BAKTAGenome Explorer: Prevotella amnii (GCA_000759315.1)
Select a Genome:
|
BAKTA Annotations for GCA_000759315.1
|
Search & Sort all 4264 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | JRNU01000094.1 | GCA000759315_01998 | gene | open | 859-1338 | hlyD | ||
| 4002 | JRNU01000096.1 | GCA000759315_01999 | CDS | open | 198-1232 | _na 344_aa | Porin | |
| 4003 | JRNU01000096.1 | GCA000759315_02000 | CDS | open | 1229-3871 | _na 880_aa | mgtA | magnesium-translocating P-type ATPase |
| 4004 | JRNU01000096.1 | GCA000759315_02001 | CDS | open | 4132-5502 | _na 456_aa | histidine kinase | |
| 4005 | JRNU01000096.1 | GCA000759315_02002 | CDS | open | 5499-6203 | _na 234_aa | Transcriptional regulator | |
| 4006 | JRNU01000096.1 | GCA000759315_01999 | gene | open | 198-1232 | |||
| 4007 | JRNU01000096.1 | GCA000759315_02000 | gene | open | 1229-3871 | mgtA | ||
| 4008 | JRNU01000096.1 | GCA000759315_02001 | gene | open | 4132-5502 | |||
| 4009 | JRNU01000096.1 | GCA000759315_02002 | gene | open | 5499-6203 | |||
| 4010 | JRNU01000097.1 | GCA000759315_02003 | CDS | open | 912-3134 | _na 740_aa | ABC transporter ATP-binding protein | |
| 4011 | JRNU01000097.1 | GCA000759315_02004 | CDS | open | 3149-4195 | _na 348_aa | gwsS | grasp-with-spasm system SPASM domain peptide maturase |
| 4012 | JRNU01000097.1 | GCA000759315_02005 | CDS | open | 4182-4403 | _na 73_aa | Transposase | |
| 4013 | JRNU01000097.1 | GCA000759315_02006 | CDS | open | 4393-5325 | _na 310_aa | gwsG | grasp-with-spasm system ATP-grasp peptide maturase |
| 4014 | JRNU01000097.1 | GCA000759315_02007 | CDS | open | 5469-5624 | _na 51_aa | hypothetical protein | |
| 4015 | JRNU01000097.1 | GCA000759315_02008 | CDS | open | 5676-5831 | _na 51_aa | hypothetical protein | |
| 4016 | JRNU01000097.1 | GCA000759315_02009 | CDS | open | 5881-6036 | _na 51_aa | hypothetical protein | |
| 4017 | JRNU01000097.1 | GCA000759315_02010 | CDS | open | 6108-7202 | _na 364_aa | DUF6734 domain-containing protein | |
| 4018 | JRNU01000097.1 | GCA000759315_02003 | gene | open | 912-3134 | |||
| 4019 | JRNU01000097.1 | GCA000759315_02004 | gene | open | 3149-4195 | gwsS | ||
| 4020 | JRNU01000097.1 | GCA000759315_02005 | gene | open | 4182-4403 | |||
| 4021 | JRNU01000097.1 | GCA000759315_02006 | gene | open | 4393-5325 | gwsG | ||
| 4022 | JRNU01000097.1 | GCA000759315_02007 | gene | open | 5469-5624 | |||
| 4023 | JRNU01000097.1 | GCA000759315_02008 | gene | open | 5676-5831 | |||
| 4024 | JRNU01000097.1 | GCA000759315_02009 | gene | open | 5881-6036 | |||
| 4025 | JRNU01000097.1 | GCA000759315_02010 | gene | open | 6108-7202 | |||
| 4026 | JRNU01000098.1 | GCA000759315_02011 | CDS | open | 373-573 | _na 66_aa | HTH cro/C1-type domain-containing protein | |
| 4027 | JRNU01000098.1 | GCA000759315_02012 | CDS | open | 585-1262 | _na 225_aa | nspV | Restriction endonuclease NspV |
| 4028 | JRNU01000098.1 | GCA000759315_02013 | CDS | open | 1249-2826 | _na 525_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 4029 | JRNU01000098.1 | GCA000759315_02014 | CDS | open | 2842-4281 | _na 479_aa | KAP NTPase domain-containing protein | |
| 4030 | JRNU01000098.1 | GCA000759315_02015 | CDS | open | 4440-5672 | _na 410_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 4031 | JRNU01000098.1 | GCA000759315_02016 | CDS | open | 6347-6799 | _na 150_aa | transposase | |
