HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium macclintockiae (GCA_000738245.1)

Select a Genome:
BAKTA Annotations for GCA_000738245.1
Genome Selected: Corynebacterium macclintockiae
ContigsBases CDSrRNA tmRNAtRNA
263 2411235 2089 3 1 54
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4307 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4307 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JFCK01000003.1 GCA000738245_00001 CDS open 300-560 _na     86_aa hypothetical protein
2 JFCK01000003.1 GCA000738245_00002 CDS open 804-983 _na     59_aa hypothetical protein
3 JFCK01000003.1 GCA000738245_00001 gene open 300-560
4 JFCK01000003.1 GCA000738245_00002 gene open 804-983
5 JFCK01000004.1 GCA000738245_00003 CDS open 314-907 _na     197_aa hypothetical protein
6 JFCK01000004.1 GCA000738245_00003 gene open 314-907
7 JFCK01000005.1 GCA000738245_00004 CDS open 129-1121 _na     330_aa RHS repeat-associated core domain-containing protein
8 JFCK01000005.1 GCA000738245_00005 CDS open 1139-2152 _na     337_aa hypothetical protein
9 JFCK01000005.1 GCA000738245_00006 CDS open 2441-2638 _na     65_aa hypothetical protein
10 JFCK01000005.1 GCA000738245_00004 gene open 129-1121
11 JFCK01000005.1 GCA000738245_00005 gene open 1139-2152
12 JFCK01000005.1 GCA000738245_00006 gene open 2441-2638
13 JFCK01000006.1 GCA000738245_00007 CDS open 71-1177 _na     368_aa lysR LysR DNA-binding transcription regulator
14 JFCK01000006.1 GCA000738245_00008 CDS open 1174-2004 _na     276_aa Beta-lactamase class A catalytic domain-containing protein
15 JFCK01000006.1 GCA000738245_00009 CDS open 2118-3899 _na     593_aa pbp2m penicillin-binding protein PBP2M
16 JFCK01000006.1 GCA000738245_00010 CDS open 3916-5223 _na     435_aa Putative helicase
17 JFCK01000006.1 GCA000738245_00007 gene open 71-1177 lysR
18 JFCK01000006.1 GCA000738245_00008 gene open 1174-2004
19 JFCK01000006.1 GCA000738245_00009 gene open 2118-3899 pbp2m
20 JFCK01000006.1 GCA000738245_00010 gene open 3916-5223
21 JFCK01000008.1 GCA000738245_00011 CDS open 77-1162 _na     361_aa ychF redox-regulated ATPase YchF
22 JFCK01000008.1 GCA000738245_00011 gene open 77-1162 ychF
23 JFCK01000011.1 GCA000738245_00012 CDS open 77-400 _na     107_aa hypothetical protein
24 JFCK01000011.1 GCA000738245_00012 gene open 77-400
25 JFCK01000012.1 GCA000738245_00013 CDS open 236-730 _na     164_aa Glycolipid-binding domain-containing protein
26 JFCK01000012.1 GCA000738245_00014 CDS open 684-1205 _na     173_aa arfB alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB
27 JFCK01000012.1 GCA000738245_00013 gene open 236-730
28 JFCK01000012.1 GCA000738245_00014 gene open 684-1205 arfB
29 JFCK01000014.1 GCA000738245_00015 CDS open 3-242 _na     79_aa Putative membrane GTPase involved in stress response
30 JFCK01000014.1 GCA000738245_00016 CDS open 419-2146 _na     575_aa ABC transporter family substrate-binding protein
31 JFCK01000014.1 GCA000738245_00017 CDS open 2150-3172 _na     340_aa mshB N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase
32 JFCK01000014.1 GCA000738245_00018 CDS open 3225-3695 _na     156_aa SPW repeat-containing protein
33 JFCK01000014.1 GCA000738245_00019 CDS open 3765-4082 _na     105_aa fdxA ferredoxin
34 JFCK01000014.1 GCA000738245_00020 CDS open 4159-5295 _na     378_aa dapC succinyldiaminopimelate transaminase
35 JFCK01000014.1 GCA000738245_00021 CDS open 5383-6315 _na     310_aa Pseudouridine synthase
36 JFCK01000014.1 GCA000738245_00022 CDS open 6312-6557 _na     81_aa hypothetical protein
37 JFCK01000014.1 GCA000738245_00015 gene open 3-242
38 JFCK01000014.1 GCA000738245_00016 gene open 419-2146
39 JFCK01000014.1 GCA000738245_00017 gene open 2150-3172 mshB
40 JFCK01000014.1 GCA000738245_00018 gene open 3225-3695
41 JFCK01000014.1 GCA000738245_00019 gene open 3765-4082 fdxA
42 JFCK01000014.1 GCA000738245_00020 gene open 4159-5295 dapC
43 JFCK01000014.1 GCA000738245_00021 gene open 5383-6315
44 JFCK01000014.1 GCA000738245_00022 gene open 6312-6557
45 JFCK01000015.1 GCA000738245_00023 CDS open 77-340 _na     87_aa hypothetical protein
46 JFCK01000015.1 GCA000738245_00023 gene open 77-340
47 JFCK01000016.1 repeat_region open 52-1210 CRISPR array with 19 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCCAGCGGGGATGAGCC and spacer length 33
48 JFCK01000020.1 GCA000738245_00024 CDS open 375-539 _na     54_aa hypothetical protein
49 JFCK01000020.1 GCA000738245_00025 CDS open 573-983 _na     136_aa hypothetical protein
50 JFCK01000020.1 GCA000738245_00026 CDS open 1032-1565 _na     177_aa hypothetical protein
51 JFCK01000020.1 GCA000738245_00027 CDS open 1876-4614 _na     912_aa Secreted protein
52 JFCK01000020.1 GCA000738245_00028 CDS open 4716-5558 _na     280_aa Nudix hydrolase domain-containing protein
53 JFCK01000020.1 GCA000738245_00024 gene open 375-539
54 JFCK01000020.1 GCA000738245_00025 gene open 573-983
55 JFCK01000020.1 GCA000738245_00026 gene open 1032-1565
56 JFCK01000020.1 GCA000738245_00027 gene open 1876-4614
57 JFCK01000020.1 GCA000738245_00028 gene open 4716-5558
58 JFCK01000021.1 GCA000738245_00029 CDS open 189-458 _na     89_aa hypothetical protein
59 JFCK01000021.1 GCA000738245_00029 gene open 189-458
