HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bifidobacterium subtile (GCA_000771185.1)

Select a Genome:
BAKTA Annotations for GCA_000771185.1
Genome Selected: Bifidobacterium subtile
ContigsBases CDSrRNA tmRNAtRNA
75 2761997 2239 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4601 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4601 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JDTX01000006.1 GCA000771185_02229 CDS open 78672-79313 _na     213_aa yckA1 Amino acid ABC transporter permease YckA1
2002 JDTX01000006.1 GCA000771185_02230 CDS open 79863-80966 _na     367_aa Glycerol dehydrogenase
2003 JDTX01000006.1 GCA000771185_02231 CDS open 81058-81942 _na     294_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2004 JDTX01000006.1 GCA000771185_02232 CDS open 82045-82779 _na     244_aa Peptide ABC transporter ATP-binding protein
2005 JDTX01000006.1 GCA000771185_02233 CDS open 82776-83429 _na     217_aa Polar amino acid ABC transporter inner membrane subunit
2006 JDTX01000006.1 GCA000771185_02234 CDS open 83487-83798 _na     103_aa transporter substrate-binding domain-containing protein
2007 JDTX01000006.1 GCA000771185_02165 gene open 272-997
2008 JDTX01000006.1 GCA000771185_02166 gene open 1474-1602
2009 JDTX01000006.1 GCA000771185_02167 gene open 2094-2816
2010 JDTX01000006.1 GCA000771185_02168 gene open 2942-4219
2011 JDTX01000006.1 GCA000771185_02169 gene open 4734-6098
2012 JDTX01000006.1 GCA000771185_02170 gene open 6235-6678
2013 JDTX01000006.1 GCA000771185_02171 gene open 6734-8425
2014 JDTX01000006.1 GCA000771185_02172 gene open 8431-9588
2015 JDTX01000006.1 GCA000771185_02173 gene open 9625-10032
2016 JDTX01000006.1 GCA000771185_02174 gene open 10029-11501
2017 JDTX01000006.1 GCA000771185_02175 gene open 11545-11745
2018 JDTX01000006.1 GCA000771185_02176 gene open 11742-12158
2019 JDTX01000006.1 GCA000771185_02177 gene open 12196-13368
2020 JDTX01000006.1 GCA000771185_02178 gene open 13368-14180
2021 JDTX01000006.1 GCA000771185_02179 gene open 14610-16157 zwf
2022 JDTX01000006.1 GCA000771185_02180 gene open 16154-17089 opcA
2023 JDTX01000006.1 GCA000771185_02181 gene open 17655-18470
2024 JDTX01000006.1 GCA000771185_02182 gene open 18683-19924
2025 JDTX01000006.1 GCA000771185_02183 gene open 20722-22005
2026 JDTX01000006.1 GCA000771185_02184 gene open 22073-23026 lysR
2027 JDTX01000006.1 GCA000771185_02185 gene open 23181-24506
2028 JDTX01000006.1 GCA000771185_02186 gene open 24657-25187 cysE
2029 JDTX01000006.1 GCA000771185_02187 gene open 25489-26940 gndA
2030 JDTX01000006.1 GCA000771185_02188 gene open 27146-30715
2031 JDTX01000006.1 GCA000771185_02189 gene open 31497-32186 tetR
2032 JDTX01000006.1 GCA000771185_02190 gene open 32721-32975 nrdH
2033 JDTX01000006.1 GCA000771185_02191 gene open 32972-33472 nrdI
2034 JDTX01000006.1 GCA000771185_02192 gene open 33795-35987 nrdE
2035 JDTX01000006.1 GCA000771185_02193 gene open 36200-37243 nrdF
2036 JDTX01000006.1 GCA000771185_02194 gene open 37524-37775
2037 JDTX01000006.1 GCA000771185_02195 gene open 37940-38476
2038 JDTX01000006.1 GCA000771185_02196 gene open 38677-39573
2039 JDTX01000006.1 GCA000771185_02197 gene open 39747-40163
2040 JDTX01000006.1 GCA000771185_02198 gene open 40367-40804 marR
2041 JDTX01000006.1 GCA000771185_02199 gene open 40794-40952
2042 JDTX01000006.1 GCA000771185_02200 gene open 41471-42409
2043 JDTX01000006.1 GCA000771185_02201 gene open 42480-43373
2044 JDTX01000006.1 GCA000771185_02202 gene open 43374-43937
2045 JDTX01000006.1 GCA000771185_02203 gene open 44764-45528
2046 JDTX01000006.1 GCA000771185_02204 gene open 45674-45970
2047 JDTX01000006.1 GCA000771185_02205 gene open 46117-46686
2048 JDTX01000006.1 GCA000771185_02206 gene open 46807-47190
2049 JDTX01000006.1 GCA000771185_02207 gene open 47203-47751
2050 JDTX01000006.1 GCA000771185_02208 gene open 47806-48417 tetR
2051 JDTX01000006.1 GCA000771185_02209 gene open 48758-50029
2052 JDTX01000006.1 GCA000771185_02210 gene open 50068-51126
2053 JDTX01000006.1 GCA000771185_02211 gene open 51388-52413
2054 JDTX01000006.1 GCA000771185_02212 gene open 52565-56716 actP
2055 JDTX01000006.1 GCA000771185_02213 gene open 57545-60712
2056 JDTX01000006.1 GCA000771185_02214 gene open 60709-63066
2057 JDTX01000006.1 GCA000771185_02215 gene open 63118-64032 tetR
2058 JDTX01000006.1 GCA000771185_02216 gene open 64329-65102
2059 JDTX01000006.1 GCA000771185_02217 gene open 65523-68012 hypD
2060 JDTX01000006.1 GCA000771185_02218 gene open 68158-69327
2061 JDTX01000006.1 GCA000771185_02219 gene open 69463-70041
2062 JDTX01000006.1 GCA000771185_02220 gene open 70374-71102 prdB
2063 JDTX01000006.1 GCA000771185_02221 gene open 71219-71407
2064 JDTX01000006.1 GCA000771185_02222 gene open 71486-73312 prdA
2065 JDTX01000006.1 GCA000771185_02223 gene open 73446-74741
2066 JDTX01000006.1 GCA000771185_02224 gene open 74932-75327
2067 JDTX01000006.1 GCA000771185_02225 gene open 75434-75802
2068 JDTX01000006.1 GCA000771185_02226 gene open 76056-76826
2069 JDTX01000006.1 GCA000771185_02227 gene open 76937-77800
2070 JDTX01000006.1 GCA000771185_02228 gene open 78013-78672 yckA2
2071 JDTX01000006.1 GCA000771185_02229 gene open 78672-79313 yckA1