| 4032 | JRNU01000098.1 | GCA000759315_02011 | gene | open | 373-573 | |||
| 4033 | JRNU01000098.1 | GCA000759315_02012 | gene | open | 585-1262 | nspV | ||
| 4034 | JRNU01000098.1 | GCA000759315_02013 | gene | open | 1249-2826 | |||
| 4035 | JRNU01000098.1 | GCA000759315_02014 | gene | open | 2842-4281 | |||
| 4036 | JRNU01000098.1 | GCA000759315_02015 | gene | open | 4440-5672 | irrE | ||
| 4037 | JRNU01000098.1 | GCA000759315_02016 | gene | open | 6347-6799 | |||
| 4038 | JRNU01000099.1 | GCA000759315_02017 | CDS | open | 1767-2147 | _na 126_aa | Helix-turn-helix domain-containing protein | |
| 4039 | JRNU01000099.1 | GCA000759315_02018 | CDS | open | 2147-2470 | _na 107_aa | HTH cro/C1-type domain-containing protein | |
| 4040 | JRNU01000099.1 | GCA000759315_02017 | gene | open | 1767-2147 | |||
| 4041 | JRNU01000099.1 | GCA000759315_02018 | gene | open | 2147-2470 | |||
| 4042 | JRNU01000101.1 | GCA000759315_02019 | CDS | open | 310-774 | _na 154_aa | DUF1896 domain-containing protein | |
| 4043 | JRNU01000101.1 | GCA000759315_02020 | CDS | open | 915-1334 | _na 139_aa | AI-2E family transporter | |
| 4044 | JRNU01000101.1 | GCA000759315_02021 | CDS | open | 1516-1839 | _na 107_aa | Quaternary ammonium transporter | |
| 4045 | JRNU01000101.1 | GCA000759315_02019 | gene | open | 310-774 | |||
| 4046 | JRNU01000101.1 | GCA000759315_02020 | gene | open | 915-1334 | |||
| 4047 | JRNU01000101.1 | GCA000759315_02021 | gene | open | 1516-1839 | |||
| 4048 | JRNU01000102.1 | GCA000759315_02022 | CDS | open | 543-2207 | _na 554_aa | Alpha-amylase | |
| 4049 | JRNU01000102.1 | GCA000759315_02023 | CDS | open | 2358-3242 | _na 294_aa | fabD | ACP S-malonyltransferase |
| 4050 | JRNU01000102.1 | GCA000759315_02024 | CDS | open | 3450-4619 | _na 389_aa | Protein involved in initiation of plasmid replication | |
| 4051 | JRNU01000102.1 | GCA000759315_02025 | CDS | open | 4710-5381 | _na 223_aa | Pyridoxal phosphate homeostasis protein | |
| 4052 | JRNU01000102.1 | GCA000759315_02026 | CDS | open | 5416-5883 | _na 155_aa | Phage tail component protein | |
| 4053 | JRNU01000102.1 | GCA000759315_02022 | gene | open | 543-2207 | |||
| 4054 | JRNU01000102.1 | GCA000759315_02023 | gene | open | 2358-3242 | fabD | ||
| 4055 | JRNU01000102.1 | GCA000759315_02024 | gene | open | 3450-4619 | |||
| 4056 | JRNU01000102.1 | GCA000759315_02025 | gene | open | 4710-5381 | |||
| 4057 | JRNU01000102.1 | GCA000759315_02026 | gene | open | 5416-5883 | |||
| 4058 | JRNU01000103.1 | GCA000759315_02027 | CDS | open | 277-882 | _na 201_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 4059 | JRNU01000103.1 | GCA000759315_02028 | CDS | open | 875-1882 | _na 335_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 4060 | JRNU01000103.1 | GCA000759315_02029 | CDS | open | 1966-2985 | _na 339_aa | DNA methylase | |
| 4061 | JRNU01000103.1 | GCA000759315_02027 | gene | open | 277-882 | |||
| 4062 | JRNU01000103.1 | GCA000759315_02028 | gene | open | 875-1882 | |||
| 4063 | JRNU01000103.1 | GCA000759315_02029 | gene | open | 1966-2985 | |||
| 4064 | JRNU01000108.1 | GCA000759315_02030 | CDS | open | 494-829 | _na 111_aa | rodZ | XRE family transcriptional regulator |
| 4065 | JRNU01000108.1 | GCA000759315_02031 | CDS | open | 836-1216 | _na 126_aa | Helix-turn-helix domain-containing protein | |
