HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Haemophilus haemolyticus (GCA_001008205.1)

Select a Genome:
BAKTA Annotations for GCA_001008205.1
Genome Selected: Haemophilus haemolyticus
ContigsBases CDSrRNA tmRNAtRNA
40 1785806 1654 4 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3455 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3455 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
501 LCTK01000005.1 GCA001008205_00231 gene open 63735-63983 rpsP
502 LCTK01000005.1 GCA001008205_00232 gene open 64294-65073
503 LCTK01000005.1 GCA001008205_00233 gene open 65098-66909 nadN
504 LCTK01000005.1 GCA001008205_00234 gene open 67196-67738 aroK
505 LCTK01000005.1 GCA001008205_00235 gene open 67758-68846 aroB
506 LCTK01000005.1 GCA001008205_00236 gene open 68848-69708 dam
507 LCTK01000005.1 GCA001008205_00237 gene open 69730-70320 mobA
508 LCTK01000005.1 GCA001008205_00238 gene open 70385-70651 yihD
509 LCTK01000005.1 GCA001008205_00239 gene open 70663-71280 dsbA
510 LCTK01000005.1 GCA001008205_00240 gene open 71342-71677 yifE
511 LCTK01000005.1 GCA001008205_00241 gene open 71820-72911 trmA
512 LCTK01000005.1 GCA001008205_00242 gene open 72893-73666 rsmJ
513 LCTK01000005.1 GCA001008205_00243 gene open 73660-74094 rseC
514 LCTK01000005.1 GCA001008205_00244 gene open 74205-74426
515 LCTK01000005.1 GCA001008205_00245 gene open 74580-75095 mobB
516 LCTK01000005.1 GCA001008205_00246 gene open 75092-76480 hsrA
517 LCTK01000005.1 GCA001008205_00247 gene open 76634-78277 hbpA
518 LCTK01000005.1 GCA001008205_00248 gene open 78456-79217 hugZ
519 LCTK01000005.1 GCA001008205_00249 gene open 79333-80637
520 LCTK01000005.1 GCA001008205_00250 gene open 80648-80962
521 LCTK01000005.1 GCA001008205_00251 gene open 80974-83781 polA
522 LCTK01000005.1 GCA001008205_00252 gene open 83930-84232 zapA
523 LCTK01000005.1 GCA001008205_00254 gene open 84694-85257 fAU1
524 LCTK01000005.1 GCA001008205_00255 gene open 85386-87956 clpB
525 LCTK01000005.1 GCA001008205_00256 gene open 88422-88739
526 LCTK01000005.1 GCA001008205_00257 gene open 89058-90224 nhaA
527 LCTK01000005.1 GCA001008205_00258 gene open 90451-91761 brnQ
528 LCTK01000005.1 GCA001008205_00259 gene open 91776-93650 gss
529 LCTK01000005.1 GCA001008205_00260 gene open 93879-94937 yedE
530 LCTK01000005.1 GCA001008205_00261 gene open 95041-97389 rnr
531 LCTK01000005.1 GCA001008205_00262 gene open 97444-98184 rlmB
532 LCTK01000005.1 GCA001008205_00263 gene open 98346-98807 lrp
533 LCTK01000005.1 GCA001008205_00264 gene open 98926-99816 rarD
534 LCTK01000005.1 GCA001008205_00265 gene open 99878-101437 guaA
535 LCTK01000005.1 GCA001008205_00266 gene open 101548-103014 guaB
536 LCTK01000005.1 GCA001008205_00267 gene open 103144-104052 birA
537 LCTK01000006.1 GCA001008205_00308 gene open 44210-44295 t44
538 LCTK01000006.1 GCA001008205_00308 ncRNA open 44210-44295 t44 RNA
539 LCTK01000006.1 regulatory_region open 32296-32406 Glycine riboswitch aptamer
540 LCTK01000006.1 regulatory_region open 200558-200643 RpsF leader
541 LCTK01000006.1 repeat_region open 94631-94939 CRISPR array with 5 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCGCGAAGGCGGCTGC and spacer length 34
542 LCTK01000006.1 GCA001008205_00268 CDS open 2-346 _na     114_aa frdD fumarate reductase subunit FrdD
543 LCTK01000006.1 GCA001008205_00269 CDS open 359-769 _na     136_aa frdC fumarate reductase subunit FrdC
544 LCTK01000006.1 GCA001008205_00270 CDS open 780-1550 _na     256_aa frdB succinate dehydrogenase/fumarate reductase iron-sulfur subunit
545 LCTK01000006.1 GCA001008205_00271 CDS open 1543-3411 _na     622_aa frdA fumarate reductase (quinol) flavoprotein subunit
546 LCTK01000006.1 GCA001008205_00272 CDS open 3558-4529 _na     323_aa epmA elongation factor P--(R)-beta-lysine ligase
547 LCTK01000006.1 GCA001008205_00273 CDS open 4569-5882 _na     437_aa cpxA envelope stress sensor histidine kinase CpxA
548 LCTK01000006.1 GCA001008205_00274 CDS open 5965-6663 _na     232_aa Transcriptional regulator
549 LCTK01000006.1 GCA001008205_00275 CDS open 6721-7134 _na     137_aa bamE outer membrane protein assembly factor BamE
550 LCTK01000006.1 GCA001008205_00276 CDS open 7199-8215 _na     338_aa yejK nucleoid-associated protein YejK
551 LCTK01000006.1 GCA001008205_00277 CDS open 8344-8562 _na     72_aa yejL UPF0352 protein HI_0840
552 LCTK01000006.1 GCA001008205_00278 CDS open 8564-10321 _na     585_aa yejM putative protein HI_0841
553 LCTK01000006.1 GCA001008205_00279 CDS open 10519-11511 _na     330_aa ssnA putative protein HI_0843
554 LCTK01000006.1 GCA001008205_00280 CDS open 11707-12270 _na     187_aa acrR putative HTH-type transcriptional regulator HI_0893
555 LCTK01000006.1 GCA001008205_00281 CDS open 12302-13498 _na     398_aa acrA putative protein HI_0894
556 LCTK01000006.1 GCA001008205_00282 CDS open 13516-16596 _na     1026_aa acrB putative transporter HI_0895
557 LCTK01000006.1 GCA001008205_00283 CDS open 16664-17308 _na     214_aa adk adenylate kinase
558 LCTK01000006.1 GCA001008205_00284 CDS open 17393-18631 _na     412_aa putative protein HI_0350
559 LCTK01000006.1 GCA001008205_00285 CDS open 18810-19826 _na     338_aa galE UDP-glucose 4-epimerase
560 LCTK01000006.1 GCA001008205_00286 CDS open 19870-21117 _na     415_aa rhlB ATP-dependent RNA helicase RhlB
561 LCTK01000006.1 GCA001008205_00287 CDS open 21234-21440 _na     68_aa yacG DNA gyrase inhibitor YacG
562 LCTK01000006.1 GCA001008205_00288 CDS open 21433-22053 _na     206_aa coaE dephospho-CoA kinase
563 LCTK01000006.1 GCA001008205_00289 CDS open 22163-22459 _na     98_aa DUF1294 domain-containing protein
