BAKTAGenome Explorer: Actinomyces israelii (GCA_000711965.1)
Select a Genome:
|
BAKTA Annotations for GCA_000711965.1
|
Search & Sort all 6745 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | JONS01000020.1 | GCA000711965_01989 | CDS | open | 37855-38508 | _na 217_aa | HAD-IA family hydrolase | |
| 3502 | JONS01000020.1 | GCA000711965_01990 | CDS | open | 38576-39583 | _na 335_aa | lacI | LacI family DNA-binding transcriptional regulator |
| 3503 | JONS01000020.1 | GCA000711965_01991 | CDS | open | 39801-41120 | _na 439_aa | anaerobic C4-dicarboxylate transporter family protein | |
| 3504 | JONS01000020.1 | GCA000711965_01992 | CDS | open | 41289-42233 | _na 314_aa | Dihydrodipicolinate synthetase family protein | |
| 3505 | JONS01000020.1 | GCA000711965_01993 | CDS | open | 42480-43148 | _na 222_aa | thiamine phosphate synthase | |
| 3506 | JONS01000020.1 | GCA000711965_01994 | CDS | open | 43145-43924 | _na 259_aa | thiM | hydroxyethylthiazole kinase |
| 3507 | JONS01000020.1 | GCA000711965_01995 | CDS | open | 43921-45360 | _na 479_aa | MFS transporter | |
| 3508 | JONS01000020.1 | GCA000711965_01996 | CDS | open | 45357-46934 | _na 525_aa | bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase | |
| 3509 | JONS01000020.1 | GCA000711965_01997 | CDS | open | 47092-48420 | _na 442_aa | M18 family aminopeptidase | |
| 3510 | JONS01000020.1 | GCA000711965_01998 | CDS | open | 48551-49636 | _na 361_aa | oxidoreductase | |
| 3511 | JONS01000020.1 | GCA000711965_01999 | CDS | open | 49822-50766 | _na 314_aa | patatin family protein | |
| 3512 | JONS01000020.1 | GCA000711965_02000 | CDS | open | 50846-51364 | _na 172_aa | NUDIX domain-containing protein | |
| 3513 | JONS01000020.1 | GCA000711965_02001 | CDS | open | 51407-52486 | _na 359_aa | DegT/DnrJ/EryC1/StrS family aminotransferase | |
| 3514 | JONS01000020.1 | GCA000711965_02002 | CDS | open | 52555-53574 | _na 339_aa | alpha/beta fold hydrolase | |
| 3515 | JONS01000020.1 | GCA000711965_02003 | CDS | open | 53630-54256 | _na 208_aa | bioY | biotin transporter BioY |
| 3516 | JONS01000020.1 | GCA000711965_02004 | CDS | open | 54396-55415 | _na 339_aa | bile acid:sodium symporter family protein | |
| 3517 | JONS01000020.1 | GCA000711965_02005 | CDS | open | 55478-56560 | _na 360_aa | msnO8 | MsnO8 family LLM class oxidoreductase |
| 3518 | JONS01000020.1 | GCA000711965_02006 | CDS | open | 56725-58365 | _na 546_aa | ABC transporter substrate-binding protein | |
| 3519 | JONS01000020.1 | GCA000711965_02007 | CDS | open | 58438-59367 | _na 309_aa | dppB | Dipeptide ABC superfamily ATP binding cassette transporter%2C membrane protein DppB |
| 3520 | JONS01000020.1 | GCA000711965_02008 | CDS | open | 59360-60361 | _na 333_aa | ABC transporter permease | |
| 3521 | JONS01000020.1 | GCA000711965_02009 | CDS | open | 60358-62199 | _na 613_aa | nikD | nickel import ATP-binding protein NikD |
| 3522 | JONS01000020.1 | GCA000711965_02010 | CDS | open | 62444-63403 | _na 319_aa | ABC transporter permease | |
| 3523 | JONS01000020.1 | GCA000711965_02011 | CDS | open | 63406-64425 | _na 339_aa | ABC transporter permease | |
| 3524 | JONS01000020.1 | GCA000711965_02012 | CDS | open | 64422-66590 | _na 722_aa | oppF | murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF |
| 3525 | JONS01000020.1 | GCA000711965_02013 | CDS | open | 66825-68498 | _na 557_aa | ABC transporter family substrate-binding protein | |
| 3526 | JONS01000020.1 | GCA000711965_02014 | CDS | open | 68701-69513 | _na 270_aa | PH domain-containing protein | |
| 3527 | JONS01000020.1 | GCA000711965_02015 | CDS | open | 69665-71587 | _na 640_aa | typA | translational GTPase TypA |
| 3528 | JONS01000020.1 | GCA000711965_01950 | gene | open | 395-571 | |||
| 3529 | JONS01000020.1 | GCA000711965_01951 | gene | open | 586-900 | |||
| 3530 | JONS01000020.1 | GCA000711965_01952 | gene | open | 1068-1295 | |||
| 3531 | JONS01000020.1 | GCA000711965_01953 | gene | open | 1312-1755 | |||
| 3532 | JONS01000020.1 | GCA000711965_01954 | gene | open | 1906-2208 | |||
| 3533 | JONS01000020.1 | GCA000711965_01955 | gene | open | 2254-3630 | |||
| 3534 | JONS01000020.1 | GCA000711965_01956 | gene | open | 3942-4415 | |||
| 3535 | JONS01000020.1 | GCA000711965_01957 | gene | open | 4412-4933 | |||
| 3536 | JONS01000020.1 | GCA000711965_01958 | gene | open | 5228-5389 | |||
| 3537 | JONS01000020.1 | GCA000711965_01959 | gene | open | 5642-6586 | |||
| 3538 | JONS01000020.1 | GCA000711965_01960 | gene | open | 6624-7376 | |||
| 3539 | JONS01000020.1 | GCA000711965_01961 | gene | open | 7373-8332 | |||
| 3540 | JONS01000020.1 | GCA000711965_01962 | gene | open | 8332-9264 | |||
| 3541 | JONS01000020.1 | GCA000711965_01963 | gene | open | 9509-10729 | |||
| 3542 | JONS01000020.1 | GCA000711965_01964 | gene | open | 11105-11554 | |||
| 3543 | JONS01000020.1 | GCA000711965_01965 | gene | open | 11761-12183 | vapC | ||
| 3544 | JONS01000020.1 | GCA000711965_01966 | gene | open | 12187-12462 | |||
| 3545 | JONS01000020.1 | GCA000711965_01967 | gene | open | 12521-13075 | |||
| 3546 | JONS01000020.1 | GCA000711965_01968 | gene | open | 13671-14111 | |||
| 3547 | JONS01000020.1 | GCA000711965_01969 | gene | open | 14180-14806 | |||
| 3548 | JONS01000020.1 | GCA000711965_01970 | gene | open | 14921-15613 | |||
| 3549 | JONS01000020.1 | GCA000711965_01971 | gene | open | 15761-17368 | |||
| 3550 | JONS01000020.1 | GCA000711965_01972 | gene | open | 17886-18707 | |||
| 3551 | JONS01000020.1 | GCA000711965_01973 | gene | open | 19018-19245 | |||
| 3552 | JONS01000020.1 | GCA000711965_01974 | gene | open | 19242-19637 | vapC | ||
| 3553 | JONS01000020.1 | GCA000711965_01975 | gene | open | 19836-20561 | |||
| 3554 | JONS01000020.1 | GCA000711965_01976 | gene | open | 20624-22270 | |||
| 3555 | JONS01000020.1 | GCA000711965_01977 | gene | open | 22673-23188 | lpqH | ||
| 3556 | JONS01000020.1 | GCA000711965_01978 | gene | open | 24248-25495 | |||
| 3557 | JONS01000020.1 | GCA000711965_01979 | gene | open | 25623-25862 | |||
| 3558 | JONS01000020.1 | GCA000711965_01980 | gene | open | 26660-27715 | |||
| 3559 | JONS01000020.1 | GCA000711965_01981 | gene | open | 27770-28837 | |||
| 3560 | JONS01000020.1 | GCA000711965_01982 | gene | open | 28819-29844 | |||
| 3561 | JONS01000020.1 | GCA000711965_01983 | gene | open | 30523-32373 | |||
