HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella denticola (GCA_000759205.1)

Select a Genome:
BAKTA Annotations for GCA_000759205.1
Genome Selected: Prevotella denticola
ContigsBases CDSrRNA tmRNAtRNA
126 3050207 2488 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5091 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 5091 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JRNO01000019.1 GCA000759205_00948 gene open 9296-10000
2002 JRNO01000019.1 GCA000759205_00949 gene open 10162-12852
2003 JRNO01000019.1 GCA000759205_00950 gene open 13044-15089 uvrB
2004 JRNO01000019.1 GCA000759205_00951 gene open 15252-16076 bamD
2005 JRNO01000019.1 GCA000759205_00952 gene open 16113-16454
2006 JRNO01000019.1 GCA000759205_00953 gene open 16457-16909
2007 JRNO01000019.1 GCA000759205_00954 gene open 17015-17920 yidA
2008 JRNO01000019.1 GCA000759205_00955 gene open 18178-19194 fba
2009 JRNO01000019.1 GCA000759205_00956 gene open 19490-21007 nnr2
2010 JRNO01000019.1 GCA000759205_00957 gene open 21100-21639 hpt
2011 JRNO01000019.1 GCA000759205_00958 gene open 21639-22211
2012 JRNO01000019.1 GCA000759205_00959 gene open 22371-23543 obgE
2013 JRNO01000019.1 GCA000759205_00960 gene open 23536-24315 pgeF
2014 JRNO01000019.1 GCA000759205_00961 gene open 24395-24538
2015 JRNO01000019.1 GCA000759205_00962 gene open 24696-24881
2016 JRNO01000019.1 GCA000759205_00963 gene open 24915-25274
2017 JRNO01000019.1 GCA000759205_00964 gene open 25391-26572 purH
2018 JRNO01000019.1 GCA000759205_00965 gene open 26855-27229 ridA
2019 JRNO01000019.1 GCA000759205_00966 gene open 27389-27730
2020 JRNO01000019.1 GCA000759205_00967 gene open 27856-28140
2021 JRNO01000019.1 GCA000759205_00968 gene open 28265-28630 rplS
2022 JRNO01000019.1 GCA000759205_00969 gene open 28822-29550
2023 JRNO01000019.1 GCA000759205_00970 gene open 29608-30621
2024 JRNO01000019.1 GCA000759205_00971 gene open 30660-31577 rbsK
2025 JRNO01000019.1 GCA000759205_00972 gene open 31714-32733 lacI
2026 JRNO01000019.1 GCA000759205_00973 gene open 32888-33652 ushA
2027 JRNO01000019.1 GCA000759205_00974 gene open 33672-34511
2028 JRNO01000019.1 GCA000759205_00975 gene open 34863-35627
2029 JRNO01000019.1 GCA000759205_00976 gene open 35639-35767
2030 JRNO01000019.1 GCA000759205_00977 gene open 35815-37410
2031 JRNO01000019.1 GCA000759205_00978 gene open 37432-37893
2032 JRNO01000019.1 GCA000759205_00979 gene open 38313-39446
2033 JRNO01000019.1 GCA000759205_00980 gene open 39621-39824
2034 JRNO01000019.1 GCA000759205_00981 gene open 39862-40620
2035 JRNO01000019.1 GCA000759205_00982 gene open 40907-42718
2036 JRNO01000019.1 GCA000759205_00983 gene open 42731-43432
2037 JRNO01000019.1 GCA000759205_00984 gene open 43456-44382
2038 JRNO01000019.1 GCA000759205_00985 gene open 44402-45547
2039 JRNO01000019.1 GCA000759205_00986 gene open 45594-46211
2040 JRNO01000019.1 GCA000759205_00987 gene open 46214-47509
2041 JRNO01000019.1 GCA000759205_00988 gene open 47502-49055
2042 JRNO01000019.1 GCA000759205_00989 gene open 49070-50137
2043 JRNO01000019.1 GCA000759205_00990 gene open 50233-50469
2044 JRNO01000019.1 GCA000759205_00991 gene open 50466-50939
2045 JRNO01000019.1 GCA000759205_00992 gene open 50936-51145
2046 JRNO01000019.1 GCA000759205_00993 gene open 51247-52785
2047 JRNO01000019.1 GCA000759205_00994 gene open 52804-55425 kpsD
2048 JRNO01000019.1 GCA000759205_00995 gene open 55431-56051
2049 JRNO01000019.1 GCA000759205_00996 gene open 56201-57280 dinB
2050 JRNO01000019.1 GCA000759205_00997 gene open 57354-57599
2051 JRNO01000019.1 GCA000759205_00998 gene open 57782-61267 cirA
2052 JRNO01000019.1 GCA000759205_00999 gene open 61274-62821 susD
2053 JRNO01000019.1 GCA000759205_01000 gene open 62862-63494
2054 JRNO01000019.1 GCA000759205_01001 gene open 63498-63971
2055 JRNO01000019.1 GCA000759205_01002 gene open 64267-65601
2056 JRNO01000019.1 GCA000759205_01003 gene open 65608-68460
2057 JRNO01000019.1 GCA000759205_01004 gene open 68668-69219
2058 JRNO01000019.1 GCA000759205_01005 gene open 69228-71000
2059 JRNO01000019.1 GCA000759205_01006 gene open 71015-73543
2060 JRNO01000019.1 GCA000759205_01007 gene open 73634-74659 miaA
2061 JRNO01000019.1 GCA000759205_01008 gene open 74682-75452 lpxA
2062 JRNO01000019.1 GCA000759205_01009 gene open 75469-76857 lpxC
2063 JRNO01000019.1 GCA000759205_01010 gene open 77032-78072 lpxD
2064 JRNO01000019.1 GCA000759205_01011 gene open 78123-79388 ydhJ
2065 JRNO01000019.1 GCA000759205_01012 gene open 79942-81348 dnaA
2066 JRNO01000019.1 GCA000759205_01013 gene open 81722-82702
2067 JRNO01000019.1 GCA000759205_01014 gene open 82713-83966
2068 JRNO01000019.1 GCA000759205_01015 gene open 84077-84685 folB
2069 JRNO01000019.1 GCA000759205_01016 gene open 84895-87492
2070 JRNO01000019.1 GCA000759205_01017 gene open 87589-88326
2071 JRNO01000019.1 GCA000759205_01018 gene open 88459-88983
2072 JRNO01000019.1 GCA000759205_01019 gene open 88986-89675
2073 JRNO01000019.1 GCA000759205_01020 gene open 89719-90237
2074 JRNO01000019.1 GCA000759205_01021 gene open 90497-91381
2075 JRNO01000019.1 GCA000759205_01022 gene open 92317-94035 glnS
2076 JRNO01000019.1 GCA000759205_01023 gene open 94048-95253
2077 JRNO01000019.1 GCA000759205_01024 gene open 95289-95921