2072 JDTX01000006.1 GCA000771185_02230 gene open 79863-80966
2073 JDTX01000006.1 GCA000771185_02231 gene open 81058-81942 dapA
2074 JDTX01000006.1 GCA000771185_02232 gene open 82045-82779
2075 JDTX01000006.1 GCA000771185_02233 gene open 82776-83429
2076 JDTX01000006.1 GCA000771185_02234 gene open 83487-83798
2077 JDTX01000007.1 GCA000771185_02237 CDS open 476-1702 _na     408_aa Acetylornithine aminotransferase apoenzyme
2078 JDTX01000007.1 GCA000771185_02238 CDS open 2276-3292 _na     338_aa 2-dehydropantoate 2-reductase
2079 JDTX01000007.1 GCA000771185_02239 CDS open 3375-3938 _na     187_aa Putative lipo protein
2080 JDTX01000007.1 GCA000771185_02240 CDS open 4433-4714 _na     93_aa hypothetical protein
2081 JDTX01000007.1 GCA000771185_02241 CDS open 4734-5339 _na     201_aa ABC transporter ATP-binding protein
2082 JDTX01000007.1 GCA000771185_02242 CDS open 5336-5479 _na     47_aa hypothetical protein
2083 JDTX01000007.1 GCA000771185_02243 CDS open 5637-5972 _na     111_aa Amino acid ABC transporter substrate-binding protein
2084 JDTX01000007.1 GCA000771185_02244 CDS open 6096-7703 _na     535_aa Iron permease
2085 JDTX01000007.1 GCA000771185_02245 CDS open 8533-9348 _na     271_aa Putative 2-hydroxyhepta-2%2C 4-diene-1%2C 7-dioateisomerase
2086 JDTX01000007.1 GCA000771185_02246 CDS open 9979-10920 _na     313_aa Pyridoxal phosphate homeostasis protein
2087 JDTX01000007.1 GCA000771185_02247 CDS open 11336-11638 _na     100_aa acylphosphatase
2088 JDTX01000007.1 GCA000771185_02248 CDS open 12586-13896 _na     436_aa Glutamyl-Q tRNA(Asp) synthetase
2089 JDTX01000007.1 GCA000771185_02250 CDS open 15233-15721 _na     162_aa hypothetical protein
2090 JDTX01000007.1 GCA000771185_02251 CDS open 15718-15978 _na     86_aa hypothetical protein
2091 JDTX01000007.1 GCA000771185_02252 CDS open 15978-16157 _na     59_aa hypothetical protein
2092 JDTX01000007.1 GCA000771185_02253 CDS open 16151-16372 _na     73_aa hypothetical protein
2093 JDTX01000007.1 GCA000771185_02254 CDS open 16369-16560 _na     63_aa hypothetical protein
2094 JDTX01000007.1 GCA000771185_02237 gene open 476-1702
2095 JDTX01000007.1 GCA000771185_02238 gene open 2276-3292
2096 JDTX01000007.1 GCA000771185_02239 gene open 3375-3938
2097 JDTX01000007.1 GCA000771185_02240 gene open 4433-4714
2098 JDTX01000007.1 GCA000771185_02241 gene open 4734-5339
2099 JDTX01000007.1 GCA000771185_02242 gene open 5336-5479
2100 JDTX01000007.1 GCA000771185_02243 gene open 5637-5972
2101 JDTX01000007.1 GCA000771185_02244 gene open 6096-7703
2102 JDTX01000007.1 GCA000771185_02245 gene open 8533-9348
2103 JDTX01000007.1 GCA000771185_02246 gene open 9979-10920
2104 JDTX01000007.1 GCA000771185_02247 gene open 11336-11638
2105 JDTX01000007.1 GCA000771185_02248 gene open 12586-13896
2106 JDTX01000007.1 GCA000771185_02250 gene open 15233-15721
2107 JDTX01000007.1 GCA000771185_02251 gene open 15718-15978
2108 JDTX01000007.1 GCA000771185_02252 gene open 15978-16157
2109 JDTX01000007.1 GCA000771185_02253 gene open 16151-16372
2110 JDTX01000007.1 GCA000771185_02254 gene open 16369-16560
2111 JDTX01000007.1 GCA000771185_02249 gene open 14365-14438 trnK
2112 JDTX01000007.1 GCA000771185_02249 tRNA open 14365-14438 trnK tRNA-Lys(ctt)
2113 JDTX01000008.1 GCA000771185_02255 CDS open 37-723 _na     228_aa hypothetical protein
2114 JDTX01000008.1 GCA000771185_02256 CDS open 702-1391 _na     229_aa Rloe protein
2115 JDTX01000008.1 GCA000771185_02257 CDS open 1445-2707 _na     420_aa Helix-turn-helix domain-containing protein
2116 JDTX01000008.1 GCA000771185_02258 CDS open 2704-3171 _na     155_aa whiB WhiB family transcriptional regulator
2117 JDTX01000008.1 GCA000771185_02255 gene open 37-723
2118 JDTX01000008.1 GCA000771185_02256 gene open 702-1391
2119 JDTX01000008.1 GCA000771185_02257 gene open 1445-2707
2120 JDTX01000008.1 GCA000771185_02258 gene open 2704-3171 whiB
2121 JDTX01000009.1 GCA000771185_02259 CDS open 188-1081 _na     297_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2122 JDTX01000009.1 GCA000771185_02260 CDS open 1264-2979 _na     571_aa hypothetical protein
2123 JDTX01000009.1 GCA000771185_02261 CDS open 3056-3430 _na     124_aa HNH endonuclease family protein
2124 JDTX01000009.1 GCA000771185_02262 CDS open 3437-3799 _na     120_aa GmrSD restriction endonucleases C-terminal domain-containing protein
2125 JDTX01000009.1 GCA000771185_02263 CDS open 4871-5290 _na     139_aa hypothetical protein
2126 JDTX01000009.1 GCA000771185_02264 CDS open 5794-6897 _na     367_aa irrE IrrE N-terminal-like domain-containing protein
2127 JDTX01000009.1 GCA000771185_02265 CDS open 6894-7400 _na     168_aa DUF4411 domain-containing protein
2128 JDTX01000009.1 GCA000771185_02266 CDS open 7867-9057 _na     396_aa Helix-turn-helix domain-containing protein
2129 JDTX01000009.1 GCA000771185_02267 CDS open 9092-9862 _na     256_aa hypothetical protein
2130 JDTX01000009.1 GCA000771185_02268 CDS open 10778-12004 _na     408_aa ATPase
2131 JDTX01000009.1 GCA000771185_02269 CDS open 12736-13149 _na     137_aa hypothetical protein
2132 JDTX01000009.1 GCA000771185_02270 CDS open 13517-14380 _na     287_aa RelA/SpoT domain-containing protein
