HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Mycobacterium tuberculosis (GCA_000667805.1)

Select a Genome:
BAKTA Annotations for GCA_000667805.1
Genome Selected: Mycobacterium tuberculosis
ContigsBases CDSrRNA tmRNAtRNA
7 4,412,618 4095 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 8344 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 8344 [17 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 KK339370.1 GCA000667805_03288 gene open 3474939-3475305 ssrA
2 KK339370.1 GCA000667805_03288 tmRNA open 3474939-3475305 ssrA transfer-messenger RNA%2C SsrA
3 KK339370.1 rep_origin open 1525-2051
4 KK339370.1 GCA000667805_00264 gene open 293604-293661 F6
5 KK339370.1 GCA000667805_00663 gene open 711532-711592 b55
6 KK339370.1 GCA000667805_00891 gene open 925646-925713 ASdes
7 KK339370.1 GCA000667805_01182 gene open 1229228-1229295 ASdes
8 KK339370.1 GCA000667805_01360 gene open 1421276-1421384 ncrMT1302
9 KK339370.1 GCA000667805_01414 gene open 1479844-1481375 rrs
10 KK339370.1 GCA000667805_01415 gene open 1481653-1484790 rrl
11 KK339370.1 GCA000667805_01416 gene open 1484895-1485007 rrf
12 KK339370.1 GCA000667805_01775 gene open 1884896-1884967 ASpks
13 KK339370.1 GCA000667805_01777 gene open 1891287-1891355 ASpks
14 KK339370.1 GCA000667805_01805 gene open 1923386-1923452 g2
15 KK339370.1 GCA000667805_01848 gene open 1960715-1960791 AS1726
16 KK339370.1 GCA000667805_01977 gene open 2106266-2106560 5_ureB_sRNA
17 KK339370.1 GCA000667805_02020 gene open 2147691-2147799 AS1890
18 KK339370.1 GCA000667805_02038 gene open 2160580-2160791 npcTB_6715
19 KK339370.1 GCA000667805_02203 gene open 2307452-2307529 ASpks
20 KK339370.1 GCA000667805_02387 gene open 2503647-2504075 RNaseP_bact_a
21 KK339370.1 GCA000667805_02567 gene open 2697187-2697535 Mcr7
22 KK339370.1 GCA000667805_02839 gene open 2985774-2985945 ncRv12659
23 KK339370.1 GCA000667805_03126 gene open 3302095-3302169 ASpks
24 KK339370.1 GCA000667805_03264 gene open 3446680-3446724 Ms_AS-5
25 KK339370.1 GCA000667805_00264 ncRNA open 293604-293661 F6 TB sRNA
26 KK339370.1 GCA000667805_00663 ncRNA open 711532-711592 Mycobacterium B11
27 KK339370.1 GCA000667805_00891 ncRNA open 925646-925713 ASdes TB sRNA
28 KK339370.1 GCA000667805_01182 ncRNA open 1229228-1229295 ASdes TB sRNA
29 KK339370.1 GCA000667805_01360 ncRNA open 1421276-1421384 Mycobacterium sRNA ncrMT1302
30 KK339370.1 GCA000667805_01775 ncRNA open 1884896-1884967 ASpks TB sRNA
31 KK339370.1 GCA000667805_01777 ncRNA open 1891287-1891355 ASpks TB sRNA
32 KK339370.1 GCA000667805_01805 ncRNA open 1923386-1923452 G2
33 KK339370.1 GCA000667805_01848 ncRNA open 1960715-1960791 AS1726 sRNA
34 KK339370.1 GCA000667805_01977 ncRNA open 2106266-2106560 5' ureB small RNA
35 KK339370.1 GCA000667805_02020 ncRNA open 2147691-2147799 AS1890 sRNA
36 KK339370.1 GCA000667805_02038 ncRNA open 2160580-2160791 Mycobacterium sRNA 6715
37 KK339370.1 GCA000667805_02203 ncRNA open 2307452-2307529 ASpks TB sRNA
38 KK339370.1 GCA000667805_02387 ncRNA open 2503647-2504075 Bacterial RNase P class A
39 KK339370.1 GCA000667805_02567 ncRNA open 2697187-2697535 mcr7 sRNA
40 KK339370.1 GCA000667805_02839 ncRNA open 2985774-2985945 ncRv12659 sRNA
41 KK339370.1 GCA000667805_03126 ncRNA open 3302095-3302169 ASpks TB sRNA
42 KK339370.1 GCA000667805_03264 ncRNA open 3446680-3446724 Mycobacterium sRNA Ms_AS-5
43 KK339370.1 regulatory_region open 79201-79291 Glycine riboswitch aptamer
44 KK339370.1 regulatory_region open 309686-309867 Cobalamin riboswitch aptamer
45 KK339370.1 regulatory_region open 508657-508767 TPP riboswitch aptamer (THI element)
46 KK339370.1 regulatory_region open 517826-517936 TPP riboswitch aptamer (THI element)
47 KK339370.1 regulatory_region open 972751-972973 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
48 KK339370.1 regulatory_region open 1268431-1268666 Cobalamin riboswitch aptamer
49 KK339370.1 regulatory_region open 1744047-1744216 M-box riboswitch aptamer (ykoK leader)
50 KK339370.1 regulatory_region open 2055927-2056101 M-box riboswitch aptamer (ykoK leader)
51 KK339370.1 regulatory_region open 2083756-2083853 Glycine riboswitch aptamer
52 KK339370.1 regulatory_region open 2083857-2083987 Glycine riboswitch aptamer
53 KK339370.1 regulatory_region open 2432501-2432604 mraW RNA
54 KK339370.1 regulatory_region open 3097310-3097380 Actino-pnp RNA
55 KK339370.1 regulatory_region open 3732894-3733013 SAM (S-adenosyl methionine) riboswitch aptamer
56 KK339370.1 GCA000667805_01414 rRNA open 1479844-1481375 rrs 16S ribosomal RNA
57 KK339370.1 GCA000667805_01415 rRNA open 1481653-1484790 rrl 23S ribosomal RNA
58 KK339370.1 GCA000667805_01416 rRNA open 1484895-1485007 rrf 5S ribosomal RNA
59 KK339370.1 repeat_region open 3123787-3124058 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC and spacer length 39
60 KK339370.1 GCA000667805_00001 CDS open 34-1524 _na     496_aa dnaA chromosomal replication initiator protein DnaA
61 KK339370.1 GCA000667805_00002 CDS open 2052-3260 _na     402_aa dnaN DNA polymerase III subunit beta
62 KK339370.1 GCA000667805_00003 CDS open 3280-4437 _na     385_aa recF DNA replication/repair protein RecF
63 KK339370.1 GCA000667805_00004 CDS open 4482-4997 _na     171_aa dciA DNA replication protein DciA
64 KK339370.1 GCA000667805_00005 CDS open 5123-7267 _na     714_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
65 KK339370.1 GCA000667805_00006 CDS open 7302-9818 _na     838_aa gyrA intein-containing DNA gyrase subunit A
66 KK339370.1 GCA000667805_00007 CDS open 9963-10160 _na     65_aa hypothetical protein
67 KK339370.1 GCA000667805_00008 CDS open 10523-10828 _na     101_aa putative conserved membrane protein
68 KK339370.1 GCA000667805_00011 CDS open 11421-11528 _na     35_aa DUF3800 domain-containing protein
69 KK339370.1 GCA000667805_00012 CDS open 11555-11692 _na     45_aa DUF3800 domain-containing protein
70 KK339370.1 GCA000667805_00013 CDS open 11874-12311 _na     145_aa cwsA Cell wall synthesis protein CwsA
71 KK339370.1 GCA000667805_00014 CDS open 12468-13016 _na     182_aa ppiA peptidylprolyl isomerase PpiA
72 KK339370.1 GCA000667805_00015 CDS open 13024-13176 _na     50_aa hypothetical protein
73 KK339370.1 GCA000667805_00016 CDS open 13133-13492 _na     119_aa putative protein Rv0010c
74 KK339370.1 GCA000667805_00017 CDS open 13714-13995 _na     93_aa crgA cell division protein CrgA
75 KK339370.1 GCA000667805_00018 CDS open 14134-14877 _na     247_aa DUF881 domain-containing protein