2078 JRNO01000019.1 GCA000759205_01025 gene open 95970-96656
2079 JRNO01000019.1 GCA000759205_01026 gene open 96937-102081
2080 JRNO01000019.1 GCA000759205_01027 gene open 102065-104491
2081 JRNO01000019.1 GCA000759205_01028 gene open 105154-105843 mtgA
2082 JRNO01000019.1 GCA000759205_01029 gene open 105912-108440
2083 JRNO01000019.1 GCA000759205_01030 gene open 108472-111291
2084 JRNO01000019.1 GCA000759205_01031 gene open 111561-114845
2085 JRNO01000019.1 GCA000759205_01032 gene open 114866-115705 ispE
2086 JRNO01000019.1 GCA000759205_01033 gene open 115804-117324 dnaB
2087 JRNO01000019.1 GCA000759205_01034 gene open 118288-120870 gyrA
2088 JRNO01000019.1 GCA000759205_01035 gene open 120918-122180
2089 JRNO01000019.1 GCA000759205_01036 gene open 122267-123379
2090 JRNO01000019.1 GCA000759205_01037 gene open 123376-124581
2091 JRNO01000019.1 GCA000759205_01038 gene open 124584-125897 dbpA
2092 JRNO01000019.1 GCA000759205_01039 gene open 126104-127171 serC
2093 JRNO01000019.1 GCA000759205_01040 gene open 127263-128180 serA
2094 JRNO01000019.1 GCA000759205_01041 gene open 128269-129516
2095 JRNO01000019.1 GCA000759205_01042 gene open 129537-130130 yigZ
2096 JRNO01000019.1 GCA000759205_01044 gene open 131117-132754
2097 JRNO01000019.1 GCA000759205_01045 gene open 132772-134409
2098 JRNO01000019.1 GCA000759205_01046 gene open 134478-134708
2099 JRNO01000019.1 GCA000759205_01047 gene open 134705-135658
2100 JRNO01000019.1 GCA000759205_01048 gene open 135645-136373
2101 JRNO01000019.1 GCA000759205_01049 gene open 136373-136756 dksA
2102 JRNO01000019.1 GCA000759205_01050 gene open 136891-140556 ileS
2103 JRNO01000019.1 GCA000759205_00940 gene open 2-76 trnP
2104 JRNO01000019.1 GCA000759205_01043 gene open 130384-130475 trnS
2105 JRNO01000019.1 GCA000759205_00940 tRNA open 2-76 trnP tRNA-Pro(ggg)
2106 JRNO01000019.1 GCA000759205_01043 tRNA open 130384-130475 trnS tRNA-Ser(cga)
2107 JRNO01000020.1 repeat_region open 36-1553 CRISPR array with 20 repeats of length 47%2C consensus sequence GTTGTGAATTGCTTCAAAATGTGTATCTTTGCAGTAGCAAGCACAAT and spacer length 29
2108 JRNO01000020.1 repeat_region open 1651-3087 CRISPR array with 19 repeats of length 47%2C consensus sequence GTTGTGAATTGCTTCAAAATGTGTATCTTTGCAGTAGCAAGCACAAT and spacer length 29
2109 JRNO01000021.1 repeat_region open 35-553 CRISPR array with 7 repeats of length 47%2C consensus sequence GTTGTGAATTGCTTCAAAATGTGTATCTTTGCAGTAGCAAGCACAAT and spacer length 29
2110 JRNO01000022.1 repeat_region open 36-1090 CRISPR array with 14 repeats of length 47%2C consensus sequence GTTGTGAATTGCTTCAAAATGTGTATCTTTGCAGTAGCAAGCACAAT and spacer length 29
2111 JRNO01000022.1 GCA000759205_01051 CDS open 1519-2445 _na     308_aa cas1 type II CRISPR-associated endonuclease Cas1
2112 JRNO01000022.1 GCA000759205_01052 CDS open 2442-6710 _na     1422_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2113 JRNO01000022.1 GCA000759205_01053 CDS open 7376-10096 _na     906_aa ppdK pyruvate%2C phosphate dikinase
2114 JRNO01000022.1 GCA000759205_01054 CDS open 10303-11739 _na     478_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2115 JRNO01000022.1 GCA000759205_01055 CDS open 12739-15123 _na     794_aa cirA TonB-dependent receptor plug domain protein
2116 JRNO01000022.1 GCA000759205_01056 CDS open 15235-15813 _na     192_aa pnuC nicotinamide riboside transporter PnuC
2117 JRNO01000022.1 GCA000759205_01057 CDS open 15930-16697 _na     255_aa thiamine diphosphokinase
2118 JRNO01000022.1 GCA000759205_01058 CDS open 16921-17895 _na     324_aa Glycosidase
2119 JRNO01000022.1 GCA000759205_01059 CDS open 18048-20303 _na     751_aa Putative alpha-1%2C2-mannosidase
2120 JRNO01000022.1 GCA000759205_01060 CDS open 20356-22455 _na     699_aa beta-N-acetylhexosaminidase
2121 JRNO01000022.1 GCA000759205_01061 CDS open 22686-24836 _na     716_aa Putative alpha-1%2C2-mannosidase
2122 JRNO01000022.1 GCA000759205_01062 CDS open 24936-26027 _na     363_aa Mucin-desulfating sulfatase
2123 JRNO01000022.1 GCA000759205_01063 CDS open 26024-26677 _na     217_aa Carbohydrate-binding domain-containing protein
2124 JRNO01000022.1 GCA000759205_01064 CDS open 26973-29180 _na     735_aa oVP1 sodium-translocating pyrophosphatase
2125 JRNO01000022.1 GCA000759205_01065 CDS open 29226-29699 _na     157_aa hypothetical protein
2126 JRNO01000022.1 GCA000759205_01066 CDS open 29604-30056 _na     150_aa Bifunctional NMN adenylyltransferase/Nudix hydrolase
2127 JRNO01000022.1 GCA000759205_01067 CDS open 30023-30205 _na     60_aa hypothetical protein
2128 JRNO01000022.1 GCA000759205_01068 CDS open 30274-31125 _na     283_aa GSCFA family protein
2129 JRNO01000022.1 GCA000759205_01069 CDS open 31137-31571 _na     144_aa Transcriptional regulator%2C Fur family
2130 JRNO01000022.1 GCA000759205_01070 CDS open 31850-34330 _na     826_aa alr bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
2131 JRNO01000022.1 GCA000759205_01071 CDS open 35215-35664 _na     149_aa DUF2721 domain-containing protein
2132 JRNO01000022.1 GCA000759205_01072 CDS open 35671-36153 _na     160_aa RNA polymerase sigma factor
2133 JRNO01000022.1 GCA000759205_01073 CDS open 36150-36539 _na     129_aa PTS cellobiose transporter subunit IIC
