BAKTAGenome Explorer: Bifidobacterium scardovii (GCA_001042635.1)
Select a Genome:
|
BAKTA Annotations for GCA_001042635.1
|
Search & Sort all 5214 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AP012331.1 | GCA001042635_01848 | gene | open | 2181798-2182191 | ssrA | ||
| 2 | AP012331.1 | GCA001042635_01848 | tmRNA | open | 2181798-2182191 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | AP012331.1 | rep_origin | open | 1552-2135 | ||||
| 4 | AP012331.1 | GCA001042635_00622 | gene | open | 721639-723163 | rrs | ||
| 5 | AP012331.1 | GCA001042635_00623 | gene | open | 723620-726694 | rrl | ||
| 6 | AP012331.1 | GCA001042635_00624 | gene | open | 726867-726983 | rrf | ||
| 7 | AP012331.1 | GCA001042635_01273 | gene | open | 1501653-1503177 | rrs | ||
| 8 | AP012331.1 | GCA001042635_01274 | gene | open | 1503634-1506708 | rrl | ||
| 9 | AP012331.1 | GCA001042635_01275 | gene | open | 1506881-1506997 | rrf | ||
| 10 | AP012331.1 | GCA001042635_01726 | gene | open | 2022497-2022868 | RNaseP_bact_a | ||
| 11 | AP012331.1 | GCA001042635_02331 | gene | open | 2782983-2783079 | Bacteria_small_SRP | ||
| 12 | AP012331.1 | GCA001042635_02387 | gene | open | 2855694-2855986 | 5_ureB_sRNA | ||
| 13 | AP012331.1 | GCA001042635_02543 | gene | open | 3076837-3076953 | rrf | ||
| 14 | AP012331.1 | GCA001042635_02544 | gene | open | 3077126-3080200 | rrl | ||
| 15 | AP012331.1 | GCA001042635_02545 | gene | open | 3080657-3082181 | rrs | ||
| 16 | AP012331.1 | GCA001042635_01726 | ncRNA | open | 2022497-2022868 | Bacterial RNase P class A | ||
| 17 | AP012331.1 | GCA001042635_02331 | ncRNA | open | 2782983-2783079 | Bacterial small signal recognition particle RNA | ||
| 18 | AP012331.1 | GCA001042635_02387 | ncRNA | open | 2855694-2855986 | 5' ureB small RNA | ||
| 19 | AP012331.1 | regulatory_region | open | 225032-225135 | TPP riboswitch aptamer (THI element) | |||
| 20 | AP012331.1 | regulatory_region | open | 717202-717301 | TPP riboswitch aptamer (THI element) | |||
| 21 | AP012331.1 | regulatory_region | open | 769739-769783 | L31-Actinobacteria ribosomal protein leader | |||
| 22 | AP012331.1 | regulatory_region | open | 995320-995391 | Fluoride riboswitch aptamer (crcB RNA motif) | |||
| 23 | AP012331.1 | regulatory_region | open | 1250847-1250950 | TPP riboswitch aptamer (THI element) | |||
| 24 | AP012331.1 | regulatory_region | open | 1258541-1258690 | FMN riboswitch aptamer (RFN element) | |||
| 25 | AP012331.1 | regulatory_region | open | 1393127-1393225 | TPP riboswitch aptamer (THI element) | |||
| 26 | AP012331.1 | regulatory_region | open | 2269668-2269775 | TPP riboswitch aptamer (THI element) | |||
| 27 | AP012331.1 | regulatory_region | open | 2592646-2592802 | M-box riboswitch aptamer (ykoK leader) | |||
| 28 | AP012331.1 | regulatory_region | open | 3112108-3112166 | msiK RNA | |||
| 29 | AP012331.1 | GCA001042635_00622 | rRNA | open | 721639-723163 | rrs | 16S ribosomal RNA | |
| 30 | AP012331.1 | GCA001042635_00623 | rRNA | open | 723620-726694 | rrl | 23S ribosomal RNA | |