| 3562 | JONS01000020.1 | GCA000711965_01984 | gene | open | 33318-34265 | |||
| 3563 | JONS01000020.1 | GCA000711965_01985 | gene | open | 34274-34918 | |||
| 3564 | JONS01000020.1 | GCA000711965_01986 | gene | open | 34953-36143 | |||
| 3565 | JONS01000020.1 | GCA000711965_01987 | gene | open | 36284-37030 | |||
| 3566 | JONS01000020.1 | GCA000711965_01988 | gene | open | 37079-37642 | gtrA | ||
| 3567 | JONS01000020.1 | GCA000711965_01989 | gene | open | 37855-38508 | |||
| 3568 | JONS01000020.1 | GCA000711965_01990 | gene | open | 38576-39583 | lacI | ||
| 3569 | JONS01000020.1 | GCA000711965_01991 | gene | open | 39801-41120 | |||
| 3570 | JONS01000020.1 | GCA000711965_01992 | gene | open | 41289-42233 | |||
| 3571 | JONS01000020.1 | GCA000711965_01993 | gene | open | 42480-43148 | |||
| 3572 | JONS01000020.1 | GCA000711965_01994 | gene | open | 43145-43924 | thiM | ||
| 3573 | JONS01000020.1 | GCA000711965_01995 | gene | open | 43921-45360 | |||
| 3574 | JONS01000020.1 | GCA000711965_01996 | gene | open | 45357-46934 | |||
| 3575 | JONS01000020.1 | GCA000711965_01997 | gene | open | 47092-48420 | |||
| 3576 | JONS01000020.1 | GCA000711965_01998 | gene | open | 48551-49636 | |||
| 3577 | JONS01000020.1 | GCA000711965_01999 | gene | open | 49822-50766 | |||
| 3578 | JONS01000020.1 | GCA000711965_02000 | gene | open | 50846-51364 | |||
| 3579 | JONS01000020.1 | GCA000711965_02001 | gene | open | 51407-52486 | |||
| 3580 | JONS01000020.1 | GCA000711965_02002 | gene | open | 52555-53574 | |||
| 3581 | JONS01000020.1 | GCA000711965_02003 | gene | open | 53630-54256 | bioY | ||
| 3582 | JONS01000020.1 | GCA000711965_02004 | gene | open | 54396-55415 | |||
| 3583 | JONS01000020.1 | GCA000711965_02005 | gene | open | 55478-56560 | msnO8 | ||
| 3584 | JONS01000020.1 | GCA000711965_02006 | gene | open | 56725-58365 | |||
| 3585 | JONS01000020.1 | GCA000711965_02007 | gene | open | 58438-59367 | dppB | ||
| 3586 | JONS01000020.1 | GCA000711965_02008 | gene | open | 59360-60361 | |||
| 3587 | JONS01000020.1 | GCA000711965_02009 | gene | open | 60358-62199 | nikD | ||
| 3588 | JONS01000020.1 | GCA000711965_02010 | gene | open | 62444-63403 | |||
| 3589 | JONS01000020.1 | GCA000711965_02011 | gene | open | 63406-64425 | |||
| 3590 | JONS01000020.1 | GCA000711965_02012 | gene | open | 64422-66590 | oppF | ||
| 3591 | JONS01000020.1 | GCA000711965_02013 | gene | open | 66825-68498 | |||
| 3592 | JONS01000020.1 | GCA000711965_02014 | gene | open | 68701-69513 | |||
| 3593 | JONS01000020.1 | GCA000711965_02015 | gene | open | 69665-71587 | typA | ||
| 3594 | JONS01000021.1 | GCA000711965_02016 | CDS | open | 271-555 | _na 94_aa | nucleoside transporter C-terminal domain-containing protein | |
| 3595 | JONS01000021.1 | GCA000711965_02017 | CDS | open | 582-1535 | _na 317_aa | nucleoside hydrolase | |
| 3596 | JONS01000021.1 | GCA000711965_02018 | CDS | open | 1699-1860 | _na 53_aa | hypothetical protein | |
| 3597 | JONS01000021.1 | GCA000711965_02019 | CDS | open | 2096-3937 | _na 613_aa | CocE/NonD family hydrolase | |
| 3598 | JONS01000021.1 | GCA000711965_02020 | CDS | open | 4056-5405 | _na 449_aa | alpha-L-rhamnosidase C-terminal domain-containing protein | |
| 3599 | JONS01000021.1 | GCA000711965_02021 | CDS | open | 5502-7091 | _na 529_aa | family 78 glycoside hydrolase catalytic domain | |
| 3600 | JONS01000021.1 | GCA000711965_02022 | CDS | open | 7347-7535 | _na 62_aa | hypothetical protein | |
| 3601 | JONS01000021.1 | GCA000711965_02023 | CDS | open | 7739-14383 | _na 2214_aa | DUF4011 domain-containing protein | |
| 3602 | JONS01000021.1 | GCA000711965_02024 | CDS | open | 15496-15684 | _na 62_aa | hypothetical protein | |
| 3603 | JONS01000021.1 | GCA000711965_02025 | CDS | open | 15715-16092 | _na 125_aa | hypothetical protein | |
| 3604 | JONS01000021.1 | GCA000711965_02026 | CDS | open | 16266-16403 | _na 45_aa | hypothetical protein | |
| 3605 | JONS01000021.1 | GCA000711965_02027 | CDS | open | 16412-17206 | _na 264_aa | ABC-2 family transporter protein | |
| 3606 | JONS01000021.1 | GCA000711965_02028 | CDS | open | 17206-17976 | _na 256_aa | ABC transporter permease | |
| 3607 | JONS01000021.1 | GCA000711965_02029 | CDS | open | 18248-18385 | _na 45_aa | hypothetical protein | |
| 3608 | JONS01000021.1 | GCA000711965_02030 | CDS | open | 18670-21663 | _na 997_aa | alpha-L-rhamnosidase | |
| 3609 | JONS01000021.1 | GCA000711965_02031 | CDS | open | 22002-22718 | _na 238_aa | TetR/AcrR family transcriptional regulator | |
| 3610 | JONS01000021.1 | GCA000711965_02032 | CDS | open | 22927-24318 | _na 463_aa | MFS transporter | |
| 3611 | JONS01000021.1 | GCA000711965_02033 | CDS | open | 24463-25731 | _na 422_aa | family 1 glycosylhydrolase | |
| 3612 | JONS01000021.1 | GCA000711965_02034 | CDS | open | 26010-26111 | _na 33_aa | hypothetical protein | |
| 3613 | JONS01000021.1 | GCA000711965_02035 | CDS | open | 26645-29716 | _na 1023_aa | family 78 glycoside hydrolase catalytic domain | |
| 3614 | JONS01000021.1 | GCA000711965_02036 | CDS | open | 29775-30602 | _na 275_aa | class II aldolase/adducin family protein | |
| 3615 | JONS01000021.1 | GCA000711965_02037 | CDS | open | 30664-31830 | _na 388_aa | alpha/beta hydrolase | |
| 3616 | JONS01000021.1 | GCA000711965_02038 | CDS | open | 31876-33399 | _na 507_aa | Rhamnulokinase | |
| 3617 | JONS01000021.1 | GCA000711965_02039 | CDS | open | 33475-34659 | _na 394_aa | rhaI | L-rhamnose isomerase |
| 3618 | JONS01000021.1 | GCA000711965_02040 | CDS | open | 35231-36562 | _na 443_aa | MFS transporter | |
| 3619 | JONS01000021.1 | GCA000711965_02041 | CDS | open | 36891-37943 | _na 350_aa | lacI | LacI family DNA-binding transcriptional regulator |
| 3620 | JONS01000021.1 | GCA000711965_02042 | CDS | open | 38001-38978 | _na 325_aa | hypothetical protein | |
| 3621 | JONS01000021.1 | GCA000711965_02043 | CDS | open | 39200-39628 | _na 142_aa | hypothetical protein | |
| 3622 | JONS01000021.1 | GCA000711965_02044 | CDS | open | 40131-40277 | _na 48_aa | hypothetical protein | |
| 3623 | JONS01000021.1 | GCA000711965_02045 | CDS | open | 40475-40804 | _na 109_aa | heavy metal-binding domain-containing protein | |
| 3624 | JONS01000021.1 | GCA000711965_02046 | CDS | open | 41430-41732 | _na 100_aa | hypothetical protein | |
| 3625 | JONS01000021.1 | GCA000711965_02047 | CDS | open | 41811-42497 | _na 228_aa | SprT-like domain-containing protein | |