2134 JRNO01000022.1 GCA000759205_01074 CDS open 36814-37125 _na     103_aa hypothetical protein
2135 JRNO01000022.1 GCA000759205_01075 CDS open 37590-38486 _na     298_aa Lipoprotein
2136 JRNO01000022.1 GCA000759205_01076 CDS open 38508-39224 _na     238_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2137 JRNO01000022.1 GCA000759205_01077 CDS open 39561-39725 _na     54_aa hypothetical protein
2138 JRNO01000022.1 GCA000759205_01078 CDS open 39759-40757 _na     332_aa luxR Transcriptional regulator%2C LuxR family
2139 JRNO01000022.1 GCA000759205_01079 CDS open 41007-41600 _na     197_aa thymidine kinase
2140 JRNO01000022.1 GCA000759205_01080 CDS open 41607-42686 _na     359_aa Pheromone autoinducer 2 transporter
2141 JRNO01000022.1 GCA000759205_01081 CDS open 42814-42975 _na     53_aa hypothetical protein
2142 JRNO01000022.1 GCA000759205_01051 gene open 1519-2445 cas1
2143 JRNO01000022.1 GCA000759205_01052 gene open 2442-6710 cas9
2144 JRNO01000022.1 GCA000759205_01053 gene open 7376-10096 ppdK
2145 JRNO01000022.1 GCA000759205_01054 gene open 10303-11739 rlmD
2146 JRNO01000022.1 GCA000759205_01055 gene open 12739-15123 cirA
2147 JRNO01000022.1 GCA000759205_01056 gene open 15235-15813 pnuC
2148 JRNO01000022.1 GCA000759205_01057 gene open 15930-16697
2149 JRNO01000022.1 GCA000759205_01058 gene open 16921-17895
2150 JRNO01000022.1 GCA000759205_01059 gene open 18048-20303
2151 JRNO01000022.1 GCA000759205_01060 gene open 20356-22455
2152 JRNO01000022.1 GCA000759205_01061 gene open 22686-24836
2153 JRNO01000022.1 GCA000759205_01062 gene open 24936-26027
2154 JRNO01000022.1 GCA000759205_01063 gene open 26024-26677
2155 JRNO01000022.1 GCA000759205_01064 gene open 26973-29180 oVP1
2156 JRNO01000022.1 GCA000759205_01065 gene open 29226-29699
2157 JRNO01000022.1 GCA000759205_01066 gene open 29604-30056
2158 JRNO01000022.1 GCA000759205_01067 gene open 30023-30205
2159 JRNO01000022.1 GCA000759205_01068 gene open 30274-31125
2160 JRNO01000022.1 GCA000759205_01069 gene open 31137-31571
2161 JRNO01000022.1 GCA000759205_01070 gene open 31850-34330 alr
2162 JRNO01000022.1 GCA000759205_01071 gene open 35215-35664
2163 JRNO01000022.1 GCA000759205_01072 gene open 35671-36153
2164 JRNO01000022.1 GCA000759205_01073 gene open 36150-36539
2165 JRNO01000022.1 GCA000759205_01074 gene open 36814-37125
2166 JRNO01000022.1 GCA000759205_01075 gene open 37590-38486
2167 JRNO01000022.1 GCA000759205_01076 gene open 38508-39224 rsmI
2168 JRNO01000022.1 GCA000759205_01077 gene open 39561-39725
2169 JRNO01000022.1 GCA000759205_01078 gene open 39759-40757 luxR
2170 JRNO01000022.1 GCA000759205_01079 gene open 41007-41600
2171 JRNO01000022.1 GCA000759205_01080 gene open 41607-42686
2172 JRNO01000022.1 GCA000759205_01081 gene open 42814-42975
2173 JRNO01000023.1 GCA000759205_01130 gene open 65433-65621 Bacteroidales-1
2174 JRNO01000023.1 GCA000759205_01130 ncRNA open 65433-65621 Bacteroidales-1 6S-Bacteroidales RNA suggested
2175 JRNO01000023.1 GCA000759205_01082 CDS open 225-1922 _na     565_aa ettA energy-dependent translational throttle protein EttA
2176 JRNO01000023.1 GCA000759205_01083 CDS open 2167-2667 _na     166_aa DNA mismatch endonuclease Vsr
2177 JRNO01000023.1 GCA000759205_01084 CDS open 2952-4283 _na     443_aa rmuC DNA recombination protein rmuC
2178 JRNO01000023.1 GCA000759205_01085 CDS open 4352-5308 _na     318_aa manA mannose-6-phosphate isomerase%2C class I
2179 JRNO01000023.1 GCA000759205_01086 CDS open 5866-7419 _na     517_aa Lipocalin-like domain-containing protein
2180 JRNO01000023.1 GCA000759205_01087 CDS open 7462-8415 _na     317_aa Outer membrane insertion signal domain protein
2181 JRNO01000023.1 GCA000759205_01088 CDS open 8428-11190 _na     920_aa Peptidase%2C S8/S53 family
2182 JRNO01000023.1 GCA000759205_01089 CDS open 11208-12812 _na     534_aa BACON domain-containing protein
2183 JRNO01000023.1 GCA000759205_01090 CDS open 12849-14468 _na     539_aa BACON domain-containing protein
2184 JRNO01000023.1 GCA000759205_01091 CDS open 15078-16217 _na     379_aa DNA polymerase III subunit tau
2185 JRNO01000023.1 GCA000759205_01092 CDS open 16349-17707 _na     452_aa PSP1 C-terminal conserved region
2186 JRNO01000023.1 GCA000759205_01093 CDS open 17704-18198 _na     164_aa gldH Gliding motility-associated lipoprotein GldH
2187 JRNO01000023.1 GCA000759205_01094 CDS open 18285-20576 _na     763_aa TonB-dependent receptor
2188 JRNO01000023.1 GCA000759205_01095 CDS open 20588-21892 _na     434_aa ydeM Anaerobic sulfatase-maturating enzyme-like protein YdeM
2189 JRNO01000023.1 GCA000759205_01096 CDS open 22813-24090 _na     425_aa DUF3078 domain-containing protein
2190 JRNO01000023.1 GCA000759205_01097 CDS open 24267-25514 _na     415_aa hflX GTPase HflX
2191 JRNO01000023.1 GCA000759205_01098 CDS open 25579-27432 _na     617_aa glgC DUF6819 domain-containing protein
2192 JRNO01000023.1 GCA000759205_01099 CDS open 27472-30402 _na     976_aa Peptidase M16 inactive domain protein
2193 JRNO01000023.1 GCA000759205_01100 CDS open 30579-32225 _na     548_aa ttdA Fumarate hydratase class I
2194 JRNO01000023.1 GCA000759205_01101 CDS open 32491-34092 _na     533_aa Leucine-rich repeat domain-containing protein
