HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium macclintockiae (GCA_000738245.1)

Select a Genome:
BAKTA Annotations for GCA_000738245.1
Genome Selected: Corynebacterium macclintockiae
ContigsBases CDSrRNA tmRNAtRNA
263 2411235 2089 3 1 54
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4307 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4307 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JFCK01000248.1 GCA000738245_01742 gene open 19531-19788
3502 JFCK01000248.1 GCA000738245_01743 gene open 19794-20099
3503 JFCK01000248.1 GCA000738245_01744 gene open 20304-22499 zntA
3504 JFCK01000248.1 GCA000738245_01745 gene open 22551-22877 copZ
3505 JFCK01000248.1 GCA000738245_01746 gene open 23017-24144 baeS
3506 JFCK01000248.1 GCA000738245_01747 gene open 24141-24863 ompR
3507 JFCK01000248.1 GCA000738245_01748 gene open 25237-25842
3508 JFCK01000248.1 GCA000738245_01749 gene open 25914-27389 sufI
3509 JFCK01000248.1 GCA000738245_01750 gene open 27841-28161
3510 JFCK01000248.1 GCA000738245_01751 gene open 28264-29118 erm(X)
3511 JFCK01000248.1 GCA000738245_01753 gene open 30025-30384 arsR
3512 JFCK01000248.1 GCA000738245_01754 gene open 30381-32273 zntA
3513 JFCK01000249.1 GCA000738245_01755 CDS open 439-1434 _na     331_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
3514 JFCK01000249.1 GCA000738245_01756 CDS open 1697-3394 _na     565_aa ctaD cytochrome c oxidase subunit I
3515 JFCK01000249.1 GCA000738245_01755 gene open 439-1434 nrdF
3516 JFCK01000249.1 GCA000738245_01756 gene open 1697-3394 ctaD
3517 JFCK01000250.1 GCA000738245_01768 gene open 14026-14143 rrf
3518 JFCK01000250.1 GCA000738245_01768 rRNA open 14026-14143 rrf 5S ribosomal RNA
3519 JFCK01000250.1 GCA000738245_01757 CDS open 2-1375 _na     457_aa DNA 3'-5' helicase XPB
3520 JFCK01000250.1 GCA000738245_01758 CDS open 1412-2104 _na     230_aa DUF3239 domain-containing protein
3521 JFCK01000250.1 GCA000738245_01759 CDS open 2266-3042 _na     258_aa pxpA 5-oxoprolinase subunit A
3522 JFCK01000250.1 GCA000738245_01760 CDS open 3039-4712 _na     557_aa 5-oxoprolinase/urea amidolyase family protein
3523 JFCK01000250.1 GCA000738245_01761 CDS open 4762-6576 _na     604_aa biotin carboxylase
3524 JFCK01000250.1 GCA000738245_01762 CDS open 6591-7235 _na     214_aa gntR GntR family transcriptional regulator
3525 JFCK01000250.1 GCA000738245_01763 CDS open 7265-8077 _na     270_aa putative hydro-lyase
3526 JFCK01000250.1 GCA000738245_01764 CDS open 8116-9390 _na     424_aa NRAMP family divalent metal transporter
3527 JFCK01000250.1 GCA000738245_01765 CDS open 9436-10398 _na     320_aa Alpha/beta hydrolase
3528 JFCK01000250.1 GCA000738245_01766 CDS open 10428-13067 _na     879_aa ABC transporter permease
3529 JFCK01000250.1 GCA000738245_01767 CDS open 13070-13822 _na     250_aa ABC transporter ATP-binding protein
3530 JFCK01000250.1 GCA000738245_01757 gene open 2-1375
3531 JFCK01000250.1 GCA000738245_01758 gene open 1412-2104
3532 JFCK01000250.1 GCA000738245_01759 gene open 2266-3042 pxpA
3533 JFCK01000250.1 GCA000738245_01760 gene open 3039-4712
3534 JFCK01000250.1 GCA000738245_01761 gene open 4762-6576
3535 JFCK01000250.1 GCA000738245_01762 gene open 6591-7235 gntR
3536 JFCK01000250.1 GCA000738245_01763 gene open 7265-8077
3537 JFCK01000250.1 GCA000738245_01764 gene open 8116-9390
3538 JFCK01000250.1 GCA000738245_01765 gene open 9436-10398
3539 JFCK01000250.1 GCA000738245_01766 gene open 10428-13067
3540 JFCK01000250.1 GCA000738245_01767 gene open 13070-13822
3541 JFCK01000251.1 GCA000738245_01769 CDS open 1054-2091 _na     345_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
3542 JFCK01000251.1 GCA000738245_01770 CDS open 2171-2908 _na     245_aa DUF6542 domain-containing protein
3543 JFCK01000251.1 GCA000738245_01771 CDS open 3098-4918 _na     606_aa AI-2E family transporter
3544 JFCK01000251.1 GCA000738245_01772 CDS open 4980-5159 _na     59_aa metS methionine/alanine import NSS transporter subunit MetS
3545 JFCK01000251.1 GCA000738245_01773 CDS open 5156-6781 _na     541_aa Transporter
3546 JFCK01000251.1 GCA000738245_01769 gene open 1054-2091
3547 JFCK01000251.1 GCA000738245_01770 gene open 2171-2908
3548 JFCK01000251.1 GCA000738245_01771 gene open 3098-4918
3549 JFCK01000251.1 GCA000738245_01772 gene open 4980-5159 metS
3550 JFCK01000251.1 GCA000738245_01773 gene open 5156-6781
3551 JFCK01000252.1 GCA000738245_01774 CDS open 3-1331 _na     442_aa glycine--tRNA ligase
3552 JFCK01000252.1 GCA000738245_01775 CDS open 1334-1957 _na     207_aa DUF3068 domain-containing protein
3553 JFCK01000252.1 GCA000738245_01774 gene open 3-1331
3554 JFCK01000252.1 GCA000738245_01775 gene open 1334-1957
3555 JFCK01000253.1 GCA000738245_01776 CDS open 159-464 _na     101_aa hypothetical protein
3556 JFCK01000253.1 GCA000738245_01777 CDS open 804-2297 _na     497_aa pta phosphate acetyltransferase
3557 JFCK01000253.1 GCA000738245_01778 CDS open 2395-3402 _na     335_aa putative membrane transporter protein
3558 JFCK01000253.1 GCA000738245_01779 CDS open 3500-4291 _na     263_aa Sirohydrochlorin cobaltochelatase
3559 JFCK01000253.1 GCA000738245_01780 CDS open 4293-5267 _na     324_aa sulfate adenylyltransferase
3560 JFCK01000253.1 GCA000738245_01776 gene open 159-464
3561 JFCK01000253.1 GCA000738245_01777 gene open 804-2297 pta
3562 JFCK01000253.1 GCA000738245_01778 gene open 2395-3402
3563 JFCK01000253.1 GCA000738245_01779 gene open 3500-4291
3564 JFCK01000253.1 GCA000738245_01780 gene open 4293-5267
3565 JFCK01000254.1 GCA000738245_01781 CDS open 618-3131 _na     837_aa gyrA DNA gyrase subunit A
3566 JFCK01000254.1 GCA000738245_01782 CDS open 3278-3958 _na     226_aa DUF3566 domain-containing protein
3567 JFCK01000254.1 GCA000738245_01785 CDS open 4567-4677 _na     36_aa hypothetical protein