| 3626 | JONS01000021.1 | GCA000711965_02048 | CDS | open | 42519-43682 | _na 387_aa | Hemagglutinin | |
| 3627 | JONS01000021.1 | GCA000711965_02049 | CDS | open | 43814-45340 | _na 508_aa | cls | cardiolipin synthase |
| 3628 | JONS01000021.1 | GCA000711965_02050 | CDS | open | 45451-46830 | _na 459_aa | serpin family protein | |
| 3629 | JONS01000021.1 | GCA000711965_02051 | CDS | open | 46969-48207 | _na 412_aa | glycosyltransferase | |
| 3630 | JONS01000021.1 | GCA000711965_02052 | CDS | open | 48283-49632 | _na 449_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 3631 | JONS01000021.1 | GCA000711965_02053 | CDS | open | 50297-51634 | _na 445_aa | Fic family protein | |
| 3632 | JONS01000021.1 | GCA000711965_02054 | CDS | open | 52565-52786 | _na 73_aa | hypothetical protein | |
| 3633 | JONS01000021.1 | GCA000711965_02055 | CDS | open | 52937-53065 | _na 42_aa | hypothetical protein | |
| 3634 | JONS01000021.1 | GCA000711965_02056 | CDS | open | 53123-53248 | _na 41_aa | hypothetical protein | |
| 3635 | JONS01000021.1 | GCA000711965_02057 | CDS | open | 53307-58937 | _na 1876_aa | hrpA | ATP-dependent RNA helicase HrpA |
| 3636 | JONS01000021.1 | GCA000711965_02058 | CDS | open | 59433-60863 | _na 476_aa | FAD-dependent oxidoreductase | |
| 3637 | JONS01000021.1 | GCA000711965_02059 | CDS | open | 60851-61510 | _na 219_aa | hypothetical protein | |
| 3638 | JONS01000021.1 | GCA000711965_02060 | CDS | open | 61510-63654 | _na 714_aa | hydantoinase/oxoprolinase family protein | |
| 3639 | JONS01000021.1 | GCA000711965_02061 | CDS | open | 63767-65068 | _na 433_aa | C4-dicarboxylate ABC transporter | |
| 3640 | JONS01000021.1 | GCA000711965_02062 | CDS | open | 65114-65809 | _na 231_aa | hypothetical protein | |
| 3641 | JONS01000021.1 | GCA000711965_02063 | CDS | open | 65881-66873 | _na 330_aa | hypothetical protein | |
| 3642 | JONS01000021.1 | GCA000711965_02064 | CDS | open | 66977-67756 | _na 259_aa | potassium channel family protein | |
| 3643 | JONS01000021.1 | GCA000711965_02065 | CDS | open | 68306-68644 | _na 112_aa | hypothetical protein | |
| 3644 | JONS01000021.1 | GCA000711965_02016 | gene | open | 271-555 | |||
| 3645 | JONS01000021.1 | GCA000711965_02017 | gene | open | 582-1535 | |||
| 3646 | JONS01000021.1 | GCA000711965_02018 | gene | open | 1699-1860 | |||
| 3647 | JONS01000021.1 | GCA000711965_02019 | gene | open | 2096-3937 | |||
| 3648 | JONS01000021.1 | GCA000711965_02020 | gene | open | 4056-5405 | |||
| 3649 | JONS01000021.1 | GCA000711965_02021 | gene | open | 5502-7091 | |||
| 3650 | JONS01000021.1 | GCA000711965_02022 | gene | open | 7347-7535 | |||
| 3651 | JONS01000021.1 | GCA000711965_02023 | gene | open | 7739-14383 | |||
| 3652 | JONS01000021.1 | GCA000711965_02024 | gene | open | 15496-15684 | |||
| 3653 | JONS01000021.1 | GCA000711965_02025 | gene | open | 15715-16092 | |||
| 3654 | JONS01000021.1 | GCA000711965_02026 | gene | open | 16266-16403 | |||
| 3655 | JONS01000021.1 | GCA000711965_02027 | gene | open | 16412-17206 | |||
| 3656 | JONS01000021.1 | GCA000711965_02028 | gene | open | 17206-17976 | |||
| 3657 | JONS01000021.1 | GCA000711965_02029 | gene | open | 18248-18385 | |||
| 3658 | JONS01000021.1 | GCA000711965_02030 | gene | open | 18670-21663 | |||
| 3659 | JONS01000021.1 | GCA000711965_02031 | gene | open | 22002-22718 | |||
| 3660 | JONS01000021.1 | GCA000711965_02032 | gene | open | 22927-24318 | |||
| 3661 | JONS01000021.1 | GCA000711965_02033 | gene | open | 24463-25731 | |||
| 3662 | JONS01000021.1 | GCA000711965_02034 | gene | open | 26010-26111 | |||
| 3663 | JONS01000021.1 | GCA000711965_02035 | gene | open | 26645-29716 | |||
| 3664 | JONS01000021.1 | GCA000711965_02036 | gene | open | 29775-30602 | |||
| 3665 | JONS01000021.1 | GCA000711965_02037 | gene | open | 30664-31830 | |||
| 3666 | JONS01000021.1 | GCA000711965_02038 | gene | open | 31876-33399 | |||
| 3667 | JONS01000021.1 | GCA000711965_02039 | gene | open | 33475-34659 | rhaI | ||
| 3668 | JONS01000021.1 | GCA000711965_02040 | gene | open | 35231-36562 | |||
| 3669 | JONS01000021.1 | GCA000711965_02041 | gene | open | 36891-37943 | lacI | ||
| 3670 | JONS01000021.1 | GCA000711965_02042 | gene | open | 38001-38978 | |||
| 3671 | JONS01000021.1 | GCA000711965_02043 | gene | open | 39200-39628 | |||
| 3672 | JONS01000021.1 | GCA000711965_02044 | gene | open | 40131-40277 | |||
| 3673 | JONS01000021.1 | GCA000711965_02045 | gene | open | 40475-40804 | |||
| 3674 | JONS01000021.1 | GCA000711965_02046 | gene | open | 41430-41732 | |||
| 3675 | JONS01000021.1 | GCA000711965_02047 | gene | open | 41811-42497 | |||
| 3676 | JONS01000021.1 | GCA000711965_02048 | gene | open | 42519-43682 | |||
| 3677 | JONS01000021.1 | GCA000711965_02049 | gene | open | 43814-45340 | cls | ||
| 3678 | JONS01000021.1 | GCA000711965_02050 | gene | open | 45451-46830 | |||
| 3679 | JONS01000021.1 | GCA000711965_02051 | gene | open | 46969-48207 | |||
| 3680 | JONS01000021.1 | GCA000711965_02052 | gene | open | 48283-49632 | |||
| 3681 | JONS01000021.1 | GCA000711965_02053 | gene | open | 50297-51634 | |||
| 3682 | JONS01000021.1 | GCA000711965_02054 | gene | open | 52565-52786 | |||
| 3683 | JONS01000021.1 | GCA000711965_02055 | gene | open | 52937-53065 | |||
| 3684 | JONS01000021.1 | GCA000711965_02056 | gene | open | 53123-53248 | |||
| 3685 | JONS01000021.1 | GCA000711965_02057 | gene | open | 53307-58937 | hrpA | ||
| 3686 | JONS01000021.1 | GCA000711965_02058 | gene | open | 59433-60863 | |||
| 3687 | JONS01000021.1 | GCA000711965_02059 | gene | open | 60851-61510 | |||
| 3688 | JONS01000021.1 | GCA000711965_02060 | gene | open | 61510-63654 | |||
| 3689 | JONS01000021.1 | GCA000711965_02061 | gene | open | 63767-65068 | |||
| 3690 | JONS01000021.1 | GCA000711965_02062 | gene | open | 65114-65809 | |||
| 3691 | JONS01000021.1 | GCA000711965_02063 | gene | open | 65881-66873 | |||
| 3692 | JONS01000021.1 | GCA000711965_02064 | gene | open | 66977-67756 | |||
| 3693 | JONS01000021.1 | GCA000711965_02065 | gene | open | 68306-68644 | |||
| 3694 | JONS01000022.1 | repeat_region | open | 11319-11497 | CRISPR array with 3 repeats of length 30%2C consensus sequence CGGCGCGCCCCTGCGCGCCCGGCCGGGCCC and spacer length 31 | |||
| 3695 | JONS01000022.1 | GCA000711965_02066 | CDS | open | 711-1646 | _na 311_aa | HAD family phosphatase | |