2195 JRNO01000023.1 GCA000759205_01102 CDS open 34151-35707 _na     518_aa DUF6850 domain-containing protein
2196 JRNO01000023.1 GCA000759205_01103 CDS open 35694-37001 _na     435_aa DUF4876 domain-containing protein
2197 JRNO01000023.1 GCA000759205_01104 CDS open 37024-39792 _na     922_aa TonB-dependent receptor plug domain protein
2198 JRNO01000023.1 GCA000759205_01105 CDS open 39869-40006 _na     45_aa hypothetical protein
2199 JRNO01000023.1 GCA000759205_01106 CDS open 40151-40483 _na     110_aa Cupin domain protein
2200 JRNO01000023.1 GCA000759205_01107 CDS open 40644-43904 _na     1086_aa TonB-dependent receptor plug domain-containing protein
2201 JRNO01000023.1 GCA000759205_01108 CDS open 44107-44886 _na     259_aa Ribosomal RNA small subunit methyltransferase E
2202 JRNO01000023.1 GCA000759205_01109 CDS open 44932-45480 _na     182_aa BFN domain-containing protein
2203 JRNO01000023.1 GCA000759205_01110 CDS open 45630-46892 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
2204 JRNO01000023.1 GCA000759205_01111 CDS open 46967-47566 _na     199_aa Lipoprotein
2205 JRNO01000023.1 GCA000759205_01112 CDS open 47607-48089 _na     160_aa Lipoprotein
2206 JRNO01000023.1 GCA000759205_01113 CDS open 48117-48386 _na     89_aa Lipoprotein
2207 JRNO01000023.1 GCA000759205_01114 CDS open 48367-48876 _na     169_aa Zinc ribbon domain-containing protein
2208 JRNO01000023.1 GCA000759205_01115 CDS open 49202-49972 _na     256_aa rlpA putative endolytic peptidoglycan transglycosylase RlpA
2209 JRNO01000023.1 GCA000759205_01116 CDS open 50067-51404 _na     445_aa gdhA NADP-specific glutamate dehydrogenase
2210 JRNO01000023.1 GCA000759205_01117 CDS open 51616-54657 _na     1013_aa Pyruvate phosphate dikinase%2C PEP/pyruvate binding domain protein
2211 JRNO01000023.1 GCA000759205_01118 CDS open 55180-56247 _na     355_aa Putative mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase
2212 JRNO01000023.1 GCA000759205_01119 CDS open 56231-56395 _na     54_aa hypothetical protein
2213 JRNO01000023.1 GCA000759205_01120 CDS open 56413-56583 _na     56_aa hypothetical protein
2214 JRNO01000023.1 GCA000759205_01121 CDS open 56600-57622 _na     340_aa Phytase-like domain-containing protein
2215 JRNO01000023.1 GCA000759205_01122 CDS open 57689-58774 _na     361_aa FMN-binding domain protein
2216 JRNO01000023.1 GCA000759205_01123 CDS open 58847-59020 _na     57_aa hypothetical protein
2217 JRNO01000023.1 GCA000759205_01124 CDS open 59017-60102 _na     361_aa gcvT glycine cleavage system aminomethyltransferase GcvT
2218 JRNO01000023.1 GCA000759205_01125 CDS open 60268-60648 _na     126_aa gcvH glycine cleavage system protein GcvH
2219 JRNO01000023.1 GCA000759205_01126 CDS open 60956-62266 _na     436_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
2220 JRNO01000023.1 GCA000759205_01127 CDS open 62298-63788 _na     496_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
2221 JRNO01000023.1 GCA000759205_01128 CDS open 63851-65215 _na     454_aa lpdA dihydrolipoyl dehydrogenase
2222 JRNO01000023.1 GCA000759205_01129 CDS open 65173-65364 _na     63_aa hypothetical protein
2223 JRNO01000023.1 GCA000759205_01131 CDS open 65815-65964 _na     49_aa Conserved domain protein
2224 JRNO01000023.1 GCA000759205_01132 CDS open 66025-66642 _na     205_aa riboflavin synthase
2225 JRNO01000023.1 GCA000759205_01133 CDS open 66804-67514 _na     236_aa Response regulator receiver domain protein
2226 JRNO01000023.1 GCA000759205_01134 CDS open 67489-68562 _na     357_aa ypdA Inner membrane protein ypdA
2227 JRNO01000023.1 GCA000759205_01135 CDS open 69263-72322 _na     1019_aa Beta-galactosidase
2228 JRNO01000023.1 GCA000759205_01136 CDS open 72394-73371 _na     325_aa putative transmembrane transcriptional regulator (Anti-sigma factor)
2229 JRNO01000023.1 GCA000759205_01137 CDS open 73763-74287 _na     174_aa sigV RNA polymerase sigma factor sigV
2230 JRNO01000023.1 GCA000759205_01138 CDS open 74531-77857 _na     1108_aa TonB-linked outer membrane protein%2C SusC/RagA family
2231 JRNO01000023.1 GCA000759205_01139 CDS open 77864-79393 _na     509_aa Putative lipoprotein
2232 JRNO01000023.1 GCA000759205_01140 CDS open 79794-80324 _na     176_aa FHA domain
2233 JRNO01000023.1 GCA000759205_01141 CDS open 80296-80493 _na     65_aa hypothetical protein
2234 JRNO01000023.1 GCA000759205_01142 CDS open 80513-81508 _na     331_aa SPOR domain-containing protein
2235 JRNO01000023.1 GCA000759205_01143 CDS open 81720-82274 _na     184_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
2236 JRNO01000023.1 GCA000759205_01144 CDS open 82360-83148 _na     262_aa Putative lipoprotein
2237 JRNO01000023.1 GCA000759205_01145 CDS open 83063-83533 _na     156_aa hypothetical protein
2238 JRNO01000023.1 GCA000759205_01082 gene open 225-1922 ettA
2239 JRNO01000023.1 GCA000759205_01083 gene open 2167-2667
2240 JRNO01000023.1 GCA000759205_01084 gene open 2952-4283 rmuC
2241 JRNO01000023.1 GCA000759205_01085 gene open 4352-5308 manA
2242 JRNO01000023.1 GCA000759205_01086 gene open 5866-7419
2243 JRNO01000023.1 GCA000759205_01087 gene open 7462-8415
2244 JRNO01000023.1 GCA000759205_01088 gene open 8428-11190
2245 JRNO01000023.1 GCA000759205_01089 gene open 11208-12812
2246 JRNO01000023.1 GCA000759205_01090 gene open 12849-14468