| 31 | AP012331.1 | GCA001042635_00624 | rRNA | open | 726867-726983 | rrf | 5S ribosomal RNA | |
| 32 | AP012331.1 | GCA001042635_01273 | rRNA | open | 1501653-1503177 | rrs | 16S ribosomal RNA | |
| 33 | AP012331.1 | GCA001042635_01274 | rRNA | open | 1503634-1506708 | rrl | 23S ribosomal RNA | |
| 34 | AP012331.1 | GCA001042635_01275 | rRNA | open | 1506881-1506997 | rrf | 5S ribosomal RNA | |
| 35 | AP012331.1 | GCA001042635_02543 | rRNA | open | 3076837-3076953 | rrf | 5S ribosomal RNA | |
| 36 | AP012331.1 | GCA001042635_02544 | rRNA | open | 3077126-3080200 | rrl | 23S ribosomal RNA | |
| 37 | AP012331.1 | GCA001042635_02545 | rRNA | open | 3080657-3082181 | rrs | 16S ribosomal RNA | |
| 38 | AP012331.1 | repeat_region | open | 2307004-2307167 | CRISPR array with 3 repeats of length 31%2C consensus sequence ACGGATCATCCCCGCGCGTGCGGGGCCAACC and spacer length 30 | |||
| 39 | AP012331.1 | repeat_region | open | 2307371-2308813 | CRISPR array with 24 repeats of length 29%2C consensus sequence CGGATCATCCCCGCGCGTGCGGGGCCAAC and spacer length 32 | |||
| 40 | AP012331.1 | repeat_region | open | 2323970-2324801 | CRISPR array with 14 repeats of length 29%2C consensus sequence CGGATCATCCCCGCGCATGCGGGGTAAAC and spacer length 32 | |||
| 41 | AP012331.1 | GCA001042635_00001 | CDS | open | 1-1551 | _na 516_aa | dnaA | chromosomal replication initiator protein DnaA |
| 42 | AP012331.1 | GCA001042635_00002 | CDS | open | 2136-3260 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 43 | AP012331.1 | GCA001042635_00003 | CDS | open | 3396-4775 | _na 459_aa | recF | DNA replication/repair protein RecF |
| 44 | AP012331.1 | GCA001042635_00004 | CDS | open | 4772-5251 | _na 159_aa | Zn-ribbon-containing RNA-binding protein | |
| 45 | AP012331.1 | GCA001042635_00005 | CDS | open | 5417-7495 | _na 692_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 46 | AP012331.1 | GCA001042635_00006 | CDS | open | 7705-10470 | _na 921_aa | gyrA | DNA gyrase subunit A |
| 47 | AP012331.1 | GCA001042635_00007 | CDS | open | 10657-11259 | _na 200_aa | Membrane protein | |
| 48 | AP012331.1 | GCA001042635_00008 | CDS | open | 11330-12373 | _na 347_aa | lacI | Regulatory protein%2C LacI |
| 49 | AP012331.1 | GCA001042635_00009 | CDS | open | 12686-14014 | _na 442_aa | MalE-type ABC sugar transport system periplasmic component | |
| 50 | AP012331.1 | GCA001042635_00010 | CDS | open | 14024-15010 | _na 328_aa | Family 43 glycoside hydrolase | |
| 51 | AP012331.1 | GCA001042635_00011 | CDS | open | 15151-16083 | _na 310_aa | ABC transporter permease | |
| 52 | AP012331.1 | GCA001042635_00012 | CDS | open | 16100-17098 | _na 332_aa | Sugars ABC transporter%2C permease protein | |
| 53 | AP012331.1 | GCA001042635_00013 | CDS | open | 17368-17481 | _na 37_aa | hypothetical protein | |
| 54 | AP012331.1 | GCA001042635_00014 | CDS | open | 17626-18552 | _na 308_aa | ABC transporter permease | |
| 55 | AP012331.1 | GCA001042635_00015 | CDS | open | 18653-19642 | _na 329_aa | Sugar ABC transporter permease | |