76 KK339370.1 GCA000667805_00019 CDS open 14914-15612 _na     232_aa trpG aminodeoxychorismate/anthranilate synthase component II
77 KK339370.1 GCA000667805_00020 CDS open 15590-17470 _na     626_aa pknB serine/threonine protein kinase PknB
78 KK339370.1 GCA000667805_00021 CDS open 17467-18762 _na     431_aa pknA serine/threonine protein kinase PknA
79 KK339370.1 GCA000667805_00022 CDS open 18759-20234 _na     491_aa pbpA D%2CD-transpeptidase PbpA
80 KK339370.1 GCA000667805_00023 CDS open 20231-21640 _na     469_aa rodA cell shape-determining peptidoglycan glycosyltransferase RodA
81 KK339370.1 GCA000667805_00024 CDS open 21637-23172 _na     511_aa pstP serine/threonine phosphatase PstP
82 KK339370.1 GCA000667805_00025 CDS open 23270-23737 _na     155_aa fhaB growth/cell division-associated protein FhaB
83 KK339370.1 GCA000667805_00026 CDS open 23861-25444 _na     527_aa fhaA cell division-associated protein FhaA
84 KK339370.1 GCA000667805_00028 CDS open 25913-26881 _na     322_aa Nitronate monooxygenase domain-containing protein
85 KK339370.1 GCA000667805_00029 CDS open 27023-27442 _na     139_aa whiB5 transcriptional regulator WhiB5
86 KK339370.1 GCA000667805_00030 CDS open 27595-28365 _na     256_aa putative HTH-type transcriptional regulator Rv0023
87 KK339370.1 GCA000667805_00031 CDS open 28362-29207 _na     281_aa NlpC/P60 domain-containing protein
88 KK339370.1 GCA000667805_00032 CDS open 29245-29607 _na     120_aa putative protein Rv0025
89 KK339370.1 GCA000667805_00033 CDS open 29722-31068 _na     448_aa putative protein Rv0026
90 KK339370.1 GCA000667805_00034 CDS open 31189-31506 _na     105_aa putative protein Rv0027
91 KK339370.1 GCA000667805_00035 CDS open 31514-31819 _na     101_aa putative protein Mb0029
92 KK339370.1 GCA000667805_00036 CDS open 31824-31967 _na     47_aa putative protein Rv0028A
93 KK339370.1 GCA000667805_00037 CDS open 32279-33154 _na     291_aa Transmembrane protein
94 KK339370.1 GCA000667805_00038 CDS open 33224-33553 _na     109_aa putative protein Rv0030
95 KK339370.1 GCA000667805_00039 CDS open 34295-36610 _na     771_aa bioF2 Putative 8-amino-7-oxononanoate synthase 2
96 KK339370.1 GCA000667805_00040 CDS open 36607-36870 _na     87_aa acpA Acyl carrier protein AcpA
97 KK339370.1 GCA000667805_00041 CDS open 36867-37262 _na     131_aa putative protein Mb0035
98 KK339370.1 GCA000667805_00042 CDS open 37259-38947 _na     562_aa Fatty-acid-CoA ligase
99 KK339370.1 GCA000667805_00043 CDS open 39056-39829 _na     257_aa putative protein Mb0037c
100 KK339370.1 GCA000667805_00044 CDS open 39877-41187 _na     436_aa putative MFS-type transporter Mb0038c
101 KK339370.1 GCA000667805_00045 CDS open 41280-41912 _na     210_aa YqgE/AlgH family protein
102 KK339370.1 GCA000667805_00046 CDS open 42004-42351 _na     115_aa putative protein Rv0039c
103 KK339370.1 GCA000667805_00047 CDS open 42433-43365 _na     310_aa mtc28 Proline-rich antigen
104 KK339370.1 GCA000667805_00048 CDS open 43595-46471 _na     958_aa leuS leucine--tRNA ligase
105 KK339370.1 GCA000667805_00049 CDS open 46581-47207 _na     208_aa putative transcriptional regulatory protein (Probably MarR-family)
106 KK339370.1 GCA000667805_00050 CDS open 47366-48100 _na     244_aa putative HTH-type transcriptional regulator Mb0044c
107 KK339370.1 GCA000667805_00051 CDS open 48233-49027 _na     264_aa putative oxidoreductase
108 KK339370.1 GCA000667805_00052 CDS open 49043-49939 _na     298_aa Esterase Rv0045c
109 KK339370.1 GCA000667805_00053 CDS open 50021-51124 _na     367_aa ino1 inositol-3-phosphate synthase
110 KK339370.1 GCA000667805_00054 CDS open 51185-51727 _na     180_aa padR Transcription regulator PadR N-terminal domain-containing protein
111 KK339370.1 GCA000667805_00055 CDS open 51828-52697 _na     289_aa putative protein Rv0048c
112 KK339370.1 GCA000667805_00056 CDS open 52831-53244 _na     137_aa putative protein Mb0050
113 KK339370.1 GCA000667805_00057 CDS open 53237-55696 _na     819_aa ponA1 transglycosylase/D%2CD-transpeptidase PonA1
114 KK339370.1 GCA000667805_00058 CDS open 55693-57375 _na     560_aa Transmembrane protein
115 KK339370.1 GCA000667805_00059 CDS open 57332-57970 _na     212_aa DJ-1/PfpI domain-containing protein
116 KK339370.1 GCA000667805_00060 CDS open 58189-58479 _na     96_aa rpsF 30S ribosomal protein S6
117 KK339370.1 GCA000667805_00061 CDS open 58583-59077 _na     164_aa ssb Single-stranded DNA-binding protein
118 KK339370.1 GCA000667805_00062 CDS open 59119-59373 _na     84_aa rpsR 30S ribosomal protein S18
119 KK339370.1 GCA000667805_00063 CDS open 59406-59864 _na     152_aa rplI 50S ribosomal protein L9
120 KK339370.1 GCA000667805_00064 CDS open 59893-60414 _na     173_aa putative protein Rv0057
121 KK339370.1 GCA000667805_00065 CDS open 60393-63017 _na     874_aa dnaB replicative DNA helicase
122 KK339370.1 GCA000667805_00066 CDS open 63197-63889 _na     230_aa darT toxin-antitoxin system toxin DarT
123 KK339370.1 GCA000667805_00067 CDS open 63906-64964 _na     352_aa darG DNA ADP-ribosyl glycohydrolase
124 KK339370.1 GCA000667805_00068 CDS open 65009-65662 _na     217_aa Secreted protein
125 KK339370.1 GCA000667805_00069 CDS open 65768-66691 _na     307_aa Glucanase
126 KK339370.1 GCA000667805_00070 CDS open 66920-68359 _na     479_aa Oxidoreductase
127 KK339370.1 GCA000667805_00071 CDS open 68421-68576 _na     51_aa Transmembrane protein
128 KK339370.1 GCA000667805_00072 CDS open 68617-71556 _na     979_aa UPF0182 protein Mb0065
129 KK339370.1 GCA000667805_00073 CDS open 71586-71825 _na     79_aa vapB1 Putative antitoxin VapB1
130 KK339370.1 GCA000667805_00074 CDS open 71818-72219 _na     133_aa vapC1 type II toxin-antitoxin system ribonuclease VapC1
131 KK339370.1 GCA000667805_00075 CDS open 72271-74508 _na     745_aa icd-2 NADP-dependent isocitrate dehydrogenase
132 KK339370.1 GCA000667805_00076 CDS open 74626-75195 _na     189_aa putative transcriptional regulatory protein (Possibly TetR-family)
133 KK339370.1 GCA000667805_00077 CDS open 75298-76209 _na     303_aa Oxidoreductase
134 KK339370.1 GCA000667805_00078 CDS open 76234-77619 _na     461_aa sdaA L-serine ammonia-lyase
135 KK339370.1 GCA000667805_00079 CDS open 77616-78893 _na     425_aa glyA2 Serine hydroxymethyltransferase 2
136 KK339370.1 GCA000667805_00080 CDS open 79483-80190 _na     235_aa Reverse transcriptase domain-containing protein
137 KK339370.1 GCA000667805_00081 CDS open 80621-81670 _na     349_aa putative ABC transporter permease Rv0072
138 KK339370.1 GCA000667805_00082 CDS open 81673-82665 _na     330_aa putative ABC transporter ATP-binding protein Rv0073