2247 JRNO01000023.1 GCA000759205_01091 gene open 15078-16217
2248 JRNO01000023.1 GCA000759205_01092 gene open 16349-17707
2249 JRNO01000023.1 GCA000759205_01093 gene open 17704-18198 gldH
2250 JRNO01000023.1 GCA000759205_01094 gene open 18285-20576
2251 JRNO01000023.1 GCA000759205_01095 gene open 20588-21892 ydeM
2252 JRNO01000023.1 GCA000759205_01096 gene open 22813-24090
2253 JRNO01000023.1 GCA000759205_01097 gene open 24267-25514 hflX
2254 JRNO01000023.1 GCA000759205_01098 gene open 25579-27432 glgC
2255 JRNO01000023.1 GCA000759205_01099 gene open 27472-30402
2256 JRNO01000023.1 GCA000759205_01100 gene open 30579-32225 ttdA
2257 JRNO01000023.1 GCA000759205_01101 gene open 32491-34092
2258 JRNO01000023.1 GCA000759205_01102 gene open 34151-35707
2259 JRNO01000023.1 GCA000759205_01103 gene open 35694-37001
2260 JRNO01000023.1 GCA000759205_01104 gene open 37024-39792
2261 JRNO01000023.1 GCA000759205_01105 gene open 39869-40006
2262 JRNO01000023.1 GCA000759205_01106 gene open 40151-40483
2263 JRNO01000023.1 GCA000759205_01107 gene open 40644-43904
2264 JRNO01000023.1 GCA000759205_01108 gene open 44107-44886
2265 JRNO01000023.1 GCA000759205_01109 gene open 44932-45480
2266 JRNO01000023.1 GCA000759205_01110 gene open 45630-46892
2267 JRNO01000023.1 GCA000759205_01111 gene open 46967-47566
2268 JRNO01000023.1 GCA000759205_01112 gene open 47607-48089
2269 JRNO01000023.1 GCA000759205_01113 gene open 48117-48386
2270 JRNO01000023.1 GCA000759205_01114 gene open 48367-48876
2271 JRNO01000023.1 GCA000759205_01115 gene open 49202-49972 rlpA
2272 JRNO01000023.1 GCA000759205_01116 gene open 50067-51404 gdhA
2273 JRNO01000023.1 GCA000759205_01117 gene open 51616-54657
2274 JRNO01000023.1 GCA000759205_01118 gene open 55180-56247
2275 JRNO01000023.1 GCA000759205_01119 gene open 56231-56395
2276 JRNO01000023.1 GCA000759205_01120 gene open 56413-56583
2277 JRNO01000023.1 GCA000759205_01121 gene open 56600-57622
2278 JRNO01000023.1 GCA000759205_01122 gene open 57689-58774
2279 JRNO01000023.1 GCA000759205_01123 gene open 58847-59020
2280 JRNO01000023.1 GCA000759205_01124 gene open 59017-60102 gcvT
2281 JRNO01000023.1 GCA000759205_01125 gene open 60268-60648 gcvH
2282 JRNO01000023.1 GCA000759205_01126 gene open 60956-62266 gcvPA
2283 JRNO01000023.1 GCA000759205_01127 gene open 62298-63788 gcvPB
2284 JRNO01000023.1 GCA000759205_01128 gene open 63851-65215 lpdA
2285 JRNO01000023.1 GCA000759205_01129 gene open 65173-65364
2286 JRNO01000023.1 GCA000759205_01131 gene open 65815-65964
2287 JRNO01000023.1 GCA000759205_01132 gene open 66025-66642
2288 JRNO01000023.1 GCA000759205_01133 gene open 66804-67514
2289 JRNO01000023.1 GCA000759205_01134 gene open 67489-68562 ypdA
2290 JRNO01000023.1 GCA000759205_01135 gene open 69263-72322
2291 JRNO01000023.1 GCA000759205_01136 gene open 72394-73371
2292 JRNO01000023.1 GCA000759205_01137 gene open 73763-74287 sigV
2293 JRNO01000023.1 GCA000759205_01138 gene open 74531-77857
2294 JRNO01000023.1 GCA000759205_01139 gene open 77864-79393
2295 JRNO01000023.1 GCA000759205_01140 gene open 79794-80324
2296 JRNO01000023.1 GCA000759205_01141 gene open 80296-80493
2297 JRNO01000023.1 GCA000759205_01142 gene open 80513-81508
2298 JRNO01000023.1 GCA000759205_01143 gene open 81720-82274 rfbC
2299 JRNO01000023.1 GCA000759205_01144 gene open 82360-83148
2300 JRNO01000023.1 GCA000759205_01145 gene open 83063-83533
2301 JRNO01000024.1 GCA000759205_01146 CDS open 361-915 _na     184_aa hypothetical protein
2302 JRNO01000024.1 GCA000759205_01147 CDS open 902-1297 _na     131_aa Helix-turn-helix domain-containing protein
2303 JRNO01000024.1 GCA000759205_01148 CDS open 1357-3357 _na     666_aa AAA family ATPase
2304 JRNO01000024.1 GCA000759205_01149 CDS open 3345-3653 _na     102_aa Helix-turn-helix domain-containing protein
2305 JRNO01000024.1 GCA000759205_01150 CDS open 3770-4357 _na     195_aa AbiEi antitoxin C-terminal domain-containing protein
2306 JRNO01000024.1 GCA000759205_01151 CDS open 4361-5383 _na     340_aa Nucleotidyl transferase%2C PF08843 family
2307 JRNO01000024.1 GCA000759205_01152 CDS open 5376-5486 _na     36_aa hypothetical protein
2308 JRNO01000024.1 GCA000759205_01153 CDS open 5435-6991 _na     518_aa Helicase C-terminal domain-containing protein
2309 JRNO01000024.1 GCA000759205_01154 CDS open 7282-8502 _na     406_aa xerD Tyr recombinase domain-containing protein
2310 JRNO01000024.1 GCA000759205_01155 CDS open 8507-9775 _na     422_aa Tyr recombinase domain-containing protein
2311 JRNO01000024.1 GCA000759205_01146 gene open 361-915
2312 JRNO01000024.1 GCA000759205_01147 gene open 902-1297
2313 JRNO01000024.1 GCA000759205_01148 gene open 1357-3357
2314 JRNO01000024.1 GCA000759205_01149 gene open 3345-3653
2315 JRNO01000024.1 GCA000759205_01150 gene open 3770-4357
2316 JRNO01000024.1 GCA000759205_01151 gene open 4361-5383
2317 JRNO01000024.1 GCA000759205_01152 gene open 5376-5486
2318 JRNO01000024.1 GCA000759205_01153 gene open 5435-6991
2319 JRNO01000024.1 GCA000759205_01154 gene open 7282-8502 xerD
2320 JRNO01000024.1 GCA000759205_01155 gene open 8507-9775
2321 JRNO01000025.1 regulatory_region open 10125-10191 lysM-Prevotella RNA
2322 JRNO01000025.1 GCA000759205_01156 CDS open 696-1625 _na     309_aa Acetyltransferase