3568 JFCK01000254.1 GCA000738245_01786 CDS open 4841-6742 _na     633_aa ycaO YcaO domain-containing protein
3569 JFCK01000254.1 GCA000738245_01787 CDS open 7092-8822 _na     576_aa RNA-binding domain-containing protein
3570 JFCK01000254.1 GCA000738245_01788 CDS open 8883-9026 _na     47_aa hypothetical protein
3571 JFCK01000254.1 GCA000738245_01789 CDS open 9199-10911 _na     570_aa Putative membrane protein
3572 JFCK01000254.1 GCA000738245_01790 CDS open 11165-11584 _na     139_aa Pentapeptide MXKDX repeat protein
3573 JFCK01000254.1 GCA000738245_01791 CDS open 11676-12227 _na     183_aa ECF-family sigma factor K
3574 JFCK01000254.1 GCA000738245_01792 CDS open 12224-13033 _na     269_aa Anti-sigma factor
3575 JFCK01000254.1 GCA000738245_01793 CDS open 13080-13448 _na     122_aa mmpS MmpS family transport accessory protein
3576 JFCK01000254.1 GCA000738245_01794 CDS open 13659-13913 _na     84_aa hypothetical protein
3577 JFCK01000254.1 GCA000738245_01795 CDS open 13928-15847 _na     639_aa Putative membrane protein
3578 JFCK01000254.1 GCA000738245_01796 CDS open 15893-16576 _na     227_aa TetR/AcrR family transcriptional regulator
3579 JFCK01000254.1 GCA000738245_01797 CDS open 16820-18211 _na     463_aa DNA binding domain-containing protein
3580 JFCK01000254.1 GCA000738245_01798 CDS open 18313-19866 _na     517_aa pabB aminodeoxychorismate synthase component I
3581 JFCK01000254.1 GCA000738245_01799 CDS open 19907-21298 _na     463_aa tolA TolA protein
3582 JFCK01000254.1 GCA000738245_01800 CDS open 21463-21987 _na     174_aa Peptidyl-prolyl cis-trans isomerase
3583 JFCK01000254.1 GCA000738245_01801 CDS open 21984-22694 _na     236_aa Rhomboid family intramembrane serine protease
3584 JFCK01000254.1 GCA000738245_01802 CDS open 22703-22975 _na     90_aa crgA cell division protein CrgA
3585 JFCK01000254.1 GCA000738245_01803 CDS open 23158-23859 _na     233_aa Gamma-glutamyl-gamma-aminobutyrate hydrolase family protein
3586 JFCK01000254.1 GCA000738245_01804 CDS open 23872-26073 _na     733_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
3587 JFCK01000254.1 GCA000738245_01805 CDS open 26256-27914 _na     552_aa non-specific serine/threonine protein kinase
3588 JFCK01000254.1 GCA000738245_01806 CDS open 27917-29365 _na     482_aa Putative penicillin-binding protein 2
3589 JFCK01000254.1 GCA000738245_01807 CDS open 29362-30669 _na     435_aa rodA Cell division protein RodA
3590 JFCK01000254.1 GCA000738245_01808 CDS open 30673-32235 _na     520_aa Protein phosphatase 2C domain-containing protein
3591 JFCK01000254.1 GCA000738245_01809 CDS open 32232-32729 _na     165_aa FHA domain-containing protein
3592 JFCK01000254.1 GCA000738245_01810 CDS open 32877-34037 _na     386_aa FHA domain-containing protein
3593 JFCK01000254.1 GCA000738245_01812 CDS open 34613-35215 _na     200_aa DJ-1/PfpI family protein
3594 JFCK01000254.1 GCA000738245_01813 CDS open 35208-36185 _na     325_aa NAD(P)/FAD-dependent oxidoreductase
3595 JFCK01000254.1 GCA000738245_01814 CDS open 36454-36744 _na     96_aa Threonine dehydratase
3596 JFCK01000254.1 GCA000738245_01815 CDS open 36823-37386 _na     187_aa MFS transporter
3597 JFCK01000254.1 GCA000738245_01816 CDS open 37440-37871 _na     143_aa vapC Ribonuclease VapC
3598 JFCK01000254.1 GCA000738245_01817 CDS open 37858-38142 _na     94_aa copG CopG family transcriptional regulator
3599 JFCK01000254.1 GCA000738245_01818 CDS open 38367-38717 _na     116_aa rpfC Resuscitation-promoting factor RpfC
3600 JFCK01000254.1 GCA000738245_01819 CDS open 38745-39479 _na     244_aa DUF4442 domain-containing protein
3601 JFCK01000254.1 GCA000738245_01820 CDS open 39946-40482 _na     178_aa HNH endonuclease family protein
3602 JFCK01000254.1 GCA000738245_01821 CDS open 40490-41128 _na     212_aa DNA-3-methyladenine glycosylase
3603 JFCK01000254.1 GCA000738245_01822 CDS open 41299-42462 _na     387_aa cystathionine gamma-synthase
3604 JFCK01000254.1 GCA000738245_01823 CDS open 42474-42890 _na     138_aa Secreted protein
3605 JFCK01000254.1 GCA000738245_01824 CDS open 42913-43989 _na     358_aa hypothetical protein
3606 JFCK01000254.1 GCA000738245_01825 CDS open 44165-45154 _na     329_aa DUF3558 domain-containing protein
3607 JFCK01000254.1 GCA000738245_01826 CDS open 45301-46077 _na     258_aa SDR family oxidoreductase
3608 JFCK01000254.1 GCA000738245_01827 CDS open 46105-46422 _na     105_aa UPF0145 protein jk0060
3609 JFCK01000254.1 GCA000738245_01828 CDS open 46682-47929 _na     415_aa DNA (cytosine-5-)-methyltransferase
3610 JFCK01000254.1 GCA000738245_01829 CDS open 47909-48679 _na     256_aa Eco47II family restriction endonuclease
3611 JFCK01000254.1 GCA000738245_01830 CDS open 48846-51275 _na     809_aa Acyltransferase
3612 JFCK01000254.1 GCA000738245_01831 CDS open 51399-51893 _na     164_aa Gamma-type carbonic anhydratase-like protein
3613 JFCK01000254.1 GCA000738245_01832 CDS open 52046-52579 _na     177_aa Flavodoxin family protein
3614 JFCK01000254.1 GCA000738245_01833 CDS open 52586-52939 _na     117_aa Secreted protein
3615 JFCK01000254.1 GCA000738245_01834 CDS open 53047-54018 _na     323_aa Putative dioxygenase related to 2-nitropropane dioxygenases
3616 JFCK01000254.1 GCA000738245_01835 CDS open 54090-55139 _na     349_aa Prolyl oligopeptidase family serine peptidase
3617 JFCK01000254.1 GCA000738245_01836 CDS open 55258-55578 _na     106_aa GlsB/YeaQ/YmgE family stress response membrane protein
3618 JFCK01000254.1 GCA000738245_01837 CDS open 55596-55952 _na     118_aa hypothetical protein
3619 JFCK01000254.1 GCA000738245_01838 CDS open 56389-57051 _na     220_aa DNA-3-methyladenine glycosidase I
3620 JFCK01000254.1 GCA000738245_01839 CDS open 57069-59393 _na     774_aa 2%2C4-dienoyl-CoA reductase