564 LCTK01000006.1 GCA001008205_00290 CDS open 22456-23721 _na     421_aa glyA Serine hydroxymethyltransferase
565 LCTK01000006.1 GCA001008205_00291 CDS open 23837-24406 _na     189_aa Lipoprotein
566 LCTK01000006.1 GCA001008205_00292 CDS open 24470-25693 _na     407_aa DUF711 domain-containing protein
567 LCTK01000006.1 GCA001008205_00293 CDS open 25718-27007 _na     429_aa purD Phosphoribosylamine--glycine ligase
568 LCTK01000006.1 GCA001008205_00294 CDS open 27161-28759 _na     532_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
569 LCTK01000006.1 GCA001008205_00295 CDS open 28941-29345 _na     134_aa doxX DoxX family protein
570 LCTK01000006.1 GCA001008205_00296 CDS open 29457-31196 _na     579_aa dsbD Thiol:disulfide interchange protein DsbD
571 LCTK01000006.1 GCA001008205_00297 CDS open 31387-32097 _na     236_aa arcA two-component system response regulator ArcA
572 LCTK01000006.1 GCA001008205_00298 CDS open 32518-33888 _na     456_aa alsT putative transporter HI_0883
573 LCTK01000006.1 GCA001008205_00299 CDS open 34123-34446 _na     107_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
574 LCTK01000006.1 GCA001008205_00300 CDS open 34515-35831 _na     438_aa Putative metabolite transport protein HI_0281
575 LCTK01000006.1 GCA001008205_00301 CDS open 35887-36630 _na     247_aa menH 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase
576 LCTK01000006.1 GCA001008205_00302 CDS open 36692-38398 _na     568_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
577 LCTK01000006.1 GCA001008205_00303 CDS open 38413-39684 _na     423_aa menF Isochorismate synthase MenF
578 LCTK01000006.1 GCA001008205_00304 CDS open 39841-41055 _na     404_aa alaA Glutamate-pyruvate aminotransferase AlaA
579 LCTK01000006.1 GCA001008205_00305 CDS open 41152-41931 _na     259_aa yggG putative metalloprotease yggG
580 LCTK01000006.1 GCA001008205_00306 CDS open 42052-43308 _na     418_aa mtr tryptophan permease
581 LCTK01000006.1 GCA001008205_00307 CDS open 43374-44138 _na     254_aa cfa putative protein HI_0912
582 LCTK01000006.1 GCA001008205_00309 CDS open 44316-45038 _na     240_aa rpsB 30S ribosomal protein S2
583 LCTK01000006.1 GCA001008205_00310 CDS open 45172-46023 _na     283_aa tsf translation elongation factor Ts
584 LCTK01000006.1 GCA001008205_00311 CDS open 46204-47229 _na     341_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
585 LCTK01000006.1 GCA001008205_00312 CDS open 47242-47835 _na     197_aa omp26 Outer membrane protein 26
586 LCTK01000006.1 GCA001008205_00313 CDS open 47946-49595 _na     549_aa bamA Outer membrane protein assembly factor BamA
587 LCTK01000006.1 GCA001008205_00314 CDS open 49561-50325 _na     254_aa bamA outer membrane protein assembly factor BamA
588 LCTK01000006.1 GCA001008205_00315 CDS open 50345-51676 _na     443_aa rseP RIP metalloprotease RseP
589 LCTK01000006.1 GCA001008205_00316 CDS open 51686-52552 _na     288_aa cdsA Phosphatidate cytidylyltransferase
590 LCTK01000006.1 GCA001008205_00317 CDS open 52574-53293 _na     239_aa uppS polyprenyl diphosphate synthase
591 LCTK01000006.1 GCA001008205_00318 CDS open 53446-53733 _na     95_aa yggU DUF167 domain-containing protein
592 LCTK01000006.1 GCA001008205_00319 CDS open 53862-56447 _na     861_aa leuS leucine--tRNA ligase
593 LCTK01000006.1 GCA001008205_00320 CDS open 56545-57048 _na     167_aa lptE LPS-assembly lipoprotein LptE
594 LCTK01000006.1 GCA001008205_00321 CDS open 57048-58082 _na     344_aa holA DNA polymerase III subunit delta
595 LCTK01000006.1 GCA001008205_00322 CDS open 58169-58435 _na     88_aa TonB-dependent receptor
596 LCTK01000006.1 GCA001008205_00323 CDS open 58484-58897 _na     137_aa mutT 8-oxo-dGTP diphosphatase MutT
597 LCTK01000006.1 GCA001008205_00324 CDS open 58962-61667 _na     901_aa secA preprotein translocase subunit SecA
598 LCTK01000006.1 GCA001008205_00325 CDS open 61795-62097 _na     100_aa secM secA translation cis-regulator SecM
599 LCTK01000006.1 GCA001008205_00326 CDS open 62176-62490 _na     104_aa putative protein HI_0907
600 LCTK01000006.1 GCA001008205_00327 CDS open 62524-63039 _na     171_aa tadA tRNA adenosine(34) deaminase TadA
601 LCTK01000006.1 GCA001008205_00328 CDS open 63039-63890 _na     283_aa thyA thymidylate synthase
602 LCTK01000006.1 GCA001008205_00329 CDS open 63901-64707 _na     268_aa lgt prolipoprotein diacylglyceryl transferase
603 LCTK01000006.1 GCA001008205_00330 CDS open 64716-65513 _na     265_aa putative membrane transporter protein
604 LCTK01000006.1 GCA001008205_00331 CDS open 65513-66103 _na     196_aa rppH RNA pyrophosphohydrolase
605 LCTK01000006.1 GCA001008205_00332 CDS open 66629-67183 _na     184_aa ampD 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD
606 LCTK01000006.1 GCA001008205_00333 CDS open 67298-67738 _na     146_aa ppdD prepilin peptidase-dependent pilin
607 LCTK01000006.1 GCA001008205_00334 CDS open 67735-69129 _na     464_aa hofB Protein transporter HofB
608 LCTK01000006.1 GCA001008205_00335 CDS open 69126-70346 _na     406_aa hofC Protein transport HofC-like protein
609 LCTK01000006.1 GCA001008205_00336 CDS open 70343-71035 _na     230_aa hofD Prepilin leader peptidase/N-methyltransferase
610 LCTK01000006.1 GCA001008205_00337 CDS open 71089-72351 _na     420_aa rho transcription termination factor Rho
611 LCTK01000006.1 GCA001008205_00338 CDS open 72599-72916 _na     105_aa metJ met regulon transcriptional regulator MetJ
612 LCTK01000006.1 GCA001008205_00339 CDS open 72930-73316 _na     128_aa Cu(I)-responsive transcriptional regulator
613 LCTK01000006.1 GCA001008205_00340 CDS open 73393-73599 _na     68_aa copZ putative protein HI_0291
614 LCTK01000006.1 GCA001008205_00341 CDS open 73574-75745 _na     723_aa zntA putative cation-transporting ATPase HI_0290