139 KK339370.1 GCA000667805_00083 CDS open 82745-83980 _na     411_aa Conserved protein
140 KK339370.1 GCA000667805_00084 CDS open 83993-85165 _na     390_aa cysteine-S-conjugate beta-lyase
141 KK339370.1 GCA000667805_00085 CDS open 85180-85569 _na     129_aa Transmembrane protein
142 KK339370.1 GCA000667805_00086 CDS open 85633-86463 _na     276_aa Alpha/beta fold family hydrolase
143 KK339370.1 GCA000667805_00087 CDS open 86525-87130 _na     201_aa acrR putative acrAB operon repressor
144 KK339370.1 GCA000667805_00088 CDS open 87205-87798 _na     197_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
145 KK339370.1 GCA000667805_00089 CDS open 87795-88001 _na     68_aa Conserved protein
146 KK339370.1 GCA000667805_00090 CDS open 88201-89022 _na     273_aa dormancy-associated translation inhibitor
147 KK339370.1 GCA000667805_00091 CDS open 89019-89477 _na     152_aa putative protein Rv0080
148 KK339370.1 GCA000667805_00092 CDS open 89572-89916 _na     114_aa putative HTH-type transcriptional regulator Rv0081
149 KK339370.1 GCA000667805_00093 CDS open 89921-90400 _na     159_aa Formate hydrogenlyase subunit 7
150 KK339370.1 GCA000667805_00094 CDS open 90397-92319 _na     640_aa putative protein Rv0083
151 KK339370.1 GCA000667805_00095 CDS open 92325-93275 _na     316_aa hycD putative formate hydrogenlyase HycD (FHL)
152 KK339370.1 GCA000667805_00096 CDS open 93286-93948 _na     220_aa putative protein Mb0088
153 KK339370.1 GCA000667805_00097 CDS open 93948-95414 _na     488_aa Putative hydrogenase HYCQ
154 KK339370.1 GCA000667805_00098 CDS open 95414-96889 _na     491_aa hycE putative formate hydrogenase HycE (FHL)
155 KK339370.1 GCA000667805_00099 CDS open 97119-97598 _na     159_aa putative protein Rv0088
156 KK339370.1 GCA000667805_00100 CDS open 97755-98348 _na     197_aa putative methyltransferase Rv0089
157 KK339370.1 GCA000667805_00101 CDS open 98477-99247 _na     256_aa putative protein Rv0090
158 KK339370.1 GCA000667805_00102 CDS open 99376-99570 _na     64_aa hypothetical protein
159 KK339370.1 GCA000667805_00103 CDS open 99681-100448 _na     255_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
160 KK339370.1 GCA000667805_00104 CDS open 100580-102865 _na     761_aa ctpA Copper-exporting P-type ATPase
161 KK339370.1 GCA000667805_00105 CDS open 102812-103522 _na     236_aa putative protein Rv0093c
162 KK339370.1 GCA000667805_00106 CDS open 103707-104666 _na     319_aa HNH nuclease domain-containing protein
163 KK339370.1 GCA000667805_00107 CDS open 104802-105167 _na     121_aa Putative putative protein Rv0095c
164 KK339370.1 GCA000667805_00108 CDS open 105321-106712 _na     463_aa pPE1 putative PPE family protein PPE1
165 KK339370.1 GCA000667805_00109 CDS open 106731-107600 _na     289_aa mmaE (3R)-3-[(carboxymethyl)amino]fatty acid oxygenase/decarboxylase
166 KK339370.1 GCA000667805_00110 CDS open 107597-108148 _na     183_aa fcoT fatty acyl CoA thioesterase FcoT
167 KK339370.1 GCA000667805_00111 CDS open 108177-109775 _na     532_aa fadD10 fatty acid--CoA ligase FadD10
168 KK339370.1 GCA000667805_00112 CDS open 109768-110016 _na     82_aa Acyl carrier protein Rv0100
169 KK339370.1 GCA000667805_00113 CDS open 109998-117536 _na     2512_aa nrp non-ribosomal peptide synthetase Nrp
170 KK339370.1 GCA000667805_00114 CDS open 117774-119696 _na     640_aa putative protein Mb0105
171 KK339370.1 GCA000667805_00115 CDS open 119912-122170 _na     752_aa ctpB Cation-transporting P-type ATPase B
172 KK339370.1 GCA000667805_00116 CDS open 122314-123828 _na     504_aa putative protein Rv0104
173 KK339370.1 GCA000667805_00117 CDS open 123977-124261 _na     94_aa rpmB 50S ribosomal protein L28
174 KK339370.1 GCA000667805_00118 CDS open 124371-125567 _na     398_aa mrf ribosome hibernation factor-recruiting GTPase MRF
175 KK339370.1 GCA000667805_00119 CDS open 125640-130538 _na     1632_aa ctpI putative cation-transporting ATPase I
176 KK339370.1 GCA000667805_00120 CDS open 130892-131134 _na     80_aa Oxidoreductase
177 KK339370.1 GCA000667805_00121 CDS open 131380-132870 _na     496_aa PE-PGRS family protein PE_PGRS1
178 KK339370.1 GCA000667805_00122 CDS open 133018-133767 _na     249_aa Rhomboid protease 1
179 KK339370.1 GCA000667805_00123 CDS open 133948-136005 _na     685_aa putative transmembrane acyltransferase
180 KK339370.1 GCA000667805_00124 CDS open 136287-137243 _na     318_aa putative GDP-mannose 4%2C6-dehydratase Gca (GDP-D-mannose dehydratase)
181 KK339370.1 GCA000667805_00125 CDS open 137284-137907 _na     207_aa gmhA D-sedoheptulose 7-phosphate isomerase
182 KK339370.1 GCA000667805_00126 CDS open 137858-138511 _na     217_aa gmhB D-glycero-alpha-D-manno-heptose-1%2C7-bisphosphate 7-phosphatase
183 KK339370.1 GCA000667805_00127 CDS open 138511-139671 _na     386_aa hddA D-glycero-alpha-D-manno-heptose 7-phosphate kinase
184 KK339370.1 GCA000667805_00128 CDS open 139954-140142 _na     62_aa Transposase
185 KK339370.1 GCA000667805_00129 CDS open 140265-141020 _na     251_aa ldtMt1 L%2CD-transpeptidase LdtMt1
186 KK339370.1 GCA000667805_00130 CDS open 141198-142142 _na     314_aa oxyS LysR family transcriptional regulator OxyS
187 KK339370.1 GCA000667805_00131 CDS open 142126-143874 _na     582_aa oxc oxalyl-CoA decarboxylase
188 KK339370.1 GCA000667805_00132 CDS open 143996-145624 _na     542_aa fadD7 FadD7 family fatty acid--CoA ligase
189 KK339370.1 GCA000667805_00133 CDS open 145625-147769 _na     714_aa elongation factor G-like protein EF-G2
190 KK339370.1 GCA000667805_00134 CDS open 147906-148340 _na     144_aa Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein
191 KK339370.1 GCA000667805_00135 CDS open 148675-148857 _na     60_aa DUF4258 domain-containing protein
192 KK339370.1 GCA000667805_00136 CDS open 148854-149222 _na     122_aa DNA-binding protein
193 KK339370.1 GCA000667805_00137 CDS open 149531-150994 _na     487_aa PE-PGRS family protein PE_PGRS2
194 KK339370.1 GCA000667805_00138 CDS open 151146-152213 _na     355_aa Serine protease
195 KK339370.1 GCA000667805_00139 CDS open 152322-154127 _na     601_aa treS Trehalose synthase/amylase TreS
196 KK339370.1 GCA000667805_00140 CDS open 154230-155597 _na     455_aa mak maltokinase
197 KK339370.1 GCA000667805_00141 CDS open 155665-156444 _na     259_aa Conserved transmembrane protein
198 KK339370.1 GCA000667805_00142 CDS open 156576-157598 _na     340_aa ag85C diacylglycerol acyltransferase/mycolyltransferase Ag85C