2133 JDTX01000009.1 GCA000771185_02271 CDS open 14664-15104 _na     146_aa Antitoxin SocA-like Panacea domain-containing protein
2134 JDTX01000009.1 GCA000771185_02272 CDS open 15186-16538 _na     450_aa D-serine ammonia-lyase
2135 JDTX01000009.1 GCA000771185_02273 CDS open 17060-18469 _na     469_aa non-specific protein-tyrosine kinase
2136 JDTX01000009.1 GCA000771185_02274 CDS open 18681-20258 _na     525_aa Sugar-binding protein
2137 JDTX01000009.1 GCA000771185_02275 CDS open 20471-21742 _na     423_aa O-antigen ligase family protein
2138 JDTX01000009.1 GCA000771185_02276 CDS open 22358-22624 _na     88_aa hypothetical protein
2139 JDTX01000009.1 GCA000771185_02277 CDS open 22621-23796 _na     391_aa Serine--pyruvate transaminase
2140 JDTX01000009.1 GCA000771185_02278 CDS open 24597-25376 _na     259_aa Cobalt transport protein
2141 JDTX01000009.1 GCA000771185_02279 CDS open 25366-27690 _na     774_aa energy-coupling factor transporter ATPase
2142 JDTX01000009.1 GCA000771185_02280 CDS open 27815-28369 _na     184_aa ECF-type riboflavin transporter%2C S component
2143 JDTX01000009.1 GCA000771185_02281 CDS open 28999-29730 _na     243_aa Glycerol uptake facilitator protein
2144 JDTX01000009.1 GCA000771185_02282 CDS open 30140-31306 _na     388_aa AAA domain protein
2145 JDTX01000009.1 GCA000771185_02283 CDS open 31425-32129 _na     234_aa AB hydrolase-1 domain-containing protein
2146 JDTX01000009.1 GCA000771185_02284 CDS open 32517-33992 _na     491_aa atzF allophanate hydrolase
2147 JDTX01000009.1 GCA000771185_02285 CDS open 34024-34752 _na     242_aa gntR GntR family transcriptional regulator
2148 JDTX01000009.1 GCA000771185_02286 CDS open 34745-36286 _na     513_aa ABC transporter
2149 JDTX01000009.1 GCA000771185_02287 CDS open 36283-37335 _na     350_aa ABC transporter permease
2150 JDTX01000009.1 GCA000771185_02288 CDS open 37332-38231 _na     299_aa ABC transporter permease
2151 JDTX01000009.1 GCA000771185_02289 CDS open 38390-39415 _na     341_aa Basic membrane lipoprotein
2152 JDTX01000009.1 GCA000771185_02290 CDS open 39412-39993 _na     193_aa Cysteine hydrolase
2153 JDTX01000009.1 GCA000771185_02291 CDS open 40079-40759 _na     226_aa Nicotinamidase-like amidase protein
2154 JDTX01000009.1 GCA000771185_02292 CDS open 41471-42076 _na     201_aa nicotinamidase
2155 JDTX01000009.1 GCA000771185_02293 CDS open 42094-43122 _na     342_aa msrA Peptide methionine sulfoxide reductase MsrA
2156 JDTX01000009.1 GCA000771185_02294 CDS open 43319-43969 _na     216_aa Phospholipase/Carboxylesterase
2157 JDTX01000009.1 GCA000771185_02295 CDS open 44173-48759 _na     1528_aa Putative ATP-dependent helicase
2158 JDTX01000009.1 GCA000771185_02259 gene open 188-1081 rfbA
2159 JDTX01000009.1 GCA000771185_02260 gene open 1264-2979
2160 JDTX01000009.1 GCA000771185_02261 gene open 3056-3430
2161 JDTX01000009.1 GCA000771185_02262 gene open 3437-3799
2162 JDTX01000009.1 GCA000771185_02263 gene open 4871-5290
2163 JDTX01000009.1 GCA000771185_02264 gene open 5794-6897 irrE
2164 JDTX01000009.1 GCA000771185_02265 gene open 6894-7400
2165 JDTX01000009.1 GCA000771185_02266 gene open 7867-9057
2166 JDTX01000009.1 GCA000771185_02267 gene open 9092-9862
2167 JDTX01000009.1 GCA000771185_02268 gene open 10778-12004
2168 JDTX01000009.1 GCA000771185_02269 gene open 12736-13149
2169 JDTX01000009.1 GCA000771185_02270 gene open 13517-14380
2170 JDTX01000009.1 GCA000771185_02271 gene open 14664-15104
2171 JDTX01000009.1 GCA000771185_02272 gene open 15186-16538
2172 JDTX01000009.1 GCA000771185_02273 gene open 17060-18469
2173 JDTX01000009.1 GCA000771185_02274 gene open 18681-20258
2174 JDTX01000009.1 GCA000771185_02275 gene open 20471-21742
2175 JDTX01000009.1 GCA000771185_02276 gene open 22358-22624
2176 JDTX01000009.1 GCA000771185_02277 gene open 22621-23796
2177 JDTX01000009.1 GCA000771185_02278 gene open 24597-25376
2178 JDTX01000009.1 GCA000771185_02279 gene open 25366-27690
2179 JDTX01000009.1 GCA000771185_02280 gene open 27815-28369
2180 JDTX01000009.1 GCA000771185_02281 gene open 28999-29730
2181 JDTX01000009.1 GCA000771185_02282 gene open 30140-31306
2182 JDTX01000009.1 GCA000771185_02283 gene open 31425-32129
2183 JDTX01000009.1 GCA000771185_02284 gene open 32517-33992 atzF
2184 JDTX01000009.1 GCA000771185_02285 gene open 34024-34752 gntR
2185 JDTX01000009.1 GCA000771185_02286 gene open 34745-36286
2186 JDTX01000009.1 GCA000771185_02287 gene open 36283-37335
2187 JDTX01000009.1 GCA000771185_02288 gene open 37332-38231
2188 JDTX01000009.1 GCA000771185_02289 gene open 38390-39415
2189 JDTX01000009.1 GCA000771185_02290 gene open 39412-39993
2190 JDTX01000009.1 GCA000771185_02291 gene open 40079-40759
2191 JDTX01000009.1 GCA000771185_02292 gene open 41471-42076
2192 JDTX01000009.1 GCA000771185_02293 gene open 42094-43122 msrA
2193 JDTX01000009.1 GCA000771185_02294 gene open 43319-43969
2194 JDTX01000009.1 GCA000771185_02295 gene open 44173-48759
2195 JDTX01000010.1 regulatory_region open 15308-15353 L31-Actinobacteria ribosomal protein leader
2196 JDTX01000010.1 GCA000771185_00442 CDS open 186-1406 _na     406_aa Peptidase M20 domain-containing protein 2