| 56 | AP012331.1 | GCA001042635_00016 | CDS | open | 19983-20948 | _na 321_aa | Glycosyl hydrolase family 43 protein | |
| 57 | AP012331.1 | GCA001042635_00017 | CDS | open | 21449-22495 | _na 348_aa | celR | Transcription regulator CelR |
| 58 | AP012331.1 | GCA001042635_00018 | CDS | open | 22621-23958 | _na 445_aa | ABC transporter substrate-binding protein | |
| 59 | AP012331.1 | GCA001042635_00019 | CDS | open | 24230-25909 | _na 559_aa | Cell surface protein fimafimbrial subunit | |
| 60 | AP012331.1 | GCA001042635_00020 | CDS | open | 26089-27099 | _na 336_aa | Sortase | |
| 61 | AP012331.1 | GCA001042635_00021 | CDS | open | 27292-28443 | _na 383_aa | Putative lysophospholipase | |
| 62 | AP012331.1 | GCA001042635_00022 | CDS | open | 28659-30005 | _na 448_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 63 | AP012331.1 | GCA001042635_00023 | CDS | open | 30177-30899 | _na 240_aa | Putative HTH-type transcriptional regulator | |
| 64 | AP012331.1 | GCA001042635_00024 | CDS | open | 31070-31582 | _na 170_aa | Gluconokinase | |
| 65 | AP012331.1 | GCA001042635_00025 | CDS | open | 31685-33013 | _na 442_aa | Gluconate transporter | |
| 66 | AP012331.1 | GCA001042635_00026 | CDS | open | 33073-33948 | _na 291_aa | gnd | phosphogluconate dehydrogenase (NAD(+)-dependent%2C decarboxylating) |
| 67 | AP012331.1 | GCA001042635_00027 | CDS | open | 34201-34647 | _na 148_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 68 | AP012331.1 | GCA001042635_00030 | CDS | open | 35188-35898 | _na 236_aa | Metal-dependent hydrolase | |
| 69 | AP012331.1 | GCA001042635_00031 | CDS | open | 36179-37840 | _na 553_aa | Dipeptide-binding ABC transporter%2C periplasmic substrate-binding component | |
| 70 | AP012331.1 | GCA001042635_00032 | CDS | open | 37984-39297 | _na 437_aa | ATPase AAA | |
| 71 | AP012331.1 | GCA001042635_00033 | CDS | open | 39790-40845 | _na 351_aa | Sugar-binding protein | |
| 72 | AP012331.1 | GCA001042635_00034 | CDS | open | 41020-42234 | _na 404_aa | Anhydro-N-acetylmuramic acid kinase | |
| 73 | AP012331.1 | GCA001042635_00035 | CDS | open | 42358-43878 | _na 506_aa | rbsA | Ribose transport ATP-binding protein RbsA |
| 74 | AP012331.1 | GCA001042635_00036 | CDS | open | 43975-44985 | _na 336_aa | rbsC | Ribose transporter permease RbsC |
| 75 | AP012331.1 | GCA001042635_00037 | CDS | open | 45191-46162 | _na 323_aa | rbsB | D-ribose-binding protein RbsB |
| 76 | AP012331.1 | GCA001042635_00038 | CDS | open | 46319-46798 | _na 159_aa | dps | Ferritin/DPS protein domain-containing protein |
| 77 | AP012331.1 | GCA001042635_00039 | CDS | open | 46951-48246 | _na 431_aa | Hemolysins and related protein containing CBS domain | |
| 78 | AP012331.1 | GCA001042635_00040 | CDS | open | 48367-49437 | _na 356_aa | lacI | LacI family transcriptional regulator |
| 79 | AP012331.1 | GCA001042635_00041 | CDS | open | 49776-50483 | _na 235_aa | Signal peptide protein | |
| 80 | AP012331.1 | GCA001042635_00042 | CDS | open | 50620-51651 | _na 343_aa | extracellular solute-binding protein | |