2323 JRNO01000025.1 GCA000759205_01157 CDS open 1728-3488 _na     586_aa susD SusD family protein
2324 JRNO01000025.1 GCA000759205_01158 CDS open 3517-6705 _na     1062_aa TonB-linked outer membrane protein%2C SusC/RagA family
2325 JRNO01000025.1 GCA000759205_01159 CDS open 7113-7751 _na     212_aa yfcE phosphodiesterase
2326 JRNO01000025.1 GCA000759205_01160 CDS open 7835-8968 _na     377_aa Fucose 4-O-acetylase and related acetyltransferases
2327 JRNO01000025.1 GCA000759205_01161 CDS open 9114-10118 _na     334_aa spoVID LysM domain-containing protein
2328 JRNO01000025.1 GCA000759205_01162 CDS open 10394-12490 _na     698_aa recG ATP-dependent DNA helicase RecG
2329 JRNO01000025.1 GCA000759205_01163 CDS open 12883-13587 _na     234_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2330 JRNO01000025.1 GCA000759205_01164 CDS open 13603-14172 _na     189_aa DJ-1 family glyoxalase III
2331 JRNO01000025.1 GCA000759205_01165 CDS open 14307-15197 _na     296_aa NAD kinase
2332 JRNO01000025.1 GCA000759205_01166 CDS open 15351-17027 _na     558_aa mdlB ABC transporter
2333 JRNO01000025.1 GCA000759205_01167 CDS open 17068-17274 _na     68_aa DUF6722 domain-containing protein
2334 JRNO01000025.1 GCA000759205_01168 CDS open 17276-17386 _na     36_aa hypothetical protein
2335 JRNO01000025.1 GCA000759205_01169 CDS open 17383-18315 _na     310_aa resA Thiol-disulfide oxidoreductase resA
2336 JRNO01000025.1 GCA000759205_01170 CDS open 18489-19424 _na     311_aa DUF5050 domain-containing protein
2337 JRNO01000025.1 GCA000759205_01171 CDS open 19424-19936 _na     170_aa hypothetical protein
2338 JRNO01000025.1 GCA000759205_01172 CDS open 19952-20479 _na     175_aa Outer membrane protein beta-barrel domain-containing protein
2339 JRNO01000025.1 GCA000759205_01173 CDS open 20663-20956 _na     97_aa AAA family ATPase
2340 JRNO01000025.1 GCA000759205_01174 CDS open 21363-21869 _na     168_aa Lipoprotein
2341 JRNO01000025.1 GCA000759205_01156 gene open 696-1625
2342 JRNO01000025.1 GCA000759205_01157 gene open 1728-3488 susD
2343 JRNO01000025.1 GCA000759205_01158 gene open 3517-6705
2344 JRNO01000025.1 GCA000759205_01159 gene open 7113-7751 yfcE
2345 JRNO01000025.1 GCA000759205_01160 gene open 7835-8968
2346 JRNO01000025.1 GCA000759205_01161 gene open 9114-10118 spoVID
2347 JRNO01000025.1 GCA000759205_01162 gene open 10394-12490 recG
2348 JRNO01000025.1 GCA000759205_01163 gene open 12883-13587
2349 JRNO01000025.1 GCA000759205_01164 gene open 13603-14172
2350 JRNO01000025.1 GCA000759205_01165 gene open 14307-15197
2351 JRNO01000025.1 GCA000759205_01166 gene open 15351-17027 mdlB
2352 JRNO01000025.1 GCA000759205_01167 gene open 17068-17274
2353 JRNO01000025.1 GCA000759205_01168 gene open 17276-17386
2354 JRNO01000025.1 GCA000759205_01169 gene open 17383-18315 resA
2355 JRNO01000025.1 GCA000759205_01170 gene open 18489-19424
2356 JRNO01000025.1 GCA000759205_01171 gene open 19424-19936
2357 JRNO01000025.1 GCA000759205_01172 gene open 19952-20479
2358 JRNO01000025.1 GCA000759205_01173 gene open 20663-20956
2359 JRNO01000025.1 GCA000759205_01174 gene open 21363-21869
2360 JRNO01000026.1 GCA000759205_01175 CDS open 84-1910 _na     608_aa Arylsulfatase
2361 JRNO01000026.1 GCA000759205_01176 CDS open 3321-5204 _na     627_aa Cyclomaltodextrin glucanotransferase
2362 JRNO01000026.1 GCA000759205_01177 CDS open 5276-7183 _na     635_aa pulA type I pullulanase
2363 JRNO01000026.1 GCA000759205_01178 CDS open 7338-10031 _na     897_aa malQ 4-alpha-glucanotransferase
2364 JRNO01000026.1 GCA000759205_01179 CDS open 10496-12163 _na     555_aa Alpha amylase%2C catalytic domain protein
2365 JRNO01000026.1 GCA000759205_01180 CDS open 13044-14372 _na     442_aa Transporter%2C major facilitator family protein
2366 JRNO01000026.1 GCA000759205_01181 CDS open 14558-15583 _na     341_aa lacI Transcriptional regulator%2C LacI family
2367 JRNO01000026.1 GCA000759205_01182 CDS open 15862-18927 _na     1021_aa TonB-linked outer membrane protein%2C SusC/RagA family
2368 JRNO01000026.1 GCA000759205_01183 CDS open 18949-20583 _na     544_aa susD SusD family protein
2369 JRNO01000026.1 GCA000759205_01184 CDS open 20653-21810 _na     385_aa susE SusE outer membrane protein domain-containing protein
2370 JRNO01000026.1 GCA000759205_01185 CDS open 21893-22900 _na     335_aa Outer membrane protein SusF/SusE-like C-terminal domain-containing protein
2371 JRNO01000026.1 GCA000759205_01186 CDS open 23247-25262 _na     671_aa Alpha-amylase
2372 JRNO01000026.1 GCA000759205_01187 CDS open 25741-27096 _na     451_aa Transporter%2C anaerobic C4-dicarboxylate uptake (Dcu) family
2373 JRNO01000026.1 GCA000759205_01188 CDS open 27254-27712 _na     152_aa putative L-asparaginase periplasmic
2374 JRNO01000026.1 GCA000759205_01189 CDS open 27795-29000 _na     401_aa Phosphate-selective porin O and P
2375 JRNO01000026.1 GCA000759205_01190 CDS open 29139-30551 _na     470_aa aspA aspartate ammonia-lyase
2376 JRNO01000026.1 GCA000759205_01191 CDS open 30742-31344 _na     200_aa ribonuclease HII
2377 JRNO01000026.1 GCA000759205_01192 CDS open 31481-32698 _na     405_aa Cysteine desulfurase
2378 JRNO01000026.1 GCA000759205_01193 CDS open 32780-34123 _na     447_aa sufD Fe-S cluster assembly protein SufD