2197 JDTX01000010.1 GCA000771185_00443 CDS open 1590-2726 _na     378_aa Membrane protein
2198 JDTX01000010.1 GCA000771185_00444 CDS open 2745-2939 _na     64_aa bioY Biotin transporter BioY
2199 JDTX01000010.1 GCA000771185_00445 CDS open 3111-4175 _na     354_aa asnC Putative AsnC family transcriptional regulator
2200 JDTX01000010.1 GCA000771185_00446 CDS open 4375-4977 _na     200_aa NAD(P)H oxidoreductase
2201 JDTX01000010.1 GCA000771185_00447 CDS open 5067-6323 _na     418_aa ATP-grasp domain-containing protein
2202 JDTX01000010.1 GCA000771185_00448 CDS open 6560-7105 _na     181_aa Putative NADPH-dependent FMN reductase
2203 JDTX01000010.1 GCA000771185_00449 CDS open 7462-8097 _na     211_aa YceJ-like MFS-type transporter
2204 JDTX01000010.1 GCA000771185_00450 CDS open 8120-8380 _na     86_aa Transcriptional regulator
2205 JDTX01000010.1 GCA000771185_00451 CDS open 8664-10097 _na     477_aa Major facilitator superfamily transporter
2206 JDTX01000010.1 GCA000771185_00452 CDS open 10499-11236 _na     245_aa NAD(P)H-dependent FMN reductase
2207 JDTX01000010.1 GCA000771185_00453 CDS open 11413-11844 _na     143_aa hypothetical protein
2208 JDTX01000010.1 GCA000771185_00454 CDS open 12233-13645 _na     470_aa Succinate-semialdehyde dehdyrogenase
2209 JDTX01000010.1 GCA000771185_00455 CDS open 14073-14759 _na     228_aa Hydroxymethylpyrimidine transport system permease protein
2210 JDTX01000010.1 GCA000771185_00457 CDS open 15377-15589 _na     70_aa rpmE 50S ribosomal protein L31
2211 JDTX01000010.1 GCA000771185_00458 CDS open 15759-16841 _na     360_aa prfA peptide chain release factor 1
2212 JDTX01000010.1 GCA000771185_00459 CDS open 16882-18111 _na     409_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2213 JDTX01000010.1 GCA000771185_00460 CDS open 18640-19299 _na     219_aa L-threonylcarbamoyladenylate synthase
2214 JDTX01000010.1 GCA000771185_00461 CDS open 19296-20660 _na     454_aa Undecaprenyl-phosphate alpha-N-acetylglucosaminyltransferase
2215 JDTX01000010.1 GCA000771185_00462 CDS open 20879-22408 _na     509_aa guaB IMP dehydrogenase
2216 JDTX01000010.1 GCA000771185_00463 CDS open 22705-23412 _na     235_aa orn oligoribonuclease
2217 JDTX01000010.1 GCA000771185_00464 CDS open 23593-24525 _na     310_aa Hydrolase
2218 JDTX01000010.1 GCA000771185_00465 CDS open 24569-25981 _na     470_aa Helicase
2219 JDTX01000010.1 GCA000771185_00466 CDS open 26377-27867 _na     496_aa Secreted polysaccharide deacetylase
2220 JDTX01000010.1 GCA000771185_00467 CDS open 28010-29824 _na     604_aa proline--tRNA ligase
2221 JDTX01000010.1 GCA000771185_00468 CDS open 30227-31075 _na     282_aa 3-hydroxyacyl-CoA dehydrogenase
2222 JDTX01000010.1 GCA000771185_00469 CDS open 31409-32215 _na     268_aa Single-stranded DNA-binding protein
2223 JDTX01000010.1 GCA000771185_00470 CDS open 32226-34292 _na     688_aa Neutral endopeptidase
2224 JDTX01000010.1 GCA000771185_00471 CDS open 34459-35100 _na     213_aa Membrane protein
2225 JDTX01000010.1 GCA000771185_00472 CDS open 35177-35953 _na     258_aa map type I methionyl aminopeptidase
2226 JDTX01000010.1 GCA000771185_00473 CDS open 36402-37694 _na     430_aa citrate synthase
2227 JDTX01000010.1 GCA000771185_00474 CDS open 38294-38629 _na     111_aa DUF3887 domain-containing protein
2228 JDTX01000010.1 GCA000771185_00475 CDS open 38767-39786 _na     339_aa Metal-dependent membrane protease
2229 JDTX01000010.1 GCA000771185_00476 CDS open 39809-40048 _na     79_aa hypothetical protein
2230 JDTX01000010.1 GCA000771185_00477 CDS open 40068-40319 _na     83_aa RelB/DinJ family addiction module antitoxin
2231 JDTX01000010.1 GCA000771185_00478 CDS open 40612-41118 _na     168_aa HXXEE domain-containing protein
2232 JDTX01000010.1 GCA000771185_00479 CDS open 41352-42341 _na     329_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2233 JDTX01000010.1 GCA000771185_00480 CDS open 43503-44636 _na     377_aa prfB peptide chain release factor 2
2234 JDTX01000010.1 GCA000771185_00481 CDS open 44676-46037 _na     453_aa ftsE cell division ATP-binding protein FtsE
2235 JDTX01000010.1 GCA000771185_00482 CDS open 46041-46964 _na     307_aa ftsX permease-like cell division protein FtsX
2236 JDTX01000010.1 GCA000771185_00483 CDS open 47218-48633 _na     471_aa Amidase
2237 JDTX01000010.1 GCA000771185_00484 CDS open 48849-49331 _na     160_aa smpB SsrA-binding protein SmpB
2238 JDTX01000010.1 GCA000771185_00485 CDS open 49643-50572 _na     309_aa ABC transporter substrate-binding protein
2239 JDTX01000010.1 GCA000771185_00486 CDS open 50744-51673 _na     309_aa Solute-binding protein of ABC transporter system
2240 JDTX01000010.1 GCA000771185_00487 CDS open 51806-52795 _na     329_aa Amino acid ABC transporter permease
2241 JDTX01000010.1 GCA000771185_00488 CDS open 52806-53669 _na     287_aa ABC transporter ATP-binding protein
2242 JDTX01000010.1 GCA000771185_00489 CDS open 53921-55813 _na     630_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2243 JDTX01000010.1 GCA000771185_00490 CDS open 56129-57073 _na     314_aa 23S RNA-specific pseudouridylate synthase
2244 JDTX01000010.1 GCA000771185_00491 CDS open 57292-58707 _na     471_aa Sugar ABC transporter substrate-binding protein