| 4066 | JRNU01000108.1 | GCA000759315_02030 | gene | open | 494-829 | rodZ | ||
| 4067 | JRNU01000108.1 | GCA000759315_02031 | gene | open | 836-1216 | |||
| 4068 | JRNU01000109.1 | GCA000759315_02032 | CDS | open | 106-414 | _na 102_aa | Helix-turn-helix domain-containing protein | |
| 4069 | JRNU01000109.1 | GCA000759315_02033 | CDS | open | 638-1369 | _na 243_aa | Transcriptional regulator AbiEi antitoxin N-terminal domain-containing protein | |
| 4070 | JRNU01000109.1 | GCA000759315_02034 | CDS | open | 1362-2267 | _na 301_aa | Nucleotidyltransferase | |
| 4071 | JRNU01000109.1 | GCA000759315_02032 | gene | open | 106-414 | |||
| 4072 | JRNU01000109.1 | GCA000759315_02033 | gene | open | 638-1369 | |||
| 4073 | JRNU01000109.1 | GCA000759315_02034 | gene | open | 1362-2267 | |||
| 4074 | JRNU01000110.1 | GCA000759315_02035 | CDS | open | 41-352 | _na 103_aa | DUF4296 domain-containing protein | |
| 4075 | JRNU01000110.1 | GCA000759315_02036 | CDS | open | 362-1444 | _na 360_aa | Peptidase M12A domain-containing protein | |
| 4076 | JRNU01000110.1 | GCA000759315_02037 | CDS | open | 1896-3902 | _na 668_aa | virD4 | YWFCY domain-containing protein |
| 4077 | JRNU01000110.1 | GCA000759315_02038 | CDS | open | 3987-4424 | _na 145_aa | Relaxase/mobilization nuclease domain protein | |
| 4078 | JRNU01000110.1 | GCA000759315_02039 | CDS | open | 4570-5247 | _na 225_aa | Relaxase/mobilization nuclease domain protein | |
| 4079 | JRNU01000110.1 | GCA000759315_02035 | gene | open | 41-352 | |||
| 4080 | JRNU01000110.1 | GCA000759315_02036 | gene | open | 362-1444 | |||
| 4081 | JRNU01000110.1 | GCA000759315_02037 | gene | open | 1896-3902 | virD4 | ||
| 4082 | JRNU01000110.1 | GCA000759315_02038 | gene | open | 3987-4424 | |||
| 4083 | JRNU01000110.1 | GCA000759315_02039 | gene | open | 4570-5247 | |||
| 4084 | JRNU01000111.1 | GCA000759315_02040 | CDS | open | 146-1552 | _na 468_aa | ltrA | group II intron reverse transcriptase/maturase |
| 4085 | JRNU01000111.1 | GCA000759315_02040 | gene | open | 146-1552 | ltrA | ||
| 4086 | JRNU01000112.1 | GCA000759315_02041 | CDS | open | 374-838 | _na 154_aa | hypothetical protein | |
| 4087 | JRNU01000112.1 | GCA000759315_02042 | CDS | open | 949-3165 | _na 738_aa | Ig-like domain-containing protein | |
| 4088 | JRNU01000112.1 | GCA000759315_02041 | gene | open | 374-838 | |||
| 4089 | JRNU01000112.1 | GCA000759315_02042 | gene | open | 949-3165 | |||
| 4090 | JRNU01000113.1 | GCA000759315_02043 | CDS | open | 161-742 | _na 193_aa | traO | Conjugative transposon protein TraO |
| 4091 | JRNU01000113.1 | GCA000759315_02044 | CDS | open | 755-1240 | _na 161_aa | traQ | Conjugative transposon protein TraQ |
| 4092 | JRNU01000113.1 | GCA000759315_02045 | CDS | open | 1227-1544 | _na 105_aa | hypothetical protein | |
| 4093 | JRNU01000113.1 | GCA000759315_02046 | CDS | open | 1752-2354 | _na 200_aa | DJ-1/PfpI domain-containing protein | |
| 4094 | JRNU01000113.1 | GCA000759315_02047 | CDS | open | 2443-2904 | _na 153_aa | HU domain-containing protein | |
| 4095 | JRNU01000113.1 | GCA000759315_02048 | CDS | open | 3373-3822 | _na 149_aa | DUF4760 domain-containing protein | |
| 4096 | JRNU01000113.1 | GCA000759315_02049 | CDS | open | 3824-4555 | _na 243_aa | Peptidase C14 caspase domain-containing protein | |