| 3696 | JONS01000022.1 | GCA000711965_02067 | CDS | open | 2612-4027 | _na 471_aa | cellulose synthase operon protein YhjQ/BcsQ | |
| 3697 | JONS01000022.1 | GCA000711965_02068 | CDS | open | 4141-5337 | _na 398_aa | tadA | TadA family conjugal transfer-associated ATPase |
| 3698 | JONS01000022.1 | GCA000711965_02069 | CDS | open | 5337-6545 | _na 402_aa | gspF | Type II secretion system protein GspF domain-containing protein |
| 3699 | JONS01000022.1 | GCA000711965_02070 | CDS | open | 7573-9054 | _na 493_aa | DHA2 family efflux MFS transporter permease subunit | |
| 3700 | JONS01000022.1 | GCA000711965_02071 | CDS | open | 9298-9816 | _na 172_aa | PH domain-containing protein | |
| 3701 | JONS01000022.1 | GCA000711965_02072 | CDS | open | 9868-10398 | _na 176_aa | carboxymuconolactone decarboxylase family protein | |
| 3702 | JONS01000022.1 | GCA000711965_02073 | CDS | open | 10509-11090 | _na 193_aa | peroxiredoxin | |
| 3703 | JONS01000022.1 | GCA000711965_02074 | CDS | open | 11539-11856 | _na 105_aa | hypothetical protein | |
| 3704 | JONS01000022.1 | GCA000711965_02075 | CDS | open | 11924-13588 | _na 554_aa | class I SAM-dependent methyltransferase | |
| 3705 | JONS01000022.1 | GCA000711965_02076 | CDS | open | 13798-14751 | _na 317_aa | phosphatase PAP2 family protein | |
| 3706 | JONS01000022.1 | GCA000711965_02077 | CDS | open | 14839-16698 | _na 619_aa | walK | cell wall metabolism sensor histidine kinase WalK |
| 3707 | JONS01000022.1 | GCA000711965_02078 | CDS | open | 16717-17460 | _na 247_aa | DNA-binding response regulator | |
| 3708 | JONS01000022.1 | GCA000711965_02079 | CDS | open | 17737-19122 | _na 461_aa | PAS domain-containing protein | |
| 3709 | JONS01000022.1 | GCA000711965_02080 | CDS | open | 19153-20472 | _na 439_aa | diguanylate cyclase | |
| 3710 | JONS01000022.1 | GCA000711965_02081 | CDS | open | 20692-23703 | _na 1003_aa | topA | type I DNA topoisomerase |
| 3711 | JONS01000022.1 | GCA000711965_02082 | CDS | open | 23884-24474 | _na 196_aa | DUF3060 domain-containing protein | |
| 3712 | JONS01000022.1 | GCA000711965_02083 | CDS | open | 24503-25246 | _na 247_aa | phoP | Putative alkaline phosphatase synthesis transcriptional regulatory protein PhoP |
| 3713 | JONS01000022.1 | GCA000711965_02084 | CDS | open | 25243-26223 | _na 326_aa | kdpD | sensor histidine kinase KdpD |
| 3714 | JONS01000022.1 | GCA000711965_02085 | CDS | open | 26260-28155 | _na 631_aa | alpha/beta hydrolase | |
| 3715 | JONS01000022.1 | GCA000711965_02086 | CDS | open | 28265-29533 | _na 422_aa | ompA | OmpA family protein |
| 3716 | JONS01000022.1 | GCA000711965_02087 | CDS | open | 29669-30400 | _na 243_aa | PF11259 family protein | |
| 3717 | JONS01000022.1 | GCA000711965_02088 | CDS | open | 30719-31462 | _na 247_aa | hypothetical protein | |
| 3718 | JONS01000022.1 | GCA000711965_02089 | CDS | open | 31590-32471 | _na 293_aa | CHAP domain-containing protein | |
| 3719 | JONS01000022.1 | GCA000711965_02090 | CDS | open | 32632-33519 | _na 295_aa | tmk | dTMP kinase |
| 3720 | JONS01000022.1 | GCA000711965_02091 | CDS | open | 33516-34835 | _na 439_aa | DNA polymerase III subunit delta' | |
| 3721 | JONS01000022.1 | GCA000711965_02092 | CDS | open | 35123-35554 | _na 143_aa | hypothetical protein | |
| 3722 | JONS01000022.1 | GCA000711965_02093 | CDS | open | 35434-36393 | _na 319_aa | helix-turn-helix domain-containing protein | |
| 3723 | JONS01000022.1 | GCA000711965_02094 | CDS | open | 36644-38269 | _na 541_aa | alpha/beta hydrolase | |
| 3724 | JONS01000022.1 | GCA000711965_02095 | CDS | open | 38387-39538 | _na 383_aa | asparaginase | |
| 3725 | JONS01000022.1 | GCA000711965_02097 | CDS | open | 40267-40593 | _na 108_aa | Lsr2 family protein | |
| 3726 | JONS01000022.1 | GCA000711965_02098 | CDS | open | 40764-41501 | _na 245_aa | gpmA | phosphoglyceromutase |
| 3727 | JONS01000022.1 | GCA000711965_02099 | CDS | open | 41669-42313 | _na 214_aa | phoU | phosphate signaling complex protein PhoU |
| 3728 | JONS01000022.1 | GCA000711965_02100 | CDS | open | 42489-43841 | _na 450_aa | ATP-binding protein | |
| 3729 | JONS01000022.1 | GCA000711965_02101 | CDS | open | 43838-44551 | _na 237_aa | response regulator transcription factor | |
| 3730 | JONS01000022.1 | GCA000711965_02102 | CDS | open | 44721-45215 | _na 164_aa | cdnL | CarD-like/TRCF RNAP-interacting domain-containing protein |
| 3731 | JONS01000022.1 | GCA000711965_02103 | CDS | open | 45225-46211 | _na 328_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 3732 | JONS01000022.1 | GCA000711965_02104 | CDS | open | 46330-47823 | _na 497_aa | MFS transporter | |
| 3733 | JONS01000022.1 | GCA000711965_02105 | CDS | open | 47980-48393 | _na 137_aa | DUF2218 domain-containing protein | |
| 3734 | JONS01000022.1 | GCA000711965_02106 | CDS | open | 48492-48887 | _na 131_aa | VOC family protein | |
| 3735 | JONS01000022.1 | GCA000711965_02107 | CDS | open | 49194-51437 | _na 747_aa | MMPL family transporter | |
| 3736 | JONS01000022.1 | GCA000711965_02108 | CDS | open | 51573-52835 | _na 420_aa | glycosyltransferase | |
| 3737 | JONS01000022.1 | GCA000711965_02109 | CDS | open | 53131-53478 | _na 115_aa | gntR | GntR family transcriptional regulator |
| 3738 | JONS01000022.1 | GCA000711965_02110 | CDS | open | 53454-54449 | _na 331_aa | ABC transporter ATP-binding protein | |
| 3739 | JONS01000022.1 | GCA000711965_02111 | CDS | open | 54451-55104 | _na 217_aa | ABC-2 transporter permease | |
| 3740 | JONS01000022.1 | GCA000711965_02112 | CDS | open | 55154-58681 | _na 1175_aa | ABC transporter ATP-binding protein/permease | |
| 3741 | JONS01000022.1 | GCA000711965_02113 | CDS | open | 59097-60464 | _na 455_aa | hypothetical protein | |
| 3742 | JONS01000022.1 | GCA000711965_02114 | CDS | open | 60583-62190 | _na 535_aa | DUF1593 domain-containing protein | |
| 3743 | JONS01000022.1 | GCA000711965_02115 | CDS | open | 62328-63239 | _na 303_aa | ribokinase | |
| 3744 | JONS01000022.1 | GCA000711965_02116 | CDS | open | 63634-64653 | _na 339_aa | lacI | LacI family DNA-binding transcriptional regulator |
| 3745 | JONS01000022.1 | GCA000711965_02117 | CDS | open | 65602-66552 | _na 316_aa | nucleoside hydrolase | |
| 3746 | JONS01000022.1 | GCA000711965_02118 | CDS | open | 67025-67846 | _na 273_aa | hypothetical protein | |
| 3747 | JONS01000022.1 | GCA000711965_02119 | CDS | open | 67818-68150 | _na 110_aa | transposase | |