2245 JDTX01000010.1 GCA000771185_00492 CDS open 58765-59532 _na     255_aa type III pantothenate kinase
2246 JDTX01000010.1 GCA000771185_00493 CDS open 59750-61429 _na     559_aa Peptide/nickel ABC transporter substrate-binding protein
2247 JDTX01000010.1 GCA000771185_00494 CDS open 61450-62442 _na     330_aa Glutathione transport system permease
2248 JDTX01000010.1 GCA000771185_00495 CDS open 62504-63541 _na     345_aa Peptide ABC transporter permease
2249 JDTX01000010.1 GCA000771185_00496 CDS open 63538-64590 _na     350_aa Peptide ABC transporter ATP-binding protein
2250 JDTX01000010.1 GCA000771185_00497 CDS open 64590-65492 _na     300_aa ABC transporter
2251 JDTX01000010.1 GCA000771185_00498 CDS open 65985-66977 _na     330_aa D-3-phosphoglycerate dehydrogenase
2252 JDTX01000010.1 GCA000771185_00499 CDS open 67264-67983 _na     239_aa AAA domain protein
2253 JDTX01000010.1 GCA000771185_00500 CDS open 68002-68631 _na     209_aa tetR Transcriptional regulator%2C TetR family
2254 JDTX01000010.1 GCA000771185_00501 CDS open 68874-71966 _na     1030_aa EmrB/QacA subfamily drug resistance transporter
2255 JDTX01000010.1 GCA000771185_00502 CDS open 72442-72855 _na     137_aa Acetoin transport repressor
2256 JDTX01000010.1 GCA000771185_00503 CDS open 72919-73854 _na     311_aa ABC transporter ATP-binding protein
2257 JDTX01000010.1 GCA000771185_00504 CDS open 73832-76012 _na     726_aa Multidrug ABC transporter permease
2258 JDTX01000010.1 GCA000771185_00505 CDS open 77010-78218 _na     402_aa Cystathionine beta-synthase
2259 JDTX01000010.1 GCA000771185_00506 CDS open 78490-79674 _na     394_aa cystathionine gamma-synthase
2260 JDTX01000010.1 GCA000771185_00507 CDS open 79944-82067 _na     707_aa recQ DNA helicase RecQ
2261 JDTX01000010.1 GCA000771185_00508 CDS open 82465-82983 _na     172_aa S-ribosylhomocysteine lyase
2262 JDTX01000010.1 GCA000771185_00509 CDS open 83453-83992 _na     179_aa cysE Serine O-acetyltransferase CysE
2263 JDTX01000010.1 GCA000771185_00510 CDS open 84276-85634 _na     452_aa alr alanine racemase
2264 JDTX01000010.1 GCA000771185_00511 CDS open 85917-87176 _na     419_aa deoxyguanosinetriphosphate triphosphohydrolase
2265 JDTX01000010.1 GCA000771185_00512 CDS open 87242-89374 _na     710_aa DNA primase
2266 JDTX01000010.1 GCA000771185_00513 CDS open 89674-90636 _na     320_aa aminodeoxychorismate lyase
2267 JDTX01000010.1 GCA000771185_00514 CDS open 90915-91712 _na     265_aa putative hydro-lyase
2268 JDTX01000010.1 GCA000771185_00515 CDS open 91894-92748 _na     284_aa 5-oxoprolinase subunit A
2269 JDTX01000010.1 GCA000771185_00516 CDS open 92736-94652 _na     638_aa pxpB 5-oxoprolinase subunit PxpB
2270 JDTX01000010.1 GCA000771185_00517 CDS open 94652-96442 _na     596_aa biotin carboxylase
2271 JDTX01000010.1 GCA000771185_00518 CDS open 96439-97554 _na     371_aa D-glutamate cyclase-like C-terminal domain-containing protein
2272 JDTX01000010.1 GCA000771185_00519 CDS open 97757-98920 _na     387_aa Transcriptional regulator
2273 JDTX01000010.1 GCA000771185_00520 CDS open 99182-99835 _na     217_aa [ribosomal protein uS5]-alanine N-acetyltransferase
2274 JDTX01000010.1 GCA000771185_00523 CDS open 100432-101385 _na     317_aa Aldose 1-epimerase
2275 JDTX01000010.1 GCA000771185_00524 CDS open 101632-102366 _na     244_aa ybaK Cys-tRNA(Pro) deacylase
2276 JDTX01000010.1 GCA000771185_00525 CDS open 102573-103628 _na     351_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2277 JDTX01000010.1 GCA000771185_00442 gene open 186-1406
2278 JDTX01000010.1 GCA000771185_00443 gene open 1590-2726
2279 JDTX01000010.1 GCA000771185_00444 gene open 2745-2939 bioY
2280 JDTX01000010.1 GCA000771185_00445 gene open 3111-4175 asnC
2281 JDTX01000010.1 GCA000771185_00446 gene open 4375-4977
2282 JDTX01000010.1 GCA000771185_00447 gene open 5067-6323
2283 JDTX01000010.1 GCA000771185_00448 gene open 6560-7105
2284 JDTX01000010.1 GCA000771185_00449 gene open 7462-8097
2285 JDTX01000010.1 GCA000771185_00450 gene open 8120-8380
2286 JDTX01000010.1 GCA000771185_00451 gene open 8664-10097
2287 JDTX01000010.1 GCA000771185_00452 gene open 10499-11236
2288 JDTX01000010.1 GCA000771185_00453 gene open 11413-11844
2289 JDTX01000010.1 GCA000771185_00454 gene open 12233-13645
2290 JDTX01000010.1 GCA000771185_00455 gene open 14073-14759
2291 JDTX01000010.1 GCA000771185_00457 gene open 15377-15589 rpmE
2292 JDTX01000010.1 GCA000771185_00458 gene open 15759-16841 prfA
2293 JDTX01000010.1 GCA000771185_00459 gene open 16882-18111 prmC
2294 JDTX01000010.1 GCA000771185_00460 gene open 18640-19299
2295 JDTX01000010.1 GCA000771185_00461 gene open 19296-20660
2296 JDTX01000010.1 GCA000771185_00462 gene open 20879-22408 guaB
2297 JDTX01000010.1 GCA000771185_00463 gene open 22705-23412 orn
2298 JDTX01000010.1 GCA000771185_00464 gene open 23593-24525
2299 JDTX01000010.1 GCA000771185_00465 gene open 24569-25981
2300 JDTX01000010.1 GCA000771185_00466 gene open 26377-27867
2301 JDTX01000010.1 GCA000771185_00467 gene open 28010-29824
2302 JDTX01000010.1 GCA000771185_00468 gene open 30227-31075
2303 JDTX01000010.1 GCA000771185_00469 gene open 31409-32215
2304 JDTX01000010.1 GCA000771185_00470 gene open 32226-34292