| 81 | AP012331.1 | GCA001042635_00043 | CDS | open | 51693-52154 | _na 153_aa | hypothetical protein | |
| 82 | AP012331.1 | GCA001042635_00044 | CDS | open | 52220-52483 | _na 87_aa | hypothetical protein | |
| 83 | AP012331.1 | GCA001042635_00045 | CDS | open | 52588-53430 | _na 280_aa | hypothetical protein | |
| 84 | AP012331.1 | GCA001042635_00046 | CDS | open | 53427-53987 | _na 186_aa | hypothetical protein | |
| 85 | AP012331.1 | GCA001042635_00047 | CDS | open | 54030-54713 | _na 227_aa | Carbonic anhydrase | |
| 86 | AP012331.1 | GCA001042635_00048 | CDS | open | 54979-55542 | _na 187_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 87 | AP012331.1 | GCA001042635_00049 | CDS | open | 55711-57624 | _na 637_aa | FAD-dependent pyridine nucleotide-disulfide oxidoreductase | |
| 88 | AP012331.1 | GCA001042635_00050 | CDS | open | 57723-58067 | _na 114_aa | rhuM | RhuM family protein |
| 89 | AP012331.1 | GCA001042635_00051 | CDS | open | 58067-58753 | _na 228_aa | rhuM | RhuM family protein |
| 90 | AP012331.1 | GCA001042635_00052 | CDS | open | 59169-60449 | _na 426_aa | Inner membrane protein | |
| 91 | AP012331.1 | GCA001042635_00053 | CDS | open | 60979-63738 | _na 919_aa | Phosphoenolpyruvate carboxylase | |
| 92 | AP012331.1 | GCA001042635_00054 | CDS | open | 64056-66014 | _na 652_aa | Membrane protein | |
| 93 | AP012331.1 | GCA001042635_00055 | CDS | open | 66150-66902 | _na 250_aa | DUF559 domain-containing protein | |
| 94 | AP012331.1 | GCA001042635_00056 | CDS | open | 67095-67520 | _na 141_aa | SnoaL-like domain protein | |
| 95 | AP012331.1 | GCA001042635_00057 | CDS | open | 67601-68701 | _na 366_aa | trpS | tryptophan--tRNA ligase |
| 96 | AP012331.1 | GCA001042635_00058 | CDS | open | 68843-69247 | _na 134_aa | DUF3073 domain-containing protein | |
| 97 | AP012331.1 | GCA001042635_00059 | CDS | open | 69328-69774 | _na 148_aa | Bacterial SCP orthologue domain-containing protein | |
| 98 | AP012331.1 | GCA001042635_00060 | CDS | open | 70173-72629 | _na 818_aa | Alpha-1%2C4 glucan phosphorylase | |
| 99 | AP012331.1 | GCA001042635_00061 | CDS | open | 73144-73362 | _na 72_aa | Secreted protein | |
| 100 | AP012331.1 | GCA001042635_00062 | CDS | open | 73620-74432 | _na 270_aa | Rhomboid family protein | |
| 101 | AP012331.1 | GCA001042635_00063 | CDS | open | 74923-76698 | _na 591_aa | DNA methyltransferase | |
| 102 | AP012331.1 | GCA001042635_00064 | CDS | open | 76863-77321 | _na 152_aa | crgA | cell division protein CrgA |
| 103 | AP012331.1 | GCA001042635_00065 | CDS | open | 77421-78209 | _na 262_aa | Membrane spanning protein | |
| 104 | AP012331.1 | GCA001042635_00066 | CDS | open | 78230-79435 | _na 401_aa | Sortase | |
| 105 | AP012331.1 | GCA001042635_00067 | CDS | open | 79748-80392 | _na 214_aa | Para-aminobenzoate synthase glutamine amidotransferase component II | |