| 3748 | JONS01000022.1 | GCA000711965_02066 | gene | open | 711-1646 | |||
| 3749 | JONS01000022.1 | GCA000711965_02067 | gene | open | 2612-4027 | |||
| 3750 | JONS01000022.1 | GCA000711965_02068 | gene | open | 4141-5337 | tadA | ||
| 3751 | JONS01000022.1 | GCA000711965_02069 | gene | open | 5337-6545 | gspF | ||
| 3752 | JONS01000022.1 | GCA000711965_02070 | gene | open | 7573-9054 | |||
| 3753 | JONS01000022.1 | GCA000711965_02071 | gene | open | 9298-9816 | |||
| 3754 | JONS01000022.1 | GCA000711965_02072 | gene | open | 9868-10398 | |||
| 3755 | JONS01000022.1 | GCA000711965_02073 | gene | open | 10509-11090 | |||
| 3756 | JONS01000022.1 | GCA000711965_02074 | gene | open | 11539-11856 | |||
| 3757 | JONS01000022.1 | GCA000711965_02075 | gene | open | 11924-13588 | |||
| 3758 | JONS01000022.1 | GCA000711965_02076 | gene | open | 13798-14751 | |||
| 3759 | JONS01000022.1 | GCA000711965_02077 | gene | open | 14839-16698 | walK | ||
| 3760 | JONS01000022.1 | GCA000711965_02078 | gene | open | 16717-17460 | |||
| 3761 | JONS01000022.1 | GCA000711965_02079 | gene | open | 17737-19122 | |||
| 3762 | JONS01000022.1 | GCA000711965_02080 | gene | open | 19153-20472 | |||
| 3763 | JONS01000022.1 | GCA000711965_02081 | gene | open | 20692-23703 | topA | ||
| 3764 | JONS01000022.1 | GCA000711965_02082 | gene | open | 23884-24474 | |||
| 3765 | JONS01000022.1 | GCA000711965_02083 | gene | open | 24503-25246 | phoP | ||
| 3766 | JONS01000022.1 | GCA000711965_02084 | gene | open | 25243-26223 | kdpD | ||
| 3767 | JONS01000022.1 | GCA000711965_02085 | gene | open | 26260-28155 | |||
| 3768 | JONS01000022.1 | GCA000711965_02086 | gene | open | 28265-29533 | ompA | ||
| 3769 | JONS01000022.1 | GCA000711965_02087 | gene | open | 29669-30400 | |||
| 3770 | JONS01000022.1 | GCA000711965_02088 | gene | open | 30719-31462 | |||
| 3771 | JONS01000022.1 | GCA000711965_02089 | gene | open | 31590-32471 | |||
| 3772 | JONS01000022.1 | GCA000711965_02090 | gene | open | 32632-33519 | tmk | ||
| 3773 | JONS01000022.1 | GCA000711965_02091 | gene | open | 33516-34835 | |||
| 3774 | JONS01000022.1 | GCA000711965_02092 | gene | open | 35123-35554 | |||
| 3775 | JONS01000022.1 | GCA000711965_02093 | gene | open | 35434-36393 | |||
| 3776 | JONS01000022.1 | GCA000711965_02094 | gene | open | 36644-38269 | |||
| 3777 | JONS01000022.1 | GCA000711965_02095 | gene | open | 38387-39538 | |||
| 3778 | JONS01000022.1 | GCA000711965_02097 | gene | open | 40267-40593 | |||
| 3779 | JONS01000022.1 | GCA000711965_02098 | gene | open | 40764-41501 | gpmA | ||
| 3780 | JONS01000022.1 | GCA000711965_02099 | gene | open | 41669-42313 | phoU | ||
| 3781 | JONS01000022.1 | GCA000711965_02100 | gene | open | 42489-43841 | |||
| 3782 | JONS01000022.1 | GCA000711965_02101 | gene | open | 43838-44551 | |||
| 3783 | JONS01000022.1 | GCA000711965_02102 | gene | open | 44721-45215 | cdnL | ||
| 3784 | JONS01000022.1 | GCA000711965_02103 | gene | open | 45225-46211 | |||
| 3785 | JONS01000022.1 | GCA000711965_02104 | gene | open | 46330-47823 | |||
| 3786 | JONS01000022.1 | GCA000711965_02105 | gene | open | 47980-48393 | |||
| 3787 | JONS01000022.1 | GCA000711965_02106 | gene | open | 48492-48887 | |||
| 3788 | JONS01000022.1 | GCA000711965_02107 | gene | open | 49194-51437 | |||
| 3789 | JONS01000022.1 | GCA000711965_02108 | gene | open | 51573-52835 | |||
| 3790 | JONS01000022.1 | GCA000711965_02109 | gene | open | 53131-53478 | gntR | ||
| 3791 | JONS01000022.1 | GCA000711965_02110 | gene | open | 53454-54449 | |||
| 3792 | JONS01000022.1 | GCA000711965_02111 | gene | open | 54451-55104 | |||
| 3793 | JONS01000022.1 | GCA000711965_02112 | gene | open | 55154-58681 | |||
| 3794 | JONS01000022.1 | GCA000711965_02113 | gene | open | 59097-60464 | |||
| 3795 | JONS01000022.1 | GCA000711965_02114 | gene | open | 60583-62190 | |||
| 3796 | JONS01000022.1 | GCA000711965_02115 | gene | open | 62328-63239 | |||
| 3797 | JONS01000022.1 | GCA000711965_02116 | gene | open | 63634-64653 | lacI | ||
| 3798 | JONS01000022.1 | GCA000711965_02117 | gene | open | 65602-66552 | |||
| 3799 | JONS01000022.1 | GCA000711965_02118 | gene | open | 67025-67846 | |||
| 3800 | JONS01000022.1 | GCA000711965_02119 | gene | open | 67818-68150 | |||
| 3801 | JONS01000022.1 | GCA000711965_02096 | gene | open | 39928-40000 | trnT | ||
| 3802 | JONS01000022.1 | GCA000711965_02096 | tRNA | open | 39928-40000 | trnT | tRNA-Thr(cgt) | |
| 3803 | JONS01000023.1 | GCA000711965_02120 | CDS | open | 216-824 | _na 202_aa | acyltransferase | |
| 3804 | JONS01000023.1 | GCA000711965_02121 | CDS | open | 950-1669 | _na 239_aa | glycosyltransferase family 2 protein | |
| 3805 | JONS01000023.1 | GCA000711965_02122 | CDS | open | 1694-2083 | _na 129_aa | DUF2304 domain-containing protein | |
| 3806 | JONS01000023.1 | GCA000711965_02123 | CDS | open | 2125-3381 | _na 418_aa | LCP family protein | |
| 3807 | JONS01000023.1 | GCA000711965_02124 | CDS | open | 3648-4898 | _na 416_aa | LCP family protein | |
| 3808 | JONS01000023.1 | GCA000711965_02125 | CDS | open | 5044-6033 | _na 329_aa | galE | UDP-glucose 4-epimerase GalE |
| 3809 | JONS01000023.1 | GCA000711965_02126 | CDS | open | 6220-6771 | _na 183_aa | CPBP family intramembrane glutamic endopeptidase | |
| 3810 | JONS01000023.1 | GCA000711965_02127 | CDS | open | 6881-7405 | _na 174_aa | 5-(carboxyamino)imidazole ribonucleotide mutase | |
| 3811 | JONS01000023.1 | GCA000711965_02128 | CDS | open | 7556-8863 | _na 435_aa | 5-(carboxyamino)imidazole ribonucleotide synthase | |
| 3812 | JONS01000023.1 | GCA000711965_02129 | CDS | open | 8970-10235 | _na 421_aa | Integral membrane protein | |
| 3813 | JONS01000023.1 | GCA000711965_02130 | CDS | open | 10294-10848 | _na 184_aa | gtrA | GtrA family protein |
| 3814 | JONS01000023.1 | GCA000711965_02131 | CDS | open | 10916-11701 | _na 261_aa | SNARE-like domain protein | |
| 3815 | JONS01000023.1 | GCA000711965_02132 | CDS | open | 11757-12836 | _na 359_aa | histidine kinase | |
| 3816 | JONS01000023.1 | GCA000711965_02133 | CDS | open | 12945-13613 | _na 222_aa | Response regulator | |
| 3817 | JONS01000023.1 | GCA000711965_02134 | CDS | open | 13690-14871 | _na 393_aa | Guanylate cyclase domain-containing protein | |
| 3818 | JONS01000023.1 | GCA000711965_02135 | CDS | open | 14926-15942 | _na 338_aa | biotin--[acetyl-CoA-carboxylase] ligase | |