2305 JDTX01000010.1 GCA000771185_00471 gene open 34459-35100
2306 JDTX01000010.1 GCA000771185_00472 gene open 35177-35953 map
2307 JDTX01000010.1 GCA000771185_00473 gene open 36402-37694
2308 JDTX01000010.1 GCA000771185_00474 gene open 38294-38629
2309 JDTX01000010.1 GCA000771185_00475 gene open 38767-39786
2310 JDTX01000010.1 GCA000771185_00476 gene open 39809-40048
2311 JDTX01000010.1 GCA000771185_00477 gene open 40068-40319
2312 JDTX01000010.1 GCA000771185_00478 gene open 40612-41118
2313 JDTX01000010.1 GCA000771185_00479 gene open 41352-42341 dapD
2314 JDTX01000010.1 GCA000771185_00480 gene open 43503-44636 prfB
2315 JDTX01000010.1 GCA000771185_00481 gene open 44676-46037 ftsE
2316 JDTX01000010.1 GCA000771185_00482 gene open 46041-46964 ftsX
2317 JDTX01000010.1 GCA000771185_00483 gene open 47218-48633
2318 JDTX01000010.1 GCA000771185_00484 gene open 48849-49331 smpB
2319 JDTX01000010.1 GCA000771185_00485 gene open 49643-50572
2320 JDTX01000010.1 GCA000771185_00486 gene open 50744-51673
2321 JDTX01000010.1 GCA000771185_00487 gene open 51806-52795
2322 JDTX01000010.1 GCA000771185_00488 gene open 52806-53669
2323 JDTX01000010.1 GCA000771185_00489 gene open 53921-55813 glmS
2324 JDTX01000010.1 GCA000771185_00490 gene open 56129-57073
2325 JDTX01000010.1 GCA000771185_00491 gene open 57292-58707
2326 JDTX01000010.1 GCA000771185_00492 gene open 58765-59532
2327 JDTX01000010.1 GCA000771185_00493 gene open 59750-61429
2328 JDTX01000010.1 GCA000771185_00494 gene open 61450-62442
2329 JDTX01000010.1 GCA000771185_00495 gene open 62504-63541
2330 JDTX01000010.1 GCA000771185_00496 gene open 63538-64590
2331 JDTX01000010.1 GCA000771185_00497 gene open 64590-65492
2332 JDTX01000010.1 GCA000771185_00498 gene open 65985-66977
2333 JDTX01000010.1 GCA000771185_00499 gene open 67264-67983
2334 JDTX01000010.1 GCA000771185_00500 gene open 68002-68631 tetR
2335 JDTX01000010.1 GCA000771185_00501 gene open 68874-71966
2336 JDTX01000010.1 GCA000771185_00502 gene open 72442-72855
2337 JDTX01000010.1 GCA000771185_00503 gene open 72919-73854
2338 JDTX01000010.1 GCA000771185_00504 gene open 73832-76012
2339 JDTX01000010.1 GCA000771185_00505 gene open 77010-78218
2340 JDTX01000010.1 GCA000771185_00506 gene open 78490-79674
2341 JDTX01000010.1 GCA000771185_00507 gene open 79944-82067 recQ
2342 JDTX01000010.1 GCA000771185_00508 gene open 82465-82983
2343 JDTX01000010.1 GCA000771185_00509 gene open 83453-83992 cysE
2344 JDTX01000010.1 GCA000771185_00510 gene open 84276-85634 alr
2345 JDTX01000010.1 GCA000771185_00511 gene open 85917-87176
2346 JDTX01000010.1 GCA000771185_00512 gene open 87242-89374
2347 JDTX01000010.1 GCA000771185_00513 gene open 89674-90636
2348 JDTX01000010.1 GCA000771185_00514 gene open 90915-91712
2349 JDTX01000010.1 GCA000771185_00515 gene open 91894-92748
2350 JDTX01000010.1 GCA000771185_00516 gene open 92736-94652 pxpB
2351 JDTX01000010.1 GCA000771185_00517 gene open 94652-96442
2352 JDTX01000010.1 GCA000771185_00518 gene open 96439-97554
2353 JDTX01000010.1 GCA000771185_00519 gene open 97757-98920
2354 JDTX01000010.1 GCA000771185_00520 gene open 99182-99835
2355 JDTX01000010.1 GCA000771185_00523 gene open 100432-101385
2356 JDTX01000010.1 GCA000771185_00524 gene open 101632-102366 ybaK
2357 JDTX01000010.1 GCA000771185_00525 gene open 102573-103628 gap
2358 JDTX01000010.1 GCA000771185_00456 gene open 14980-15053 trnI
2359 JDTX01000010.1 GCA000771185_00521 gene open 100030-100103 trnR
2360 JDTX01000010.1 GCA000771185_00456 tRNA open 14980-15053 trnI tRNA-Ile2(cat)
2361 JDTX01000010.1 GCA000771185_00521 tRNA open 100030-100103 trnR tRNA-Arg(tct)
2362 JDTX01000011.1 GCA000771185_00526 CDS open 46-441 _na     131_aa arsC ArsC family protein
2363 JDTX01000011.1 GCA000771185_00527 CDS open 455-1318 _na     287_aa thiamine diphosphokinase
2364 JDTX01000011.1 GCA000771185_00528 CDS open 1419-3119 _na     566_aa Spermine synthase
2365 JDTX01000011.1 GCA000771185_00529 CDS open 3339-5222 _na     627_aa asnB asparagine synthase (glutamine-hydrolyzing)
2366 JDTX01000011.1 GCA000771185_00530 CDS open 5581-6291 _na     236_aa infC translation initiation factor IF-3
2367 JDTX01000011.1 GCA000771185_00531 CDS open 6410-6604 _na     64_aa rpmI 50S ribosomal protein L35
2368 JDTX01000011.1 GCA000771185_00532 CDS open 6651-7034 _na     127_aa rplT 50S ribosomal protein L20
2369 JDTX01000011.1 GCA000771185_00533 CDS open 7221-8147 _na     308_aa xerD site-specific tyrosine recombinase XerD
2370 JDTX01000011.1 GCA000771185_00534 CDS open 8337-10769 _na     810_aa Phosphoesterase
2371 JDTX01000011.1 GCA000771185_00535 CDS open 10766-11332 _na     188_aa Lipoprotein
2372 JDTX01000011.1 GCA000771185_00536 CDS open 11665-12729 _na     354_aa Chromosome partitioning protein
2373 JDTX01000011.1 GCA000771185_00537 CDS open 12736-13680 _na     314_aa Segregation and condensation protein A
2374 JDTX01000011.1 GCA000771185_00538 CDS open 13677-14612 _na     311_aa scpB SMC-Scp complex subunit ScpB
2375 JDTX01000011.1 GCA000771185_00539 CDS open 14754-15716 _na     320_aa ADP-ribose pyrophosphatase
2376 JDTX01000011.1 GCA000771185_00540 CDS open 15910-17310 _na     466_aa Sugar transporter