60 JFCK01000025.1 GCA000738245_00030 CDS open 1160-2083 _na     307_aa NUDIX hydrolase
61 JFCK01000025.1 GCA000738245_00031 CDS open 2220-5024 _na     934_aa Secreted protein
62 JFCK01000025.1 GCA000738245_00032 CDS open 4975-5751 _na     258_aa hypothetical protein
63 JFCK01000025.1 GCA000738245_00033 CDS open 5830-6063 _na     77_aa hypothetical protein
64 JFCK01000025.1 GCA000738245_00034 CDS open 6274-6438 _na     54_aa hypothetical protein
65 JFCK01000025.1 GCA000738245_00030 gene open 1160-2083
66 JFCK01000025.1 GCA000738245_00031 gene open 2220-5024
67 JFCK01000025.1 GCA000738245_00032 gene open 4975-5751
68 JFCK01000025.1 GCA000738245_00033 gene open 5830-6063
69 JFCK01000025.1 GCA000738245_00034 gene open 6274-6438
70 JFCK01000026.1 GCA000738245_00035 CDS open 17-196 _na     59_aa hypothetical protein
71 JFCK01000026.1 GCA000738245_00035 gene open 17-196
72 JFCK01000031.1 repeat_region open 52-600 CRISPR array with 9 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCCAGCGGGGATGAGCC and spacer length 33
73 JFCK01000033.1 GCA000738245_00036 gene open 2-77 trnG
74 JFCK01000033.1 GCA000738245_00037 gene open 127-198 trnV
75 JFCK01000033.1 GCA000738245_00036 tRNA open 2-77 trnG tRNA-Gly(gcc)
76 JFCK01000033.1 GCA000738245_00037 tRNA open 127-198 trnV tRNA-Val(gac)
77 JFCK01000035.1 GCA000738245_00038 CDS open 247-390 _na     47_aa hypothetical protein
78 JFCK01000035.1 GCA000738245_00038 gene open 247-390
79 JFCK01000044.1 GCA000738245_00039 CDS open 436-786 _na     116_aa Glyoxalase-like domain-containing protein
80 JFCK01000044.1 GCA000738245_00040 CDS open 835-1092 _na     85_aa hypothetical protein
81 JFCK01000044.1 GCA000738245_00041 CDS open 1112-1555 _na     147_aa arfB alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB
82 JFCK01000044.1 GCA000738245_00039 gene open 436-786
83 JFCK01000044.1 GCA000738245_00040 gene open 835-1092
84 JFCK01000044.1 GCA000738245_00041 gene open 1112-1555 arfB
85 JFCK01000053.1 GCA000738245_00042 CDS open 692-925 _na     77_aa hypothetical protein
86 JFCK01000053.1 GCA000738245_00042 gene open 692-925
87 JFCK01000054.1 GCA000738245_00043 CDS open 692-979 _na     95_aa hypothetical protein
88 JFCK01000054.1 GCA000738245_00043 gene open 692-979
89 JFCK01000063.1 GCA000738245_00044 CDS open 81-314 _na     77_aa hypothetical protein
90 JFCK01000063.1 GCA000738245_00044 gene open 81-314
91 JFCK01000066.1 GCA000738245_00045 CDS open 46-231 _na     61_aa hypothetical protein
92 JFCK01000066.1 GCA000738245_00045 gene open 46-231
93 JFCK01000068.1 GCA000738245_00046 CDS open 181-375 _na     64_aa hypothetical protein
94 JFCK01000068.1 GCA000738245_00046 gene open 181-375
95 JFCK01000069.1 GCA000738245_00047 CDS open 46-216 _na     56_aa hypothetical protein
96 JFCK01000069.1 GCA000738245_00047 gene open 46-216
97 JFCK01000084.1 GCA000738245_00048 CDS open 656-979 _na     107_aa Secreted protein
98 JFCK01000084.1 GCA000738245_00049 CDS open 1028-1651 _na     207_aa copC Copper resistance protein CopC
99 JFCK01000084.1 GCA000738245_00048 gene open 656-979
100 JFCK01000084.1 GCA000738245_00049 gene open 1028-1651 copC
101 JFCK01000084.1 GCA000738245_00050 gene open 1802-1876 trnV
102 JFCK01000084.1 GCA000738245_00051 gene open 2126-2201 trnG
103 JFCK01000084.1 GCA000738245_00050 tRNA open 1802-1876 trnV tRNA-Val(cac)
104 JFCK01000084.1 GCA000738245_00051 tRNA open 2126-2201 trnG tRNA-Gly(gcc)
105 JFCK01000090.1 GCA000738245_00052 CDS open 316-1407 _na     363_aa ddl D-alanine--D-alanine ligase
106 JFCK01000090.1 GCA000738245_00053 CDS open 1465-1992 _na     175_aa hypothetical protein
107 JFCK01000090.1 GCA000738245_00052 gene open 316-1407 ddl
108 JFCK01000090.1 GCA000738245_00053 gene open 1465-1992
109 JFCK01000094.1 GCA000738245_00054 CDS open 66-449 _na     127_aa hypothetical protein
110 JFCK01000094.1 GCA000738245_00055 CDS open 413-841 _na     142_aa hypothetical protein
111 JFCK01000094.1 GCA000738245_00054 gene open 66-449
112 JFCK01000094.1 GCA000738245_00055 gene open 413-841
113 JFCK01000095.1 GCA000738245_00056 CDS open 30-230 _na     66_aa hypothetical protein
114 JFCK01000095.1 GCA000738245_00056 gene open 30-230
115 JFCK01000100.1 GCA000738245_00057 CDS open 2683-3699 _na     338_aa hypothetical protein
116 JFCK01000100.1 GCA000738245_00058 CDS open 3710-4765 _na     351_aa RHS repeat-associated core domain-containing protein
117 JFCK01000100.1 GCA000738245_00057 gene open 2683-3699
118 JFCK01000100.1 GCA000738245_00058 gene open 3710-4765
119 JFCK01000101.1 GCA000738245_00059 CDS open 465-1220 _na     251_aa hypothetical protein
120 JFCK01000101.1 GCA000738245_00060 CDS open 2430-2723 _na     97_aa ESAT-6-like protein
121 JFCK01000101.1 GCA000738245_00061 CDS open 2772-3107 _na     111_aa WXG100 family type VII secretion target
122 JFCK01000101.1 GCA000738245_00062 CDS open 3267-3572 _na     101_aa WXG100 family type VII secretion target
123 JFCK01000101.1 GCA000738245_00063 CDS open 3576-3893 _na     105_aa hypothetical protein
124 JFCK01000101.1 GCA000738245_00064 CDS open 3897-4598 _na     233_aa hypothetical protein
125 JFCK01000101.1 GCA000738245_00065 CDS open 4876-8931 _na     1351_aa Type VII secretion protein EccCa