| 106 | AP012331.1 | GCA001042635_00068 | CDS | open | 80601-82766 | _na 721_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 107 | AP012331.1 | GCA001042635_00069 | CDS | open | 82763-83782 | _na 339_aa | non-specific serine/threonine protein kinase | |
| 108 | AP012331.1 | GCA001042635_00070 | CDS | open | 83779-85242 | _na 487_aa | Penicillin-binding protein transpeptidase | |
| 109 | AP012331.1 | GCA001042635_00071 | CDS | open | 85239-86627 | _na 462_aa | ftsW | Cell division protein FtsW |
| 110 | AP012331.1 | GCA001042635_00072 | CDS | open | 86630-88303 | _na 557_aa | Phosphoprotein phosphatase | |
| 111 | AP012331.1 | GCA001042635_00073 | CDS | open | 88311-88847 | _na 178_aa | FHA domain containing protein | |
| 112 | AP012331.1 | GCA001042635_00074 | CDS | open | 88873-89574 | _na 233_aa | Signal peptide protein | |
| 113 | AP012331.1 | GCA001042635_00075 | CDS | open | 89845-92367 | _na 840_aa | Peptidase | |
| 114 | AP012331.1 | GCA001042635_00076 | CDS | open | 93686-94789 | _na 367_aa | lacI | LacI family transcriptional regulator |
| 115 | AP012331.1 | GCA001042635_00077 | CDS | open | 95454-96839 | _na 461_aa | ABC transporter substrate-binding protein | |
| 116 | AP012331.1 | GCA001042635_00078 | CDS | open | 96971-97912 | _na 313_aa | Binding-protein-dependent transport system inner membrane protein | |
| 117 | AP012331.1 | GCA001042635_00079 | CDS | open | 97912-98889 | _na 325_aa | Binding-protein-dependent transport system inner membrane protein | |
| 118 | AP012331.1 | GCA001042635_00080 | CDS | open | 99138-100034 | _na 298_aa | Family 43 glycoside hydrolase | |
| 119 | AP012331.1 | GCA001042635_00081 | CDS | open | 100347-103079 | _na 910_aa | Phage infection protein | |
| 120 | AP012331.1 | GCA001042635_00082 | CDS | open | 103076-105400 | _na 774_aa | Membrane protein | |
| 121 | AP012331.1 | GCA001042635_00083 | CDS | open | 105679-106587 | _na 302_aa | pldB | PldB Lysophospholipase |
| 122 | AP012331.1 | GCA001042635_00084 | CDS | open | 106802-107257 | _na 151_aa | Putative Hsp20 family chaperone | |
| 123 | AP012331.1 | GCA001042635_00085 | CDS | open | 107634-108002 | _na 122_aa | yccF | YccF domain-containing protein |
| 124 | AP012331.1 | GCA001042635_00086 | CDS | open | 108207-109523 | _na 438_aa | Aminotransferase | |
| 125 | AP012331.1 | GCA001042635_00087 | CDS | open | 109669-110745 | _na 358_aa | Glycerol dehydrogenase | |
| 126 | AP012331.1 | GCA001042635_00088 | CDS | open | 111099-111968 | _na 289_aa | Lipoprotein | |
| 127 | AP012331.1 | GCA001042635_00089 | CDS | open | 112056-112736 | _na 226_aa | ABC transporter permease | |
| 128 | AP012331.1 | GCA001042635_00090 | CDS | open | 112733-113848 | _na 371_aa | Methionine ABC transporter ATP-binding protein | |
| 129 | AP012331.1 | GCA001042635_00091 | CDS | open | 113939-115105 | _na 388_aa | bdhA | BdhA NADH-dependent butanol dehydrogenase |
| 130 | AP012331.1 | GCA001042635_00092 | CDS | open | 115102-115656 | _na 184_aa | Putative transmembrane protein | |
| 131 | AP012331.1 | GCA001042635_00093 | CDS | open | 116030-116380 | _na 116_aa | Membrane protein | |