3621 JFCK01000254.1 GCA000738245_01840 CDS open 59747-64354 _na     1535_aa gltB glutamate synthase large subunit
3622 JFCK01000254.1 GCA000738245_01841 CDS open 64355-65893 _na     512_aa Glutamate synthase (NADPH) small chain
3623 JFCK01000254.1 GCA000738245_01842 CDS open 65890-66585 _na     231_aa lysE LysE family translocator
3624 JFCK01000254.1 GCA000738245_01843 CDS open 66606-67010 _na     134_aa RNA-binding S4 domain-containing protein
3625 JFCK01000254.1 GCA000738245_01844 CDS open 67107-67916 _na     269_aa VOC family protein
3626 JFCK01000254.1 GCA000738245_01845 CDS open 67988-70147 _na     719_aa Putative endopeptidase
3627 JFCK01000254.1 GCA000738245_01846 CDS open 70188-70892 _na     234_aa Secreted protein
3628 JFCK01000254.1 GCA000738245_01847 CDS open 70885-71853 _na     322_aa prsW PrsW family intramembrane metalloprotease
3629 JFCK01000254.1 GCA000738245_01848 CDS open 71977-73410 _na     477_aa Glycoside hydrolase family 25 protein
3630 JFCK01000254.1 GCA000738245_01849 CDS open 74235-77726 _na     1163_aa Putative arabinosyl transferase
3631 JFCK01000254.1 GCA000738245_01850 CDS open 77863-79998 _na     711_aa Galactan 5-O-arabinofuranosyltransferase
3632 JFCK01000254.1 GCA000738245_01851 CDS open 80047-81363 _na     438_aa NYN domain-containing protein
3633 JFCK01000254.1 GCA000738245_01852 CDS open 81531-81905 _na     124_aa Putative transcriptional regulator (GntR family)
3634 JFCK01000254.1 GCA000738245_01853 CDS open 81902-82834 _na     310_aa ABC transporter ATP-binding protein
3635 JFCK01000254.1 GCA000738245_01854 CDS open 82836-84161 _na     441_aa ABC transporter permease
3636 JFCK01000254.1 GCA000738245_01781 gene open 618-3131 gyrA
3637 JFCK01000254.1 GCA000738245_01782 gene open 3278-3958
3638 JFCK01000254.1 GCA000738245_01785 gene open 4567-4677
3639 JFCK01000254.1 GCA000738245_01786 gene open 4841-6742 ycaO
3640 JFCK01000254.1 GCA000738245_01787 gene open 7092-8822
3641 JFCK01000254.1 GCA000738245_01788 gene open 8883-9026
3642 JFCK01000254.1 GCA000738245_01789 gene open 9199-10911
3643 JFCK01000254.1 GCA000738245_01790 gene open 11165-11584
3644 JFCK01000254.1 GCA000738245_01791 gene open 11676-12227
3645 JFCK01000254.1 GCA000738245_01792 gene open 12224-13033
3646 JFCK01000254.1 GCA000738245_01793 gene open 13080-13448 mmpS
3647 JFCK01000254.1 GCA000738245_01794 gene open 13659-13913
3648 JFCK01000254.1 GCA000738245_01795 gene open 13928-15847
3649 JFCK01000254.1 GCA000738245_01796 gene open 15893-16576
3650 JFCK01000254.1 GCA000738245_01797 gene open 16820-18211
3651 JFCK01000254.1 GCA000738245_01798 gene open 18313-19866 pabB
3652 JFCK01000254.1 GCA000738245_01799 gene open 19907-21298 tolA
3653 JFCK01000254.1 GCA000738245_01800 gene open 21463-21987
3654 JFCK01000254.1 GCA000738245_01801 gene open 21984-22694
3655 JFCK01000254.1 GCA000738245_01802 gene open 22703-22975 crgA
3656 JFCK01000254.1 GCA000738245_01803 gene open 23158-23859
3657 JFCK01000254.1 GCA000738245_01804 gene open 23872-26073 pknB
3658 JFCK01000254.1 GCA000738245_01805 gene open 26256-27914
3659 JFCK01000254.1 GCA000738245_01806 gene open 27917-29365
3660 JFCK01000254.1 GCA000738245_01807 gene open 29362-30669 rodA
3661 JFCK01000254.1 GCA000738245_01808 gene open 30673-32235
3662 JFCK01000254.1 GCA000738245_01809 gene open 32232-32729
3663 JFCK01000254.1 GCA000738245_01810 gene open 32877-34037
3664 JFCK01000254.1 GCA000738245_01812 gene open 34613-35215
3665 JFCK01000254.1 GCA000738245_01813 gene open 35208-36185
3666 JFCK01000254.1 GCA000738245_01814 gene open 36454-36744
3667 JFCK01000254.1 GCA000738245_01815 gene open 36823-37386
3668 JFCK01000254.1 GCA000738245_01816 gene open 37440-37871 vapC
3669 JFCK01000254.1 GCA000738245_01817 gene open 37858-38142 copG
3670 JFCK01000254.1 GCA000738245_01818 gene open 38367-38717 rpfC
3671 JFCK01000254.1 GCA000738245_01819 gene open 38745-39479
3672 JFCK01000254.1 GCA000738245_01820 gene open 39946-40482
3673 JFCK01000254.1 GCA000738245_01821 gene open 40490-41128
3674 JFCK01000254.1 GCA000738245_01822 gene open 41299-42462
3675 JFCK01000254.1 GCA000738245_01823 gene open 42474-42890
3676 JFCK01000254.1 GCA000738245_01824 gene open 42913-43989
3677 JFCK01000254.1 GCA000738245_01825 gene open 44165-45154
3678 JFCK01000254.1 GCA000738245_01826 gene open 45301-46077
3679 JFCK01000254.1 GCA000738245_01827 gene open 46105-46422
3680 JFCK01000254.1 GCA000738245_01828 gene open 46682-47929
3681 JFCK01000254.1 GCA000738245_01829 gene open 47909-48679
3682 JFCK01000254.1 GCA000738245_01830 gene open 48846-51275
3683 JFCK01000254.1 GCA000738245_01831 gene open 51399-51893
3684 JFCK01000254.1 GCA000738245_01832 gene open 52046-52579
3685 JFCK01000254.1 GCA000738245_01833 gene open 52586-52939
3686 JFCK01000254.1 GCA000738245_01834 gene open 53047-54018
3687 JFCK01000254.1 GCA000738245_01835 gene open 54090-55139
3688 JFCK01000254.1 GCA000738245_01836 gene open 55258-55578
3689 JFCK01000254.1 GCA000738245_01837 gene open 55596-55952
3690 JFCK01000254.1 GCA000738245_01838 gene open 56389-57051
3691 JFCK01000254.1 GCA000738245_01839 gene open 57069-59393
3692 JFCK01000254.1 GCA000738245_01840 gene open 59747-64354 gltB
3693 JFCK01000254.1 GCA000738245_01841 gene open 64355-65893
3694 JFCK01000254.1 GCA000738245_01842 gene open 65890-66585 lysE
3695 JFCK01000254.1 GCA000738245_01843 gene open 66606-67010
3696 JFCK01000254.1 GCA000738245_01844 gene open 67107-67916
3697 JFCK01000254.1 GCA000738245_01845 gene open 67988-70147
3698 JFCK01000254.1 GCA000738245_01846 gene open 70188-70892
3699 JFCK01000254.1 GCA000738245_01847 gene open 70885-71853 prsW
3700 JFCK01000254.1 GCA000738245_01848 gene open 71977-73410
3701 JFCK01000254.1 GCA000738245_01849 gene open 74235-77726
3702 JFCK01000254.1 GCA000738245_01850 gene open 77863-79998