2379 JRNO01000026.1 GCA000759205_01194 CDS open 34233-34991 _na     252_aa sufC Fe-S cluster assembly ATPase SufC
2380 JRNO01000026.1 GCA000759205_01195 CDS open 35004-35408 _na     134_aa hypothetical protein
2381 JRNO01000026.1 GCA000759205_01196 CDS open 35427-36872 _na     481_aa sufB Fe-S cluster assembly protein SufB
2382 JRNO01000026.1 GCA000759205_01197 CDS open 37005-39851 _na     948_aa infB translation initiation factor IF-2
2383 JRNO01000026.1 GCA000759205_01198 CDS open 39987-41252 _na     421_aa nusA Transcription termination/antitermination protein NusA
2384 JRNO01000026.1 GCA000759205_01199 CDS open 41257-41724 _na     155_aa rimP ribosome assembly cofactor RimP
2385 JRNO01000026.1 GCA000759205_01200 CDS open 42256-44004 _na     582_aa Peptidase%2C S41 family
2386 JRNO01000026.1 GCA000759205_01202 CDS open 44622-45305 _na     227_aa hypothetical protein
2387 JRNO01000026.1 GCA000759205_01203 CDS open 45302-46570 _na     422_aa AAA family ATPase
2388 JRNO01000026.1 GCA000759205_01175 gene open 84-1910
2389 JRNO01000026.1 GCA000759205_01176 gene open 3321-5204
2390 JRNO01000026.1 GCA000759205_01177 gene open 5276-7183 pulA
2391 JRNO01000026.1 GCA000759205_01178 gene open 7338-10031 malQ
2392 JRNO01000026.1 GCA000759205_01179 gene open 10496-12163
2393 JRNO01000026.1 GCA000759205_01180 gene open 13044-14372
2394 JRNO01000026.1 GCA000759205_01181 gene open 14558-15583 lacI
2395 JRNO01000026.1 GCA000759205_01182 gene open 15862-18927
2396 JRNO01000026.1 GCA000759205_01183 gene open 18949-20583 susD
2397 JRNO01000026.1 GCA000759205_01184 gene open 20653-21810 susE
2398 JRNO01000026.1 GCA000759205_01185 gene open 21893-22900
2399 JRNO01000026.1 GCA000759205_01186 gene open 23247-25262
2400 JRNO01000026.1 GCA000759205_01187 gene open 25741-27096
2401 JRNO01000026.1 GCA000759205_01188 gene open 27254-27712
2402 JRNO01000026.1 GCA000759205_01189 gene open 27795-29000
2403 JRNO01000026.1 GCA000759205_01190 gene open 29139-30551 aspA
2404 JRNO01000026.1 GCA000759205_01191 gene open 30742-31344
2405 JRNO01000026.1 GCA000759205_01192 gene open 31481-32698
2406 JRNO01000026.1 GCA000759205_01193 gene open 32780-34123 sufD
2407 JRNO01000026.1 GCA000759205_01194 gene open 34233-34991 sufC
2408 JRNO01000026.1 GCA000759205_01195 gene open 35004-35408
2409 JRNO01000026.1 GCA000759205_01196 gene open 35427-36872 sufB
2410 JRNO01000026.1 GCA000759205_01197 gene open 37005-39851 infB
2411 JRNO01000026.1 GCA000759205_01198 gene open 39987-41252 nusA
2412 JRNO01000026.1 GCA000759205_01199 gene open 41257-41724 rimP
2413 JRNO01000026.1 GCA000759205_01200 gene open 42256-44004
2414 JRNO01000026.1 GCA000759205_01202 gene open 44622-45305
2415 JRNO01000026.1 GCA000759205_01203 gene open 45302-46570
2416 JRNO01000026.1 GCA000759205_01201 gene open 44199-44272 trnN
2417 JRNO01000026.1 GCA000759205_01201 tRNA open 44199-44272 trnN tRNA-Asn(gtt)
2418 JRNO01000027.1 GCA000759205_01204 CDS open 398-2671 _na     757_aa Outer membrane protein beta-barrel domain-containing protein
2419 JRNO01000027.1 GCA000759205_01205 CDS open 3157-3573 _na     138_aa hypothetical protein
2420 JRNO01000027.1 GCA000759205_01204 gene open 398-2671
2421 JRNO01000027.1 GCA000759205_01205 gene open 3157-3573
2422 JRNO01000028.1 GCA000759205_01206 CDS open 38-952 _na     304_aa ATP-binding cassette domain-containing protein
2423 JRNO01000028.1 GCA000759205_01207 CDS open 971-1120 _na     49_aa hypothetical protein
2424 JRNO01000028.1 GCA000759205_01208 CDS open 1488-1856 _na     122_aa sORL Desulfoferrodoxin
2425 JRNO01000028.1 GCA000759205_01209 CDS open 2083-2718 _na     211_aa DUF4294 domain-containing protein
2426 JRNO01000028.1 GCA000759205_01210 CDS open 2758-4341 _na     527_aa Lipoprotein
2427 JRNO01000028.1 GCA000759205_01211 CDS open 4708-5982 _na     424_aa Mannosylfructose-phosphate synthase
2428 JRNO01000028.1 GCA000759205_01212 CDS open 5979-6758 _na     259_aa Glycosyltransferase%2C group 2 family protein
2429 JRNO01000028.1 GCA000759205_01213 CDS open 6921-7358 _na     145_aa Serum opacity factor
2430 JRNO01000028.1 GCA000759205_01214 CDS open 7636-7770 _na     44_aa hypothetical protein
2431 JRNO01000028.1 GCA000759205_01215 CDS open 7982-11257 _na     1091_aa Colicin I receptor
2432 JRNO01000028.1 GCA000759205_01216 CDS open 11278-12948 _na     556_aa SusD-like N-terminal domain-containing protein
2433 JRNO01000028.1 GCA000759205_01217 CDS open 12978-13733 _na     251_aa Lipoprotein
2434 JRNO01000028.1 GCA000759205_01218 CDS open 13855-14829 _na     324_aa WYL domain-containing protein
2435 JRNO01000028.1 GCA000759205_01219 CDS open 15003-16196 _na     397_aa SGNH hydrolase-type esterase domain-containing protein
2436 JRNO01000028.1 GCA000759205_01220 CDS open 16317-17456 _na     379_aa Conserved domain protein
2437 JRNO01000028.1 GCA000759205_01221 CDS open 17831-18352 _na     173_aa tonB TonB family C-terminal domain protein
2438 JRNO01000028.1 GCA000759205_01222 CDS open 18566-20083 _na     505_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
2439 JRNO01000028.1 GCA000759205_01223 CDS open 20232-20693 _na     153_aa Lipoprotein
2440 JRNO01000028.1 GCA000759205_01224 CDS open 20776-20922 _na     48_aa Conserved domain protein