199 KK339370.1 GCA000667805_00143 CDS open 157845-158300 _na     151_aa htdZ 3-hydroxyacyl-thioester dehydratase HtdZ
200 KK339370.1 GCA000667805_00144 CDS open 158313-159656 _na     447_aa fadE1 Acyl-CoA dehydrogenase FadE1
201 KK339370.1 GCA000667805_00145 CDS open 159698-160780 _na     360_aa fgd2 F420-dependent hydroxymycolic acid dehydrogenase
202 KK339370.1 GCA000667805_00146 CDS open 160867-161472 _na     201_aa GCN5-related N-acetyltransferase
203 KK339370.1 GCA000667805_00147 CDS open 161769-162671 _na     300_aa Alpha/beta hydrolase
204 KK339370.1 GCA000667805_00148 CDS open 162642-163247 _na     201_aa putative transcriptional regulatory protein
205 KK339370.1 GCA000667805_00149 CDS open 163364-164689 _na     441_aa cyp138 Putative cytochrome P450 138
206 KK339370.1 GCA000667805_00150 CDS open 164710-165258 _na     182_aa msrA Peptide methionine sulfoxide reductase MsrA
207 KK339370.1 GCA000667805_00151 CDS open 165321-165824 _na     167_aa SnoaL-like domain-containing protein
208 KK339370.1 GCA000667805_00152 CDS open 165825-166847 _na     340_aa Oxidoreductase
209 KK339370.1 GCA000667805_00153 CDS open 166908-167288 _na     126_aa Conserved protein
210 KK339370.1 GCA000667805_00154 CDS open 167269-167679 _na     136_aa SnoaL-like domain-containing protein
211 KK339370.1 GCA000667805_00155 CDS open 167709-168635 _na     308_aa DNA-3-methyladenine glycosylase II
212 KK339370.1 GCA000667805_00156 CDS open 168702-170180 _na     492_aa Transmembrane protein
213 KK339370.1 GCA000667805_00157 CDS open 170282-171124 _na     280_aa tetR TetR family transcriptional regulator
214 KK339370.1 GCA000667805_00158 CDS open 171213-172166 _na     317_aa Putative S-adenosyl-L-methionine-dependent methyltransferase MRA_0152
215 KK339370.1 GCA000667805_00159 CDS open 172209-173141 _na     310_aa Putative S-adenosyl-L-methionine-dependent methyltransferase BCG_0182
216 KK339370.1 GCA000667805_00160 CDS open 173236-174756 _na     506_aa Aldehyde dehydrogenase
217 KK339370.1 GCA000667805_00161 CDS open 174831-175691 _na     286_aa fabG Putative short-chain type dehydrogenase/reductase Rv0148
218 KK339370.1 GCA000667805_00162 CDS open 175698-176666 _na     322_aa putative quinone oxidoreductase (NADPH:quinone oxidoreductase) (Zeta-crystallin)
219 KK339370.1 GCA000667805_00163 CDS open 176663-176950 _na     95_aa PE family protein
220 KK339370.1 GCA000667805_00164 CDS open 177541-179307 _na     588_aa PE family protein PE1
221 KK339370.1 GCA000667805_00165 CDS open 179317-180789 _na     490_aa PE family protein PE2
222 KK339370.1 GCA000667805_00166 CDS open 180803-181027 _na     74_aa PE-PGRS family protein
223 KK339370.1 GCA000667805_00167 CDS open 181153-181983 _na     276_aa ptbB tyrosine-protein phosphatase PtbB
224 KK339370.1 GCA000667805_00168 CDS open 181985-183196 _na     403_aa fadE2 putative acyl-CoA dehydrogenase FadE2
225 KK339370.1 GCA000667805_00169 CDS open 183620-184720 _na     366_aa pntA Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
226 KK339370.1 GCA000667805_00170 CDS open 184721-185053 _na     110_aa proton-translocating NAD(P)(+) transhydrogenase
227 KK339370.1 GCA000667805_00171 CDS open 185050-186477 _na     475_aa NAD(P) transhydrogenase subunit beta
228 KK339370.1 GCA000667805_00172 CDS open 186493-186618 _na     41_aa tetR TetR family transcriptional regulator
229 KK339370.1 GCA000667805_00173 CDS open 186783-187427 _na     214_aa TetR-family transcriptional regulator
230 KK339370.1 GCA000667805_00174 CDS open 187431-188837 _na     468_aa pE3 PE family protein PE3
231 KK339370.1 GCA000667805_00175 CDS open 188929-190437 _na     502_aa PE family protein PE4
232 KK339370.1 GCA000667805_00176 CDS open 190605-191954 _na     449_aa putative oxidoreductase
233 KK339370.1 GCA000667805_00177 CDS open 191982-193100 _na     372_aa Zinc-type alcohol dehydrogenase subunit E
234 KK339370.1 GCA000667805_00178 CDS open 193115-193570 _na     151_aa Conserved protein
235 KK339370.1 GCA000667805_00179 CDS open 193669-194109 _na     146_aa Coenzyme Q-binding protein COQ10 START domain-containing protein
236 KK339370.1 GCA000667805_00180 CDS open 194142-194936 _na     264_aa Transcriptional regulator Mce1R
237 KK339370.1 GCA000667805_00181 CDS open 194991-196655 _na     554_aa fadD5 fatty-acid--CoA ligase FadD5
238 KK339370.1 GCA000667805_00182 CDS open 196859-197656 _na     265_aa mlaE Conserved integral membrane protein YrbE1A
239 KK339370.1 GCA000667805_00183 CDS open 197658-198527 _na     289_aa Conserved integral membrane protein YrbE1B
240 KK339370.1 GCA000667805_00184 CDS open 198532-199896 _na     454_aa Mce-family protein Mce1A
241 KK339370.1 GCA000667805_00185 CDS open 199893-200933 _na     346_aa Mce-family protein Mce1B
242 KK339370.1 GCA000667805_00186 CDS open 200930-202477 _na     515_aa Mce-family protein Mce1C
243 KK339370.1 GCA000667805_00187 CDS open 202474-204066 _na     530_aa Mce-family protein Mce1D
244 KK339370.1 GCA000667805_00188 CDS open 204063-205235 _na     390_aa lprK putative Mce-family lipoprotein LprK (Mce-family lipoprotein Mce1E)
245 KK339370.1 GCA000667805_00189 CDS open 205229-206776 _na     515_aa Mce-family protein Mce1F
246 KK339370.1 GCA000667805_00190 CDS open 206746-207453 _na     235_aa Mce associated membrane protein
247 KK339370.1 GCA000667805_00191 CDS open 207450-208418 _na     322_aa Mce associated transmembrane protein
248 KK339370.1 GCA000667805_00192 CDS open 208415-208969 _na     184_aa mce1 operon protein
249 KK339370.1 GCA000667805_00193 CDS open 208936-209670 _na     244_aa Conserved Mce associated membrane protein
250 KK339370.1 GCA000667805_00194 CDS open 209701-210810 _na     369_aa Phosphodiester glycosidase domain-containing protein
251 KK339370.1 GCA000667805_00195 CDS open 210890-212248 _na     452_aa Conserved transmembrane protein
252 KK339370.1 GCA000667805_00196 CDS open 212275-213009 _na     244_aa Putative quercetin 2%2C3-dioxygenase Mb0187c
253 KK339370.1 GCA000667805_00197 CDS open 213026-214024 _na     332_aa sigG ECF RNA polymerase sigma factor SigG
254 KK339370.1 GCA000667805_00198 CDS open 214029-214925 _na     298_aa monoacylglycerol lipase
255 KK339370.1 GCA000667805_00199 CDS open 214967-215716 _na     249_aa DUF2786 domain-containing protein
256 KK339370.1 GCA000667805_00200 CDS open 215713-216222 _na     169_aa TIGR04338 family metallohydrolase
257 KK339370.1 GCA000667805_00201 CDS open 216267-218342 _na     691_aa bglS putative beta-glucosidase bglS
258 KK339370.1 GCA000667805_00202 CDS open 218388-218534 _na     48_aa mymT metallothionein MymT