| 4097 | JRNU01000113.1 | GCA000759315_02050 | CDS | open | 4623-4994 | _na 123_aa | PcfJ-like protein | |
| 4098 | JRNU01000113.1 | GCA000759315_02043 | gene | open | 161-742 | traO | ||
| 4099 | JRNU01000113.1 | GCA000759315_02044 | gene | open | 755-1240 | traQ | ||
| 4100 | JRNU01000113.1 | GCA000759315_02045 | gene | open | 1227-1544 | |||
| 4101 | JRNU01000113.1 | GCA000759315_02046 | gene | open | 1752-2354 | |||
| 4102 | JRNU01000113.1 | GCA000759315_02047 | gene | open | 2443-2904 | |||
| 4103 | JRNU01000113.1 | GCA000759315_02048 | gene | open | 3373-3822 | |||
| 4104 | JRNU01000113.1 | GCA000759315_02049 | gene | open | 3824-4555 | |||
| 4105 | JRNU01000113.1 | GCA000759315_02050 | gene | open | 4623-4994 | |||
| 4106 | JRNU01000114.1 | GCA000759315_02051 | CDS | open | 23-805 | _na 260_aa | traD | Conjugal transfer protein TraD |
| 4107 | JRNU01000114.1 | GCA000759315_02052 | CDS | open | 802-1332 | _na 176_aa | traC | Conjugative transposon protein TraC |
| 4108 | JRNU01000114.1 | GCA000759315_02053 | CDS | open | 1329-2126 | _na 265_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 4109 | JRNU01000114.1 | GCA000759315_02051 | gene | open | 23-805 | traD | ||
| 4110 | JRNU01000114.1 | GCA000759315_02052 | gene | open | 802-1332 | traC | ||
| 4111 | JRNU01000114.1 | GCA000759315_02053 | gene | open | 1329-2126 | |||
| 4112 | JRNU01000115.1 | GCA000759315_02054 | CDS | open | 338-1618 | _na 426_aa | Relaxase/mobilization nuclease domain protein | |
| 4113 | JRNU01000115.1 | GCA000759315_02054 | gene | open | 338-1618 | |||
| 4114 | JRNU01000116.1 | GCA000759315_02055 | CDS | open | 86-1360 | _na 424_aa | PcfJ-like protein | |
| 4115 | JRNU01000116.1 | GCA000759315_02056 | CDS | open | 1388-1642 | _na 84_aa | hypothetical protein | |
| 4116 | JRNU01000116.1 | GCA000759315_02057 | CDS | open | 1578-1988 | _na 136_aa | hypothetical protein | |
| 4117 | JRNU01000116.1 | GCA000759315_02058 | CDS | open | 2000-2899 | _na 299_aa | abiH | Bacteriophage abortive infection AbiH |
| 4118 | JRNU01000116.1 | GCA000759315_02059 | CDS | open | 3021-3527 | _na 168_aa | rrrD | Lysozyme |
| 4119 | JRNU01000116.1 | GCA000759315_02060 | CDS | open | 3514-3966 | _na 150_aa | traQ | Conjugative transposon protein TraQ |
| 4120 | JRNU01000116.1 | GCA000759315_02061 | CDS | open | 4012-4593 | _na 193_aa | traO | Conjugal transfer protein TraO |
| 4121 | JRNU01000116.1 | GCA000759315_02055 | gene | open | 86-1360 | |||
| 4122 | JRNU01000116.1 | GCA000759315_02056 | gene | open | 1388-1642 | |||
| 4123 | JRNU01000116.1 | GCA000759315_02057 | gene | open | 1578-1988 | |||
| 4124 | JRNU01000116.1 | GCA000759315_02058 | gene | open | 2000-2899 | abiH | ||
| 4125 | JRNU01000116.1 | GCA000759315_02059 | gene | open | 3021-3527 | rrrD | ||
| 4126 | JRNU01000116.1 | GCA000759315_02060 | gene | open | 3514-3966 | traQ | ||
| 4127 | JRNU01000116.1 | GCA000759315_02061 | gene | open | 4012-4593 | traO | ||
| 4128 | JRNU01000117.1 | GCA000759315_02062 | CDS | open | 787-2481 | _na 564_aa | Sigma-70 region 2 | |
| 4129 | JRNU01000117.1 | GCA000759315_02063 | CDS | open | 2501-3022 | _na 173_aa | Lipoprotein | |
| 4130 | JRNU01000117.1 | GCA000759315_02064 | CDS | open | 3131-3991 | _na 286_aa | Methyltransferase domain protein | |