615 LCTK01000006.1 GCA001008205_00342 CDS open 75968-77206 _na     412_aa sdaC Serine transporter SdaC
616 LCTK01000006.1 GCA001008205_00343 CDS open 77242-78609 _na     455_aa sdaA L-serine ammonia-lyase
617 LCTK01000006.1 GCA001008205_00344 CDS open 78908-80275 _na     455_aa Putative phosphoethanolamine transferase HI_1005
618 LCTK01000006.1 GCA001008205_00345 CDS open 80316-80609 _na     97_aa Lipoprotein
619 LCTK01000006.1 GCA001008205_00346 CDS open 80620-81144 _na     174_aa Lipoprotein
620 LCTK01000006.1 GCA001008205_00347 CDS open 81259-82176 _na     305_aa ccmI C-type cytochrome biogenesis protein CcmI
621 LCTK01000006.1 GCA001008205_00348 CDS open 82177-82638 _na     153_aa nrfF Cytochrome c-type biogenesis protein
622 LCTK01000006.1 GCA001008205_00349 CDS open 82638-83183 _na     181_aa dsbE Thiol:disulfide interchange protein DsbE
623 LCTK01000006.1 GCA001008205_00350 CDS open 83297-85243 _na     648_aa ccmF Cytochrome c-type biogenesis protein CcmF
624 LCTK01000006.1 GCA001008205_00351 CDS open 85240-85761 _na     173_aa ccmE cytochrome c maturation protein CcmE
625 LCTK01000006.1 GCA001008205_00352 CDS open 85758-85961 _na     67_aa ccmD heme exporter protein CcmD
626 LCTK01000006.1 GCA001008205_00353 CDS open 86004-86744 _na     246_aa ccmC Heme exporter protein C
627 LCTK01000006.1 GCA001008205_00354 CDS open 86803-87468 _na     221_aa ccmB heme exporter protein CcmB
628 LCTK01000006.1 GCA001008205_00355 CDS open 87473-88111 _na     212_aa ccmA cytochrome c biogenesis heme-transporting ATPase CcmA
629 LCTK01000006.1 GCA001008205_00356 CDS open 88377-89024 _na     215_aa sodA superoxide dismutase [Mn]
630 LCTK01000006.1 GCA001008205_00357 CDS open 89125-90075 _na     316_aa cysK cysteine synthase A
631 LCTK01000006.1 GCA001008205_00358 CDS open 90175-90993 _na     272_aa cysZ sulfate transporter CysZ
632 LCTK01000006.1 GCA001008205_00359 CDS open 91146-92132 _na     328_aa zipA cell division protein ZipA
633 LCTK01000006.1 GCA001008205_00360 CDS open 92243-94261 _na     672_aa ligA NAD-dependent DNA ligase LigA
634 LCTK01000006.1 GCA001008205_00361 CDS open 95121-95414 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
635 LCTK01000006.1 GCA001008205_00362 CDS open 95418-96431 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
636 LCTK01000006.1 GCA001008205_00363 CDS open 96575-97516 _na     313_aa DUF3150 domain-containing protein
637 LCTK01000006.1 GCA001008205_00364 CDS open 97520-97783 _na     87_aa hypothetical protein
638 LCTK01000006.1 GCA001008205_00365 CDS open 97809-98465 _na     218_aa cas4 CRISPR-associated protein Cas4
639 LCTK01000006.1 GCA001008205_00366 CDS open 98483-99349 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
640 LCTK01000006.1 GCA001008205_00367 CDS open 99361-101139 _na     592_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
641 LCTK01000006.1 GCA001008205_00368 CDS open 101136-101816 _na     226_aa cas5c type I-C CRISPR-associated protein Cas5c
642 LCTK01000006.1 GCA001008205_00369 CDS open 101979-103301 _na     440_aa hypothetical protein
643 LCTK01000006.1 GCA001008205_00370 CDS open 103398-105689 _na     763_aa CRISPR-associated helicase/endonuclease Cas3
644 LCTK01000006.1 GCA001008205_00371 CDS open 105815-107347 _na     510_aa emrB Multidrug export protein EmrB
645 LCTK01000006.1 GCA001008205_00372 CDS open 107357-108529 _na     390_aa emrA Multidrug export protein EmrA
646 LCTK01000006.1 GCA001008205_00373 CDS open 108707-109189 _na     160_aa folA type 3 dihydrofolate reductase
647 LCTK01000006.1 GCA001008205_00374 CDS open 109291-110394 _na     367_aa proB Glutamate 5-kinase
648 LCTK01000006.1 GCA001008205_00375 CDS open 110508-111296 _na     262_aa ftsN cell division protein FtsN
649 LCTK01000006.1 GCA001008205_00376 CDS open 111472-112074 _na     200_aa napC Cytochrome c-type protein NapC
650 LCTK01000006.1 GCA001008205_00377 CDS open 112089-112532 _na     147_aa napB Periplasmic nitrate reductase%2C electron transfer subunit
651 LCTK01000006.1 GCA001008205_00378 CDS open 112538-113401 _na     287_aa napH quinol dehydrogenase ferredoxin subunit NapH
652 LCTK01000006.1 GCA001008205_00379 CDS open 113401-114210 _na     269_aa napG ferredoxin-type protein NapG
653 LCTK01000006.1 GCA001008205_00380 CDS open 114294-116777 _na     827_aa napA nitrate reductase catalytic subunit NapA
654 LCTK01000006.1 GCA001008205_00381 CDS open 116933-117214 _na     93_aa napD Chaperone NapD
655 LCTK01000006.1 GCA001008205_00382 CDS open 117207-117737 _na     176_aa napF ferredoxin-type protein NapF
656 LCTK01000006.1 GCA001008205_00383 CDS open 117952-118296 _na     114_aa yggL putative protein HI_0341
657 LCTK01000006.1 GCA001008205_00384 CDS open 118414-119154 _na     246_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
658 LCTK01000006.1 GCA001008205_00385 CDS open 119239-121431 _na     730_aa priA primosomal protein N'
659 LCTK01000006.1 GCA001008205_00386 CDS open 121473-122519 _na     348_aa perM Putative transport protein HI_0338
660 LCTK01000006.1 GCA001008205_00387 CDS open 122519-122857 _na     112_aa glnB nitrogen regulatory protein P-II
661 LCTK01000006.1 GCA001008205_00388 CDS open 122859-123452 _na     197_aa mog molybdopterin adenylyltransferase
662 LCTK01000006.1 GCA001008205_00389 CDS open 123535-123891 _na     118_aa dgkA Diacylglycerol kinase
663 LCTK01000006.1 GCA001008205_00390 CDS open 123906-126137 _na     743_aa relA GTP diphosphokinase
664 LCTK01000006.1 GCA001008205_00391 CDS open 126215-127531 _na     438_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