126 JFCK01000101.1 GCA000738245_00066 CDS open 9052-10557 _na     501_aa eccD Type VII secretion integral membrane protein EccD
127 JFCK01000101.1 GCA000738245_00067 CDS open 10687-11616 _na     309_aa MaoC-like domain-containing protein
128 JFCK01000101.1 GCA000738245_00068 CDS open 11661-13007 _na     448_aa 3-oxoacyl-ACP reductase
129 JFCK01000101.1 GCA000738245_00069 CDS open 13236-14552 _na     438_aa acetyl-CoA C-acetyltransferase
130 JFCK01000101.1 GCA000738245_00070 CDS open 14566-15822 _na     418_aa DUF4185 domain-containing protein
131 JFCK01000101.1 GCA000738245_00071 CDS open 15875-16222 _na     115_aa DUF1311 domain-containing protein
132 JFCK01000101.1 GCA000738245_00072 CDS open 16239-16823 _na     194_aa coaE dephospho-CoA kinase
133 JFCK01000101.1 GCA000738245_00073 CDS open 16828-17772 _na     314_aa DUF218 domain-containing protein
134 JFCK01000101.1 GCA000738245_00074 CDS open 17858-20005 _na     715_aa uvrB excinuclease ABC subunit UvrB
135 JFCK01000101.1 GCA000738245_00075 CDS open 20016-20450 _na     144_aa Universal stress protein
136 JFCK01000101.1 GCA000738245_00076 CDS open 20447-22744 _na     765_aa UvrD-like helicase ATP-binding domain-containing protein
137 JFCK01000101.1 GCA000738245_00077 CDS open 23004-23954 _na     316_aa SCP domain-containing protein
138 JFCK01000101.1 GCA000738245_00078 CDS open 24014-24865 _na     283_aa doxX DoxX family protein
139 JFCK01000101.1 GCA000738245_00079 CDS open 24995-25681 _na     228_aa Metallo-beta-lactamase domain-containing protein
140 JFCK01000101.1 GCA000738245_00080 CDS open 25754-28600 _na     948_aa uvrA excinuclease ABC subunit UvrA
141 JFCK01000101.1 GCA000738245_00081 CDS open 28579-30435 _na     618_aa DUF2339 domain-containing protein
142 JFCK01000101.1 GCA000738245_00082 CDS open 31522-31866 _na     114_aa infC translation initiation factor IF-3
143 JFCK01000101.1 GCA000738245_00083 CDS open 31899-32093 _na     64_aa rpmI 50S ribosomal protein L35
144 JFCK01000101.1 GCA000738245_00084 CDS open 32206-32589 _na     127_aa rplT 50S ribosomal protein L20
145 JFCK01000101.1 GCA000738245_00085 CDS open 32726-33481 _na     251_aa Lipoprotein
146 JFCK01000101.1 GCA000738245_00086 CDS open 33489-34349 _na     286_aa Putative rRNA methylase
147 JFCK01000101.1 GCA000738245_00087 CDS open 34435-35490 _na     351_aa pheS phenylalanine--tRNA ligase subunit alpha
148 JFCK01000101.1 GCA000738245_00088 CDS open 35569-38127 _na     852_aa pheT phenylalanine--tRNA ligase subunit beta
149 JFCK01000101.1 GCA000738245_00089 CDS open 38191-39216 _na     341_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
150 JFCK01000101.1 GCA000738245_00090 CDS open 39224-40426 _na     400_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
151 JFCK01000101.1 GCA000738245_00091 CDS open 40490-41437 _na     315_aa argB Acetylglutamate kinase
152 JFCK01000101.1 GCA000738245_00092 CDS open 41440-42645 _na     401_aa acetylornithine transaminase
153 JFCK01000101.1 GCA000738245_00093 CDS open 42665-43600 _na     311_aa argF ornithine carbamoyltransferase
154 JFCK01000101.1 GCA000738245_00094 CDS open 43585-44049 _na     154_aa argR arginine repressor
155 JFCK01000101.1 GCA000738245_00095 CDS open 44122-45318 _na     398_aa argG argininosuccinate synthase
156 JFCK01000101.1 GCA000738245_00096 CDS open 45381-46820 _na     479_aa argH argininosuccinate lyase
157 JFCK01000101.1 GCA000738245_00097 CDS open 46850-48073 _na     407_aa thiF ThiF family adenylyltransferase
158 JFCK01000101.1 GCA000738245_00098 CDS open 48073-48876 _na     267_aa Thiazole synthase
159 JFCK01000101.1 GCA000738245_00099 CDS open 48889-49107 _na     72_aa thiS sulfur carrier protein ThiS
160 JFCK01000101.1 GCA000738245_00100 CDS open 49173-50333 _na     386_aa thiO glycine oxidase ThiO
161 JFCK01000101.1 GCA000738245_00101 CDS open 50375-51019 _na     214_aa thiamine phosphate synthase
162 JFCK01000101.1 GCA000738245_00102 CDS open 51009-52949 _na     646_aa thiC phosphomethylpyrimidine synthase ThiC
163 JFCK01000101.1 GCA000738245_00103 CDS open 53165-54820 _na     551_aa VWA domain-containing protein
164 JFCK01000101.1 GCA000738245_00104 CDS open 54869-55534 _na     221_aa Secreted protein
165 JFCK01000101.1 GCA000738245_00105 CDS open 55595-57172 _na     525_aa Substrate-binding domain-containing protein
166 JFCK01000101.1 GCA000738245_00106 CDS open 57221-57388 _na     55_aa UPF0434 protein jk0859
167 JFCK01000101.1 GCA000738245_00107 CDS open 57435-58721 _na     428_aa tyrS tyrosine--tRNA ligase
168 JFCK01000101.1 GCA000738245_00059 gene open 465-1220
169 JFCK01000101.1 GCA000738245_00060 gene open 2430-2723
170 JFCK01000101.1 GCA000738245_00061 gene open 2772-3107
171 JFCK01000101.1 GCA000738245_00062 gene open 3267-3572
172 JFCK01000101.1 GCA000738245_00063 gene open 3576-3893
173 JFCK01000101.1 GCA000738245_00064 gene open 3897-4598
174 JFCK01000101.1 GCA000738245_00065 gene open 4876-8931
175 JFCK01000101.1 GCA000738245_00066 gene open 9052-10557 eccD
176 JFCK01000101.1 GCA000738245_00067 gene open 10687-11616
177 JFCK01000101.1 GCA000738245_00068 gene open 11661-13007
178 JFCK01000101.1 GCA000738245_00069 gene open 13236-14552
179 JFCK01000101.1 GCA000738245_00070 gene open 14566-15822