3703 JFCK01000254.1 GCA000738245_01851 gene open 80047-81363
3704 JFCK01000254.1 GCA000738245_01852 gene open 81531-81905
3705 JFCK01000254.1 GCA000738245_01853 gene open 81902-82834
3706 JFCK01000254.1 GCA000738245_01854 gene open 82836-84161
3707 JFCK01000254.1 GCA000738245_01783 gene open 4063-4139 trnI
3708 JFCK01000254.1 GCA000738245_01784 gene open 4205-4277 trnA
3709 JFCK01000254.1 GCA000738245_01811 gene open 34430-34512 trnL
3710 JFCK01000254.1 GCA000738245_01783 tRNA open 4063-4139 trnI tRNA-Ile(gat)
3711 JFCK01000254.1 GCA000738245_01784 tRNA open 4205-4277 trnA tRNA-Ala(tgc)
3712 JFCK01000254.1 GCA000738245_01811 tRNA open 34430-34512 trnL tRNA-Leu(cag)
3713 JFCK01000255.1 GCA000738245_01856 gene open 1107-1201 Bacteria_small_SRP
3714 JFCK01000255.1 GCA000738245_01856 ncRNA open 1107-1201 Bacterial small signal recognition particle RNA
3715 JFCK01000255.1 GCA000738245_01855 CDS open 28-1071 _na     347_aa corA Magnesium and cobalt transport protein CorA
3716 JFCK01000255.1 GCA000738245_01858 CDS open 1607-2467 _na     286_aa crotonase/enoyl-CoA hydratase family protein
3717 JFCK01000255.1 GCA000738245_01859 CDS open 2537-3799 _na     420_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
3718 JFCK01000255.1 GCA000738245_01855 gene open 28-1071 corA
3719 JFCK01000255.1 GCA000738245_01858 gene open 1607-2467
3720 JFCK01000255.1 GCA000738245_01859 gene open 2537-3799 gluQRS
3721 JFCK01000255.1 GCA000738245_01857 gene open 1365-1453 trnS
3722 JFCK01000255.1 GCA000738245_01857 tRNA open 1365-1453 trnS tRNA-Ser(gga)
3723 JFCK01000256.1 GCA000738245_01860 CDS open 369-1067 _na     232_aa hypothetical protein
3724 JFCK01000256.1 GCA000738245_01860 gene open 369-1067
3725 JFCK01000257.1 GCA000738245_01861 CDS open 1360-1668 _na     102_aa WXG100 family type VII secretion target
3726 JFCK01000257.1 GCA000738245_01862 CDS open 1760-3103 _na     447_aa glmM phosphoglucosamine mutase
3727 JFCK01000257.1 GCA000738245_01863 CDS open 3281-3841 _na     186_aa rpsI 30S ribosomal protein S9
3728 JFCK01000257.1 GCA000738245_01864 CDS open 3841-4284 _na     147_aa rplM 50S ribosomal protein L13
3729 JFCK01000257.1 GCA000738245_01865 CDS open 4536-5471 _na     311_aa DUF2382 domain-containing protein
3730 JFCK01000257.1 GCA000738245_01866 CDS open 5867-6148 _na     93_aa ESAT-6-like protein
3731 JFCK01000257.1 GCA000738245_01867 CDS open 6188-6475 _na     95_aa ESAT-6-like protein
3732 JFCK01000257.1 GCA000738245_01868 CDS open 6669-7190 _na     173_aa hypothetical protein
3733 JFCK01000257.1 GCA000738245_01861 gene open 1360-1668
3734 JFCK01000257.1 GCA000738245_01862 gene open 1760-3103 glmM
3735 JFCK01000257.1 GCA000738245_01863 gene open 3281-3841 rpsI
3736 JFCK01000257.1 GCA000738245_01864 gene open 3841-4284 rplM
3737 JFCK01000257.1 GCA000738245_01865 gene open 4536-5471
3738 JFCK01000257.1 GCA000738245_01866 gene open 5867-6148
3739 JFCK01000257.1 GCA000738245_01867 gene open 6188-6475
3740 JFCK01000257.1 GCA000738245_01868 gene open 6669-7190
3741 JFCK01000258.1 GCA000738245_01869 CDS open 2145-3752 _na     535_aa Replicative DNA helicase
3742 JFCK01000258.1 GCA000738245_01870 CDS open 3841-4332 _na     163_aa marR MarR family winged helix-turn-helix transcriptional regulator
3743 JFCK01000258.1 GCA000738245_01871 CDS open 4482-5036 _na     184_aa fluC Fluoride-specific ion channel FluC
3744 JFCK01000258.1 GCA000738245_01872 CDS open 5033-5503 _na     156_aa Fluoride-specific ion channel
3745 JFCK01000258.1 GCA000738245_01873 CDS open 5534-6037 _na     167_aa DUF4442 domain-containing protein
3746 JFCK01000258.1 GCA000738245_01874 CDS open 6127-6495 _na     122_aa trxA thioredoxin
3747 JFCK01000258.1 GCA000738245_01875 CDS open 6623-7198 _na     191_aa DUF6230 domain-containing protein
3748 JFCK01000258.1 GCA000738245_01876 CDS open 7188-8177 _na     329_aa DUF6114 domain-containing protein
3749 JFCK01000258.1 GCA000738245_01877 CDS open 8313-9113 _na     266_aa PspA/IM30 family protein
3750 JFCK01000258.1 GCA000738245_01878 CDS open 9103-10665 _na     520_aa Putative permease of the major facilitator superfamily
3751 JFCK01000258.1 GCA000738245_01879 CDS open 10673-11410 _na     245_aa alpha/beta hydrolase
3752 JFCK01000258.1 GCA000738245_01880 CDS open 11484-12179 _na     231_aa yafY YafY family protein
3753 JFCK01000258.1 GCA000738245_01881 CDS open 12211-12969 _na     252_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
3754 JFCK01000258.1 GCA000738245_01882 CDS open 13020-14432 _na     470_aa Decaprenylphosphoryl-beta-D-ribose 2-epimerase component
3755 JFCK01000258.1 GCA000738245_01883 CDS open 14556-14882 _na     108_aa hypothetical protein
3756 JFCK01000258.1 GCA000738245_01884 CDS open 14907-15689 _na     260_aa N-acetylglucosamine-6-phosphate deacetylase
3757 JFCK01000258.1 GCA000738245_01885 CDS open 15828-17075 _na     415_aa hypothetical protein
3758 JFCK01000258.1 GCA000738245_01886 CDS open 17903-18295 _na     130_aa gtrA GtrA family protein
3759 JFCK01000258.1 GCA000738245_01887 CDS open 18357-19046 _na     229_aa Putative membrane protein
3760 JFCK01000258.1 GCA000738245_01888 CDS open 19294-20202 _na     302_aa Putative glycosyltransferase
3761 JFCK01000258.1 GCA000738245_01889 CDS open 20206-22023 _na     605_aa long-chain-fatty-acid--CoA ligase
3762 JFCK01000258.1 GCA000738245_01890 CDS open 22280-22549 _na     89_aa hypothetical protein
3763 JFCK01000258.1 GCA000738245_01869 gene open 2145-3752
3764 JFCK01000258.1 GCA000738245_01870 gene open 3841-4332 marR
3765 JFCK01000258.1 GCA000738245_01871 gene open 4482-5036 fluC
3766 JFCK01000258.1 GCA000738245_01872 gene open 5033-5503
3767 JFCK01000258.1 GCA000738245_01873 gene open 5534-6037
3768 JFCK01000258.1 GCA000738245_01874 gene open 6127-6495 trxA
3769 JFCK01000258.1 GCA000738245_01875 gene open 6623-7198