2377 JDTX01000011.1 GCA000771185_00541 CDS open 17600-19522 _na     640_aa typA translational GTPase TypA
2378 JDTX01000011.1 GCA000771185_00542 CDS open 19825-20424 _na     199_aa Alcohol dehydrogenase
2379 JDTX01000011.1 GCA000771185_00543 CDS open 20424-21815 _na     463_aa Prephenate dehydratase
2380 JDTX01000011.1 GCA000771185_00544 CDS open 21809-22936 _na     375_aa Prephenate dehydrogenase
2381 JDTX01000011.1 GCA000771185_00545 CDS open 23039-23308 _na     89_aa DUF6725 domain-containing protein
2382 JDTX01000011.1 GCA000771185_00546 CDS open 23737-25056 _na     439_aa Phage integrase family protein
2383 JDTX01000011.1 GCA000771185_00547 CDS open 26087-27511 _na     474_aa ABC transporter substrate-binding protein
2384 JDTX01000011.1 GCA000771185_00548 CDS open 27859-28785 _na     308_aa Peptide ABC transporter permease
2385 JDTX01000011.1 GCA000771185_00549 CDS open 28806-29792 _na     328_aa Peptide ABC transporter permease
2386 JDTX01000011.1 GCA000771185_00550 CDS open 29814-31847 _na     677_aa nikD nickel import ATP-binding protein NikD
2387 JDTX01000011.1 GCA000771185_00551 CDS open 32343-34652 _na     769_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2388 JDTX01000011.1 GCA000771185_00552 CDS open 34739-35917 _na     392_aa Polyprenyl synthase
2389 JDTX01000011.1 GCA000771185_00553 CDS open 36136-37044 _na     302_aa DUF4192 domain-containing protein
2390 JDTX01000011.1 GCA000771185_00554 CDS open 37169-38584 _na     471_aa RNA polymerase sigma factor
2391 JDTX01000011.1 GCA000771185_00555 CDS open 38823-41237 _na     804_aa DNA topoisomerase (ATP-hydrolyzing)
2392 JDTX01000011.1 GCA000771185_00556 CDS open 41379-42929 _na     516_aa Aspartate ammonia-lyase
2393 JDTX01000011.1 GCA000771185_00557 CDS open 43566-44819 _na     417_aa Transporter%2C major facilitator family protein
2394 JDTX01000011.1 GCA000771185_00558 CDS open 44854-50409 _na     1851_aa ATP-dependent helicase
2395 JDTX01000011.1 GCA000771185_00559 CDS open 50551-50886 _na     111_aa XRE family transcriptional regulator
2396 JDTX01000011.1 GCA000771185_00560 CDS open 50879-51502 _na     207_aa Phosphatidylinositol kinase
2397 JDTX01000011.1 GCA000771185_00561 CDS open 51557-51799 _na     80_aa Antitoxin
2398 JDTX01000011.1 GCA000771185_00562 CDS open 51950-54607 _na     885_aa DNA topoisomerase (ATP-hydrolyzing)
2399 JDTX01000011.1 GCA000771185_00563 CDS open 55187-56557 _na     456_aa Nucleotide pyrophosphatase
2400 JDTX01000011.1 GCA000771185_00564 CDS open 56808-58046 _na     412_aa sepH septation protein SepH
2401 JDTX01000011.1 GCA000771185_00565 CDS open 58209-58502 _na     97_aa dUTPase
2402 JDTX01000011.1 GCA000771185_00566 CDS open 58502-58978 _na     158_aa dut dUTP diphosphatase
2403 JDTX01000011.1 GCA000771185_00567 CDS open 59154-61484 _na     776_aa GTP pyrophosphokinase/Guanosine 3'%2C5'-bis(Diphosphate)3'-pyrophosphohydrolase
2404 JDTX01000011.1 GCA000771185_00568 CDS open 61499-62467 _na     322_aa Sugar-binding protein
2405 JDTX01000011.1 GCA000771185_00569 CDS open 62679-63248 _na     189_aa Phosphotriesterase family protein
2406 JDTX01000011.1 GCA000771185_00570 CDS open 63263-63721 _na     152_aa Insertion element IS6110 membrane protein
2407 JDTX01000011.1 GCA000771185_00571 CDS open 63690-64475 _na     261_aa IS3 family transposase
2408 JDTX01000011.1 GCA000771185_00572 CDS open 64522-65337 _na     271_aa HNH endonuclease
2409 JDTX01000011.1 GCA000771185_00573 CDS open 65398-65634 _na     78_aa Helix-turn-helix domain-containing protein
2410 JDTX01000011.1 GCA000771185_00574 CDS open 65637-66212 _na     191_aa repB RepB protein
2411 JDTX01000011.1 GCA000771185_00526 gene open 46-441 arsC
2412 JDTX01000011.1 GCA000771185_00527 gene open 455-1318
2413 JDTX01000011.1 GCA000771185_00528 gene open 1419-3119
2414 JDTX01000011.1 GCA000771185_00529 gene open 3339-5222 asnB
2415 JDTX01000011.1 GCA000771185_00530 gene open 5581-6291 infC
2416 JDTX01000011.1 GCA000771185_00531 gene open 6410-6604 rpmI
2417 JDTX01000011.1 GCA000771185_00532 gene open 6651-7034 rplT
2418 JDTX01000011.1 GCA000771185_00533 gene open 7221-8147 xerD
2419 JDTX01000011.1 GCA000771185_00534 gene open 8337-10769
2420 JDTX01000011.1 GCA000771185_00535 gene open 10766-11332
2421 JDTX01000011.1 GCA000771185_00536 gene open 11665-12729
2422 JDTX01000011.1 GCA000771185_00537 gene open 12736-13680
2423 JDTX01000011.1 GCA000771185_00538 gene open 13677-14612 scpB
2424 JDTX01000011.1 GCA000771185_00539 gene open 14754-15716
2425 JDTX01000011.1 GCA000771185_00540 gene open 15910-17310
2426 JDTX01000011.1 GCA000771185_00541 gene open 17600-19522 typA
2427 JDTX01000011.1 GCA000771185_00542 gene open 19825-20424
2428 JDTX01000011.1 GCA000771185_00543 gene open 20424-21815
2429 JDTX01000011.1 GCA000771185_00544 gene open 21809-22936
2430 JDTX01000011.1 GCA000771185_00545 gene open 23039-23308
2431 JDTX01000011.1 GCA000771185_00546 gene open 23737-25056
2432 JDTX01000011.1 GCA000771185_00547 gene open 26087-27511
2433 JDTX01000011.1 GCA000771185_00548 gene open 27859-28785
2434 JDTX01000011.1 GCA000771185_00549 gene open 28806-29792
2435 JDTX01000011.1 GCA000771185_00550 gene open 29814-31847 nikD