| 132 | AP012331.1 | GCA001042635_00094 | CDS | open | 116455-117411 | _na 318_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 133 | AP012331.1 | GCA001042635_00095 | CDS | open | 117408-118076 | _na 222_aa | Flavin-nucleotide-binding protein | |
| 134 | AP012331.1 | GCA001042635_00096 | CDS | open | 118171-119073 | _na 300_aa | Glycosyltransferase%2C group 2 family protein | |
| 135 | AP012331.1 | GCA001042635_00097 | CDS | open | 119077-122295 | _na 1072_aa | Helicase | |
| 136 | AP012331.1 | GCA001042635_00098 | CDS | open | 122360-122773 | _na 137_aa | 8-oxo-dGTP diphosphatase | |
| 137 | AP012331.1 | GCA001042635_00099 | CDS | open | 122977-123309 | _na 110_aa | putative heavy metal-binding protein | |
| 138 | AP012331.1 | GCA001042635_00100 | CDS | open | 123735-124103 | _na 122_aa | Zn-dependent protease | |
| 139 | AP012331.1 | GCA001042635_00101 | CDS | open | 124218-124667 | _na 149_aa | Acetyltransferase (GNAT) family | |
| 140 | AP012331.1 | GCA001042635_00102 | CDS | open | 124728-125720 | _na 330_aa | Hly-III family protein | |
| 141 | AP012331.1 | GCA001042635_00103 | CDS | open | 125932-126720 | _na 262_aa | Aminoglycoside phosphotransferase | |
| 142 | AP012331.1 | GCA001042635_00104 | CDS | open | 127367-127630 | _na 87_aa | hypothetical protein | |
| 143 | AP012331.1 | GCA001042635_00105 | CDS | open | 127734-127919 | _na 61_aa | Transposase | |
| 144 | AP012331.1 | GCA001042635_00106 | CDS | open | 128069-129220 | _na 383_aa | phage major capsid protein | |
| 145 | AP012331.1 | GCA001042635_00107 | CDS | open | 129226-129360 | _na 44_aa | Transposase | |
| 146 | AP012331.1 | GCA001042635_00108 | CDS | open | 129584-129964 | _na 126_aa | hypothetical protein | |
| 147 | AP012331.1 | GCA001042635_00109 | CDS | open | 130219-130521 | _na 100_aa | hypothetical protein | |
| 148 | AP012331.1 | GCA001042635_00110 | CDS | open | 130523-130717 | _na 64_aa | hypothetical protein | |
| 149 | AP012331.1 | GCA001042635_00111 | CDS | open | 130943-132307 | _na 454_aa | dnaB | DnaB domain-containing protein helicase domain-containing protein |
| 150 | AP012331.1 | GCA001042635_00112 | CDS | open | 132304-132537 | _na 77_aa | hypothetical protein | |
| 151 | AP012331.1 | GCA001042635_00113 | CDS | open | 132718-132945 | _na 75_aa | DNA-binding protein | |
| 152 | AP012331.1 | GCA001042635_00114 | CDS | open | 132942-133157 | _na 71_aa | Helix-turn-helix domain-containing protein | |
| 153 | AP012331.1 | GCA001042635_00115 | CDS | open | 133300-133908 | _na 202_aa | Putative DNA binding protein | |
| 154 | AP012331.1 | GCA001042635_00116 | CDS | open | 133912-135003 | _na 363_aa | Phage integrase | |
| 155 | AP012331.1 | GCA001042635_00118 | CDS | open | 135812-136243 | _na 143_aa | Transposase | |
| 156 | AP012331.1 | GCA001042635_00119 | CDS | open | 136240-136560 | _na 106_aa | Putative transposase | |
| 157 | AP012331.1 | GCA001042635_00120 | CDS | open | 136916-138550 | _na 544_aa | Gamma-glutamyltransferase | |