3770 JFCK01000258.1 GCA000738245_01876 gene open 7188-8177
3771 JFCK01000258.1 GCA000738245_01877 gene open 8313-9113
3772 JFCK01000258.1 GCA000738245_01878 gene open 9103-10665
3773 JFCK01000258.1 GCA000738245_01879 gene open 10673-11410
3774 JFCK01000258.1 GCA000738245_01880 gene open 11484-12179 yafY
3775 JFCK01000258.1 GCA000738245_01881 gene open 12211-12969
3776 JFCK01000258.1 GCA000738245_01882 gene open 13020-14432
3777 JFCK01000258.1 GCA000738245_01883 gene open 14556-14882
3778 JFCK01000258.1 GCA000738245_01884 gene open 14907-15689
3779 JFCK01000258.1 GCA000738245_01885 gene open 15828-17075
3780 JFCK01000258.1 GCA000738245_01886 gene open 17903-18295 gtrA
3781 JFCK01000258.1 GCA000738245_01887 gene open 18357-19046
3782 JFCK01000258.1 GCA000738245_01888 gene open 19294-20202
3783 JFCK01000258.1 GCA000738245_01889 gene open 20206-22023
3784 JFCK01000258.1 GCA000738245_01890 gene open 22280-22549
3785 JFCK01000259.1 repeat_region open 1080-3398 CRISPR array with 38 repeats of length 28%2C consensus sequence GTGCTCCCCGCGCCAGCGGGGATGAGCC and spacer length 33
3786 JFCK01000259.1 GCA000738245_01891 CDS open 94-663 _na     189_aa hypothetical protein
3787 JFCK01000259.1 GCA000738245_01892 CDS open 3471-3713 _na     80_aa hypothetical protein
3788 JFCK01000259.1 GCA000738245_01891 gene open 94-663
3789 JFCK01000259.1 GCA000738245_01892 gene open 3471-3713
3790 JFCK01000259.1 GCA000738245_01893 gene open 3813-3886 trnI
3791 JFCK01000259.1 GCA000738245_01894 gene open 4096-4168 trnN
3792 JFCK01000259.1 GCA000738245_01893 tRNA open 3813-3886 trnI tRNA-Ile2(cat)
3793 JFCK01000259.1 GCA000738245_01894 tRNA open 4096-4168 trnN tRNA-Asn(gtt)
3794 JFCK01000260.1 GCA000738245_01895 CDS open 75-908 _na     277_aa Putative secreted protein
3795 JFCK01000260.1 GCA000738245_01897 CDS open 1502-2899 _na     465_aa Multidrug and toxic compound extrusion family protein
3796 JFCK01000260.1 GCA000738245_01898 CDS open 3061-4218 _na     385_aa Putative iron ABC transport system%2C solute-binding protein
3797 JFCK01000260.1 GCA000738245_01899 CDS open 4335-5342 _na     335_aa Putative iron ABC transport system%2C permease protein
3798 JFCK01000260.1 GCA000738245_01900 CDS open 5410-6180 _na     256_aa Putative iron ABC transport system%2C ATP-binding protein
3799 JFCK01000260.1 GCA000738245_01901 CDS open 6398-9631 _na     1077_aa DUF4040 domain-containing protein
3800 JFCK01000260.1 GCA000738245_01902 CDS open 9628-10131 _na     167_aa Cation:proton antiporter subunit C
3801 JFCK01000260.1 GCA000738245_01903 CDS open 10131-11813 _na     560_aa monovalent cation/H+ antiporter subunit D family protein
3802 JFCK01000260.1 GCA000738245_01904 CDS open 11817-12710 _na     297_aa Na+/H+ antiporter subunit E
3803 JFCK01000260.1 GCA000738245_01905 CDS open 12711-12989 _na     92_aa mnhF MnhF protein
3804 JFCK01000260.1 GCA000738245_01906 CDS open 12990-13391 _na     133_aa Na+/H+ antiporter subunit G
3805 JFCK01000260.1 GCA000738245_01907 CDS open 13471-13896 _na     141_aa Organic hydroperoxide resistance protein
3806 JFCK01000260.1 GCA000738245_01908 CDS open 13971-15581 _na     536_aa Catalase
3807 JFCK01000260.1 GCA000738245_01909 CDS open 15719-16336 _na     205_aa RNA polymerase sigma factor
3808 JFCK01000260.1 GCA000738245_01910 CDS open 16403-17677 _na     424_aa ferrochelatase
3809 JFCK01000260.1 GCA000738245_01911 CDS open 17715-18794 _na     359_aa aspartate-semialdehyde dehydrogenase
3810 JFCK01000260.1 GCA000738245_01912 CDS open 18833-20098 _na     421_aa aspartate kinase
3811 JFCK01000260.1 GCA000738245_01913 CDS open 20348-21286 _na     312_aa Putative membrane protein
3812 JFCK01000260.1 GCA000738245_01914 CDS open 21588-23375 _na     595_aa leuA 2-isopropylmalate synthase
3813 JFCK01000260.1 GCA000738245_01915 CDS open 23486-25516 _na     676_aa DNA polymerase III subunit epsilon
3814 JFCK01000260.1 GCA000738245_01916 CDS open 25816-26244 _na     142_aa Low molecular weight phosphatase family protein
3815 JFCK01000260.1 GCA000738245_01917 CDS open 26262-27353 _na     363_aa arsB ACR3 family arsenite efflux transporter
3816 JFCK01000260.1 GCA000738245_01918 CDS open 27409-27780 _na     123_aa Metalloregulator ArsR/SmtB family transcription factor
3817 JFCK01000260.1 GCA000738245_01919 CDS open 28081-29292 _na     403_aa murT MurT ligase domain-containing protein
3818 JFCK01000260.1 GCA000738245_01920 CDS open 29293-30114 _na     273_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
3819 JFCK01000260.1 GCA000738245_01921 CDS open 30124-30834 _na     236_aa recR Recombination protein RecR
3820 JFCK01000260.1 GCA000738245_01922 CDS open 30865-31179 _na     104_aa YbaB/EbfC family nucleoid-associated protein
3821 JFCK01000260.1 GCA000738245_01923 CDS open 31290-32399 _na     369_aa hypothetical protein
3822 JFCK01000260.1 GCA000738245_01895 gene open 75-908
3823 JFCK01000260.1 GCA000738245_01897 gene open 1502-2899
3824 JFCK01000260.1 GCA000738245_01898 gene open 3061-4218
3825 JFCK01000260.1 GCA000738245_01899 gene open 4335-5342
3826 JFCK01000260.1 GCA000738245_01900 gene open 5410-6180
3827 JFCK01000260.1 GCA000738245_01901 gene open 6398-9631
3828 JFCK01000260.1 GCA000738245_01902 gene open 9628-10131
3829 JFCK01000260.1 GCA000738245_01903 gene open 10131-11813
3830 JFCK01000260.1 GCA000738245_01904 gene open 11817-12710
3831 JFCK01000260.1 GCA000738245_01905 gene open 12711-12989 mnhF
3832 JFCK01000260.1 GCA000738245_01906 gene open 12990-13391
3833 JFCK01000260.1 GCA000738245_01907 gene open 13471-13896
3834 JFCK01000260.1 GCA000738245_01908 gene open 13971-15581
3835 JFCK01000260.1 GCA000738245_01909 gene open 15719-16336
3836 JFCK01000260.1 GCA000738245_01910 gene open 16403-17677
3837 JFCK01000260.1 GCA000738245_01911 gene open 17715-18794