2436 JDTX01000011.1 GCA000771185_00551 gene open 32343-34652 pknB
2437 JDTX01000011.1 GCA000771185_00552 gene open 34739-35917
2438 JDTX01000011.1 GCA000771185_00553 gene open 36136-37044
2439 JDTX01000011.1 GCA000771185_00554 gene open 37169-38584
2440 JDTX01000011.1 GCA000771185_00555 gene open 38823-41237
2441 JDTX01000011.1 GCA000771185_00556 gene open 41379-42929
2442 JDTX01000011.1 GCA000771185_00557 gene open 43566-44819
2443 JDTX01000011.1 GCA000771185_00558 gene open 44854-50409
2444 JDTX01000011.1 GCA000771185_00559 gene open 50551-50886
2445 JDTX01000011.1 GCA000771185_00560 gene open 50879-51502
2446 JDTX01000011.1 GCA000771185_00561 gene open 51557-51799
2447 JDTX01000011.1 GCA000771185_00562 gene open 51950-54607
2448 JDTX01000011.1 GCA000771185_00563 gene open 55187-56557
2449 JDTX01000011.1 GCA000771185_00564 gene open 56808-58046 sepH
2450 JDTX01000011.1 GCA000771185_00565 gene open 58209-58502
2451 JDTX01000011.1 GCA000771185_00566 gene open 58502-58978 dut
2452 JDTX01000011.1 GCA000771185_00567 gene open 59154-61484
2453 JDTX01000011.1 GCA000771185_00568 gene open 61499-62467
2454 JDTX01000011.1 GCA000771185_00569 gene open 62679-63248
2455 JDTX01000011.1 GCA000771185_00570 gene open 63263-63721
2456 JDTX01000011.1 GCA000771185_00571 gene open 63690-64475
2457 JDTX01000011.1 GCA000771185_00572 gene open 64522-65337
2458 JDTX01000011.1 GCA000771185_00573 gene open 65398-65634
2459 JDTX01000011.1 GCA000771185_00574 gene open 65637-66212 repB
2460 JDTX01000012.1 repeat_region open 25535-26292 CRISPR array with 12 repeats of length 31%2C consensus sequence GTCGCTCCCTCACGGGAGCGTGGATTGAAAT and spacer length 34
2461 JDTX01000012.1 GCA000771185_00575 CDS open 736-1326 _na     196_aa DNA-binding ferritin-like protein (Oxidative damage protectant)
2462 JDTX01000012.1 GCA000771185_00576 CDS open 1326-1556 _na     76_aa merP MerTP family mercury (Hg2 ) permease%2C binding protein MerP
2463 JDTX01000012.1 GCA000771185_00577 CDS open 1638-3728 _na     696_aa Cation transport ATPase
2464 JDTX01000012.1 GCA000771185_00578 CDS open 4007-5095 _na     362_aa Transporter%2C probably Formate efflux permease
2465 JDTX01000012.1 GCA000771185_00579 CDS open 5219-6202 _na     327_aa diaminopimelate dehydrogenase
2466 JDTX01000012.1 GCA000771185_00581 CDS open 6574-7206 _na     210_aa 2-keto-3-deoxygluconate kinase
2467 JDTX01000012.1 GCA000771185_00582 CDS open 7255-8616 _na     453_aa Sugar transporter
2468 JDTX01000012.1 GCA000771185_00583 CDS open 9190-9882 _na     230_aa L-ribulose-5-phosphate 4-epimerase
2469 JDTX01000012.1 GCA000771185_00584 CDS open 10334-11302 _na     322_aa Major facilitator superfamily protein
2470 JDTX01000012.1 GCA000771185_00585 CDS open 11384-11830 _na     148_aa marR Transcriptional regulator%2C MarR family
2471 JDTX01000012.1 GCA000771185_00586 CDS open 12275-15628 _na     1117_aa ileS mupirocin-resistant isoleucine--tRNA ligase
2472 JDTX01000012.1 GCA000771185_00587 CDS open 15712-16956 _na     414_aa Filamentation induced by cAMP protein fic
2473 JDTX01000012.1 GCA000771185_00588 CDS open 17192-19579 _na     795_aa CRISPR-associated protein Cas3
2474 JDTX01000012.1 GCA000771185_00589 CDS open 19590-20300 _na     236_aa cas5c type I-C CRISPR-associated protein Cas5c
2475 JDTX01000012.1 GCA000771185_00590 CDS open 20305-22269 _na     654_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2476 JDTX01000012.1 GCA000771185_00591 CDS open 22275-23117 _na     280_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2477 JDTX01000012.1 GCA000771185_00592 CDS open 23238-23948 _na     236_aa cas4 CRISPR-associated protein Cas4
2478 JDTX01000012.1 GCA000771185_00593 CDS open 23945-24976 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2479 JDTX01000012.1 GCA000771185_00594 CDS open 24983-25273 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
2480 JDTX01000012.1 GCA000771185_00575 gene open 736-1326
2481 JDTX01000012.1 GCA000771185_00576 gene open 1326-1556 merP
2482 JDTX01000012.1 GCA000771185_00577 gene open 1638-3728
2483 JDTX01000012.1 GCA000771185_00578 gene open 4007-5095
2484 JDTX01000012.1 GCA000771185_00579 gene open 5219-6202
2485 JDTX01000012.1 GCA000771185_00581 gene open 6574-7206
2486 JDTX01000012.1 GCA000771185_00582 gene open 7255-8616
2487 JDTX01000012.1 GCA000771185_00583 gene open 9190-9882
2488 JDTX01000012.1 GCA000771185_00584 gene open 10334-11302
2489 JDTX01000012.1 GCA000771185_00585 gene open 11384-11830 marR
2490 JDTX01000012.1 GCA000771185_00586 gene open 12275-15628 ileS
2491 JDTX01000012.1 GCA000771185_00587 gene open 15712-16956
2492 JDTX01000012.1 GCA000771185_00588 gene open 17192-19579
2493 JDTX01000012.1 GCA000771185_00589 gene open 19590-20300 cas5c
2494 JDTX01000012.1 GCA000771185_00590 gene open 20305-22269 cas8c
2495 JDTX01000012.1 GCA000771185_00591 gene open 22275-23117 cas7c
2496 JDTX01000012.1 GCA000771185_00592 gene open 23238-23948 cas4
2497 JDTX01000012.1 GCA000771185_00593 gene open 23945-24976 cas1c
2498 JDTX01000012.1 GCA000771185_00594 gene open 24983-25273 cas2
2499 JDTX01000012.1 GCA000771185_00580 gene open 6481-6545 trnfM
2500 JDTX01000012.1 GCA000771185_00580 tRNA open 6481-6545 trnfM tRNA-fMet(cat)