| 3819 | JONS01000023.1 | GCA000711965_02136 | CDS | open | 16367-17005 | _na 212_aa | nucleoside triphosphate pyrophosphatase | |
| 3820 | JONS01000023.1 | GCA000711965_02137 | CDS | open | 17002-17550 | _na 182_aa | NUDIX domain-containing protein | |
| 3821 | JONS01000023.1 | GCA000711965_02138 | CDS | open | 17564-18121 | _na 185_aa | marR | MarR family winged helix-turn-helix transcriptional regulator |
| 3822 | JONS01000023.1 | GCA000711965_02139 | CDS | open | 18246-19064 | _na 272_aa | protein dehydratase | |
| 3823 | JONS01000023.1 | GCA000711965_02140 | CDS | open | 19096-19266 | _na 56_aa | rpmG | 50S ribosomal protein L33 |
| 3824 | JONS01000023.1 | GCA000711965_02144 | CDS | open | 20729-21775 | _na 348_aa | iron ABC transporter permease | |
| 3825 | JONS01000023.1 | GCA000711965_02145 | CDS | open | 21772-22677 | _na 301_aa | ABC transporter ATP-binding protein | |
| 3826 | JONS01000023.1 | GCA000711965_02146 | CDS | open | 23199-24275 | _na 358_aa | ABC transporter substrate-binding protein | |
| 3827 | JONS01000023.1 | GCA000711965_02147 | CDS | open | 24580-25722 | _na 380_aa | phosphotransferase family protein | |
| 3828 | JONS01000023.1 | GCA000711965_02148 | CDS | open | 25964-26593 | _na 209_aa | hypothetical protein | |
| 3829 | JONS01000023.1 | GCA000711965_02149 | CDS | open | 26646-27230 | _na 194_aa | AAA family ATPase | |
| 3830 | JONS01000023.1 | GCA000711965_02150 | CDS | open | 27230-28105 | _na 291_aa | htpX | zinc metalloprotease HtpX |
| 3831 | JONS01000023.1 | GCA000711965_02151 | CDS | open | 28437-28748 | _na 103_aa | higA | HigA family addiction module antitoxin |
| 3832 | JONS01000023.1 | GCA000711965_02152 | CDS | open | 29064-30179 | _na 371_aa | ald | alanine dehydrogenase |
| 3833 | JONS01000023.1 | GCA000711965_02153 | CDS | open | 30260-31747 | _na 495_aa | gltD | ferredoxin--NADP(+) reductase |
| 3834 | JONS01000023.1 | GCA000711965_02154 | CDS | open | 31988-33208 | _na 406_aa | glycoside hydrolase family 32 protein | |
| 3835 | JONS01000023.1 | GCA000711965_02155 | CDS | open | 33377-34708 | _na 443_aa | ABC transporter substrate-binding protein | |
| 3836 | JONS01000023.1 | GCA000711965_02156 | CDS | open | 34803-35654 | _na 283_aa | ugpA | sn-glycerol-3-phosphate transport system permease protein ugpA |
| 3837 | JONS01000023.1 | GCA000711965_02157 | CDS | open | 35654-36493 | _na 279_aa | ycjP | Inner membrane ABC transporter permease protein ycjP |
| 3838 | JONS01000023.1 | GCA000711965_02158 | CDS | open | 36538-37890 | _na 450_aa | nosD | NosD domain-containing protein |
| 3839 | JONS01000023.1 | GCA000711965_02159 | CDS | open | 38042-39091 | _na 349_aa | lacI | LacI family DNA-binding transcriptional regulator |
| 3840 | JONS01000023.1 | GCA000711965_02160 | CDS | open | 39501-39833 | _na 110_aa | hypothetical protein | |
| 3841 | JONS01000023.1 | GCA000711965_02161 | CDS | open | 39833-40684 | _na 283_aa | nosD | NosD domain-containing protein |
| 3842 | JONS01000023.1 | GCA000711965_02162 | CDS | open | 41109-41768 | _na 219_aa | rloB | RloB domain-containing protein |
| 3843 | JONS01000023.1 | GCA000711965_02163 | CDS | open | 41778-43106 | _na 442_aa | ATP/GTP-binding protein | |
| 3844 | JONS01000023.1 | GCA000711965_02164 | CDS | open | 43184-43939 | _na 251_aa | ABC transporter permease | |
| 3845 | JONS01000023.1 | GCA000711965_02165 | CDS | open | 43932-44474 | _na 180_aa | ATP-binding cassette domain-containing protein | |
| 3846 | JONS01000023.1 | GCA000711965_02166 | CDS | open | 44586-44834 | _na 82_aa | hypothetical protein | |
| 3847 | JONS01000023.1 | GCA000711965_02167 | CDS | open | 44911-46017 | _na 368_aa | Polyprenyl synthetase | |
| 3848 | JONS01000023.1 | GCA000711965_02168 | CDS | open | 46014-47603 | _na 529_aa | nuoN | NADH-quinone oxidoreductase subunit NuoN |
| 3849 | JONS01000023.1 | GCA000711965_02169 | CDS | open | 47600-49189 | _na 529_aa | NADH-quinone oxidoreductase subunit M | |
| 3850 | JONS01000023.1 | GCA000711965_02170 | CDS | open | 49204-51246 | _na 680_aa | nuoL | NADH-quinone oxidoreductase subunit L |
| 3851 | JONS01000023.1 | GCA000711965_02171 | CDS | open | 51260-51565 | _na 101_aa | nuoK | NADH-quinone oxidoreductase subunit NuoK |
| 3852 | JONS01000023.1 | GCA000711965_02172 | CDS | open | 51562-52635 | _na 357_aa | NADH-quinone oxidoreductase subunit J | |
| 3853 | JONS01000023.1 | GCA000711965_02173 | CDS | open | 52632-53408 | _na 258_aa | nuoI | NADH-quinone oxidoreductase subunit NuoI |
| 3854 | JONS01000023.1 | GCA000711965_02174 | CDS | open | 53401-54927 | _na 508_aa | nuoH | NADH-quinone oxidoreductase subunit NuoH |
| 3855 | JONS01000023.1 | GCA000711965_02175 | CDS | open | 54924-57728 | _na 934_aa | NADH-quinone oxidoreductase subunit G | |
| 3856 | JONS01000023.1 | GCA000711965_02176 | CDS | open | 57732-58343 | _na 203_aa | NADH-ubiquinone oxidoreductase 51kDa subunit iron-sulphur binding domain-containing protein | |
| 3857 | JONS01000023.1 | GCA000711965_02177 | CDS | open | 59085-59789 | _na 234_aa | nuoE | NADH-quinone oxidoreductase subunit NuoE |
| 3858 | JONS01000023.1 | GCA000711965_02178 | CDS | open | 59789-61177 | _na 462_aa | NADH-quinone oxidoreductase subunit D | |
| 3859 | JONS01000023.1 | GCA000711965_02179 | CDS | open | 61177-61941 | _na 254_aa | NADH-quinone oxidoreductase subunit C | |
| 3860 | JONS01000023.1 | GCA000711965_02180 | CDS | open | 61938-62558 | _na 206_aa | NADH-quinone oxidoreductase subunit B | |
| 3861 | JONS01000023.1 | GCA000711965_02181 | CDS | open | 62593-62952 | _na 119_aa | NADH-quinone oxidoreductase subunit | |
| 3862 | JONS01000023.1 | GCA000711965_02182 | CDS | open | 62949-64286 | _na 445_aa | FAD-binding domain-containing protein | |
| 3863 | JONS01000023.1 | GCA000711965_02183 | CDS | open | 64470-64952 | _na 160_aa | hypothetical protein | |
| 3864 | JONS01000023.1 | GCA000711965_02184 | CDS | open | 65066-65467 | _na 133_aa | hypothetical protein | |
| 3865 | JONS01000023.1 | GCA000711965_02185 | CDS | open | 65761-66345 | _na 194_aa | hypothetical protein | |
| 3866 | JONS01000023.1 | GCA000711965_02186 | CDS | open | 66363-66614 | _na 83_aa | hypothetical protein | |
| 3867 | JONS01000023.1 | GCA000711965_02187 | CDS | open | 66773-67351 | _na 192_aa | Transposase IS110-like N-terminal domain-containing protein | |
| 3868 | JONS01000023.1 | GCA000711965_02188 | CDS | open | 67785-67985 | _na 66_aa | hypothetical protein | |