665 LCTK01000006.1 GCA001008205_00392 CDS open 127531-128241 _na     236_aa recO DNA repair protein RecO
666 LCTK01000006.1 GCA001008205_00393 CDS open 128244-128648 _na     134_aa oapB Opacity-associated protein OapB
667 LCTK01000006.1 GCA001008205_00394 CDS open 128696-130063 _na     455_aa oapA opacity-associated protein OapA
668 LCTK01000006.1 GCA001008205_00395 CDS open 130148-131164 _na     338_aa epmB EF-P beta-lysylation protein EpmB
669 LCTK01000006.1 GCA001008205_00396 CDS open 131202-131768 _na     188_aa efp elongation factor P
670 LCTK01000006.1 GCA001008205_00397 CDS open 132427-133806 _na     459_aa yegQ tRNA 5-hydroxyuridine modification protein YegQ
671 LCTK01000006.1 GCA001008205_00398 CDS open 133949-134374 _na     141_aa ruvX Holliday junction resolvase RuvX
672 LCTK01000006.1 GCA001008205_00399 CDS open 134374-134934 _na     186_aa YqgE/AlgH family protein
673 LCTK01000006.1 GCA001008205_00400 CDS open 134931-135668 _na     245_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
674 LCTK01000006.1 GCA001008205_00401 CDS open 135730-136455 _na     241_aa fadR fatty acid metabolism transcriptional regulator FadR
675 LCTK01000006.1 GCA001008205_00402 CDS open 136582-138126 _na     514_aa nhaB Na(+)/H(+) antiporter NhaB
676 LCTK01000006.1 GCA001008205_00403 CDS open 138136-138669 _na     177_aa dsbB disulfide bond formation protein DsbB
677 LCTK01000006.1 GCA001008205_00404 CDS open 138724-139200 _na     158_aa surface-adhesin protein E
678 LCTK01000006.1 GCA001008205_00405 CDS open 139232-139972 _na     246_aa pflA pyruvate formate lyase 1-activating protein
679 LCTK01000006.1 GCA001008205_00406 CDS open 140088-140378 _na     96_aa ABM domain-containing protein
680 LCTK01000006.1 GCA001008205_00407 CDS open 140461-142773 _na     770_aa pflB formate C-acetyltransferase
681 LCTK01000006.1 GCA001008205_00408 CDS open 142815-143669 _na     284_aa focA formate transporter FocA
682 LCTK01000006.1 GCA001008205_00409 CDS open 143955-145136 _na     393_aa gsp Putative acid--amine ligase HI_0929
683 LCTK01000006.1 GCA001008205_00410 CDS open 145137-145718 _na     193_aa putative protein HI_0930
684 LCTK01000006.1 GCA001008205_00411 CDS open 145731-146150 _na     139_aa putative protein HI_0931
685 LCTK01000006.1 GCA001008205_00412 CDS open 146184-146894 _na     236_aa hypothetical protein
686 LCTK01000006.1 GCA001008205_00413 CDS open 147034-148344 _na     436_aa eno phosphopyruvate hydratase
687 LCTK01000006.1 GCA001008205_00414 CDS open 148535-150172 _na     545_aa pyrG glutamine hydrolyzing CTP synthase
688 LCTK01000006.1 GCA001008205_00415 CDS open 150359-151252 _na     297_aa xerD site-specific tyrosine recombinase XerD
689 LCTK01000006.1 GCA001008205_00416 CDS open 151283-152449 _na     388_aa hcaT 3-phenylpropionate MFS transporter
690 LCTK01000006.1 GCA001008205_00417 CDS open 152449-153264 _na     271_aa proC pyrroline-5-carboxylate reductase
691 LCTK01000006.1 GCA001008205_00418 CDS open 153330-154238 _na     302_aa rdgC recombination-associated protein RdgC
692 LCTK01000006.1 GCA001008205_00419 CDS open 154356-155681 _na     441_aa srmB ATP-dependent RNA helicase SrmB
693 LCTK01000006.1 GCA001008205_00420 CDS open 155762-156460 _na     232_aa trmN6 tRNA1(Val) (adenine(37)-N6)-methyltransferase
694 LCTK01000006.1 GCA001008205_00421 CDS open 156503-159451 _na     982_aa hypothetical protein
695 LCTK01000006.1 GCA001008205_00422 CDS open 159705-160760 _na     351_aa tRNA/rRNA methyltransferase
696 LCTK01000006.1 GCA001008205_00423 CDS open 160906-162273 _na     455_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
697 LCTK01000006.1 GCA001008205_00424 CDS open 162650-163693 _na     347_aa opsX heptosyltransferase I
698 LCTK01000006.1 GCA001008205_00425 CDS open 163770-164495 _na     241_aa kdkA 3-deoxy-D-manno-octulosonic-acid kinase
699 LCTK01000006.1 GCA001008205_00426 CDS open 164507-165094 _na     195_aa orfM deoxyribonucleotide triphosphate pyrophosphatase
700 LCTK01000006.1 GCA001008205_00427 CDS open 165182-167026 _na     614_aa mdlB putative ABC transporter ATP-binding protein HI_1051
701 LCTK01000006.1 GCA001008205_00428 CDS open 167105-168001 _na     298_aa rhaS L-rhamnose operon regulatory protein rhaS
702 LCTK01000006.1 GCA001008205_00429 CDS open 168113-168454 _na     113_aa putative protein HI_1053
703 LCTK01000006.1 GCA001008205_00430 CDS open 168856-169347 _na     163_aa rraA ribonuclease E activity regulator RraA
704 LCTK01000006.1 GCA001008205_00431 CDS open 169399-170310 _na     303_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
705 LCTK01000006.1 GCA001008205_00432 CDS open 170373-171092 _na     239_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
706 LCTK01000006.1 GCA001008205_00433 CDS open 171145-172089 _na     314_aa tehA dicarboxylate transporter/tellurite-resistance protein TehA
707 LCTK01000006.1 GCA001008205_00434 CDS open 172284-176534 _na     1416_aa rpoC DNA-directed RNA polymerase subunit beta'
708 LCTK01000006.1 GCA001008205_00435 CDS open 176660-180688 _na     1342_aa rpoB DNA-directed RNA polymerase subunit beta
709 LCTK01000006.1 GCA001008205_00436 CDS open 181070-181759 _na     229_aa rplA 50S ribosomal protein L1
710 LCTK01000006.1 GCA001008205_00437 CDS open 181764-182192 _na     142_aa rplK 50S ribosomal protein L11
711 LCTK01000006.1 GCA001008205_00438 CDS open 182365-183081 _na     238_aa deoD purine-nucleoside phosphorylase
712 LCTK01000006.1 GCA001008205_00439 CDS open 183151-184404 _na     417_aa nupC putative transporter HI_0519
713 LCTK01000006.1 GCA001008205_00440 CDS open 184504-185292 _na     262_aa pflA Putative glycyl-radical enzyme activating enzyme HI_0520