| 158 | AP012331.1 | GCA001042635_00121 | CDS | open | 138653-139954 | _na 433_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 159 | AP012331.1 | GCA001042635_00122 | CDS | open | 140386-142407 | _na 673_aa | Peptidase | |
| 160 | AP012331.1 | GCA001042635_00123 | CDS | open | 142796-145153 | _na 785_aa | E1-E2 ATPase | |
| 161 | AP012331.1 | GCA001042635_00124 | CDS | open | 145392-146843 | _na 483_aa | gltD | ferredoxin--NADP(+) reductase |
| 162 | AP012331.1 | GCA001042635_00125 | CDS | open | 147144-148283 | _na 379_aa | Autolysin | |
| 163 | AP012331.1 | GCA001042635_00126 | CDS | open | 148360-149307 | _na 315_aa | htpX | zinc metalloprotease HtpX |
| 164 | AP012331.1 | GCA001042635_00127 | CDS | open | 149304-150221 | _na 305_aa | Transcriptional regulator | |
| 165 | AP012331.1 | GCA001042635_00128 | CDS | open | 150433-151473 | _na 346_aa | ABC Fe(3 ) transporter | |
| 166 | AP012331.1 | GCA001042635_00129 | CDS | open | 151463-153109 | _na 548_aa | ABC transporter permease | |
| 167 | AP012331.1 | GCA001042635_00130 | CDS | open | 153112-154260 | _na 382_aa | ABC transporter ATP-binding protein | |
| 168 | AP012331.1 | GCA001042635_00131 | CDS | open | 154322-155995 | _na 557_aa | Phosphoesterase | |
| 169 | AP012331.1 | GCA001042635_00133 | CDS | open | 156436-157074 | _na 212_aa | mug | Uracil-DNA glycosylase |
| 170 | AP012331.1 | GCA001042635_00134 | CDS | open | 157245-158450 | _na 401_aa | Oligosaccharide deacetylase | |
| 171 | AP012331.1 | GCA001042635_00135 | CDS | open | 158927-160024 | _na 365_aa | fbaA | class II fructose-bisphosphate aldolase |
| 172 | AP012331.1 | GCA001042635_00136 | CDS | open | 160130-161416 | _na 428_aa | purA | adenylosuccinate synthase |
| 173 | AP012331.1 | GCA001042635_00137 | CDS | open | 161747-162517 | _na 256_aa | fluC | Fluoride-specific ion channel FluC |
| 174 | AP012331.1 | GCA001042635_00138 | CDS | open | 162514-162888 | _na 124_aa | fluC | Fluoride-specific ion channel FluC |
| 175 | AP012331.1 | GCA001042635_00139 | CDS | open | 163085-164233 | _na 382_aa | lacI | LacI family transcriptional regulator |
| 176 | AP012331.1 | GCA001042635_00140 | CDS | open | 164916-166436 | _na 506_aa | gtfA | sucrose phosphorylase |
| 177 | AP012331.1 | GCA001042635_00141 | CDS | open | 166617-168371 | _na 584_aa | Transport protein | |
| 178 | AP012331.1 | GCA001042635_00142 | CDS | open | 168881-170245 | _na 454_aa | proP | Transmembrane transport protein possibly for shikimate |
| 179 | AP012331.1 | GCA001042635_00143 | CDS | open | 170472-171524 | _na 350_aa | ilvC | ketol-acid reductoisomerase |
| 180 | AP012331.1 | GCA001042635_00144 | CDS | open | 171832-172974 | _na 380_aa | Sel1 domain-containing protein | |
| 181 | AP012331.1 | GCA001042635_00145 | CDS | open | 173384-174436 | _na 350_aa | ilvC | ketol-acid reductoisomerase |
| 182 | AP012331.1 | GCA001042635_00146 | CDS | open | 174878-175405 | _na 175_aa | Nucleoside deoxyribosyltransferase | |
| 183 | AP012331.1 | GCA001042635_00147 | CDS | open | 175696-177597 | _na 633_aa | Sialic acidspecific 9-O-acetylesterase | |