| 3869 | JONS01000023.1 | GCA000711965_02120 | gene | open | 216-824 | |||
| 3870 | JONS01000023.1 | GCA000711965_02121 | gene | open | 950-1669 | |||
| 3871 | JONS01000023.1 | GCA000711965_02122 | gene | open | 1694-2083 | |||
| 3872 | JONS01000023.1 | GCA000711965_02123 | gene | open | 2125-3381 | |||
| 3873 | JONS01000023.1 | GCA000711965_02124 | gene | open | 3648-4898 | |||
| 3874 | JONS01000023.1 | GCA000711965_02125 | gene | open | 5044-6033 | galE | ||
| 3875 | JONS01000023.1 | GCA000711965_02126 | gene | open | 6220-6771 | |||
| 3876 | JONS01000023.1 | GCA000711965_02127 | gene | open | 6881-7405 | |||
| 3877 | JONS01000023.1 | GCA000711965_02128 | gene | open | 7556-8863 | |||
| 3878 | JONS01000023.1 | GCA000711965_02129 | gene | open | 8970-10235 | |||
| 3879 | JONS01000023.1 | GCA000711965_02130 | gene | open | 10294-10848 | gtrA | ||
| 3880 | JONS01000023.1 | GCA000711965_02131 | gene | open | 10916-11701 | |||
| 3881 | JONS01000023.1 | GCA000711965_02132 | gene | open | 11757-12836 | |||
| 3882 | JONS01000023.1 | GCA000711965_02133 | gene | open | 12945-13613 | |||
| 3883 | JONS01000023.1 | GCA000711965_02134 | gene | open | 13690-14871 | |||
| 3884 | JONS01000023.1 | GCA000711965_02135 | gene | open | 14926-15942 | |||
| 3885 | JONS01000023.1 | GCA000711965_02136 | gene | open | 16367-17005 | |||
| 3886 | JONS01000023.1 | GCA000711965_02137 | gene | open | 17002-17550 | |||
| 3887 | JONS01000023.1 | GCA000711965_02138 | gene | open | 17564-18121 | marR | ||
| 3888 | JONS01000023.1 | GCA000711965_02139 | gene | open | 18246-19064 | |||
| 3889 | JONS01000023.1 | GCA000711965_02140 | gene | open | 19096-19266 | rpmG | ||
| 3890 | JONS01000023.1 | GCA000711965_02144 | gene | open | 20729-21775 | |||
| 3891 | JONS01000023.1 | GCA000711965_02145 | gene | open | 21772-22677 | |||
| 3892 | JONS01000023.1 | GCA000711965_02146 | gene | open | 23199-24275 | |||
| 3893 | JONS01000023.1 | GCA000711965_02147 | gene | open | 24580-25722 | |||
| 3894 | JONS01000023.1 | GCA000711965_02148 | gene | open | 25964-26593 | |||
| 3895 | JONS01000023.1 | GCA000711965_02149 | gene | open | 26646-27230 | |||
| 3896 | JONS01000023.1 | GCA000711965_02150 | gene | open | 27230-28105 | htpX | ||
| 3897 | JONS01000023.1 | GCA000711965_02151 | gene | open | 28437-28748 | higA | ||
| 3898 | JONS01000023.1 | GCA000711965_02152 | gene | open | 29064-30179 | ald | ||
| 3899 | JONS01000023.1 | GCA000711965_02153 | gene | open | 30260-31747 | gltD | ||
| 3900 | JONS01000023.1 | GCA000711965_02154 | gene | open | 31988-33208 | |||
| 3901 | JONS01000023.1 | GCA000711965_02155 | gene | open | 33377-34708 | |||
| 3902 | JONS01000023.1 | GCA000711965_02156 | gene | open | 34803-35654 | ugpA | ||
| 3903 | JONS01000023.1 | GCA000711965_02157 | gene | open | 35654-36493 | ycjP | ||
| 3904 | JONS01000023.1 | GCA000711965_02158 | gene | open | 36538-37890 | nosD | ||
| 3905 | JONS01000023.1 | GCA000711965_02159 | gene | open | 38042-39091 | lacI | ||
| 3906 | JONS01000023.1 | GCA000711965_02160 | gene | open | 39501-39833 | |||
| 3907 | JONS01000023.1 | GCA000711965_02161 | gene | open | 39833-40684 | nosD | ||
| 3908 | JONS01000023.1 | GCA000711965_02162 | gene | open | 41109-41768 | rloB | ||
| 3909 | JONS01000023.1 | GCA000711965_02163 | gene | open | 41778-43106 | |||
| 3910 | JONS01000023.1 | GCA000711965_02164 | gene | open | 43184-43939 | |||
| 3911 | JONS01000023.1 | GCA000711965_02165 | gene | open | 43932-44474 | |||
| 3912 | JONS01000023.1 | GCA000711965_02166 | gene | open | 44586-44834 | |||
| 3913 | JONS01000023.1 | GCA000711965_02167 | gene | open | 44911-46017 | |||
| 3914 | JONS01000023.1 | GCA000711965_02168 | gene | open | 46014-47603 | nuoN | ||
| 3915 | JONS01000023.1 | GCA000711965_02169 | gene | open | 47600-49189 | |||
| 3916 | JONS01000023.1 | GCA000711965_02170 | gene | open | 49204-51246 | nuoL | ||
| 3917 | JONS01000023.1 | GCA000711965_02171 | gene | open | 51260-51565 | nuoK | ||
| 3918 | JONS01000023.1 | GCA000711965_02172 | gene | open | 51562-52635 | |||
| 3919 | JONS01000023.1 | GCA000711965_02173 | gene | open | 52632-53408 | nuoI | ||
| 3920 | JONS01000023.1 | GCA000711965_02174 | gene | open | 53401-54927 | nuoH | ||
| 3921 | JONS01000023.1 | GCA000711965_02175 | gene | open | 54924-57728 | |||
| 3922 | JONS01000023.1 | GCA000711965_02176 | gene | open | 57732-58343 | |||
| 3923 | JONS01000023.1 | GCA000711965_02177 | gene | open | 59085-59789 | nuoE | ||
| 3924 | JONS01000023.1 | GCA000711965_02178 | gene | open | 59789-61177 | |||
| 3925 | JONS01000023.1 | GCA000711965_02179 | gene | open | 61177-61941 | |||
| 3926 | JONS01000023.1 | GCA000711965_02180 | gene | open | 61938-62558 | |||
| 3927 | JONS01000023.1 | GCA000711965_02181 | gene | open | 62593-62952 | |||
| 3928 | JONS01000023.1 | GCA000711965_02182 | gene | open | 62949-64286 | |||
| 3929 | JONS01000023.1 | GCA000711965_02183 | gene | open | 64470-64952 | |||
| 3930 | JONS01000023.1 | GCA000711965_02184 | gene | open | 65066-65467 | |||
| 3931 | JONS01000023.1 | GCA000711965_02185 | gene | open | 65761-66345 | |||
| 3932 | JONS01000023.1 | GCA000711965_02186 | gene | open | 66363-66614 | |||
| 3933 | JONS01000023.1 | GCA000711965_02187 | gene | open | 66773-67351 | |||
| 3934 | JONS01000023.1 | GCA000711965_02188 | gene | open | 67785-67985 | |||
| 3935 | JONS01000023.1 | GCA000711965_02141 | gene | open | 19323-19396 | trnM | ||
| 3936 | JONS01000023.1 | GCA000711965_02142 | gene | open | 19437-19509 | trnT | ||
| 3937 | JONS01000023.1 | GCA000711965_02143 | gene | open | 19629-19712 | trnY | ||
| 3938 | JONS01000023.1 | GCA000711965_02141 | tRNA | open | 19323-19396 | trnM | tRNA-Met(cat) | |
| 3939 | JONS01000023.1 | GCA000711965_02142 | tRNA | open | 19437-19509 | trnT | tRNA-Thr(ggt) | |
| 3940 | JONS01000023.1 | GCA000711965_02143 | tRNA | open | 19629-19712 | trnY | tRNA-Tyr(gta) | |
| 3941 | JONS01000024.1 | GCA000711965_02189 | CDS | open | 97-300 | _na 67_aa | hypothetical protein | |
| 3942 | JONS01000024.1 | GCA000711965_02190 | CDS | open | 340-633 | _na 97_aa | hypothetical protein | |
| 3943 | JONS01000024.1 | GCA000711965_02191 | CDS | open | 727-3129 | _na 800_aa | hypothetical protein | |
| 3944 | JONS01000024.1 | GCA000711965_02192 | CDS | open | 3245-4162 | _na 305_aa | Cation diffusion facilitator family transporter | |