714 LCTK01000006.1 GCA001008205_00441 CDS open 185301-186845 _na     514_aa putative protein HI_0521
715 LCTK01000006.1 GCA001008205_00442 CDS open 187058-188098 _na     346_aa waaQ heptosyltransferase-like protein
716 LCTK01000006.1 GCA001008205_00443 CDS open 188165-189244 _na     359_aa fbaA class II fructose-bisphosphate aldolase
717 LCTK01000006.1 GCA001008205_00444 CDS open 189363-190523 _na     386_aa pgk phosphoglycerate kinase
718 LCTK01000006.1 GCA001008205_00445 CDS open 190619-191389 _na     256_aa Ribonuclease HI
719 LCTK01000006.1 GCA001008205_00446 CDS open 191467-191727 _na     86_aa yfhL YfhL family 4Fe-4S dicluster ferredoxin
720 LCTK01000006.1 GCA001008205_00447 CDS open 191871-193091 _na     406_aa tyrP-B Tyrosine-specific transport system 2
721 LCTK01000006.1 GCA001008205_00448 CDS open 193128-193709 _na     193_aa tdk thymidine kinase
722 LCTK01000006.1 GCA001008205_00449 CDS open 193718-194746 _na     342_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
723 LCTK01000006.1 GCA001008205_00450 CDS open 194978-195193 _na     71_aa rpsU 30S ribosomal protein S21
724 LCTK01000006.1 GCA001008205_00451 CDS open 195327-197108 _na     593_aa dnaG DNA primase
725 LCTK01000006.1 GCA001008205_00452 CDS open 197180-199063 _na     627_aa rpoD RNA polymerase sigma factor RpoD
726 LCTK01000006.1 GCA001008205_00453 CDS open 199165-199614 _na     149_aa rplI 50S ribosomal protein L9
727 LCTK01000006.1 GCA001008205_00454 CDS open 199631-199858 _na     75_aa rpsR 30S ribosomal protein S18
728 LCTK01000006.1 GCA001008205_00455 CDS open 199870-200196 _na     108_aa priB primosomal replication protein N
729 LCTK01000006.1 GCA001008205_00456 CDS open 200183-200560 _na     125_aa rpsF 30S ribosomal protein S6
730 LCTK01000006.1 GCA001008205_00457 CDS open 200763-200981 _na     72_aa infA translation initiation factor IF-1
731 LCTK01000006.1 GCA001008205_00458 CDS open 201187-202050 _na     287_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
732 LCTK01000006.1 GCA001008205_00459 CDS open 202066-202893 _na     275_aa apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
733 LCTK01000006.1 GCA001008205_00460 CDS open 202903-203526 _na     207_aa putative protein HI_0552
734 LCTK01000006.1 GCA001008205_00461 CDS open 203629-204963 _na     444_aa ndh Type II NADH:quinone oxidoreductase
735 LCTK01000006.1 GCA001008205_00462 CDS open 205004-205951 _na     315_aa rseB sigma-E factor regulatory protein RseB
736 LCTK01000006.1 GCA001008205_00463 CDS open 206037-206624 _na     195_aa rseA Anti-sigma-E factor RseA
737 LCTK01000006.1 GCA001008205_00464 CDS open 206642-207220 _na     192_aa rpoE RNA polymerase sigma factor RpoE
738 LCTK01000006.1 GCA001008205_00465 CDS open 207329-207586 _na     85_aa sdhE FAD assembly factor SdhE
739 LCTK01000006.1 GCA001008205_00466 CDS open 207681-208067 _na     128_aa mscL large-conductance mechanosensitive channel protein MscL
740 LCTK01000006.1 GCA001008205_00467 CDS open 208141-209517 _na     458_aa trkA Trk system potassium transporter TrkA
741 LCTK01000006.1 GCA001008205_00468 CDS open 209521-210324 _na     267_aa Glycosyltransferase%2C group 2 family protein
742 LCTK01000006.1 GCA001008205_00469 CDS open 210333-211685 _na     450_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
743 LCTK01000006.1 GCA001008205_00470 CDS open 211685-212641 _na     318_aa fmt methionyl-tRNA formyltransferase
744 LCTK01000006.1 GCA001008205_00471 CDS open 212717-213226 _na     169_aa def peptide deformylase
745 LCTK01000006.1 GCA001008205_00268 gene open 2-346 frdD
746 LCTK01000006.1 GCA001008205_00269 gene open 359-769 frdC
747 LCTK01000006.1 GCA001008205_00270 gene open 780-1550 frdB
748 LCTK01000006.1 GCA001008205_00271 gene open 1543-3411 frdA
749 LCTK01000006.1 GCA001008205_00272 gene open 3558-4529 epmA
750 LCTK01000006.1 GCA001008205_00273 gene open 4569-5882 cpxA
751 LCTK01000006.1 GCA001008205_00274 gene open 5965-6663
752 LCTK01000006.1 GCA001008205_00275 gene open 6721-7134 bamE
753 LCTK01000006.1 GCA001008205_00276 gene open 7199-8215 yejK
754 LCTK01000006.1 GCA001008205_00277 gene open 8344-8562 yejL
755 LCTK01000006.1 GCA001008205_00278 gene open 8564-10321 yejM
756 LCTK01000006.1 GCA001008205_00279 gene open 10519-11511 ssnA
757 LCTK01000006.1 GCA001008205_00280 gene open 11707-12270 acrR
758 LCTK01000006.1 GCA001008205_00281 gene open 12302-13498 acrA
759 LCTK01000006.1 GCA001008205_00282 gene open 13516-16596 acrB
760 LCTK01000006.1 GCA001008205_00283 gene open 16664-17308 adk
761 LCTK01000006.1 GCA001008205_00284 gene open 17393-18631
762 LCTK01000006.1 GCA001008205_00285 gene open 18810-19826 galE
763 LCTK01000006.1 GCA001008205_00286 gene open 19870-21117 rhlB
764 LCTK01000006.1 GCA001008205_00287 gene open 21234-21440 yacG
765 LCTK01000006.1 GCA001008205_00288 gene open 21433-22053 coaE
766 LCTK01000006.1 GCA001008205_00289 gene open 22163-22459
767 LCTK01000006.1 GCA001008205_00290 gene open 22456-23721 glyA
768 LCTK01000006.1 GCA001008205_00291 gene open 23837-24406
769 LCTK01000006.1 GCA001008205_00292 gene open 24470-25693
770 LCTK01000006.1 GCA001008205_00293 gene open 25718-27007 purD
771 LCTK01000006.1 GCA001008205_00294 gene open 27161-28759 purH
772 LCTK01000006.1 GCA001008205_00295 gene open 28941-29345 doxX
773 LCTK01000006.1 GCA001008205_00296 gene open 29457-31196 dsbD
774 LCTK01000006.1 GCA001008205_00297 gene open 31387-32097 arcA
775 LCTK01000006.1 GCA001008205_00298 gene open 32518-33888 alsT
776 LCTK01000006.1 GCA001008205_00299 gene open 34123-34446 hpf
777 LCTK01000006.1 GCA001008205_00300 gene open 34515-35831
778 LCTK01000006.1 GCA001008205_00301 gene open 35887-36630 menH