259 KK339370.1 GCA000667805_00203 CDS open 218709-219365 _na     218_aa Catechol O-methyltransferase
260 KK339370.1 GCA000667805_00204 CDS open 219484-219915 _na     143_aa Transmembrane protein
261 KK339370.1 GCA000667805_00205 CDS open 219994-221721 _na     575_aa ilvD dihydroxy-acid dehydratase
262 KK339370.1 GCA000667805_00206 CDS open 221869-222159 _na     96_aa ricR Copper-sensing transcriptional repressor RicR
263 KK339370.1 GCA000667805_00207 CDS open 222287-223528 _na     413_aa Rv0191 family MFS efflux transporter
264 KK339370.1 GCA000667805_00208 CDS open 223605-223907 _na     100_aa Conserved secreted protein
265 KK339370.1 GCA000667805_00209 CDS open 223898-224662 _na     254_aa L%2CD-transpeptidase 4
266 KK339370.1 GCA000667805_00210 CDS open 224722-226569 _na     615_aa hypothetical protein
267 KK339370.1 GCA000667805_00211 CDS open 226698-226817 _na     39_aa hypothetical protein
268 KK339370.1 GCA000667805_00212 CDS open 226876-230460 _na     1194_aa msbA lipid A export permease/ATP-binding protein MsbA
269 KK339370.1 GCA000667805_00213 CDS open 230765-231532 _na     255_aa luxR LuxR family transcriptional regulator
270 KK339370.1 GCA000667805_00214 CDS open 231645-232229 _na     194_aa putative HTH-type transcriptional regulator Rv0196
271 KK339370.1 GCA000667805_00215 CDS open 232229-234475 _na     748_aa putative oxidoreductase
272 KK339370.1 GCA000667805_00216 CDS open 234516-236507 _na     663_aa zmp1 zinc metalloprotease Zmp1
273 KK339370.1 GCA000667805_00217 CDS open 236550-237209 _na     219_aa Conserved membrane protein
274 KK339370.1 GCA000667805_00218 CDS open 237206-237895 _na     229_aa putative conserved transmembrane protein
275 KK339370.1 GCA000667805_00219 CDS open 237892-238395 _na     167_aa Conserved protein
276 KK339370.1 GCA000667805_00220 CDS open 238392-241289 _na     965_aa mmpL11 RND transporter MmpL11
277 KK339370.1 GCA000667805_00221 CDS open 241514-241924 _na     136_aa hemophore
278 KK339370.1 GCA000667805_00222 CDS open 241976-243259 _na     427_aa Transmembrane protein
279 KK339370.1 GCA000667805_00223 CDS open 243384-244487 _na     367_aa Putative transport protein Rv0205
280 KK339370.1 GCA000667805_00224 CDS open 244484-247318 _na     944_aa mmpL3 trehalose monomycolate RND transporter MmpL3
281 KK339370.1 GCA000667805_00225 CDS open 247384-248118 _na     244_aa NYN domain-containing protein
282 KK339370.1 GCA000667805_00226 CDS open 248115-248708 _na     197_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
283 KK339370.1 GCA000667805_00227 CDS open 249038-250123 _na     361_aa G domain-containing protein
284 KK339370.1 GCA000667805_00228 CDS open 250120-251598 _na     492_aa Transmembrane protein
285 KK339370.1 GCA000667805_00229 CDS open 251782-253602 _na     606_aa pckG phosphoenolpyruvate carboxykinase (GTP)
286 KK339370.1 GCA000667805_00230 CDS open 253669-254640 _na     323_aa nadR putative transcriptional regulatory protein NadR (Probably AsnC-family)
287 KK339370.1 GCA000667805_00231 CDS open 254637-255953 _na     438_aa putative methyltransferase (Methylase)
288 KK339370.1 GCA000667805_00232 CDS open 256160-257677 _na     505_aa fadD4 fatty-acid--CoA ligase FadD4
289 KK339370.1 GCA000667805_00233 CDS open 257783-258856 _na     357_aa fadE3 putative acyl-CoA dehydrogenase fadE3
290 KK339370.1 GCA000667805_00234 CDS open 258913-259926 _na     337_aa Double hotdog hydratase
291 KK339370.1 GCA000667805_00235 CDS open 259923-260831 _na     302_aa Esterase
292 KK339370.1 GCA000667805_00236 CDS open 260924-262252 _na     442_aa Oxidoreductase molybdopterin-binding domain-containing protein
293 KK339370.1 GCA000667805_00237 CDS open 262254-262802 _na     182_aa Transmembrane protein
294 KK339370.1 GCA000667805_00238 CDS open 262812-264023 _na     403_aa lipC esterase LipC
295 KK339370.1 GCA000667805_00239 CDS open 264067-265476 _na     469_aa Putative diacyglycerol O-acyltransferase Rv0221
296 KK339370.1 GCA000667805_00240 CDS open 265507-266295 _na     262_aa echA1 Enoyl-CoA hydratase EchA1
297 KK339370.1 GCA000667805_00241 CDS open 266301-267764 _na     487_aa Putative aldehyde dehydrogenase
298 KK339370.1 GCA000667805_00242 CDS open 267863-268627 _na     254_aa putative methyltransferase Mb0229c
299 KK339370.1 GCA000667805_00243 CDS open 268663-269817 _na     384_aa putative conserved protein
300 KK339370.1 GCA000667805_00244 CDS open 269834-271564 _na     576_aa Transmembrane protein
301 KK339370.1 GCA000667805_00245 CDS open 271574-272854 _na     426_aa Conserved membrane protein
302 KK339370.1 GCA000667805_00246 CDS open 272980-274278 _na     432_aa Integral membrane acyl transferase
303 KK339370.1 GCA000667805_00247 CDS open 274306-274719 _na     137_aa vapC51 Ribonuclease VapC51
304 KK339370.1 GCA000667805_00248 CDS open 274710-274904 _na     64_aa vapB51 Putative antitoxin VapB51
305 KK339370.1 GCA000667805_00249 CDS open 274983-275963 _na     326_aa php Phosphotriesterase-like y protein
306 KK339370.1 GCA000667805_00250 CDS open 276058-277764 _na     568_aa Acyl-CoA dehydrogenase
307 KK339370.1 GCA000667805_00251 CDS open 277899-278588 _na     229_aa TetR/AcrR-family transcriptional regulator
308 KK339370.1 GCA000667805_00252 CDS open 278585-279529 _na     314_aa nrdB R2-like ligand-binding oxidase
309 KK339370.1 GCA000667805_00253 CDS open 279605-280978 _na     457_aa gabD1 NADP-dependent succinic semialdehyde dehydrogenase
310 KK339370.1 GCA000667805_00254 CDS open 281166-282614 _na     482_aa Conserved transmembrane protein
311 KK339370.1 GCA000667805_00255 CDS open 282649-286851 _na     1400_aa aftD alpha-(1->3)-arabinofuranosyltransferase
312 KK339370.1 GCA000667805_00256 CDS open 286898-287071 _na     57_aa Putative secreted protein Rv0236A
313 KK339370.1 GCA000667805_00257 CDS open 287186-288352 _na     388_aa lpqI beta-N-acetylhexosaminidase
314 KK339370.1 GCA000667805_00258 CDS open 288476-289042 _na     188_aa putative transcriptional regulatory protein (Probably TetR-family)
315 KK339370.1 GCA000667805_00259 CDS open 289104-289337 _na     77_aa vapB24 Putative antitoxin VapB24
316 KK339370.1 GCA000667805_00260 CDS open 289345-289782 _na     145_aa vapC24 Ribonuclease VapC24
317 KK339370.1 GCA000667805_00261 CDS open 289812-290654 _na     280_aa htdX 3-hydroxyacyl-thioester dehydratase HtdX
318 KK339370.1 GCA000667805_00262 CDS open 290665-292029 _na     454_aa fabG4 3-oxoacyl-ACP reductase
319 KK339370.1 GCA000667805_00263 CDS open 292171-293493 _na     440_aa acetyl-CoA C-acetyltransferase