| 4131 | JRNU01000117.1 | GCA000759315_02065 | CDS | open | 4081-4227 | _na 48_aa | Toxin-antitoxin system%2C toxin component domain protein | |
| 4132 | JRNU01000117.1 | GCA000759315_02062 | gene | open | 787-2481 | |||
| 4133 | JRNU01000117.1 | GCA000759315_02063 | gene | open | 2501-3022 | |||
| 4134 | JRNU01000117.1 | GCA000759315_02064 | gene | open | 3131-3991 | |||
| 4135 | JRNU01000117.1 | GCA000759315_02065 | gene | open | 4081-4227 | |||
| 4136 | JRNU01000118.1 | GCA000759315_02066 | CDS | open | 172-270 | _na 32_aa | hypothetical protein | |
| 4137 | JRNU01000118.1 | GCA000759315_02067 | CDS | open | 557-1648 | _na 363_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 4138 | JRNU01000118.1 | GCA000759315_02068 | CDS | open | 1670-3919 | _na 749_aa | Peptidase%2C U32 family | |
| 4139 | JRNU01000118.1 | GCA000759315_02069 | CDS | open | 3916-4311 | _na 131_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 4140 | JRNU01000118.1 | GCA000759315_02066 | gene | open | 172-270 | |||
| 4141 | JRNU01000118.1 | GCA000759315_02067 | gene | open | 557-1648 | |||
| 4142 | JRNU01000118.1 | GCA000759315_02068 | gene | open | 1670-3919 | |||
| 4143 | JRNU01000118.1 | GCA000759315_02069 | gene | open | 3916-4311 | |||
| 4144 | JRNU01000119.1 | GCA000759315_02070 | CDS | open | 66-1775 | _na 569_aa | Glycosyl hydrolase-like 10 domain-containing protein | |
| 4145 | JRNU01000119.1 | GCA000759315_02071 | CDS | open | 1967-2464 | _na 165_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4146 | JRNU01000119.1 | GCA000759315_02072 | CDS | open | 2482-3090 | _na 202_aa | recR | recombination mediator RecR |
| 4147 | JRNU01000119.1 | GCA000759315_02073 | CDS | open | 3102-3554 | _na 150_aa | DUF2975 domain-containing protein | |
| 4148 | JRNU01000119.1 | GCA000759315_02074 | CDS | open | 3571-4110 | _na 179_aa | Acetyltransferase%2C GNAT family | |
| 4149 | JRNU01000119.1 | GCA000759315_02070 | gene | open | 66-1775 | |||
| 4150 | JRNU01000119.1 | GCA000759315_02071 | gene | open | 1967-2464 | |||
| 4151 | JRNU01000119.1 | GCA000759315_02072 | gene | open | 2482-3090 | recR | ||
| 4152 | JRNU01000119.1 | GCA000759315_02073 | gene | open | 3102-3554 | |||
| 4153 | JRNU01000119.1 | GCA000759315_02074 | gene | open | 3571-4110 | |||
| 4154 | JRNU01000120.1 | GCA000759315_02075 | CDS | open | 5-430 | _na 141_aa | copG | Ribbon-helix-helix protein%2C CopG family |
| 4155 | JRNU01000120.1 | GCA000759315_02076 | CDS | open | 789-1247 | _na 152_aa | DUF3408 domain-containing protein | |
| 4156 | JRNU01000120.1 | GCA000759315_02077 | CDS | open | 1252-1821 | _na 189_aa | Toprim domain-containing protein | |
| 4157 | JRNU01000120.1 | GCA000759315_02078 | CDS | open | 1923-2267 | _na 114_aa | hypothetical protein | |
| 4158 | JRNU01000120.1 | GCA000759315_02079 | CDS | open | 2503-3306 | _na 267_aa | Virulence-associated protein E-like domain-containing protein | |
| 4159 | JRNU01000120.1 | GCA000759315_02075 | gene | open | 5-430 | copG | ||
| 4160 | JRNU01000120.1 | GCA000759315_02076 | gene | open | 789-1247 | |||
| 4161 | JRNU01000120.1 | GCA000759315_02077 | gene | open | 1252-1821 | |||
| 4162 | JRNU01000120.1 | GCA000759315_02078 | gene | open | 1923-2267 | |||
| 4163 | JRNU01000120.1 | GCA000759315_02079 | gene | open | 2503-3306 | |||