2441 JRNO01000028.1 GCA000759205_01225 CDS open 20987-21289 _na     100_aa Lipoprotein
2442 JRNO01000028.1 GCA000759205_01226 CDS open 21388-22053 _na     221_aa ung uracil-DNA glycosylase
2443 JRNO01000028.1 GCA000759205_01227 CDS open 22069-22770 _na     233_aa ung uracil-DNA glycosylase
2444 JRNO01000028.1 GCA000759205_01228 CDS open 23067-23657 _na     196_aa DUF3109 domain-containing protein
2445 JRNO01000028.1 GCA000759205_01229 CDS open 23737-24621 _na     294_aa araC Transcriptional regulator%2C AraC family
2446 JRNO01000028.1 GCA000759205_01230 CDS open 24895-26868 _na     657_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2447 JRNO01000028.1 GCA000759205_01206 gene open 38-952
2448 JRNO01000028.1 GCA000759205_01207 gene open 971-1120
2449 JRNO01000028.1 GCA000759205_01208 gene open 1488-1856 sORL
2450 JRNO01000028.1 GCA000759205_01209 gene open 2083-2718
2451 JRNO01000028.1 GCA000759205_01210 gene open 2758-4341
2452 JRNO01000028.1 GCA000759205_01211 gene open 4708-5982
2453 JRNO01000028.1 GCA000759205_01212 gene open 5979-6758
2454 JRNO01000028.1 GCA000759205_01213 gene open 6921-7358
2455 JRNO01000028.1 GCA000759205_01214 gene open 7636-7770
2456 JRNO01000028.1 GCA000759205_01215 gene open 7982-11257
2457 JRNO01000028.1 GCA000759205_01216 gene open 11278-12948
2458 JRNO01000028.1 GCA000759205_01217 gene open 12978-13733
2459 JRNO01000028.1 GCA000759205_01218 gene open 13855-14829
2460 JRNO01000028.1 GCA000759205_01219 gene open 15003-16196
2461 JRNO01000028.1 GCA000759205_01220 gene open 16317-17456
2462 JRNO01000028.1 GCA000759205_01221 gene open 17831-18352 tonB
2463 JRNO01000028.1 GCA000759205_01222 gene open 18566-20083 gpmI
2464 JRNO01000028.1 GCA000759205_01223 gene open 20232-20693
2465 JRNO01000028.1 GCA000759205_01224 gene open 20776-20922
2466 JRNO01000028.1 GCA000759205_01225 gene open 20987-21289
2467 JRNO01000028.1 GCA000759205_01226 gene open 21388-22053 ung
2468 JRNO01000028.1 GCA000759205_01227 gene open 22069-22770 ung
2469 JRNO01000028.1 GCA000759205_01228 gene open 23067-23657
2470 JRNO01000028.1 GCA000759205_01229 gene open 23737-24621 araC
2471 JRNO01000028.1 GCA000759205_01230 gene open 24895-26868 gyrB
2472 JRNO01000029.1 GCA000759205_01231 CDS open 278-532 _na     84_aa rpsT 30S ribosomal protein S20
2473 JRNO01000029.1 GCA000759205_01232 CDS open 888-1703 _na     271_aa recO DNA repair protein RecO
2474 JRNO01000029.1 GCA000759205_01233 CDS open 1931-2938 _na     335_aa yeiH YeiH family sulfate export transporter
2475 JRNO01000029.1 GCA000759205_01231 gene open 278-532 rpsT
2476 JRNO01000029.1 GCA000759205_01232 gene open 888-1703 recO
2477 JRNO01000029.1 GCA000759205_01233 gene open 1931-2938 yeiH
2478 JRNO01000030.1 GCA000759205_01234 CDS open 66-1391 _na     441_aa ftsZ cell division protein FtsZ
2479 JRNO01000030.1 GCA000759205_01235 CDS open 1455-2903 _na     482_aa ftsA cell division protein FtsA
2480 JRNO01000030.1 GCA000759205_01236 CDS open 2958-3896 _na     312_aa ftsQ Cell division protein FtsQ
2481 JRNO01000030.1 GCA000759205_01237 CDS open 3944-5320 _na     458_aa murC UDP-N-acetylmuramate--L-alanine ligase
2482 JRNO01000030.1 GCA000759205_01238 CDS open 5455-6561 _na     368_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
2483 JRNO01000030.1 GCA000759205_01239 CDS open 6647-7936 _na     429_aa ftsW putative peptidoglycan glycosyltransferase FtsW
2484 JRNO01000030.1 GCA000759205_01240 CDS open 7980-9311 _na     443_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
2485 JRNO01000030.1 GCA000759205_01241 CDS open 9507-10778 _na     423_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
2486 JRNO01000030.1 GCA000759205_01242 CDS open 10990-12444 _na     484_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
2487 JRNO01000030.1 GCA000759205_01243 CDS open 12492-14651 _na     719_aa Penicillin-binding protein%2C transpeptidase domain protein
2488 JRNO01000030.1 GCA000759205_01244 CDS open 14657-15271 _na     204_aa ftsL Cell division protein FtsL
2489 JRNO01000030.1 GCA000759205_01245 CDS open 15264-16208 _na     314_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2490 JRNO01000030.1 GCA000759205_01246 CDS open 16205-16717 _na     170_aa mraZ division/cell wall cluster transcriptional repressor MraZ
2491 JRNO01000030.1 GCA000759205_01247 CDS open 16971-17822 _na     283_aa Putative acyltransferase ACT14924-like acyltransferase domain-containing protein
2492 JRNO01000030.1 GCA000759205_01248 CDS open 17882-18871 _na     329_aa Hemolysin
2493 JRNO01000030.1 GCA000759205_01249 CDS open 19304-21556 _na     750_aa glnA3 Glutamate--ammonia ligase%2C catalytic domain protein
2494 JRNO01000030.1 GCA000759205_01250 CDS open 22043-24196 _na     717_aa Tetratricopeptide repeat family protein
2495 JRNO01000030.1 GCA000759205_01251 CDS open 24684-25142 _na     152_aa bcp thioredoxin-dependent thiol peroxidase
2496 JRNO01000030.1 GCA000759205_01234 gene open 66-1391 ftsZ
2497 JRNO01000030.1 GCA000759205_01235 gene open 1455-2903 ftsA
2498 JRNO01000030.1 GCA000759205_01236 gene open 2958-3896 ftsQ
2499 JRNO01000030.1 GCA000759205_01237 gene open 3944-5320 murC
2500 JRNO01000030.1 GCA000759205_01238 gene open 5455-6561 murG