3838 JFCK01000260.1 GCA000738245_01912 gene open 18833-20098
3839 JFCK01000260.1 GCA000738245_01913 gene open 20348-21286
3840 JFCK01000260.1 GCA000738245_01914 gene open 21588-23375 leuA
3841 JFCK01000260.1 GCA000738245_01915 gene open 23486-25516
3842 JFCK01000260.1 GCA000738245_01916 gene open 25816-26244
3843 JFCK01000260.1 GCA000738245_01917 gene open 26262-27353 arsB
3844 JFCK01000260.1 GCA000738245_01918 gene open 27409-27780
3845 JFCK01000260.1 GCA000738245_01919 gene open 28081-29292 murT
3846 JFCK01000260.1 GCA000738245_01920 gene open 29293-30114 gatD
3847 JFCK01000260.1 GCA000738245_01921 gene open 30124-30834 recR
3848 JFCK01000260.1 GCA000738245_01922 gene open 30865-31179
3849 JFCK01000260.1 GCA000738245_01923 gene open 31290-32399
3850 JFCK01000260.1 GCA000738245_01896 gene open 1032-1108 trnP
3851 JFCK01000260.1 GCA000738245_01896 tRNA open 1032-1108 trnP tRNA-Pro(cgg)
3852 JFCK01000261.1 GCA000738245_01924 CDS open 299-1195 _na     298_aa Tetratricopeptide repeat protein
3853 JFCK01000261.1 GCA000738245_01925 CDS open 1199-2206 _na     335_aa HAD-IIA family hydrolase
3854 JFCK01000261.1 GCA000738245_01926 CDS open 2207-2383 _na     58_aa hypothetical protein
3855 JFCK01000261.1 GCA000738245_01927 CDS open 2383-3222 _na     279_aa RNA-binding S4 domain-containing protein
3856 JFCK01000261.1 GCA000738245_01928 CDS open 3219-4163 _na     314_aa nadK NAD kinase
3857 JFCK01000261.1 GCA000738245_01929 CDS open 4166-5890 _na     574_aa recN DNA repair protein RecN
3858 JFCK01000261.1 GCA000738245_01930 CDS open 6034-6762 _na     242_aa Lipoprotein
3859 JFCK01000261.1 GCA000738245_01931 CDS open 6780-8606 _na     608_aa hypothetical protein
3860 JFCK01000261.1 GCA000738245_01932 CDS open 8680-9882 _na     400_aa steA putative cytokinetic ring protein SteA
3861 JFCK01000261.1 GCA000738245_01933 CDS open 9915-10847 _na     310_aa Copper transporter
3862 JFCK01000261.1 GCA000738245_01934 CDS open 10910-12577 _na     555_aa pyrG CTP synthase
3863 JFCK01000261.1 GCA000738245_01935 CDS open 12603-13259 _na     218_aa NUDIX hydrolase
3864 JFCK01000261.1 GCA000738245_01936 CDS open 13256-14155 _na     299_aa xerC Tyrosine recombinase XerC
3865 JFCK01000261.1 GCA000738245_01937 CDS open 14231-15124 _na     297_aa Sporulation initiation inhibitor protein Soj
3866 JFCK01000261.1 GCA000738245_01938 CDS open 15099-15947 _na     282_aa Segregation and condensation protein A
3867 JFCK01000261.1 GCA000738245_01939 CDS open 15981-16565 _na     194_aa scpB SMC-Scp complex subunit ScpB
3868 JFCK01000261.1 GCA000738245_01940 CDS open 16630-17502 _na     290_aa Pseudouridine synthase
3869 JFCK01000261.1 GCA000738245_01941 CDS open 17590-19932 _na     780_aa der bifunctional cytidylate kinase/GTPase Der
3870 JFCK01000261.1 GCA000738245_01942 CDS open 19960-21648 _na     562_aa fhs formate--tetrahydrofolate ligase
3871 JFCK01000261.1 GCA000738245_01943 CDS open 21787-23253 _na     488_aa glyceraldehyde-3-phosphate dehydrogenase
3872 JFCK01000261.1 GCA000738245_01944 CDS open 23264-24892 _na     542_aa Putative membrane protein
3873 JFCK01000261.1 GCA000738245_01945 CDS open 24971-25063 _na     30_aa hypothetical protein
3874 JFCK01000261.1 GCA000738245_01946 CDS open 25266-26972 _na     568_aa ABC-ATPase domain-containing protein
3875 JFCK01000261.1 GCA000738245_01947 CDS open 26969-28033 _na     354_aa glpQ GlpQ protein
3876 JFCK01000261.1 GCA000738245_01948 CDS open 28133-28735 _na     200_aa tcsR2 Two-component system response regulator TcsR2
3877 JFCK01000261.1 GCA000738245_01949 CDS open 28732-29859 _na     375_aa tcsS2 Two-component system sensor kinase TcsS2
3878 JFCK01000261.1 GCA000738245_01950 CDS open 29859-30620 _na     253_aa ABC transporter permease
3879 JFCK01000261.1 GCA000738245_01951 CDS open 30623-31540 _na     305_aa Putative ABC transport system%2C ATP-binding protein
3880 JFCK01000261.1 GCA000738245_01952 CDS open 31680-32975 _na     431_aa Putative membrane protein
3881 JFCK01000261.1 GCA000738245_01953 CDS open 32938-34536 _na     532_aa kefB Putative glutathione-regulated potassium-efflux system protein KefB
3882 JFCK01000261.1 GCA000738245_01954 CDS open 34657-34803 _na     48_aa yefM Antitoxin YefM
3883 JFCK01000261.1 GCA000738245_01955 CDS open 34889-35284 _na     131_aa DUF3887 domain-containing protein
3884 JFCK01000261.1 GCA000738245_01956 CDS open 35804-36496 _na     230_aa site-specific DNA-methyltransferase (adenine-specific)
3885 JFCK01000261.1 GCA000738245_01957 CDS open 36715-38346 _na     543_aa ATP-binding cassette domain-containing protein
3886 JFCK01000261.1 GCA000738245_01959 CDS open 38897-39400 _na     167_aa rraA ribonuclease E activity regulator RraA
3887 JFCK01000261.1 GCA000738245_01960 CDS open 39405-40154 _na     249_aa S9 family peptidase
3888 JFCK01000261.1 GCA000738245_01961 CDS open 40227-42542 _na     771_aa secA2 accessory Sec system translocase SecA2
3889 JFCK01000261.1 GCA000738245_01962 CDS open 42614-43048 _na     144_aa odhI oxoglutarate dehydrogenase inhibitor Odhl
3890 JFCK01000261.1 GCA000738245_01963 CDS open 43055-43792 _na     245_aa Putative transcriptional regulator (MerR family)
3891 JFCK01000261.1 GCA000738245_01964 CDS open 43785-44378 _na     197_aa BFN domain-containing protein
3892 JFCK01000261.1 GCA000738245_01965 CDS open 44505-45017 _na     170_aa merR MerR family transcriptional regulator
3893 JFCK01000261.1 GCA000738245_01966 CDS open 45020-45523 _na     167_aa Secreted protein
3894 JFCK01000261.1 GCA000738245_01967 CDS open 45547-46386 _na     279_aa 3-methyladenine DNA glycosylase
3895 JFCK01000261.1 GCA000738245_01968 CDS open 46379-47422 _na     347_aa Putative membrane protein
3896 JFCK01000261.1 GCA000738245_01969 CDS open 47422-48747 _na     441_aa Putative membrane protein