| 4164 | JRNU01000122.1 | GCA000759315_02080 | CDS | open | 22-474 | _na 150_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 4165 | JRNU01000122.1 | GCA000759315_02081 | CDS | open | 479-2053 | _na 524_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 4166 | JRNU01000122.1 | GCA000759315_02080 | gene | open | 22-474 | |||
| 4167 | JRNU01000122.1 | GCA000759315_02081 | gene | open | 479-2053 | |||
| 4168 | JRNU01000123.1 | GCA000759315_02082 | CDS | open | 127-1524 | _na 465_aa | IS5 family transposase | |
| 4169 | JRNU01000123.1 | GCA000759315_02082 | gene | open | 127-1524 | |||
| 4170 | JRNU01000124.1 | GCA000759315_02083 | CDS | open | 117-1244 | _na 375_aa | hypothetical protein | |
| 4171 | JRNU01000124.1 | GCA000759315_02083 | gene | open | 117-1244 | |||
| 4172 | JRNU01000125.1 | GCA000759315_02084 | CDS | open | 92-871 | _na 259_aa | IS1380 family transposase | |
| 4173 | JRNU01000125.1 | GCA000759315_02085 | CDS | open | 1183-1482 | _na 99_aa | Response regulator transcription factor | |
| 4174 | JRNU01000125.1 | GCA000759315_02084 | gene | open | 92-871 | |||
| 4175 | JRNU01000125.1 | GCA000759315_02085 | gene | open | 1183-1482 | |||
| 4176 | JRNU01000126.1 | GCA000759315_02086 | CDS | open | 1602-2669 | _na 355_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 4177 | JRNU01000126.1 | GCA000759315_02087 | CDS | open | 2666-3376 | _na 236_aa | AbiEi antitoxin C-terminal domain-containing protein | |
| 4178 | JRNU01000126.1 | GCA000759315_02086 | gene | open | 1602-2669 | |||
| 4179 | JRNU01000126.1 | GCA000759315_02087 | gene | open | 2666-3376 | |||
| 4180 | JRNU01000127.1 | GCA000759315_02088 | CDS | open | 247-873 | _na 208_aa | PPM-type phosphatase domain-containing protein | |
| 4181 | JRNU01000127.1 | GCA000759315_02089 | CDS | open | 870-1709 | _na 279_aa | Nucleotidyltransferase | |
| 4182 | JRNU01000127.1 | GCA000759315_02090 | CDS | open | 1687-2691 | _na 334_aa | HTH marR-type domain-containing protein | |
| 4183 | JRNU01000127.1 | GCA000759315_02088 | gene | open | 247-873 | |||
| 4184 | JRNU01000127.1 | GCA000759315_02089 | gene | open | 870-1709 | |||
| 4185 | JRNU01000127.1 | GCA000759315_02090 | gene | open | 1687-2691 | |||
| 4186 | JRNU01000129.1 | GCA000759315_02091 | CDS | open | 592-2793 | _na 733_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 4187 | JRNU01000129.1 | GCA000759315_02092 | CDS | open | 2857-3045 | _na 62_aa | hypothetical protein | |
| 4188 | JRNU01000129.1 | GCA000759315_02091 | gene | open | 592-2793 | |||
| 4189 | JRNU01000129.1 | GCA000759315_02092 | gene | open | 2857-3045 | |||
| 4190 | JRNU01000130.1 | GCA000759315_02093 | CDS | open | 151-1773 | _na 540_aa | pckA | phosphoenolpyruvate carboxykinase (ATP) |
| 4191 | JRNU01000130.1 | GCA000759315_02094 | CDS | open | 2056-2715 | _na 219_aa | upp | uracil phosphoribosyltransferase |
| 4192 | JRNU01000130.1 | GCA000759315_02093 | gene | open | 151-1773 | pckA | ||
| 4193 | JRNU01000130.1 | GCA000759315_02094 | gene | open | 2056-2715 | upp | ||
| 4194 | JRNU01000131.1 | GCA000759315_02095 | CDS | open | 137-2473 | _na 778_aa | TonB-dependent receptor | |
| 4195 | JRNU01000131.1 | GCA000759315_02096 | CDS | open | 2622-2843 | _na 73_aa | hypothetical protein | |
| 4196 | JRNU01000131.1 | GCA000759315_02095 | gene | open | 137-2473 | |||
| 4197 | JRNU01000131.1 | GCA000759315_02096 | gene | open | 2622-2843 | |||