320 KK339370.1 GCA000667805_00265 CDS open 293798-295633 _na     611_aa fadE5 Broad-specificity linear acyl-CoA dehydrogenase FadE5
321 KK339370.1 GCA000667805_00266 CDS open 296005-296493 _na     162_aa putative oxidoreductase
322 KK339370.1 GCA000667805_00267 CDS open 296809-298119 _na     436_aa Integral membrane protein
323 KK339370.1 GCA000667805_00268 CDS open 298116-298862 _na     248_aa sdhB succinate dehydrogenase/fumarate reductase iron-sulfur subunit
324 KK339370.1 GCA000667805_00269 CDS open 298863-300803 _na     646_aa fumarate reductase/succinate dehydrogenase flavoprotein subunit
325 KK339370.1 GCA000667805_00270 CDS open 300834-301655 _na     273_aa Succinate dehydrogenase membrane anchor subunit
326 KK339370.1 GCA000667805_00271 CDS open 301735-302028 _na     97_aa putative protein Rv0250c
327 KK339370.1 GCA000667805_00272 CDS open 302173-302652 _na     159_aa acr2 stress-responsive chaperone Acr2
328 KK339370.1 GCA000667805_00273 CDS open 302917-305427 _na     836_aa assimilatory sulfite reductase (ferredoxin)
329 KK339370.1 GCA000667805_00274 CDS open 305453-305809 _na     118_aa Nitrite reductase [NAD(P)H]%2C small subunit
330 KK339370.1 GCA000667805_00275 CDS open 305825-306349 _na     174_aa Adenosylcobinamide kinase
331 KK339370.1 GCA000667805_00276 CDS open 306374-307858 _na     494_aa cobQ cobyric acid synthase
332 KK339370.1 GCA000667805_00277 CDS open 307877-309547 _na     556_aa pPE2 PPE family protein PPE2
333 KK339370.1 GCA000667805_00278 CDS open 310294-310749 _na     151_aa Tetracyclin repressor-like C-terminal domain-containing protein
334 KK339370.1 GCA000667805_00279 CDS open 310774-311517 _na     247_aa Sirohydrochlorin chelatase
335 KK339370.1 GCA000667805_00280 CDS open 311514-312659 _na     381_aa uroporphyrinogen-III synthase
336 KK339370.1 GCA000667805_00281 CDS open 312759-314168 _na     469_aa narK3 Integral membrane nitrite extrusion protein NarK3
337 KK339370.1 GCA000667805_00282 CDS open 314309-314854 _na     181_aa aac(2')-Ic aminoglycoside N-acetyltransferase AAC(2')-Ic
338 KK339370.1 GCA000667805_00283 CDS open 314864-315766 _na     300_aa Carboxyltransferase domain-containing protein
339 KK339370.1 GCA000667805_00284 CDS open 315783-316436 _na     217_aa Carboxyltransferase domain-containing protein
340 KK339370.1 GCA000667805_00285 CDS open 316511-317503 _na     330_aa ABC transporter substrate-binding protein
341 KK339370.1 GCA000667805_00286 CDS open 317525-321154 _na     1209_aa oplA 5-oxoprolinase OplA
342 KK339370.1 GCA000667805_00287 CDS open 321331-322722 _na     463_aa Nitrate/nitrite transporter
343 KK339370.1 GCA000667805_00288 CDS open 322764-323021 _na     85_aa Putative antitoxin Rv0268c
344 KK339370.1 GCA000667805_00289 CDS open 323338-324531 _na     397_aa DNA ligase D polymerase domain-containing protein
345 KK339370.1 GCA000667805_00290 CDS open 324567-326249 _na     560_aa fadD2 long-chain-fatty-acid--CoA ligase FadD2
346 KK339370.1 GCA000667805_00291 CDS open 326266-328461 _na     731_aa Acyl-CoA dehydrogenase
347 KK339370.1 GCA000667805_00292 CDS open 328575-329708 _na     377_aa Alpha/beta hydrolase
348 KK339370.1 GCA000667805_00293 CDS open 329705-330325 _na     206_aa putative transcriptional regulatory protein
349 KK339370.1 GCA000667805_00294 CDS open 330422-331003 _na     193_aa Conserved protein
350 KK339370.1 GCA000667805_00295 CDS open 330933-331667 _na     244_aa HTH tetR-type domain-containing protein
351 KK339370.1 GCA000667805_00296 CDS open 331748-332668 _na     306_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
352 KK339370.1 GCA000667805_00297 CDS open 332708-333136 _na     142_aa vapC31 Ribonuclease VapC31
353 KK339370.1 GCA000667805_00298 CDS open 333160-333333 _na     57_aa Antitoxin
354 KK339370.1 GCA000667805_00299 CDS open 333437-336028 _na     863_aa PE family protein
355 KK339370.1 GCA000667805_00300 CDS open 337389-337928 _na     179_aa hypothetical protein
356 KK339370.1 GCA000667805_00301 CDS open 338034-338189 _na     51_aa hypothetical protein
357 KK339370.1 GCA000667805_00302 CDS open 338435-340024 _na     529_aa PE family protein
358 KK339370.1 GCA000667805_00303 CDS open 341665-341925 _na     86_aa hypothetical protein
359 KK339370.1 GCA000667805_00304 CDS open 341922-343532 _na     536_aa pPE3 putative PPE family protein PPE3
360 KK339370.1 GCA000667805_00305 CDS open 343556-344464 _na     302_aa Putative S-adenosyl-L-methionine-dependent methyltransferase MRA_0290
361 KK339370.1 GCA000667805_00306 CDS open 344688-346583 _na     631_aa eccA3 Type VII secretion system protein EccA3
362 KK339370.1 GCA000667805_00307 CDS open 346580-348196 _na     538_aa eccB3 type VII secretion system ESX-3 subunit EccB3
363 KK339370.1 GCA000667805_00308 CDS open 348193-352185 _na     1330_aa eccC3 type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3
364 KK339370.1 GCA000667805_00309 CDS open 352182-352490 _na     102_aa pE5 type VII secretion system ESX-3 target PE5
365 KK339370.1 GCA000667805_00310 CDS open 352493-354034 _na     513_aa pPE4 type VII secretion system ESX-3 target PPE4
366 KK339370.1 GCA000667805_00311 CDS open 354083-354376 _na     97_aa esxG type VII secretion system protein EsxG
367 KK339370.1 GCA000667805_00312 CDS open 354406-354696 _na     96_aa esxH type VII secretion system effector EsxH
368 KK339370.1 GCA000667805_00313 CDS open 354707-355594 _na     295_aa espG3 type VII secretion system ESX-3 associated protein EspG3
369 KK339370.1 GCA000667805_00314 CDS open 355641-357059 _na     472_aa eccD3 type VII secretion system ESX-3 subunit EccD3
370 KK339370.1 GCA000667805_00315 CDS open 357056-358441 _na     461_aa mycP3 type VII secretion system ESX-3 serine protease mycosin MycP3
371 KK339370.1 GCA000667805_00316 CDS open 358438-359433 _na     331_aa eccE3 type VII secretion system ESX-3 subunit EccE3
372 KK339370.1 GCA000667805_00317 CDS open 359420-360631 _na     403_aa AB hydrolase-1 domain-containing protein
373 KK339370.1 GCA000667805_00318 CDS open 360729-361514 _na     261_aa tam trans-aconitate 2-methyltransferase
374 KK339370.1 GCA000667805_00319 CDS open 361503-362306 _na     267_aa stf0 trehalose 2-sulfotransferase
375 KK339370.1 GCA000667805_00320 CDS open 362316-363713 _na     465_aa Sulfatase
376 KK339370.1 GCA000667805_00321 CDS open 363892-365667 _na     591_aa pE_PGRS5 PE-PGRS family protein PE_PGRS5
377 KK339370.1 GCA000667805_00322 CDS open 365810-366037 _na     75_aa Antitoxin Rv0298