3897 JFCK01000261.1 GCA000738245_01970 CDS open 48764-49912 _na     382_aa Putative ATP-dependent RNA helicase
3898 JFCK01000261.1 GCA000738245_01971 CDS open 49913-51358 _na     481_aa gndA NADP-dependent phosphogluconate dehydrogenase
3899 JFCK01000261.1 GCA000738245_01972 CDS open 51403-51885 _na     160_aa paaI PaaI family thioesterase
3900 JFCK01000261.1 GCA000738245_01973 CDS open 51889-53304 _na     471_aa NADH:ubiquinone reductase (non-electrogenic)
3901 JFCK01000261.1 GCA000738245_01974 CDS open 53486-54718 _na     410_aa Class I SAM-dependent methyltransferase
3902 JFCK01000261.1 GCA000738245_01975 CDS open 54799-56478 _na     559_aa FAD-binding dehydrogenase
3903 JFCK01000261.1 GCA000738245_01976 CDS open 56465-57742 _na     425_aa amidase
3904 JFCK01000261.1 GCA000738245_01977 CDS open 57717-58511 _na     264_aa Putative short-chain dehydrogenase
3905 JFCK01000261.1 GCA000738245_01978 CDS open 58669-59889 _na     406_aa HNH endonuclease
3906 JFCK01000261.1 GCA000738245_01979 CDS open 59893-61104 _na     403_aa Putative permease of the major facilitator superfamily
3907 JFCK01000261.1 GCA000738245_01980 CDS open 61104-62330 _na     408_aa Putative beta-glucosidase
3908 JFCK01000261.1 GCA000738245_01981 CDS open 62420-63679 _na     419_aa Putative secreted protein
3909 JFCK01000261.1 GCA000738245_01982 CDS open 63703-63870 _na     55_aa Secreted protein
3910 JFCK01000261.1 GCA000738245_01983 CDS open 63881-64564 _na     227_aa yceI YceI family protein
3911 JFCK01000261.1 GCA000738245_01984 CDS open 64585-64926 _na     113_aa FCS-type domain-containing protein
3912 JFCK01000261.1 GCA000738245_01985 CDS open 64997-65371 _na     124_aa rbpA RNA polymerase-binding protein RbpA
3913 JFCK01000261.1 GCA000738245_01986 CDS open 65362-66153 _na     263_aa Polyprenol-phosphate-mannose synthase domain 1
3914 JFCK01000261.1 GCA000738245_01987 CDS open 66146-67573 _na     475_aa lnt apolipoprotein N-acyltransferase
3915 JFCK01000261.1 GCA000738245_01988 CDS open 67570-68007 _na     145_aa fxsA FxsA family protein
3916 JFCK01000261.1 GCA000738245_01989 CDS open 68158-68415 _na     85_aa Secreted protein
3917 JFCK01000261.1 GCA000738245_01990 CDS open 68412-69140 _na     242_aa Putative dehydrogenase related to short-chain alcohol dehydrogenases
3918 JFCK01000261.1 GCA000738245_01991 CDS open 69133-71805 _na     890_aa Putative helicase
3919 JFCK01000261.1 GCA000738245_01992 CDS open 71792-72769 _na     325_aa tatC twin-arginine translocase subunit TatC
3920 JFCK01000261.1 GCA000738245_01993 CDS open 72770-73030 _na     86_aa tatA Sec-independent protein translocase subunit TatA
3921 JFCK01000261.1 GCA000738245_01994 CDS open 73069-74037 _na     322_aa WYL domain-containing protein
3922 JFCK01000261.1 GCA000738245_01995 CDS open 74034-74969 _na     311_aa WYL domain-containing protein
3923 JFCK01000261.1 GCA000738245_01996 CDS open 74966-76375 _na     469_aa pafA Pup--protein ligase
3924 JFCK01000261.1 GCA000738245_01997 CDS open 76372-76566 _na     64_aa Prokaryotic ubiquitin-like protein Pup
3925 JFCK01000261.1 GCA000738245_01998 CDS open 76570-78093 _na     507_aa dop depupylase/deamidase Dop
3926 JFCK01000261.1 GCA000738245_01999 CDS open 78106-79716 _na     536_aa arc proteasome ATPase
3927 JFCK01000261.1 GCA000738245_02000 CDS open 79673-80506 _na     277_aa trmI tRNA (adenine(58)-N(1))-methyltransferase TrmI
3928 JFCK01000261.1 GCA000738245_02001 CDS open 80561-81364 _na     267_aa recB Putative RecB family exonuclease
3929 JFCK01000261.1 GCA000738245_02002 CDS open 81334-82896 _na     520_aa aspA aspartate ammonia-lyase
3930 JFCK01000261.1 GCA000738245_02003 CDS open 82955-83800 _na     281_aa hisG ATP phosphoribosyltransferase
3931 JFCK01000261.1 GCA000738245_02004 CDS open 83823-84800 _na     325_aa phosphoribosyl-ATP diphosphatase
3932 JFCK01000261.1 GCA000738245_02005 CDS open 84911-85756 _na     281_aa Thioesterase family protein
3933 JFCK01000261.1 GCA000738245_02006 CDS open 85753-86229 _na     158_aa hypothetical protein
3934 JFCK01000261.1 GCA000738245_02007 CDS open 86254-87501 _na     415_aa mshC cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase
3935 JFCK01000261.1 GCA000738245_02008 CDS open 87513-88385 _na     290_aa uppP2 undecaprenyl-diphosphate phosphatase
3936 JFCK01000261.1 GCA000738245_02009 CDS open 88429-89577 _na     382_aa lppL Prolipoprotein LppL
3937 JFCK01000261.1 GCA000738245_02010 CDS open 89614-90717 _na     367_aa quinone-dependent dihydroorotate dehydrogenase
3938 JFCK01000261.1 GCA000738245_02011 CDS open 90714-91271 _na     185_aa YbhB/YbcL family Raf kinase inhibitor-like protein
3939 JFCK01000261.1 GCA000738245_02013 CDS open 91513-92217 _na     234_aa TVP38/TMEM64 family membrane protein
3940 JFCK01000261.1 GCA000738245_02014 CDS open 92223-92843 _na     206_aa DNA-binding protein
3941 JFCK01000261.1 GCA000738245_02015 CDS open 92840-93982 _na     380_aa Putative secreted protein
3942 JFCK01000261.1 GCA000738245_02016 CDS open 94002-94442 _na     146_aa nfeD NfeD family protein
3943 JFCK01000261.1 GCA000738245_02017 CDS open 94465-95295 _na     276_aa DUF3097 domain-containing protein
3944 JFCK01000261.1 GCA000738245_02018 CDS open 95321-96097 _na     258_aa Serine/threonine protein kinase
3945 JFCK01000261.1 GCA000738245_02019 CDS open 96104-97903 _na     599_aa DIP1281 family NlpC/P60 protein
3946 JFCK01000261.1 GCA000738245_02020 CDS open 98305-98832 _na     175_aa DUF6676 domain-containing protein
3947 JFCK01000261.1 GCA000738245_02021 CDS open 99056-101866 _na     936_aa acnA aconitate hydratase AcnA
3948 JFCK01000261.1 GCA000738245_02022 CDS open 101972-102541 _na     189_aa acnR HTH-type transcriptional repressor AcnR
3949 JFCK01000261.1 GCA000738245_02023 CDS open 102573-102842 _na     89_aa ACT domain-containing protein