| 4198 | JRNU01000133.1 | GCA000759315_02097 | CDS | open | 198-596 | _na 132_aa | Helix-turn-helix domain-containing protein | |
| 4199 | JRNU01000133.1 | GCA000759315_02098 | CDS | open | 648-1064 | _na 138_aa | Lipoprotein | |
| 4200 | JRNU01000133.1 | GCA000759315_02097 | gene | open | 198-596 | |||
| 4201 | JRNU01000133.1 | GCA000759315_02098 | gene | open | 648-1064 | |||
| 4202 | JRNU01000134.1 | GCA000759315_02099 | CDS | open | 463-1164 | _na 233_aa | carboxypeptidase-like regulatory domain-containing protein | |
| 4203 | JRNU01000134.1 | GCA000759315_02099 | gene | open | 463-1164 | |||
| 4204 | JRNU01000135.1 | GCA000759315_02100 | CDS | open | 716-1255 | _na 179_aa | Lipoprotein | |
| 4205 | JRNU01000135.1 | GCA000759315_02100 | gene | open | 716-1255 | |||
| 4206 | JRNU01000136.1 | GCA000759315_02101 | CDS | open | 497-961 | _na 154_aa | hypothetical protein | |
| 4207 | JRNU01000136.1 | GCA000759315_02101 | gene | open | 497-961 | |||
| 4208 | JRNU01000137.1 | GCA000759315_02102 | CDS | open | 209-379 | _na 56_aa | hypothetical protein | |
| 4209 | JRNU01000137.1 | GCA000759315_02102 | gene | open | 209-379 | |||
| 4210 | JRNU01000138.1 | GCA000759315_02103 | CDS | open | 166-465 | _na 99_aa | traG | TraG P-loop domain-containing protein |
| 4211 | JRNU01000138.1 | GCA000759315_02103 | gene | open | 166-465 | traG | ||
| 4212 | JRNU01000139.1 | GCA000759315_02104 | CDS | open | 469-768 | _na 99_aa | hypothetical protein | |
| 4213 | JRNU01000139.1 | GCA000759315_02104 | gene | open | 469-768 | |||
| 4214 | JRNU01000140.1 | GCA000759315_02105 | CDS | open | 248-559 | _na 103_aa | traI | Conjugal transfer protein TraI |
| 4215 | JRNU01000140.1 | GCA000759315_02105 | gene | open | 248-559 | traI | ||
| 4216 | JRNU01000141.1 | GCA000759315_02106 | CDS | open | 167-553 | _na 128_aa | hypothetical protein | |
| 4217 | JRNU01000141.1 | GCA000759315_02106 | gene | open | 167-553 | |||
| 4218 | JRNU01000142.1 | GCA000759315_02107 | CDS | open | 55-681 | _na 208_aa | DNA topoisomerase type IA central domain-containing protein | |
| 4219 | JRNU01000142.1 | GCA000759315_02107 | gene | open | 55-681 | |||
| 4220 | JRNU01000143.1 | GCA000759315_02108 | CDS | open | 22-1098 | _na 358_aa | S8 family serine peptidase | |
| 4221 | JRNU01000143.1 | GCA000759315_02109 | CDS | open | 1142-2173 | _na 343_aa | S8 family serine peptidase | |
| 4222 | JRNU01000143.1 | GCA000759315_02108 | gene | open | 22-1098 | |||
| 4223 | JRNU01000143.1 | GCA000759315_02109 | gene | open | 1142-2173 | |||
| 4224 | JRNU01000144.1 | GCA000759315_02110 | CDS | open | 1414-2019 | _na 201_aa | DUF3945 domain-containing protein | |
| 4225 | JRNU01000144.1 | GCA000759315_02110 | gene | open | 1414-2019 | |||
| 4226 | JRNU01000145.1 | GCA000759315_02111 | CDS | open | 166-2046 | _na 626_aa | IS1634 family transposase | |
| 4227 | JRNU01000145.1 | GCA000759315_02111 | gene | open | 166-2046 | |||
| 4228 | JRNU01000146.1 | GCA000759315_02112 | CDS | open | 417-1220 | _na 267_aa | Virulence-associated protein E-like domain-containing protein | |
| 4229 | JRNU01000146.1 | GCA000759315_02112 | gene | open | 417-1220 | |||
| 4230 | JRNU01000147.1 | GCA000759315_02113 | CDS | open | 26-532 | _na 168_aa | hypothetical protein | |