378 KK339370.1 GCA000667805_00323 CDS open 366034-366336 _na     100_aa Toxin Rv0299
379 KK339370.1 GCA000667805_00324 CDS open 366384-366605 _na     73_aa vapB2 type II toxin-antitoxin system antitoxin VapB2
380 KK339370.1 GCA000667805_00325 CDS open 366602-367027 _na     141_aa vapC2 Ribonuclease VapC2
381 KK339370.1 GCA000667805_00326 CDS open 367163-367795 _na     210_aa tetR TetR family transcriptional regulator
382 KK339370.1 GCA000667805_00327 CDS open 367792-368700 _na     302_aa Short-chain type dehydrogenase/reductase
383 KK339370.1 GCA000667805_00328 CDS open 368708-375322 _na     2204_aa PPE family protein PPE5
384 KK339370.1 GCA000667805_00329 CDS open 375378-378269 _na     963_aa PPE family protein PPE6
385 KK339370.1 GCA000667805_00330 CDS open 378472-379143 _na     223_aa bluB 5%2C6-dimethylbenzimidazole synthase
386 KK339370.1 GCA000667805_00331 CDS open 379131-379613 _na     160_aa Acetoacetate decarboxylase
387 KK339370.1 GCA000667805_00332 CDS open 379671-380387 _na     238_aa Conserved integral membrane protein
388 KK339370.1 GCA000667805_00333 CDS open 380489-381145 _na     218_aa putative conserved exported protein
389 KK339370.1 GCA000667805_00334 CDS open 381215-381706 _na     163_aa SnoaL-like domain-containing protein
390 KK339370.1 GCA000667805_00335 CDS open 381730-382959 _na     409_aa DUF222 domain-containing protein
391 KK339370.1 GCA000667805_00336 CDS open 383114-384976 _na     620_aa Hsp70 family protein
392 KK339370.1 GCA000667805_00337 CDS open 385048-385434 _na     128_aa putative protein Rv0313
393 KK339370.1 GCA000667805_00338 CDS open 385437-386099 _na     220_aa DUF3060 domain-containing protein
394 KK339370.1 GCA000667805_00339 CDS open 386190-387044 _na     284_aa putative beta-1%2C3-glucanase
395 KK339370.1 GCA000667805_00340 CDS open 387093-387707 _na     204_aa putative muconolactone isomerase
396 KK339370.1 GCA000667805_00341 CDS open 387731-388468 _na     245_aa glpQ2 putative glycerophosphodiester phosphodiesterase 2
397 KK339370.1 GCA000667805_00343 CDS open 388863-389639 _na     258_aa Integral membrane protein
398 KK339370.1 GCA000667805_00344 CDS open 389706-390374 _na     222_aa pcp pyroglutamyl-peptidase I
399 KK339370.1 GCA000667805_00345 CDS open 390521-391108 _na     195_aa Glycoside hydrolase
400 KK339370.1 GCA000667805_00346 CDS open 391140-391712 _na     190_aa dcd dCTP deaminase
401 KK339370.1 GCA000667805_00347 CDS open 391818-393149 _na     443_aa ugd UDP-glucose 6-dehydrogenase
402 KK339370.1 GCA000667805_00348 CDS open 393138-393809 _na     223_aa GlcNAc-PI de-N-acetylase
403 KK339370.1 GCA000667805_00349 CDS open 393910-394590 _na     226_aa HTH-type transcriptional regulator Rv0324
404 KK339370.1 GCA000667805_00350 CDS open 394597-394821 _na     74_aa SAM-dependent methyltransferase
405 KK339370.1 GCA000667805_00351 CDS open 394831-395286 _na     151_aa Methyltransferase domain-containing protein
406 KK339370.1 GCA000667805_00352 CDS open 395254-396603 _na     449_aa cyp135A1 Putative cytochrome P450 135A1
407 KK339370.1 GCA000667805_00353 CDS open 396669-397271 _na     200_aa putative transcriptional regulatory protein (Possibly TetR/AcrR-family)
408 KK339370.1 GCA000667805_00354 CDS open 397252-397878 _na     208_aa Methyltransferase type 11 domain-containing protein
409 KK339370.1 GCA000667805_00355 CDS open 397905-398645 _na     246_aa HTH tetR-type domain-containing protein
410 KK339370.1 GCA000667805_00356 CDS open 398759-399925 _na     388_aa Dehydrogenase/reductase
411 KK339370.1 GCA000667805_00357 CDS open 400000-400785 _na     261_aa Maleylpyruvate isomerase family mycothiol-dependent enzyme
412 KK339370.1 GCA000667805_00358 CDS open 400752-401186 _na     144_aa SnoaL-like domain-containing protein
413 KK339370.1 GCA000667805_00359 CDS open 401216-402082 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
414 KK339370.1 GCA000667805_00360 CDS open 402045-402656 _na     203_aa PE family protein PE6
415 KK339370.1 GCA000667805_00361 CDS open 402819-404261 _na     480_aa HNH nuclease domain-containing protein
416 KK339370.1 GCA000667805_00362 CDS open 404431-405720 _na     429_aa aspC Alanine aminotransferase
417 KK339370.1 GCA000667805_00363 CDS open 405751-408399 _na     882_aa Iron-sulfur-binding reductase
418 KK339370.1 GCA000667805_00364 CDS open 408508-410958 _na     816_aa iniR isoniazid response ATPase/transcriptional regulator IniR
419 KK339370.1 GCA000667805_00365 CDS open 411192-411731 _na     179_aa Rv0340 family IniB-related protein
420 KK339370.1 GCA000667805_00366 CDS open 411920-413359 _na     479_aa iniB isoniazid-induced protein IniB
421 KK339370.1 GCA000667805_00367 CDS open 413396-415318 _na     640_aa iniA isoniazid-induced protein IniA
422 KK339370.1 GCA000667805_00368 CDS open 415315-416796 _na     493_aa iniC isoniazid-induced protein IniC
423 KK339370.1 GCA000667805_00369 CDS open 416939-417499 _na     186_aa Lipoprotein LPQJ
424 KK339370.1 GCA000667805_00370 CDS open 417602-418018 _na     138_aa MobA-like NTP transferase domain-containing protein
425 KK339370.1 GCA000667805_00371 CDS open 418060-419523 _na     487_aa ansP2 L-asparagine permease 2
426 KK339370.1 GCA000667805_00372 CDS open 420036-420848 _na     270_aa TIGR04255 family protein
427 KK339370.1 GCA000667805_00373 CDS open 420851-421504 _na     217_aa mosR hypoxia/intracellular survival transcriptional regulator MosR
428 KK339370.1 GCA000667805_00374 CDS open 421507-422166 _na     219_aa hypothetical protein
429 KK339370.1 GCA000667805_00375 CDS open 422393-424270 _na     625_aa dnaK molecular chaperone DnaK
430 KK339370.1 GCA000667805_00376 CDS open 424267-424974 _na     235_aa grpE nucleotide exchange factor GrpE
431 KK339370.1 GCA000667805_00377 CDS open 425010-426197 _na     395_aa dnaJ molecular chaperone DnaJ
432 KK339370.1 GCA000667805_00378 CDS open 426197-426577 _na     126_aa hspR heat shock transcriptional regulator HspR
433 KK339370.1 GCA000667805_00379 CDS open 426651-427202 _na     183_aa PPE family protein
434 KK339370.1 GCA000667805_00380 CDS open 427285-427785 _na     166_aa PPE family protein PPE8
435 KK339370.1 GCA000667805_00381 CDS open 428646-429218 _na     190_aa pirG Exported repetitive protein PirG
436 KK339370.1 GCA000667805_00382 CDS open 429270-429596 _na     108_aa pirG Exported repetitive protein PirG
437 KK339370.1 GCA000667805_00383 CDS open 429672-430103 _na     143_aa hypothetical protein
438 KK339370.1 GCA000667805_00384 CDS open 430428-430610 _na     60_aa hypothetical protein