180 JFCK01000101.1 GCA000738245_00071 gene open 15875-16222
181 JFCK01000101.1 GCA000738245_00072 gene open 16239-16823 coaE
182 JFCK01000101.1 GCA000738245_00073 gene open 16828-17772
183 JFCK01000101.1 GCA000738245_00074 gene open 17858-20005 uvrB
184 JFCK01000101.1 GCA000738245_00075 gene open 20016-20450
185 JFCK01000101.1 GCA000738245_00076 gene open 20447-22744
186 JFCK01000101.1 GCA000738245_00077 gene open 23004-23954
187 JFCK01000101.1 GCA000738245_00078 gene open 24014-24865 doxX
188 JFCK01000101.1 GCA000738245_00079 gene open 24995-25681
189 JFCK01000101.1 GCA000738245_00080 gene open 25754-28600 uvrA
190 JFCK01000101.1 GCA000738245_00081 gene open 28579-30435
191 JFCK01000101.1 GCA000738245_00082 gene open 31522-31866 infC
192 JFCK01000101.1 GCA000738245_00083 gene open 31899-32093 rpmI
193 JFCK01000101.1 GCA000738245_00084 gene open 32206-32589 rplT
194 JFCK01000101.1 GCA000738245_00085 gene open 32726-33481
195 JFCK01000101.1 GCA000738245_00086 gene open 33489-34349
196 JFCK01000101.1 GCA000738245_00087 gene open 34435-35490 pheS
197 JFCK01000101.1 GCA000738245_00088 gene open 35569-38127 pheT
198 JFCK01000101.1 GCA000738245_00089 gene open 38191-39216 argC
199 JFCK01000101.1 GCA000738245_00090 gene open 39224-40426 argJ
200 JFCK01000101.1 GCA000738245_00091 gene open 40490-41437 argB
201 JFCK01000101.1 GCA000738245_00092 gene open 41440-42645
202 JFCK01000101.1 GCA000738245_00093 gene open 42665-43600 argF
203 JFCK01000101.1 GCA000738245_00094 gene open 43585-44049 argR
204 JFCK01000101.1 GCA000738245_00095 gene open 44122-45318 argG
205 JFCK01000101.1 GCA000738245_00096 gene open 45381-46820 argH
206 JFCK01000101.1 GCA000738245_00097 gene open 46850-48073 thiF
207 JFCK01000101.1 GCA000738245_00098 gene open 48073-48876
208 JFCK01000101.1 GCA000738245_00099 gene open 48889-49107 thiS
209 JFCK01000101.1 GCA000738245_00100 gene open 49173-50333 thiO
210 JFCK01000101.1 GCA000738245_00101 gene open 50375-51019
211 JFCK01000101.1 GCA000738245_00102 gene open 51009-52949 thiC
212 JFCK01000101.1 GCA000738245_00103 gene open 53165-54820
213 JFCK01000101.1 GCA000738245_00104 gene open 54869-55534
214 JFCK01000101.1 GCA000738245_00105 gene open 55595-57172
215 JFCK01000101.1 GCA000738245_00106 gene open 57221-57388
216 JFCK01000101.1 GCA000738245_00107 gene open 57435-58721 tyrS
217 JFCK01000108.1 GCA000738245_00108 CDS open 117-407 _na     96_aa Fido domain-containing protein
218 JFCK01000108.1 GCA000738245_00108 gene open 117-407
219 JFCK01000109.1 GCA000738245_00109 CDS open 79-369 _na     96_aa Fido domain-containing protein
220 JFCK01000109.1 GCA000738245_00109 gene open 79-369
221 JFCK01000110.1 GCA000738245_00110 CDS open 14-247 _na     77_aa hypothetical protein
222 JFCK01000110.1 GCA000738245_00110 gene open 14-247
223 JFCK01000114.1 GCA000738245_00111 CDS open 209-700 _na     163_aa hypothetical protein
224 JFCK01000114.1 GCA000738245_00112 CDS open 734-1606 _na     290_aa hypothetical protein
225 JFCK01000114.1 GCA000738245_00111 gene open 209-700
226 JFCK01000114.1 GCA000738245_00112 gene open 734-1606
227 JFCK01000118.1 GCA000738245_00113 CDS open 224-922 _na     232_aa hypothetical protein
228 JFCK01000118.1 GCA000738245_00113 gene open 224-922
229 JFCK01000119.1 GCA000738245_00114 gene open 2-77 trnG
230 JFCK01000119.1 GCA000738245_00115 gene open 121-195 trnC
231 JFCK01000119.1 GCA000738245_00116 gene open 224-295 trnV
232 JFCK01000119.1 GCA000738245_00114 tRNA open 2-77 trnG tRNA-Gly(gcc)
233 JFCK01000119.1 GCA000738245_00115 tRNA open 121-195 trnC tRNA-Cys(gca)
234 JFCK01000119.1 GCA000738245_00116 tRNA open 224-295 trnV tRNA-Val(gac)
235 JFCK01000124.1 GCA000738245_00117 CDS open 72-308 _na     78_aa hypothetical protein
236 JFCK01000124.1 GCA000738245_00117 gene open 72-308
237 JFCK01000125.1 repeat_region open 52-233 CRISPR array with 3 repeats of length 29%2C consensus sequence GGCTCATCCCCGCTGGCGCGGGGAGCACA and spacer length 32
238 JFCK01000126.1 GCA000738245_00118 CDS open 251-415 _na     54_aa hypothetical protein
239 JFCK01000126.1 GCA000738245_00118 gene open 251-415
240 JFCK01000127.1 GCA000738245_00119 CDS open 30-176 _na     48_aa hypothetical protein
241 JFCK01000127.1 GCA000738245_00119 gene open 30-176
242 JFCK01000130.1 GCA000738245_00120 CDS open 48-215 _na     55_aa hypothetical protein
243 JFCK01000130.1 GCA000738245_00120 gene open 48-215
244 JFCK01000131.1 GCA000738245_00121 CDS open 120-356 _na     78_aa hypothetical protein
245 JFCK01000131.1 GCA000738245_00121 gene open 120-356
246 JFCK01000139.1 GCA000738245_00122 CDS open 24-200 _na     58_aa type I-E CRISPR-associated protein Cas6/Cse3/CasE
247 JFCK01000139.1 GCA000738245_00122 gene open 24-200
248 JFCK01000140.1 GCA000738245_00123 CDS open 24-200 _na     58_aa hypothetical protein
249 JFCK01000140.1 GCA000738245_00123 gene open 24-200
250 JFCK01000142.1 GCA000738245_00124 CDS open 58-2247 _na     729_aa hypothetical protein
251 JFCK01000142.1 GCA000738245_00125 CDS open 2451-3041 _na     196_aa Sigma-70 family RNA polymerase sigma factor
252 JFCK01000142.1 GCA000738245_00126 CDS open 3080-4093 _na     337_aa Thioredoxin reductase
253 JFCK01000142.1 GCA000738245_00127 CDS open 4223-4546 _na     107_aa trxA thioredoxin