| 4231 | JRNU01000147.1 | GCA000759315_02113 | gene | open | 26-532 | |||
| 4232 | JRNU01000148.1 | GCA000759315_02114 | CDS | open | 467-1420 | _na 317_aa | abiF | Abi-like protein |
| 4233 | JRNU01000148.1 | GCA000759315_02114 | gene | open | 467-1420 | abiF | ||
| 4234 | JRNU01000149.1 | GCA000759315_02115 | CDS | open | 24-758 | _na 244_aa | ISL3 family transposase | |
| 4235 | JRNU01000149.1 | GCA000759315_02115 | gene | open | 24-758 | |||
| 4236 | JRNU01000150.1 | GCA000759315_02116 | CDS | open | 35-904 | _na 289_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 4237 | JRNU01000150.1 | GCA000759315_02117 | CDS | open | 1020-1364 | _na 114_aa | Transposase | |
| 4238 | JRNU01000150.1 | GCA000759315_02116 | gene | open | 35-904 | |||
| 4239 | JRNU01000150.1 | GCA000759315_02117 | gene | open | 1020-1364 | |||
| 4240 | JRNU01000152.1 | GCA000759315_02118 | CDS | open | 14-373 | _na 119_aa | Spi family protease inhibitor | |
| 4241 | JRNU01000152.1 | GCA000759315_02119 | CDS | open | 345-812 | _na 155_aa | hypothetical protein | |
| 4242 | JRNU01000152.1 | GCA000759315_02120 | CDS | open | 823-1236 | _na 137_aa | Lipoprotein | |
| 4243 | JRNU01000152.1 | GCA000759315_02118 | gene | open | 14-373 | |||
| 4244 | JRNU01000152.1 | GCA000759315_02119 | gene | open | 345-812 | |||
| 4245 | JRNU01000152.1 | GCA000759315_02120 | gene | open | 823-1236 | |||
| 4246 | JRNU01000153.1 | GCA000759315_02121 | CDS | open | 300-1331 | _na 343_aa | traM | conjugative transposon protein TraM |
| 4247 | JRNU01000153.1 | GCA000759315_02121 | gene | open | 300-1331 | traM | ||
| 4248 | JRNU01000158.1 | GCA000759315_02122 | CDS | open | 42-455 | _na 137_aa | response regulator transcription factor | |
| 4249 | JRNU01000158.1 | GCA000759315_02122 | gene | open | 42-455 | |||
| 4250 | JRNU01000159.1 | GCA000759315_02123 | CDS | open | 72-1094 | _na 340_aa | tnp | IS5 family transposase |
| 4251 | JRNU01000159.1 | GCA000759315_02123 | gene | open | 72-1094 | tnp | ||
| 4252 | JRNU01000160.1 | GCA000759315_02124 | CDS | open | 139-1002 | _na 287_aa | Peptidase M16 C-terminal domain-containing protein | |
| 4253 | JRNU01000160.1 | GCA000759315_02124 | gene | open | 139-1002 | |||
| 4254 | JRNU01000163.1 | GCA000759315_02125 | CDS | open | 128-361 | _na 77_aa | DUF2188 domain-containing protein | |
| 4255 | JRNU01000163.1 | GCA000759315_02125 | gene | open | 128-361 | |||
| 4256 | JRNU01000167.1 | GCA000759315_02126 | CDS | open | 29-133 | _na 34_aa | hypothetical protein | |
| 4257 | JRNU01000167.1 | GCA000759315_02127 | CDS | open | 146-595 | _na 149_aa | hypothetical protein | |
| 4258 | JRNU01000167.1 | GCA000759315_02126 | gene | open | 29-133 | |||
| 4259 | JRNU01000167.1 | GCA000759315_02127 | gene | open | 146-595 | |||
| 4260 | JRNU01000168.1 | repeat_region | open | 95-686 | CRISPR array with 8 repeats of length 47%2C consensus sequence GTTGTGATTTGCTTAAAATTTCTTACCTTTGTAGGTGTATAAACAAC and spacer length 29 | |||
| 4261 | JRNU01000176.1 | GCA000759315_02128 | CDS | open | 19-309 | _na 96_aa | Helix-turn-helix domain-containing protein | |
| 4262 | JRNU01000176.1 | GCA000759315_02128 | gene | open | 19-309 | |||
| 4263 | JRNU01000179.1 | GCA000759315_02129 | CDS | open | 23-352 | _na 109_aa | Transcriptional accessory protein | |
| 4264 | JRNU01000179.1 | GCA000759315_02129 | gene | open | 23-352 |