779 LCTK01000006.1 GCA001008205_00302 gene open 36692-38398 menD
780 LCTK01000006.1 GCA001008205_00303 gene open 38413-39684 menF
781 LCTK01000006.1 GCA001008205_00304 gene open 39841-41055 alaA
782 LCTK01000006.1 GCA001008205_00305 gene open 41152-41931 yggG
783 LCTK01000006.1 GCA001008205_00306 gene open 42052-43308 mtr
784 LCTK01000006.1 GCA001008205_00307 gene open 43374-44138 cfa
785 LCTK01000006.1 GCA001008205_00309 gene open 44316-45038 rpsB
786 LCTK01000006.1 GCA001008205_00310 gene open 45172-46023 tsf
787 LCTK01000006.1 GCA001008205_00311 gene open 46204-47229 lpxD
788 LCTK01000006.1 GCA001008205_00312 gene open 47242-47835 omp26
789 LCTK01000006.1 GCA001008205_00313 gene open 47946-49595 bamA
790 LCTK01000006.1 GCA001008205_00314 gene open 49561-50325 bamA
791 LCTK01000006.1 GCA001008205_00315 gene open 50345-51676 rseP
792 LCTK01000006.1 GCA001008205_00316 gene open 51686-52552 cdsA
793 LCTK01000006.1 GCA001008205_00317 gene open 52574-53293 uppS
794 LCTK01000006.1 GCA001008205_00318 gene open 53446-53733 yggU
795 LCTK01000006.1 GCA001008205_00319 gene open 53862-56447 leuS
796 LCTK01000006.1 GCA001008205_00320 gene open 56545-57048 lptE
797 LCTK01000006.1 GCA001008205_00321 gene open 57048-58082 holA
798 LCTK01000006.1 GCA001008205_00322 gene open 58169-58435
799 LCTK01000006.1 GCA001008205_00323 gene open 58484-58897 mutT
800 LCTK01000006.1 GCA001008205_00324 gene open 58962-61667 secA
801 LCTK01000006.1 GCA001008205_00325 gene open 61795-62097 secM
802 LCTK01000006.1 GCA001008205_00326 gene open 62176-62490
803 LCTK01000006.1 GCA001008205_00327 gene open 62524-63039 tadA
804 LCTK01000006.1 GCA001008205_00328 gene open 63039-63890 thyA
805 LCTK01000006.1 GCA001008205_00329 gene open 63901-64707 lgt
806 LCTK01000006.1 GCA001008205_00330 gene open 64716-65513
807 LCTK01000006.1 GCA001008205_00331 gene open 65513-66103 rppH
808 LCTK01000006.1 GCA001008205_00332 gene open 66629-67183 ampD
809 LCTK01000006.1 GCA001008205_00333 gene open 67298-67738 ppdD
810 LCTK01000006.1 GCA001008205_00334 gene open 67735-69129 hofB
811 LCTK01000006.1 GCA001008205_00335 gene open 69126-70346 hofC
812 LCTK01000006.1 GCA001008205_00336 gene open 70343-71035 hofD
813 LCTK01000006.1 GCA001008205_00337 gene open 71089-72351 rho
814 LCTK01000006.1 GCA001008205_00338 gene open 72599-72916 metJ
815 LCTK01000006.1 GCA001008205_00339 gene open 72930-73316
816 LCTK01000006.1 GCA001008205_00340 gene open 73393-73599 copZ
817 LCTK01000006.1 GCA001008205_00341 gene open 73574-75745 zntA
818 LCTK01000006.1 GCA001008205_00342 gene open 75968-77206 sdaC
819 LCTK01000006.1 GCA001008205_00343 gene open 77242-78609 sdaA
820 LCTK01000006.1 GCA001008205_00344 gene open 78908-80275
821 LCTK01000006.1 GCA001008205_00345 gene open 80316-80609
822 LCTK01000006.1 GCA001008205_00346 gene open 80620-81144
823 LCTK01000006.1 GCA001008205_00347 gene open 81259-82176 ccmI
824 LCTK01000006.1 GCA001008205_00348 gene open 82177-82638 nrfF
825 LCTK01000006.1 GCA001008205_00349 gene open 82638-83183 dsbE
826 LCTK01000006.1 GCA001008205_00350 gene open 83297-85243 ccmF
827 LCTK01000006.1 GCA001008205_00351 gene open 85240-85761 ccmE
828 LCTK01000006.1 GCA001008205_00352 gene open 85758-85961 ccmD
829 LCTK01000006.1 GCA001008205_00353 gene open 86004-86744 ccmC
830 LCTK01000006.1 GCA001008205_00354 gene open 86803-87468 ccmB
831 LCTK01000006.1 GCA001008205_00355 gene open 87473-88111 ccmA
832 LCTK01000006.1 GCA001008205_00356 gene open 88377-89024 sodA
833 LCTK01000006.1 GCA001008205_00357 gene open 89125-90075 cysK
834 LCTK01000006.1 GCA001008205_00358 gene open 90175-90993 cysZ
835 LCTK01000006.1 GCA001008205_00359 gene open 91146-92132 zipA
836 LCTK01000006.1 GCA001008205_00360 gene open 92243-94261 ligA
837 LCTK01000006.1 GCA001008205_00361 gene open 95121-95414 cas2
838 LCTK01000006.1 GCA001008205_00362 gene open 95418-96431 cas1c
839 LCTK01000006.1 GCA001008205_00363 gene open 96575-97516
840 LCTK01000006.1 GCA001008205_00364 gene open 97520-97783
841 LCTK01000006.1 GCA001008205_00365 gene open 97809-98465 cas4
842 LCTK01000006.1 GCA001008205_00366 gene open 98483-99349 cas7c
843 LCTK01000006.1 GCA001008205_00367 gene open 99361-101139 cas8c
844 LCTK01000006.1 GCA001008205_00368 gene open 101136-101816 cas5c
845 LCTK01000006.1 GCA001008205_00369 gene open 101979-103301
846 LCTK01000006.1 GCA001008205_00370 gene open 103398-105689
847 LCTK01000006.1 GCA001008205_00371 gene open 105815-107347 emrB
848 LCTK01000006.1 GCA001008205_00372 gene open 107357-108529 emrA
849 LCTK01000006.1 GCA001008205_00373 gene open 108707-109189 folA
850 LCTK01000006.1 GCA001008205_00374 gene open 109291-110394 proB
851 LCTK01000006.1 GCA001008205_00375 gene open 110508-111296 ftsN
852 LCTK01000006.1 GCA001008205_00376 gene open 111472-112074 napC
853 LCTK01000006.1 GCA001008205_00377 gene open 112089-112532 napB
854 LCTK01000006.1 GCA001008205_00378 gene open 112538-113401 napH
855 LCTK01000006.1 GCA001008205_00379 gene open 113401-114210 napG
856 LCTK01000006.1 GCA001008205_00380 gene open 114294-116777 napA
857 LCTK01000006.1 GCA001008205_00381 gene open 116933-117214 napD
858 LCTK01000006.1 GCA001008205_00382 gene open 117207-117737 napF
859 LCTK01000006.1 GCA001008205_00383 gene open 117952-118296 yggL
860 LCTK01000006.1 GCA001008205_00384 gene open 118414-119154 trmB
861 LCTK01000006.1 GCA001008205_00385 gene open 119239-121431 priA
862 LCTK01000006.1 GCA001008205_00386 gene open 121473-122519 perM
863 LCTK01000006.1 GCA001008205_00387 gene open 122519-122857 glnB
864 LCTK01000006.1 GCA001008205_00388 gene open 122859-123452 mog
865 LCTK01000006.1 GCA001008205_00389 gene open 123535-123891 dgkA