254 JFCK01000142.1 GCA000738245_00128 CDS open 4685-5872 _na     395_aa Putative hydrolase
255 JFCK01000142.1 GCA000738245_00129 CDS open 5846-6736 _na     296_aa hypothetical protein
256 JFCK01000142.1 GCA000738245_00130 CDS open 7038-7619 _na     193_aa Nitroreductase family protein
257 JFCK01000142.1 GCA000738245_00131 CDS open 7635-8390 _na     251_aa parB Chromosome partitioning protein ParB
258 JFCK01000142.1 GCA000738245_00132 CDS open 8945-9886 _na     313_aa parA Chromosome partitioning protein ParA
259 JFCK01000142.1 GCA000738245_00133 CDS open 10015-10683 _na     222_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
260 JFCK01000142.1 GCA000738245_00134 CDS open 11003-11977 _na     324_aa yidC membrane protein insertase YidC
261 JFCK01000142.1 GCA000738245_00135 CDS open 12296-12514 _na     72_aa Ribonuclease P
262 JFCK01000142.1 GCA000738245_00136 CDS open 12766-12909 _na     47_aa rpmH 50S ribosomal protein L34
263 JFCK01000142.1 GCA000738245_00137 CDS open 13671-15392 _na     573_aa dnaA chromosomal replication initiator protein DnaA
264 JFCK01000142.1 GCA000738245_00138 CDS open 15947-17191 _na     414_aa dnaN DNA polymerase III subunit beta
265 JFCK01000142.1 GCA000738245_00139 CDS open 17226-18530 _na     434_aa recF DNA replication/repair protein RecF
266 JFCK01000142.1 GCA000738245_00140 CDS open 18520-19047 _na     175_aa DUF721 domain-containing protein
267 JFCK01000142.1 GCA000738245_00141 CDS open 19162-21186 _na     674_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
268 JFCK01000142.1 GCA000738245_00142 CDS open 21271-22194 _na     307_aa Alpha/beta fold hydrolase
269 JFCK01000142.1 GCA000738245_00143 CDS open 22302-22493 _na     63_aa hypothetical protein
270 JFCK01000142.1 GCA000738245_00124 gene open 58-2247
271 JFCK01000142.1 GCA000738245_00125 gene open 2451-3041
272 JFCK01000142.1 GCA000738245_00126 gene open 3080-4093
273 JFCK01000142.1 GCA000738245_00127 gene open 4223-4546 trxA
274 JFCK01000142.1 GCA000738245_00128 gene open 4685-5872
275 JFCK01000142.1 GCA000738245_00129 gene open 5846-6736
276 JFCK01000142.1 GCA000738245_00130 gene open 7038-7619
277 JFCK01000142.1 GCA000738245_00131 gene open 7635-8390 parB
278 JFCK01000142.1 GCA000738245_00132 gene open 8945-9886 parA
279 JFCK01000142.1 GCA000738245_00133 gene open 10015-10683 rsmG
280 JFCK01000142.1 GCA000738245_00134 gene open 11003-11977 yidC
281 JFCK01000142.1 GCA000738245_00135 gene open 12296-12514
282 JFCK01000142.1 GCA000738245_00136 gene open 12766-12909 rpmH
283 JFCK01000142.1 GCA000738245_00137 gene open 13671-15392 dnaA
284 JFCK01000142.1 GCA000738245_00138 gene open 15947-17191 dnaN
285 JFCK01000142.1 GCA000738245_00139 gene open 17226-18530 recF
286 JFCK01000142.1 GCA000738245_00140 gene open 18520-19047
287 JFCK01000142.1 GCA000738245_00141 gene open 19162-21186 gyrB
288 JFCK01000142.1 GCA000738245_00142 gene open 21271-22194
289 JFCK01000142.1 GCA000738245_00143 gene open 22302-22493
290 JFCK01000145.1 GCA000738245_00144 CDS open 592-3282 _na     896_aa non-specific serine/threonine protein kinase
291 JFCK01000145.1 GCA000738245_00145 CDS open 3279-4421 _na     380_aa Transporter substrate-binding domain-containing protein
292 JFCK01000145.1 GCA000738245_00146 CDS open 4421-5839 _na     472_aa Chemotaxis methyl-accepting receptor HlyB-like 4HB MCP domain-containing protein
293 JFCK01000145.1 GCA000738245_00147 CDS open 5911-6969 _na     352_aa ABC transporter ATP-binding protein
294 JFCK01000145.1 GCA000738245_00148 CDS open 6969-7781 _na     270_aa ABC transporter permease
295 JFCK01000145.1 GCA000738245_00149 CDS open 7872-8414 _na     180_aa Putative transcriptional regulator (MarR family)
296 JFCK01000145.1 GCA000738245_00150 CDS open 8551-10062 _na     503_aa cls cardiolipin synthase
297 JFCK01000145.1 GCA000738245_00151 CDS open 10066-10890 _na     274_aa exodeoxyribonuclease III
298 JFCK01000145.1 GCA000738245_00152 CDS open 10902-11912 _na     336_aa GNAT family N-acetyltransferase
299 JFCK01000145.1 GCA000738245_00153 CDS open 11905-12477 _na     190_aa peptide deformylase
300 JFCK01000145.1 GCA000738245_00154 CDS open 12485-12721 _na     78_aa Fis family transcriptional regulator
301 JFCK01000145.1 GCA000738245_00155 CDS open 12776-13468 _na     230_aa lytR LytR C-terminal domain-containing protein
302 JFCK01000145.1 GCA000738245_00156 CDS open 13518-14696 _na     392_aa glutamate--cysteine ligase
303 JFCK01000145.1 GCA000738245_00157 CDS open 14762-15382 _na     206_aa Acetyl-CoA acetyltransferase
304 JFCK01000145.1 GCA000738245_00158 CDS open 15638-17029 _na     463_aa Putative peptidase
305 JFCK01000145.1 GCA000738245_00159 CDS open 17308-18951 _na     547_aa groL chaperonin GroEL
306 JFCK01000145.1 GCA000738245_00160 CDS open 19218-19343 _na     41_aa putative cell wall channel
307 JFCK01000145.1 GCA000738245_00161 CDS open 19516-20406 _na     296_aa ppk2 polyphosphate kinase 2
308 JFCK01000145.1 GCA000738245_00162 CDS open 20403-24305 _na     1300_aa Putative peptide synthase
309 JFCK01000145.1 GCA000738245_00163 CDS open 24313-24747 _na     144_aa Putative transcriptional regulator (MarR family)
310 JFCK01000145.1 GCA000738245_00164 CDS open 24792-25103 _na     103_aa Rhodanese domain-containing protein
