312445_01623 | CDS | open | 353817-354035 | _na 72_aa | immunity 17 family protein | |
| 2948 | HE997184.1 | GCA000312445_01624 | CDS | open | 354035-354460 | _na 141_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 2949 | HE997184.1 | GCA000312445_01625 | CDS | open | 354473-355300 | _na 275_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 2950 | HE997184.1 | GCA000312445_01626 | CDS | open | 355301-355735 | _na 144_aa | hypothetical protein | |
| 2951 | HE997184.1 | GCA000312445_01627 | CDS | open | 355739-356977 | _na 412_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 2952 | HE997184.1 | GCA000312445_01629 | CDS | open | 357907-359040 | _na 377_aa | PF01594 domain protein | |
| 2953 | HE997184.1 | GCA000312445_01630 | CDS | open | 359061-359678 | _na 205_aa | thymidine kinase | |
| 2954 | HE997184.1 | GCA000312445_01631 | CDS | open | 359859-360620 | _na 253_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 2955 | HE997184.1 | GCA000312445_01632 | CDS | open | 360642-361487 | _na 281_aa | Putative lipoprotein | |
| 2956 | HE997184.1 | GCA000312445_01633 | CDS | open | 361568-362260 | _na 230_aa | yjjG | YjjG family noncanonical pyrimidine nucleotidase |
| 2957 | HE997184.1 | GCA000312445_01634 | CDS | open | 362623-365835 | _na 1070_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 2958 | HE997184.1 | GCA000312445_01635 | CDS | open | 365854-367539 | _na 561_aa | Starch-binding protein%2C SusD-like family | |
| 2959 | HE997184.1 | GCA000312445_01636 | CDS | open | 367571-368437 | _na 288_aa | Putative lipoprotein | |
| 2960 | HE997184.1 | GCA000312445_01637 | CDS | open | 372167-372958 | _na 263_aa | fimbrillin family protein | |
| 2961 | HE997184.1 | GCA000312445_01328 | gene | open | 114-1730 | |||
| 2962 | HE997184.1 | GCA000312445_01329 | gene | open | 1902-2534 | grpE | ||
| 2963 | HE997184.1 | GCA000312445_01330 | gene | open | 2546-3715 | dnaJ | ||
| 2964 | HE997184.1 | GCA000312445_01331 | gene | open | 3719-5011 | |||
| 2965 | HE997184.1 | GCA000312445_01332 | gene | open | 5105-6202 | |||
| 2966 | HE997184.1 | GCA000312445_01333 | gene | open | 6236-7561 | |||
| 2967 | HE997184.1 | GCA000312445_01334 | gene | open | 7603-8757 | galK | ||
| 2968 | HE997184.1 | GCA000312445_01335 | gene | open | 9649-12735 | |||
| 2969 | HE997184.1 | GCA000312445_01336 | gene | open | 12749-14407 | |||
| 2970 | HE997184.1 | GCA000312445_01337 | gene | open | 14476-15657 | |||
| 2971 | HE997184.1 | GCA000312445_01338 | gene | open | 15848-17515 | |||
| 2972 | HE997184.1 | GCA000312445_01339 | gene | open | 17756-19606 | mutA | ||
| 2973 | HE997184.1 | GCA000312445_01340 | gene | open | 19634-21796 | scpA | ||
| 2974 | HE997184.1 | GCA000312445_01341 | gene | open | 22027-23085 | |||
| 2975 | HE997184.1 | GCA000312445_01342 | gene | open | 23114-23263 | |||
| 2976 | HE997184.1 | GCA000312445_01343 | gene | open | 23306-23458 | |||
| 2977 | HE997184.1 | GCA000312445_01344 | gene | open | 23949-24728 | |||
| 2978 | HE997184.1 | GCA000312445_01345 | gene | open | 24725-25915 | |||
| 2979 | HE997184.1 | GCA000312445_01346 | gene | open | 25941-26870 | |||
| 2980 | HE997184.1 | GCA000312445_01347 | gene | open | 26892-28265 | |||
| 2981 | HE997184.1 | GCA000312445_01348 | gene | open | 28290-29831 | |||
| 2982 | HE997184.1 | GCA000312445_01349 | gene | open | 29987-31159 | |||
| 2983 | HE997184.1 | GCA000312445_01350 | gene | open | 31398-32492 | |||
| 2984 | HE997184.1 | GCA000312445_01351 | gene | open | 32498-33595 | meaB | ||
| 2985 | HE997184.1 | GCA000312445_01352 | gene | open | 33808-34710 | |||
| 2986 | HE997184.1 | GCA000312445_01353 | gene | open | 34700-35485 | cmk | ||
| 2987 | HE997184.1 | GCA000312445_01354 | gene | open | 35532-36263 | tonB | ||
| 2988 | HE997184.1 | GCA000312445_01355 | gene | open | 36515-37495 | |||
| 2989 | HE997184.1 | GCA000312445_01356 | gene | open | 37495-38283 | tatD | ||
| 2990 | HE997184.1 | GCA000312445_01358 | gene | open | 38598-39383 | |||
| 2991 | HE997184.1 | GCA000312445_01359 | gene | open | 39392-39859 | |||
| 2992 | HE997184.1 | GCA000312445_01360 | gene | open | 39900-40493 | |||
| 2993 | HE997184.1 | GCA000312445_01361 | gene | open | 40526-40957 | |||
| 2994 | HE997184.1 | GCA000312445_01362 | gene | open | 41008-41553 | |||
| 2995 | HE997184.1 | GCA000312445_01363 | gene | open | 41554-42843 | |||
| 2996 | HE997184.1 | GCA000312445_01364 | gene | open | 43096-43572 | asnC | ||
| 2997 | HE997184.1 | GCA000312445_01365 | gene | open | 43612-44124 | |||
| 2998 | HE997184.1 | GCA000312445_01366 | gene | open | 44146-44940 | |||
| 2999 | HE997184.1 | GCA000312445_01367 | gene | open | 44975-46243 | |||
| 3000 | HE997184.1 | GCA000312445_01368 | gene | open | 46680-48086 |