866 LCTK01000006.1 GCA001008205_00390 gene open 123906-126137 relA
867 LCTK01000006.1 GCA001008205_00391 gene open 126215-127531 rlmD
868 LCTK01000006.1 GCA001008205_00392 gene open 127531-128241 recO
869 LCTK01000006.1 GCA001008205_00393 gene open 128244-128648 oapB
870 LCTK01000006.1 GCA001008205_00394 gene open 128696-130063 oapA
871 LCTK01000006.1 GCA001008205_00395 gene open 130148-131164 epmB
872 LCTK01000006.1 GCA001008205_00396 gene open 131202-131768 efp
873 LCTK01000006.1 GCA001008205_00397 gene open 132427-133806 yegQ
874 LCTK01000006.1 GCA001008205_00398 gene open 133949-134374 ruvX
875 LCTK01000006.1 GCA001008205_00399 gene open 134374-134934
876 LCTK01000006.1 GCA001008205_00400 gene open 134931-135668 rsmE
877 LCTK01000006.1 GCA001008205_00401 gene open 135730-136455 fadR
878 LCTK01000006.1 GCA001008205_00402 gene open 136582-138126 nhaB
879 LCTK01000006.1 GCA001008205_00403 gene open 138136-138669 dsbB
880 LCTK01000006.1 GCA001008205_00404 gene open 138724-139200
881 LCTK01000006.1 GCA001008205_00405 gene open 139232-139972 pflA
882 LCTK01000006.1 GCA001008205_00406 gene open 140088-140378
883 LCTK01000006.1 GCA001008205_00407 gene open 140461-142773 pflB
884 LCTK01000006.1 GCA001008205_00408 gene open 142815-143669 focA
885 LCTK01000006.1 GCA001008205_00409 gene open 143955-145136 gsp
886 LCTK01000006.1 GCA001008205_00410 gene open 145137-145718
887 LCTK01000006.1 GCA001008205_00411 gene open 145731-146150
888 LCTK01000006.1 GCA001008205_00412 gene open 146184-146894
889 LCTK01000006.1 GCA001008205_00413 gene open 147034-148344 eno
890 LCTK01000006.1 GCA001008205_00414 gene open 148535-150172 pyrG
891 LCTK01000006.1 GCA001008205_00415 gene open 150359-151252 xerD
892 LCTK01000006.1 GCA001008205_00416 gene open 151283-152449 hcaT
893 LCTK01000006.1 GCA001008205_00417 gene open 152449-153264 proC
894 LCTK01000006.1 GCA001008205_00418 gene open 153330-154238 rdgC
895 LCTK01000006.1 GCA001008205_00419 gene open 154356-155681 srmB
896 LCTK01000006.1 GCA001008205_00420 gene open 155762-156460 trmN6
897 LCTK01000006.1 GCA001008205_00421 gene open 156503-159451
898 LCTK01000006.1 GCA001008205_00422 gene open 159705-160760
899 LCTK01000006.1 GCA001008205_00423 gene open 160906-162273 pssA
900 LCTK01000006.1 GCA001008205_00424 gene open 162650-163693 opsX
901 LCTK01000006.1 GCA001008205_00425 gene open 163770-164495 kdkA
902 LCTK01000006.1 GCA001008205_00426 gene open 164507-165094 orfM
903 LCTK01000006.1 GCA001008205_00427 gene open 165182-167026 mdlB
904 LCTK01000006.1 GCA001008205_00428 gene open 167105-168001 rhaS
905 LCTK01000006.1 GCA001008205_00429 gene open 168113-168454
906 LCTK01000006.1 GCA001008205_00430 gene open 168856-169347 rraA
907 LCTK01000006.1 GCA001008205_00431 gene open 169399-170310 menA
908 LCTK01000006.1 GCA001008205_00432 gene open 170373-171092 tsaA
909 LCTK01000006.1 GCA001008205_00433 gene open 171145-172089 tehA
910 LCTK01000006.1 GCA001008205_00434 gene open 172284-176534 rpoC
911 LCTK01000006.1 GCA001008205_00435 gene open 176660-180688 rpoB
912 LCTK01000006.1 GCA001008205_00436 gene open 181070-181759 rplA
913 LCTK01000006.1 GCA001008205_00437 gene open 181764-182192 rplK
914 LCTK01000006.1 GCA001008205_00438 gene open 182365-183081 deoD
915 LCTK01000006.1 GCA001008205_00439 gene open 183151-184404 nupC
916 LCTK01000006.1 GCA001008205_00440 gene open 184504-185292 pflA
917 LCTK01000006.1 GCA001008205_00441 gene open 185301-186845
918 LCTK01000006.1 GCA001008205_00442 gene open 187058-188098 waaQ
919 LCTK01000006.1 GCA001008205_00443 gene open 188165-189244 fbaA
920 LCTK01000006.1 GCA001008205_00444 gene open 189363-190523 pgk
921 LCTK01000006.1 GCA001008205_00445 gene open 190619-191389
922 LCTK01000006.1 GCA001008205_00446 gene open 191467-191727 yfhL
923 LCTK01000006.1 GCA001008205_00447 gene open 191871-193091 tyrP-B
924 LCTK01000006.1 GCA001008205_00448 gene open 193128-193709 tdk
925 LCTK01000006.1 GCA001008205_00449 gene open 193718-194746 tsaD
926 LCTK01000006.1 GCA001008205_00450 gene open 194978-195193 rpsU
927 LCTK01000006.1 GCA001008205_00451 gene open 195327-197108 dnaG
928 LCTK01000006.1 GCA001008205_00452 gene open 197180-199063 rpoD
929 LCTK01000006.1 GCA001008205_00453 gene open 199165-199614 rplI
930 LCTK01000006.1 GCA001008205_00454 gene open 199631-199858 rpsR
931 LCTK01000006.1 GCA001008205_00455 gene open 199870-200196 priB
932 LCTK01000006.1 GCA001008205_00456 gene open 200183-200560 rpsF
933 LCTK01000006.1 GCA001008205_00457 gene open 200763-200981 infA
934 LCTK01000006.1 GCA001008205_00458 gene open 201187-202050 rsmA
935 LCTK01000006.1 GCA001008205_00459 gene open 202066-202893 apaH
936 LCTK01000006.1 GCA001008205_00460 gene open 202903-203526
937 LCTK01000006.1 GCA001008205_00461 gene open 203629-204963 ndh
938 LCTK01000006.1 GCA001008205_00462 gene open 205004-205951 rseB
939 LCTK01000006.1 GCA001008205_00463 gene open 206037-206624 rseA
940 LCTK01000006.1 GCA001008205_00464 gene open 206642-207220 rpoE
941 LCTK01000006.1 GCA001008205_00465 gene open 207329-207586 sdhE
942 LCTK01000006.1 GCA001008205_00466 gene open 207681-208067 mscL
943 LCTK01000006.1 GCA001008205_00467 gene open 208141-209517 trkA
944 LCTK01000006.1 GCA001008205_00468 gene open 209521-210324
945 LCTK01000006.1 GCA001008205_00469 gene open 210333-211685 rsmB
946 LCTK01000006.1 GCA001008205_00470 gene open 211685-212641 fmt
947 LCTK01000006.1 GCA001008205_00471 gene open 212717-213226 def
948 LCTK01000007.1 GCA001008205_00487 gene open 11320-11685 ssrA
949 LCTK01000007.1 GCA001008205_00487 tmRNA open 11320-11685 ssrA transfer-messenger RNA%2C SsrA
950 LCTK01000007.1 GCA001008205_00473 CDS open 1755-2159 _na     134_aa zapG Z-ring associated protein G