311 JFCK01000145.1 GCA000738245_00165 CDS open 25203-27602 _na     799_aa Cation-transporting P-type ATPase N-terminal domain-containing protein
312 JFCK01000145.1 GCA000738245_00166 CDS open 27615-28106 _na     163_aa Inorganic pyrophosphatase
313 JFCK01000145.1 GCA000738245_00167 CDS open 28144-29478 _na     444_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
314 JFCK01000145.1 GCA000738245_00168 CDS open 29517-30575 _na     352_aa tRNA(Ile)-lysidine synthase
315 JFCK01000145.1 GCA000738245_00169 CDS open 30666-31247 _na     193_aa hpt hypoxanthine phosphoribosyltransferase
316 JFCK01000145.1 GCA000738245_00170 CDS open 31335-33716 _na     793_aa ftsH ATP-dependent zinc metalloprotease FtsH
317 JFCK01000145.1 GCA000738245_00171 CDS open 33716-34312 _na     198_aa folE GTP cyclohydrolase I FolE
318 JFCK01000145.1 GCA000738245_00172 CDS open 34309-35217 _na     302_aa folP dihydropteroate synthase
319 JFCK01000145.1 GCA000738245_00173 CDS open 35210-35638 _na     142_aa folB dihydroneopterin aldolase
320 JFCK01000145.1 GCA000738245_00174 CDS open 35635-36174 _na     179_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
321 JFCK01000145.1 GCA000738245_00175 CDS open 36199-36690 _na     163_aa DUF3180 domain-containing protein
322 JFCK01000145.1 GCA000738245_00176 CDS open 36671-37795 _na     374_aa DUF6779 domain-containing protein
323 JFCK01000145.1 GCA000738245_00177 CDS open 37846-38745 _na     299_aa DUF2520 domain-containing protein
324 JFCK01000145.1 GCA000738245_00178 CDS open 38751-39689 _na     312_aa panC pantoate--beta-alanine ligase
325 JFCK01000145.1 GCA000738245_00179 CDS open 39694-40710 _na     338_aa Aldose 1-epimerase family protein
326 JFCK01000145.1 GCA000738245_00180 CDS open 40855-42489 _na     544_aa Sodium/glucose cotransporter
327 JFCK01000145.1 GCA000738245_00181 CDS open 42527-42826 _na     99_aa Cell wall anchor protein
328 JFCK01000145.1 GCA000738245_00182 CDS open 42934-44073 _na     379_aa galT galactose-1-phosphate uridylyltransferase
329 JFCK01000145.1 GCA000738245_00183 CDS open 44063-45322 _na     419_aa galK galactokinase
330 JFCK01000145.1 GCA000738245_00184 CDS open 45462-45866 _na     134_aa panD aspartate 1-decarboxylase
331 JFCK01000145.1 GCA000738245_00185 CDS open 45863-47050 _na     395_aa Secreted protein
332 JFCK01000145.1 GCA000738245_00186 CDS open 47210-48817 _na     535_aa lysS lysine--tRNA ligase
333 JFCK01000145.1 GCA000738245_00187 CDS open 49130-50548 _na     472_aa Acyl-CoA dehydrogenase
334 JFCK01000145.1 GCA000738245_00188 CDS open 50609-51817 _na     402_aa Acyl-CoA dehydrogenase
335 JFCK01000145.1 GCA000738245_00189 CDS open 51836-52717 _na     293_aa Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
336 JFCK01000145.1 GCA000738245_00190 CDS open 53346-55109 _na     587_aa Acyl-CoA synthetase
337 JFCK01000145.1 GCA000738245_00191 CDS open 55559-58213 _na     884_aa ATP-dependent Clp protease ATP-binding subunit
338 JFCK01000145.1 GCA000738245_00192 CDS open 58214-59587 _na     457_aa Lipase family protein
339 JFCK01000145.1 GCA000738245_00193 CDS open 59636-61057 _na     473_aa brnQ branched-chain amino acid transport system II carrier protein
340 JFCK01000145.1 GCA000738245_00194 CDS open 61153-62172 _na     339_aa Adenine DNA glycosylase
341 JFCK01000145.1 GCA000738245_00195 CDS open 62209-62853 _na     214_aa Carbonic anhydrase
342 JFCK01000145.1 GCA000738245_00196 CDS open 62899-63624 _na     241_aa Secreted protein
343 JFCK01000145.1 GCA000738245_00197 CDS open 63646-64860 _na     404_aa radA DNA repair protein RadA
344 JFCK01000145.1 GCA000738245_00198 CDS open 65170-65766 _na     198_aa lpqE Lipoprotein LpqE
345 JFCK01000145.1 GCA000738245_00199 CDS open 66012-66602 _na     196_aa carD CarD family transcriptional regulator
346 JFCK01000145.1 GCA000738245_00200 CDS open 66617-67444 _na     275_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
347 JFCK01000145.1 GCA000738245_00201 CDS open 67496-67987 _na     163_aa ispF 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
348 JFCK01000145.1 GCA000738245_00202 CDS open 68066-68797 _na     243_aa Putative ABC transport system%2C ATP-binding protein
349 JFCK01000145.1 GCA000738245_00203 CDS open 68784-69971 _na     395_aa ABC transporter permease
350 JFCK01000145.1 GCA000738245_00204 CDS open 69971-70564 _na     197_aa hypothetical protein
351 JFCK01000145.1 GCA000738245_00205 CDS open 70554-71372 _na     272_aa Putative 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase
352 JFCK01000145.1 GCA000738245_00206 CDS open 71417-72871 _na     484_aa cysS cysteine--tRNA ligase
353 JFCK01000145.1 GCA000738245_00207 CDS open 72828-73415 _na     195_aa Cell-surface hemin receptor
354 JFCK01000145.1 GCA000738245_00208 CDS open 73626-75560 _na     644_aa Putative membrane protein
355 JFCK01000145.1 GCA000738245_00209 CDS open 75609-76700 _na     363_aa Putative iron ABC transport system%2C solute-binding protein
356 JFCK01000145.1 GCA000738245_00210 CDS open 76684-77733 _na     349_aa Iron ABC transporter permease
357 JFCK01000145.1 GCA000738245_00211 CDS open 77730-78638 _na     302_aa heme ABC transporter ATP-binding protein