439 KK339370.1 GCA000667805_00385 CDS open 430747-431493 _na     248_aa hypothetical protein
440 KK339370.1 GCA000667805_00386 CDS open 431631-432083 _na     150_aa PPE family protein
441 KK339370.1 GCA000667805_00387 CDS open 436481-436993 _na     170_aa pirG Exported repetitive protein PirG
442 KK339370.1 GCA000667805_00388 CDS open 437312-437671 _na     119_aa pirG Exported repetitive protein PirG
443 KK339370.1 GCA000667805_00389 CDS open 437723-438037 _na     104_aa pirG Exported repetitive protein PirG
444 KK339370.1 GCA000667805_00390 CDS open 438038-438409 _na     123_aa PPE family protein
445 KK339370.1 GCA000667805_00391 CDS open 438734-439048 _na     104_aa pirG Exported repetitive protein PirG
446 KK339370.1 GCA000667805_00392 CDS open 439103-439705 _na     200_aa hypothetical protein
447 KK339370.1 GCA000667805_00393 CDS open 439736-439960 _na     74_aa hypothetical protein
448 KK339370.1 GCA000667805_00394 CDS open 440111-440410 _na     99_aa pirG Exported repetitive protein PirG
449 KK339370.1 GCA000667805_00395 CDS open 440636-441109 _na     157_aa hypothetical protein
450 KK339370.1 GCA000667805_00396 CDS open 441308-441727 _na     139_aa pirG Exported repetitive protein PirG
451 KK339370.1 GCA000667805_00397 CDS open 441881-442075 _na     64_aa hypothetical protein
452 KK339370.1 GCA000667805_00398 CDS open 442438-443082 _na     214_aa Acyl-coenzyme A thioesterase THEM4
453 KK339370.1 GCA000667805_00399 CDS open 443079-444377 _na     432_aa purA adenylosuccinate synthase
454 KK339370.1 GCA000667805_00400 CDS open 444468-445115 _na     215_aa Peptidase M50
455 KK339370.1 GCA000667805_00401 CDS open 445126-445905 _na     259_aa rip2 Putative zinc metalloprotease Rip2
456 KK339370.1 GCA000667805_00402 CDS open 445910-446314 _na     134_aa DUF3151 domain-containing protein
457 KK339370.1 GCA000667805_00403 CDS open 446430-447257 _na     275_aa DUF4878 domain-containing protein
458 KK339370.1 GCA000667805_00404 CDS open 447479-448861 _na     460_aa mgtE magnesium transporter
459 KK339370.1 GCA000667805_00405 CDS open 448873-449907 _na     344_aa fbaA class II fructose-bisphosphate aldolase
460 KK339370.1 GCA000667805_00406 CDS open 450003-450686 _na     227_aa putative membrane protein Rv0364
461 KK339370.1 GCA000667805_00407 CDS open 450675-451805 _na     376_aa Conserved protein
462 KK339370.1 GCA000667805_00408 CDS open 451830-452423 _na     197_aa Zeta toxin domain-containing protein
463 KK339370.1 GCA000667805_00409 CDS open 452452-452841 _na     129_aa ParD-like antitoxin of type II toxin-antitoxin system
464 KK339370.1 GCA000667805_00410 CDS open 452922-454142 _na     406_aa VWFA domain-containing protein
465 KK339370.1 GCA000667805_00411 CDS open 454139-454741 _na     200_aa putative membrane oxidoreductase
466 KK339370.1 GCA000667805_00412 CDS open 454755-455651 _na     298_aa putative oxidoreductase
467 KK339370.1 GCA000667805_00413 CDS open 455648-456241 _na     197_aa MobA-like NTP transferase domain-containing protein
468 KK339370.1 GCA000667805_00414 CDS open 456238-456993 _na     251_aa Carbon monoxide dehydrogenase
469 KK339370.1 GCA000667805_00415 CDS open 457012-459411 _na     799_aa coxL aerobic carbon-monoxide dehydrogenase large subunit
470 KK339370.1 GCA000667805_00416 CDS open 459408-459887 _na     159_aa Carbon monoxide dehydrogenase small chain
471 KK339370.1 GCA000667805_00417 CDS open 459902-460804 _na     300_aa Carbon monoxide dehydrogenase medium subunit
472 KK339370.1 GCA000667805_00418 CDS open 460838-461995 _na     385_aa XshC-Cox1 family protein
473 KK339370.1 GCA000667805_00419 CDS open 462029-462994 _na     321_aa lysR putative HTH-type transcriptional regulator Rv0377
474 KK339370.1 GCA000667805_00420 CDS open 463242-463466 _na     74_aa PE-PGRS family protein
475 KK339370.1 GCA000667805_00421 CDS open 463600-463800 _na     66_aa secE2 calcium dodecin
476 KK339370.1 GCA000667805_00422 CDS open 463876-464526 _na     216_aa RNA methyltransferase
477 KK339370.1 GCA000667805_00423 CDS open 464523-465431 _na     302_aa Lipoprotein
478 KK339370.1 GCA000667805_00424 CDS open 465449-465988 _na     179_aa pyrE Orotate phosphoribosyltransferase
479 KK339370.1 GCA000667805_00425 CDS open 466069-466923 _na     284_aa ttfA trehalose monomycolate transport factor TtfA
480 KK339370.1 GCA000667805_00426 CDS open 467064-469610 _na     848_aa clpB ATP-dependent chaperone ClpB
481 KK339370.1 GCA000667805_00427 CDS open 469638-470915 _na     425_aa nitric oxide dioxygenase
482 KK339370.1 GCA000667805_00428 CDS open 471019-474276 _na     1085_aa luxR Transcriptional regulator%2C LuxR family
483 KK339370.1 GCA000667805_00429 CDS open 474280-475611 _na     443_aa PPE family protein
484 KK339370.1 GCA000667805_00430 CDS open 475945-477204 _na     419_aa purT phosphoribosylglycinamide formyltransferase 2
485 KK339370.1 GCA000667805_00431 CDS open 477243-477623 _na     126_aa Rhodanese domain-containing protein
486 KK339370.1 GCA000667805_00432 CDS open 477620-478840 _na     406_aa metZ O-succinylhomoserine sulfhydrylase
487 KK339370.1 GCA000667805_00433 CDS open 478837-480249 _na     470_aa ndhA Type II NADH:quinone oxidoreductase NdhA
488 KK339370.1 GCA000667805_00434 CDS open 480524-480715 _na     63_aa 13E12 repeat family protein
489 KK339370.1 GCA000667805_00435 CDS open 480730-481716 _na     328_aa 13E12 repeat family protein
490 KK339370.1 GCA000667805_00436 CDS open 481732-482451 _na     239_aa hyaluronidase/chondrosulfatase
491 KK339370.1 GCA000667805_00437 CDS open 482550-482954 _na     134_aa hypothetical protein
492 KK339370.1 GCA000667805_00438 CDS open 482936-483352 _na     138_aa Phospholipase D-like domain-containing protein
493 KK339370.1 GCA000667805_00439 CDS open 483426-483794 _na     122_aa Conserved 13E12 repeat family protein
494 KK339370.1 GCA000667805_00440 CDS open 484289-484930 _na     213_aa putative secreted protein
495 KK339370.1 GCA000667805_00441 CDS open 484937-486166 _na     409_aa lpqK putative conserved lipoprotein LpqK
496 KK339370.1 GCA000667805_00442 CDS open 486176-487363 _na     395_aa Glutaryl-CoA dehydrogenase
497 KK339370.1 GCA000667805_00443 CDS open 487399-487770 _na     123_aa Transmembrane protein
498 KK339370.1 GCA000667805_00444 CDS open 487965-490841 _na     958_aa mmpL1 RND transporter MmpL1
499 KK339370.1 GCA000667805_00445 CDS open 490838-491266 _na     142_aa mmpS1 putative transport accessory protein MmpS1
500 KK339370.1 GCA000667805_00446 CDS open 492139-493344 _na     401_aa fadD30 putative long-chain-fatty-acid--AMP ligase FadD30