3950 JFCK01000261.1 GCA000738245_02024 CDS open 102862-104235 _na     457_aa UPF0210 protein jk0972
3951 JFCK01000261.1 GCA000738245_02025 CDS open 104237-104995 _na     252_aa DUF3592 domain-containing protein
3952 JFCK01000261.1 GCA000738245_02026 CDS open 104972-105451 _na     159_aa Lrp/AsnC family transcriptional regulator
3953 JFCK01000261.1 GCA000738245_02027 CDS open 105688-109086 _na     1132_aa 2-oxoacid:acceptor oxidoreductase family protein
3954 JFCK01000261.1 GCA000738245_02028 CDS open 109121-109864 _na     247_aa glutamine amidotransferase
3955 JFCK01000261.1 GCA000738245_02029 CDS open 109892-111523 _na     543_aa ccmA heme ABC exporter ATP-binding protein CcmA
3956 JFCK01000261.1 GCA000738245_02030 CDS open 111954-113030 _na     358_aa Lycopene cyclase family protein
3957 JFCK01000261.1 GCA000738245_02031 CDS open 113062-113469 _na     135_aa Metal-sulfur cluster assembly factor
3958 JFCK01000261.1 GCA000738245_02032 CDS open 113505-114011 _na     168_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
3959 JFCK01000261.1 GCA000738245_02033 CDS open 114033-115286 _na     417_aa Cysteine desulfurase
3960 JFCK01000261.1 GCA000738245_02034 CDS open 115370-116125 _na     251_aa sufC Fe-S cluster assembly ATPase SufC
3961 JFCK01000261.1 GCA000738245_02035 CDS open 116171-117382 _na     403_aa sufD Fe-S cluster assembly protein SufD
3962 JFCK01000261.1 GCA000738245_02036 CDS open 117388-118830 _na     480_aa sufB Fe-S cluster assembly protein SufB
3963 JFCK01000261.1 GCA000738245_02037 CDS open 118834-119517 _na     227_aa Transcriptional regulator
3964 JFCK01000261.1 GCA000738245_02038 CDS open 119718-121493 _na     591_aa mptB polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB
3965 JFCK01000261.1 GCA000738245_02039 CDS open 121477-122457 _na     326_aa ABC transporter ATP-binding protein
3966 JFCK01000261.1 GCA000738245_02040 CDS open 122454-123245 _na     263_aa ABC transporter permease
3967 JFCK01000261.1 GCA000738245_02041 CDS open 123302-124372 _na     356_aa COX15/CtaA family protein
3968 JFCK01000261.1 GCA000738245_02042 CDS open 124424-125218 _na     264_aa hypothetical protein
3969 JFCK01000261.1 GCA000738245_02043 CDS open 125246-126184 _na     312_aa ctaB heme o synthase
3970 JFCK01000261.1 GCA000738245_02044 CDS open 126441-128552 _na     703_aa tkt transketolase
3971 JFCK01000261.1 GCA000738245_02045 CDS open 128581-129693 _na     370_aa tal transaldolase
3972 JFCK01000261.1 GCA000738245_02046 CDS open 129737-131299 _na     520_aa zwf glucose-6-phosphate dehydrogenase
3973 JFCK01000261.1 GCA000738245_02047 CDS open 131353-132429 _na     358_aa opcA Oxppcycle protein OpcA
3974 JFCK01000261.1 GCA000738245_02048 CDS open 132426-133259 _na     277_aa 6-phosphogluconolactonase
3975 JFCK01000261.1 GCA000738245_02049 CDS open 133256-133495 _na     79_aa secG preprotein translocase subunit SecG
3976 JFCK01000261.1 GCA000738245_02050 CDS open 133599-136445 _na     948_aa ppc phosphoenolpyruvate carboxylase
3977 JFCK01000261.1 GCA000738245_02051 CDS open 136456-137241 _na     261_aa tpiA triose-phosphate isomerase
3978 JFCK01000261.1 GCA000738245_02052 CDS open 137311-138522 _na     403_aa pgk Phosphoglycerate kinase
3979 JFCK01000261.1 GCA000738245_02053 CDS open 138663-139670 _na     335_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
3980 JFCK01000261.1 GCA000738245_02054 CDS open 139852-140838 _na     328_aa whiA DNA-binding protein WhiA
3981 JFCK01000261.1 GCA000738245_02055 CDS open 140899-141933 _na     344_aa Putative gluconeogenesis factor
3982 JFCK01000261.1 GCA000738245_02056 CDS open 141951-142826 _na     291_aa rapZ RNase adapter RapZ
3983 JFCK01000261.1 GCA000738245_02057 CDS open 142838-144931 _na     697_aa uvrC excinuclease ABC subunit UvrC
3984 JFCK01000261.1 GCA000738245_02058 CDS open 144924-145379 _na     151_aa Low molecular weight protein antigen 6 PH domain-containing protein
3985 JFCK01000261.1 GCA000738245_02059 CDS open 145415-145897 _na     160_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
3986 JFCK01000261.1 GCA000738245_02060 CDS open 145950-147200 _na     416_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
3987 JFCK01000261.1 GCA000738245_02061 CDS open 147220-147867 _na     215_aa riboflavin synthase
3988 JFCK01000261.1 GCA000738245_02062 CDS open 147922-148995 _na     357_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
3989 JFCK01000261.1 GCA000738245_02063 CDS open 149000-149668 _na     222_aa rpe ribulose-phosphate 3-epimerase
3990 JFCK01000261.1 GCA000738245_02064 CDS open 149706-151217 _na     503_aa rRNA small subunit methyltransferase B
3991 JFCK01000261.1 GCA000738245_02065 CDS open 151236-152231 _na     331_aa fmt methionyl-tRNA formyltransferase
3992 JFCK01000261.1 GCA000738245_02066 CDS open 152228-152611 _na     127_aa hypothetical protein
3993 JFCK01000261.1 GCA000738245_02067 CDS open 152887-154950 _na     687_aa primosomal protein N'
3994 JFCK01000261.1 GCA000738245_02068 CDS open 154981-156204 _na     407_aa metK methionine adenosyltransferase
3995 JFCK01000261.1 GCA000738245_02069 CDS open 156302-157558 _na     418_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
3996 JFCK01000261.1 GCA000738245_02070 CDS open 157579-157860 _na     93_aa rpoZ DNA-directed RNA polymerase subunit omega
3997 JFCK01000261.1 GCA000738245_02071 CDS open 157900-158421 _na     173_aa gmk guanylate kinase
3998 JFCK01000261.1 GCA000738245_02072 CDS open 158478-158798 _na     106_aa mihF integration host factor MihF
3999 JFCK01000261.1 GCA000738245_02073 CDS open 159077-159925 _na     282_aa pyrF orotidine-5'-phosphate decarboxylase
4000 JFCK01000261.1 GCA000738245_02074 CDS open 159922-163287 _na     1121_aa carB carbamoyl-phosphate synthase large subunit