358 JFCK01000145.1 GCA000738245_00212 CDS open 78644-79795 _na     383_aa Htaa domain-containing protein
359 JFCK01000145.1 GCA000738245_00213 CDS open 79876-80550 _na     224_aa hmuO HmuO protein
360 JFCK01000145.1 GCA000738245_00214 CDS open 80591-81448 _na     285_aa Htaa domain-containing protein
361 JFCK01000145.1 GCA000738245_00215 CDS open 81652-82608 _na     318_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
362 JFCK01000145.1 GCA000738245_00216 CDS open 82659-83225 _na     188_aa Putative transcriptional regulator (TetR family)
363 JFCK01000145.1 GCA000738245_00217 CDS open 83348-84358 _na     336_aa Putative membrane protein
364 JFCK01000145.1 GCA000738245_00218 CDS open 84410-86068 _na     552_aa Carboxylic ester hydrolase
365 JFCK01000145.1 GCA000738245_00219 CDS open 86156-87094 _na     312_aa Metal ABC transporter permease
366 JFCK01000145.1 GCA000738245_00220 CDS open 87091-87792 _na     233_aa Putative ABC transport system%2C ATP-binding protein
367 JFCK01000145.1 GCA000738245_00221 CDS open 87792-88688 _na     298_aa ABC transporter substrate-binding protein
368 JFCK01000145.1 GCA000738245_00222 CDS open 88711-89937 _na     408_aa Putative transcriptional regulator (LacI family)
369 JFCK01000145.1 GCA000738245_00223 CDS open 89902-90771 _na     289_aa otsB trehalose-phosphatase
370 JFCK01000145.1 GCA000738245_00224 CDS open 90775-91275 _na     166_aa Putative secreted protein
371 JFCK01000145.1 GCA000738245_00225 CDS open 91275-92741 _na     488_aa alpha%2Calpha-trehalose-phosphate synthase (ADP-forming)
372 JFCK01000145.1 GCA000738245_00226 CDS open 92774-93172 _na     132_aa Histone
373 JFCK01000145.1 GCA000738245_00227 CDS open 93242-94837 _na     531_aa thrE threonine/serine exporter ThrE
374 JFCK01000145.1 GCA000738245_00230 CDS open 95454-95969 _na     171_aa Cytoplasmic protein
375 JFCK01000145.1 GCA000738245_00231 CDS open 95938-96792 _na     284_aa recombinase family protein
376 JFCK01000145.1 GCA000738245_00144 gene open 592-3282
377 JFCK01000145.1 GCA000738245_00145 gene open 3279-4421
378 JFCK01000145.1 GCA000738245_00146 gene open 4421-5839
379 JFCK01000145.1 GCA000738245_00147 gene open 5911-6969
380 JFCK01000145.1 GCA000738245_00148 gene open 6969-7781
381 JFCK01000145.1 GCA000738245_00149 gene open 7872-8414
382 JFCK01000145.1 GCA000738245_00150 gene open 8551-10062 cls
383 JFCK01000145.1 GCA000738245_00151 gene open 10066-10890
384 JFCK01000145.1 GCA000738245_00152 gene open 10902-11912
385 JFCK01000145.1 GCA000738245_00153 gene open 11905-12477
386 JFCK01000145.1 GCA000738245_00154 gene open 12485-12721
387 JFCK01000145.1 GCA000738245_00155 gene open 12776-13468 lytR
388 JFCK01000145.1 GCA000738245_00156 gene open 13518-14696
389 JFCK01000145.1 GCA000738245_00157 gene open 14762-15382
390 JFCK01000145.1 GCA000738245_00158 gene open 15638-17029
391 JFCK01000145.1 GCA000738245_00159 gene open 17308-18951 groL
392 JFCK01000145.1 GCA000738245_00160 gene open 19218-19343
393 JFCK01000145.1 GCA000738245_00161 gene open 19516-20406 ppk2
394 JFCK01000145.1 GCA000738245_00162 gene open 20403-24305
395 JFCK01000145.1 GCA000738245_00163 gene open 24313-24747
396 JFCK01000145.1 GCA000738245_00164 gene open 24792-25103
397 JFCK01000145.1 GCA000738245_00165 gene open 25203-27602
398 JFCK01000145.1 GCA000738245_00166 gene open 27615-28106
399 JFCK01000145.1 GCA000738245_00167 gene open 28144-29478 dacB
400 JFCK01000145.1 GCA000738245_00168 gene open 29517-30575
401 JFCK01000145.1 GCA000738245_00169 gene open 30666-31247 hpt
402 JFCK01000145.1 GCA000738245_00170 gene open 31335-33716 ftsH
403 JFCK01000145.1 GCA000738245_00171 gene open 33716-34312 folE
404 JFCK01000145.1 GCA000738245_00172 gene open 34309-35217 folP
405 JFCK01000145.1 GCA000738245_00173 gene open 35210-35638 folB
406 JFCK01000145.1 GCA000738245_00174 gene open 35635-36174 folK
407 JFCK01000145.1 GCA000738245_00175 gene open 36199-36690
408 JFCK01000145.1 GCA000738245_00176 gene open 36671-37795
409 JFCK01000145.1 GCA000738245_00177 gene open 37846-38745
410 JFCK01000145.1 GCA000738245_00178 gene open 38751-39689 panC
411 JFCK01000145.1 GCA000738245_00179 gene open 39694-40710
412 JFCK01000145.1 GCA000738245_00180 gene open 40855-42489
413 JFCK01000145.1 GCA000738245_00181 gene open 42527-42826
414 JFCK01000145.1 GCA000738245_00182 gene open 42934-44073 galT
415 JFCK01000145.1 GCA000738245_00183 gene open 44063-45322 galK
416 JFCK01000145.1 GCA000738245_00184 gene open 45462-45866 panD
417 JFCK01000145.1 GCA000738245_00185 gene open 45863-47050
418 JFCK01000145.1 GCA000738245_00186 gene open 47210-48817 lysS
419 JFCK01000145.1 GCA000738245_00187 gene open 49130-50548
420 JFCK01000145.1 GCA000738245_00188 gene open 50609-51817
421 JFCK01000145.1 GCA000738245_00189 gene open 51836-52717
422 JFCK01000145.1 GCA000738245_00190 gene open 53346-55109
423 JFCK01000145.1 GCA000738245_00191 gene open 55559-58213
424 JFCK01000145.1 GCA000738245_00192 gene open 58214-59587
425 JFCK01000145.1 GCA000738245_00193 gene open 59636-61057 brnQ
426 JFCK01000145.1 GCA000738245_00194 gene open 61153-62172
427 JFCK01000145.1 GCA000738245_00195 gene open 62209-62853
428 JFCK01000145.1 GCA000738245_00196 gene open 62899-63624