| 3945 | JONS01000024.1 | GCA000711965_02193 | CDS | open | 4387-5211 | _na 274_aa | trimeric intracellular cation channel family protein | |
| 3946 | JONS01000024.1 | GCA000711965_02194 | CDS | open | 5249-5566 | _na 105_aa | ytxH | YtxH domain-containing protein |
| 3947 | JONS01000024.1 | GCA000711965_02195 | CDS | open | 5660-6166 | _na 168_aa | hypothetical protein | |
| 3948 | JONS01000024.1 | GCA000711965_02196 | CDS | open | 7064-7837 | _na 257_aa | hypothetical protein | |
| 3949 | JONS01000024.1 | GCA000711965_02197 | CDS | open | 7834-8169 | _na 111_aa | hypothetical protein | |
| 3950 | JONS01000024.1 | GCA000711965_02198 | CDS | open | 8230-9102 | _na 290_aa | hypothetical protein | |
| 3951 | JONS01000024.1 | GCA000711965_02199 | CDS | open | 9162-10346 | _na 394_aa | App1 family protein | |
| 3952 | JONS01000024.1 | GCA000711965_02200 | CDS | open | 10315-11682 | _na 455_aa | glycosyltransferase 87 family protein | |
| 3953 | JONS01000024.1 | GCA000711965_02201 | CDS | open | 11841-13112 | _na 423_aa | MFS transporter | |
| 3954 | JONS01000024.1 | GCA000711965_02202 | CDS | open | 13297-14562 | _na 421_aa | Serine/threonine protein kinase | |
| 3955 | JONS01000024.1 | GCA000711965_02203 | CDS | open | 14776-15549 | _na 257_aa | PP2C family serine/threonine-protein phosphatase | |
| 3956 | JONS01000024.1 | GCA000711965_02204 | CDS | open | 15546-16937 | _na 463_aa | FHA domain-containing protein | |
| 3957 | JONS01000024.1 | GCA000711965_02205 | CDS | open | 16981-17814 | _na 277_aa | FHA domain-containing protein | |
| 3958 | JONS01000024.1 | GCA000711965_02206 | CDS | open | 17811-18863 | _na 350_aa | lmeA | LmeA family phospholipid-binding protein |
| 3959 | JONS01000024.1 | GCA000711965_02207 | CDS | open | 18967-20241 | _na 424_aa | ATPase%2C AAA family | |
| 3960 | JONS01000024.1 | GCA000711965_02208 | CDS | open | 20277-21293 | _na 338_aa | DUF58 domain-containing protein | |
| 3961 | JONS01000024.1 | GCA000711965_02209 | CDS | open | 21297-21818 | _na 173_aa | alpha-amylase | |
| 3962 | JONS01000024.1 | GCA000711965_02210 | CDS | open | 21812-22867 | _na 351_aa | VWA domain-containing protein | |
| 3963 | JONS01000024.1 | GCA000711965_02211 | CDS | open | 22864-24201 | _na 445_aa | VWA domain-containing protein | |
| 3964 | JONS01000024.1 | GCA000711965_02212 | CDS | open | 24198-25103 | _na 301_aa | tetratricopeptide repeat protein | |
| 3965 | JONS01000024.1 | GCA000711965_02213 | CDS | open | 25580-25972 | _na 130_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 3966 | JONS01000024.1 | GCA000711965_02214 | CDS | open | 26088-26801 | _na 237_aa | SAF domain-containing protein | |
| 3967 | JONS01000024.1 | GCA000711965_02215 | CDS | open | 27005-27682 | _na 225_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 3968 | JONS01000024.1 | GCA000711965_02216 | CDS | open | 27843-29054 | _na 403_aa | glp | gephyrin-like molybdotransferase Glp |
| 3969 | JONS01000024.1 | GCA000711965_02217 | CDS | open | 29058-29750 | _na 230_aa | GNAT family N-acetyltransferase | |
| 3970 | JONS01000024.1 | GCA000711965_02218 | CDS | open | 29884-31293 | _na 469_aa | hypothetical protein | |
| 3971 | JONS01000024.1 | GCA000711965_02220 | CDS | open | 31538-32284 | _na 248_aa | 4'-phosphopantetheinyl transferase | |
| 3972 | JONS01000024.1 | GCA000711965_02221 | CDS | open | 32576-33238 | _na 220_aa | mptD | MptD family putative ECF transporter S component |
| 3973 | JONS01000024.1 | GCA000711965_02222 | CDS | open | 33252-33962 | _na 236_aa | energy-coupling factor transporter transmembrane component T | |
| 3974 | JONS01000024.1 | GCA000711965_02223 | CDS | open | 33959-35509 | _na 516_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 3975 | JONS01000024.1 | GCA000711965_02224 | CDS | open | 35529-37247 | _na 572_aa | ABC transporter ATP-binding protein | |
| 3976 | JONS01000024.1 | GCA000711965_02225 | CDS | open | 37244-38998 | _na 584_aa | ABC transporter ATP-binding protein | |
| 3977 | JONS01000024.1 | GCA000711965_02226 | CDS | open | 39008-39709 | _na 233_aa | tetR | TetR family transcriptional regulator |
| 3978 | JONS01000024.1 | GCA000711965_02227 | CDS | open | 39795-44861 | _na 1688_aa | non-ribosomal peptide synthetase | |
| 3979 | JONS01000024.1 | GCA000711965_02228 | CDS | open | 44870-45949 | _na 359_aa | Gfo/Idh/MocA family oxidoreductase | |
| 3980 | JONS01000024.1 | GCA000711965_02229 | CDS | open | 46029-51599 | _na 1856_aa | non-ribosomal peptide synthetase | |
| 3981 | JONS01000024.1 | GCA000711965_02230 | CDS | open | 51596-52732 | _na 378_aa | saccharopine dehydrogenase NADP-binding domain-containing protein | |
| 3982 | JONS01000024.1 | GCA000711965_02231 | CDS | open | 52732-54678 | _na 648_aa | class I SAM-dependent methyltransferase | |
| 3983 | JONS01000024.1 | GCA000711965_02232 | CDS | open | 54675-56207 | _na 510_aa | class I SAM-dependent methyltransferase | |
| 3984 | JONS01000024.1 | GCA000711965_02233 | CDS | open | 56204-56992 | _na 262_aa | thioesterase II family protein | |
| 3985 | JONS01000024.1 | GCA000711965_02234 | CDS | open | 56979-58631 | _na 550_aa | (2%2C3-dihydroxybenzoyl)adenylate synthase | |
| 3986 | JONS01000024.1 | GCA000711965_02235 | CDS | open | 58631-59656 | _na 341_aa | methyltransferase | |
| 3987 | JONS01000024.1 | GCA000711965_02236 | CDS | open | 60178-60486 | _na 102_aa | hypothetical protein | |
| 3988 | JONS01000024.1 | GCA000711965_02189 | gene | open | 97-300 | |||
| 3989 | JONS01000024.1 | GCA000711965_02190 | gene | open | 340-633 | |||
| 3990 | JONS01000024.1 | GCA000711965_02191 | gene | open | 727-3129 | |||
| 3991 | JONS01000024.1 | GCA000711965_02192 | gene | open | 3245-4162 | |||
| 3992 | JONS01000024.1 | GCA000711965_02193 | gene | open | 4387-5211 | |||
| 3993 | JONS01000024.1 | GCA000711965_02194 | gene | open | 5249-5566 | ytxH | ||
| 3994 | JONS01000024.1 | GCA000711965_02195 | gene | open | 5660-6166 | |||
| 3995 | JONS01000024.1 | GCA000711965_02196 | gene | open | 7064-7837 | |||
| 3996 | JONS01000024.1 | GCA000711965_02197 | gene | open | 7834-8169 | |||
| 3997 | JONS01000024.1 | GCA000711965_02198 | gene | open | 8230-9102 | |||
| 3998 | JONS01000024.1 | GCA000711965_02199 | gene | open | 9162-10346 | |||
| 3999 | JONS01000024.1 | GCA000711965_02200 | gene | open | 10315-11682 | |||
| 4000 | JONS01000024.1 | GCA000711965_02201 | gene | open | 11841-13112 |