951 LCTK01000007.1 GCA001008205_00474 CDS open 2190-2540 _na     116_aa ridA RutC family protein HI_1627
952 LCTK01000007.1 GCA001008205_00475 CDS open 2652-3368 _na     238_aa putative protein HI_1626
953 LCTK01000007.1 GCA001008205_00476 CDS open 3369-3911 _na     180_aa Beta-lactamase
954 LCTK01000007.1 GCA001008205_00477 CDS open 3925-4332 _na     135_aa zntR HTH-type transcriptional regulator ZntR-like protein
955 LCTK01000007.1 GCA001008205_00478 CDS open 4422-5105 _na     227_aa putative protein HI_1624
956 LCTK01000007.1 GCA001008205_00479 CDS open 5118-5603 _na     161_aa putative protein HI_1622
957 LCTK01000007.1 GCA001008205_00480 CDS open 5603-6223 _na     206_aa cbiM cobalt transporter CbiM
958 LCTK01000007.1 GCA001008205_00481 CDS open 6223-6855 _na     210_aa ecfT Aromatic-amino-acid aminotransferase
959 LCTK01000007.1 GCA001008205_00482 CDS open 6857-7474 _na     205_aa ecfA2 putative ABC transporter ATP-binding protein HI_1618
960 LCTK01000007.1 GCA001008205_00483 CDS open 7611-8420 _na     269_aa hypB hydrogenase nickel incorporation protein HypB
961 LCTK01000007.1 GCA001008205_00484 CDS open 8424-9536 _na     370_aa hypD hydrogenase formation protein HypD
962 LCTK01000007.1 GCA001008205_00485 CDS open 9538-10551 _na     337_aa hypE hydrogenase expression/formation protein HypE
963 LCTK01000007.1 GCA001008205_00486 CDS open 10767-11147 _na     126_aa Deoxyribonuclease V
964 LCTK01000007.1 GCA001008205_00488 CDS open 11858-12925 _na     355_aa dinB DNA polymerase IV
965 LCTK01000007.1 GCA001008205_00489 CDS open 12958-13494 _na     178_aa epmC Elongation factor P hydroxylase
966 LCTK01000007.1 GCA001008205_00490 CDS open 13585-14670 _na     361_aa prfA peptide chain release factor 1
967 LCTK01000007.1 GCA001008205_00491 CDS open 14723-15163 _na     146_aa yckC putative protein HI_1560
968 LCTK01000007.1 GCA001008205_00492 CDS open 15163-16041 _na     292_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
969 LCTK01000007.1 GCA001008205_00493 CDS open 16041-16844 _na     267_aa sirB1 Protein SirB1 N-terminal domain-containing protein
970 LCTK01000007.1 GCA001008205_00494 CDS open 16859-17713 _na     284_aa kdsA 2-dehydro-3-deoxyphosphooctonate aldolase
971 LCTK01000007.1 GCA001008205_00495 CDS open 17776-18723 _na     315_aa ldhA 2-hydroxyacid dehydrogenase
972 LCTK01000007.1 GCA001008205_00496 CDS open 18723-19904 _na     393_aa lolC lipoprotein-releasing ABC transporter permease subunit
973 LCTK01000007.1 GCA001008205_00497 CDS open 19926-21215 _na     429_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
974 LCTK01000007.1 GCA001008205_00498 CDS open 21224-22366 _na     380_aa bioF 8-amino-7-oxononanoate synthase
975 LCTK01000007.1 GCA001008205_00499 CDS open 22376-23023 _na     215_aa Dithiobiotin synthetase
976 LCTK01000007.1 GCA001008205_00500 CDS open 23011-23790 _na     259_aa bioC malonyl-ACP O-methyltransferase BioC
977 LCTK01000007.1 GCA001008205_00501 CDS open 23803-24444 _na     213_aa bioD dethiobiotin synthase
978 LCTK01000007.1 GCA001008205_00502 CDS open 24526-25209 _na     227_aa lolD lipoprotein-releasing ABC transporter ATP-binding protein LolD
979 LCTK01000007.1 GCA001008205_00503 CDS open 25209-26459 _na     416_aa lolE lipoprotein-releasing ABC transporter permease subunit LolE
980 LCTK01000007.1 GCA001008205_00504 CDS open 26677-27765 _na     362_aa aroG 3-deoxy-7-phosphoheptulonate synthase AroG
981 LCTK01000007.1 GCA001008205_00505 CDS open 28423-29613 _na     396_aa aspC Aspartate aminotransferase
982 LCTK01000007.1 GCA001008205_00506 CDS open 29753-30841 _na     362_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
983 LCTK01000007.1 GCA001008205_00507 CDS open 30911-31405 _na     164_aa N5-carboxyaminoimidazole ribonucleotide mutase
984 LCTK01000007.1 GCA001008205_00508 CDS open 31567-34176 _na     869_aa pepN aminopeptidase N
985 LCTK01000007.1 GCA001008205_00509 CDS open 34227-38576 _na     1449_aa site-specific DNA-methyltransferase (adenine-specific)
986 LCTK01000007.1 GCA001008205_00510 CDS open 39615-41885 _na     756_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
987 LCTK01000007.1 GCA001008205_00511 CDS open 42086-43678 _na     530_aa eptB Phosphoethanolamine transferase eptB
988 LCTK01000007.1 GCA001008205_00512 CDS open 43946-44965 _na     339_aa pyrD quinone-dependent dihydroorotate dehydrogenase
989 LCTK01000007.1 GCA001008205_00513 CDS open 44965-45789 _na     274_aa rnm RNase RNM
990 LCTK01000007.1 GCA001008205_00514 CDS open 45890-46498 _na     202_aa putative protein HI_1399
991 LCTK01000007.1 GCA001008205_00515 CDS open 46626-48020 _na     464_aa fumC class II fumarate hydratase
992 LCTK01000007.1 GCA001008205_00516 CDS open 48255-48689 _na     144_aa holC DNA polymerase III subunit chi
993 LCTK01000007.1 GCA001008205_00517 CDS open 48693-49661 _na     322_aa N(4)-acetylcytidine amidohydrolase
994 LCTK01000007.1 GCA001008205_00518 CDS open 49703-52567 _na     954_aa valS valine--tRNA ligase
995 LCTK01000007.1 GCA001008205_00519 CDS open 52627-53925 _na     432_aa Cytosine-specific methyltransferase
996 LCTK01000007.1 GCA001008205_00520 CDS open 53927-55801 _na     624_aa Restriction endonuclease
997 LCTK01000007.1 GCA001008205_00521 CDS open 55807-58107 _na     766_aa DUF2357 domain-containing protein
998 LCTK01000007.1 GCA001008205_00522 CDS open 58125-59405 _na     426_aa hipA Serine/threonine-protein kinase HipA
999 LCTK01000007.1 GCA001008205_00523 CDS open 59405-59683 _na     92_aa hipB Antitoxin HipB
1000 LCTK01000007.1 GCA001008205_00524 CDS open 59993-60268 _na     91_aa hybG hydrogenase maturation factor HybG