429 JFCK01000145.1 GCA000738245_00197 gene open 63646-64860 radA
430 JFCK01000145.1 GCA000738245_00198 gene open 65170-65766 lpqE
431 JFCK01000145.1 GCA000738245_00199 gene open 66012-66602 carD
432 JFCK01000145.1 GCA000738245_00200 gene open 66617-67444 ispD
433 JFCK01000145.1 GCA000738245_00201 gene open 67496-67987 ispF
434 JFCK01000145.1 GCA000738245_00202 gene open 68066-68797
435 JFCK01000145.1 GCA000738245_00203 gene open 68784-69971
436 JFCK01000145.1 GCA000738245_00204 gene open 69971-70564
437 JFCK01000145.1 GCA000738245_00205 gene open 70554-71372
438 JFCK01000145.1 GCA000738245_00206 gene open 71417-72871 cysS
439 JFCK01000145.1 GCA000738245_00207 gene open 72828-73415
440 JFCK01000145.1 GCA000738245_00208 gene open 73626-75560
441 JFCK01000145.1 GCA000738245_00209 gene open 75609-76700
442 JFCK01000145.1 GCA000738245_00210 gene open 76684-77733
443 JFCK01000145.1 GCA000738245_00211 gene open 77730-78638
444 JFCK01000145.1 GCA000738245_00212 gene open 78644-79795
445 JFCK01000145.1 GCA000738245_00213 gene open 79876-80550 hmuO
446 JFCK01000145.1 GCA000738245_00214 gene open 80591-81448
447 JFCK01000145.1 GCA000738245_00215 gene open 81652-82608 rlmB
448 JFCK01000145.1 GCA000738245_00216 gene open 82659-83225
449 JFCK01000145.1 GCA000738245_00217 gene open 83348-84358
450 JFCK01000145.1 GCA000738245_00218 gene open 84410-86068
451 JFCK01000145.1 GCA000738245_00219 gene open 86156-87094
452 JFCK01000145.1 GCA000738245_00220 gene open 87091-87792
453 JFCK01000145.1 GCA000738245_00221 gene open 87792-88688
454 JFCK01000145.1 GCA000738245_00222 gene open 88711-89937
455 JFCK01000145.1 GCA000738245_00223 gene open 89902-90771 otsB
456 JFCK01000145.1 GCA000738245_00224 gene open 90775-91275
457 JFCK01000145.1 GCA000738245_00225 gene open 91275-92741
458 JFCK01000145.1 GCA000738245_00226 gene open 92774-93172
459 JFCK01000145.1 GCA000738245_00227 gene open 93242-94837 thrE
460 JFCK01000145.1 GCA000738245_00230 gene open 95454-95969
461 JFCK01000145.1 GCA000738245_00231 gene open 95938-96792
462 JFCK01000145.1 GCA000738245_00228 gene open 95067-95139 trnT
463 JFCK01000145.1 GCA000738245_00229 gene open 95187-95260 trnG
464 JFCK01000145.1 GCA000738245_00228 tRNA open 95067-95139 trnT tRNA-Thr(tgt)
465 JFCK01000145.1 GCA000738245_00229 tRNA open 95187-95260 trnG tRNA-Gly(ccc)
466 JFCK01000149.1 GCA000738245_00232 gene open 109-180 trnQ
467 JFCK01000149.1 GCA000738245_00233 gene open 182-254 trnE
468 JFCK01000149.1 GCA000738245_00232 tRNA open 109-180 trnQ tRNA-Gln(ctg)
469 JFCK01000149.1 GCA000738245_00233 tRNA open 182-254 trnE tRNA-Glu(ctc)
470 JFCK01000152.1 GCA000738245_00234 CDS open 132-278 _na     48_aa hypothetical protein
471 JFCK01000152.1 GCA000738245_00234 gene open 132-278
472 JFCK01000153.1 GCA000738245_00235 CDS open 113-307 _na     64_aa hypothetical protein
473 JFCK01000153.1 GCA000738245_00235 gene open 113-307
474 JFCK01000154.1 GCA000738245_00236 CDS open 184-360 _na     58_aa hypothetical protein
475 JFCK01000154.1 GCA000738245_00236 gene open 184-360
476 JFCK01000154.1 GCA000738245_00237 gene open 525-596 trnI
477 JFCK01000154.1 GCA000738245_00237 tRNA open 525-596 trnI tRNA-Ile2(cat)
478 JFCK01000155.1 repeat_region open 51-234 CRISPR array with 3 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCCAGCGGGGATGAGCC and spacer length 33
479 JFCK01000157.1 GCA000738245_00238 CDS open 224-1309 _na     361_aa ychF redox-regulated ATPase YchF
480 JFCK01000157.1 GCA000738245_00239 CDS open 1433-1702 _na     89_aa Ribosome-associated protein
481 JFCK01000157.1 GCA000738245_00240 CDS open 1895-2245 _na     116_aa Mercuric ion transport protein
482 JFCK01000157.1 GCA000738245_00241 CDS open 2242-3663 _na     473_aa merA mercury(II) reductase
483 JFCK01000157.1 GCA000738245_00242 CDS open 3762-4151 _na     129_aa soxR HTH merR-type domain-containing protein
484 JFCK01000157.1 GCA000738245_00243 CDS open 4195-4323 _na     42_aa Monooxygenase
485 JFCK01000157.1 GCA000738245_00238 gene open 224-1309 ychF
486 JFCK01000157.1 GCA000738245_00239 gene open 1433-1702
487 JFCK01000157.1 GCA000738245_00240 gene open 1895-2245
488 JFCK01000157.1 GCA000738245_00241 gene open 2242-3663 merA
489 JFCK01000157.1 GCA000738245_00242 gene open 3762-4151 soxR
490 JFCK01000157.1 GCA000738245_00243 gene open 4195-4323
491 JFCK01000158.1 GCA000738245_00244 CDS open 28-174 _na     48_aa hypothetical protein
492 JFCK01000158.1 GCA000738245_00244 gene open 28-174
493 JFCK01000164.1 GCA000738245_00245 CDS open 113-1219 _na     368_aa Integrase
494 JFCK01000164.1 GCA000738245_00246 CDS open 1315-2055 _na     246_aa hypothetical protein
495 JFCK01000164.1 GCA000738245_00247 CDS open 2052-2453 _na     133_aa ImmA/IrrE family metallo-endopeptidase
496 JFCK01000164.1 GCA000738245_00248 CDS open 2574-3263 _na     229_aa DUF3800 domain-containing protein
497 JFCK01000164.1 GCA000738245_00249 CDS open 3247-3720 _na     157_aa DNA-binding protein
498 JFCK01000164.1 GCA000738245_00250 CDS open 3875-4099 _na     74_aa Transcriptional regulator
499 JFCK01000164.1 GCA000738245_00251 CDS open 4154-5053 _na     299_aa parB ParB N-terminal domain-containing protein
500 JFCK01000164.1 GCA000738245_00252 CDS open 5047-5571 _na     174_aa hypothetical protein