| 184 | AP012331.1 | GCA001042635_00148 | CDS | open | 177654-178958 | _na 434_aa | RnfABCDGE type electron transport complex subunit D | |
| 185 | AP012331.1 | GCA001042635_00149 | CDS | open | 179377-180768 | _na 463_aa | GH1 family beta-glucosidase | |
| 186 | AP012331.1 | GCA001042635_00150 | CDS | open | 180915-182948 | _na 677_aa | Beta-galactosidase | |
| 187 | AP012331.1 | GCA001042635_00151 | CDS | open | 183635-185500 | _na 621_aa | ABC transporter | |
| 188 | AP012331.1 | GCA001042635_00152 | CDS | open | 186042-187436 | _na 464_aa | Sugar ABC transporter substrate-binding protein | |
| 189 | AP012331.1 | GCA001042635_00153 | CDS | open | 187590-188639 | _na 349_aa | Sugar ABC transporter permease | |
| 190 | AP012331.1 | GCA001042635_00154 | CDS | open | 188636-189532 | _na 298_aa | Sugar ABC transporter permease | |
| 191 | AP012331.1 | GCA001042635_00155 | CDS | open | 189660-192350 | _na 896_aa | beta-mannosidase | |
| 192 | AP012331.1 | GCA001042635_00156 | CDS | open | 192456-193481 | _na 341_aa | lacI | Bacterial regulatory protein%2C LacI family |
| 193 | AP012331.1 | GCA001042635_00157 | CDS | open | 193558-194223 | _na 221_aa | Transferase | |
| 194 | AP012331.1 | GCA001042635_00158 | CDS | open | 194320-195090 | _na 256_aa | hypothetical protein | |
| 195 | AP012331.1 | GCA001042635_00159 | CDS | open | 195212-197395 | _na 727_aa | yicI | alpha-xylosidase |
| 196 | AP012331.1 | GCA001042635_00160 | CDS | open | 197447-199171 | _na 574_aa | alpha-galactosidase | |
| 197 | AP012331.1 | GCA001042635_00161 | CDS | open | 199168-199710 | _na 180_aa | alpha-galactosidase | |
| 198 | AP012331.1 | GCA001042635_00162 | CDS | open | 199859-201028 | _na 389_aa | Mannosidase | |
| 199 | AP012331.1 | GCA001042635_00163 | CDS | open | 201372-203864 | _na 830_aa | Alpha-galactosidase | |
| 200 | AP012331.1 | GCA001042635_00164 | CDS | open | 204635-205909 | _na 424_aa | Beta-lactamase | |
| 201 | AP012331.1 | GCA001042635_00165 | CDS | open | 206144-208531 | _na 795_aa | Mannan endo-1%2C4-beta-mannosidase | |
| 202 | AP012331.1 | GCA001042635_00166 | CDS | open | 208889-212740 | _na 1283_aa | Beta-galactosidase | |
| 203 | AP012331.1 | GCA001042635_00167 | CDS | open | 212837-213991 | _na 384_aa | araC | AraC family transcriptional regulator |
| 204 | AP012331.1 | GCA001042635_00168 | CDS | open | 214009-215487 | _na 492_aa | Amino acid permease | |
| 205 | AP012331.1 | GCA001042635_00169 | CDS | open | 215640-216209 | _na 189_aa | Acrr-type transcriptional regulator | |
| 206 | AP012331.1 | GCA001042635_00170 | CDS | open | 216531-217232 | _na 233_aa | lolD | ABC transporter ATP-binding protein |
| 207 | AP012331.1 | GCA001042635_00171 | CDS | open | 217241-220747 | _na 1168_aa | ABC transporter permease | |
| 208 | AP012331.1 | GCA001042635_00172 | CDS | open | 221057-222607 | _na 516_aa | Amino acid transport protein | |
| 209 | AP012331.1 | GCA001042635_00173 | CDS | open | 222823-223716 | _na 297_aa | Thiazole synthase | |
| 210 | AP012331.1 | GCA001042635_00174 | CDS | open | 223769-224494 | _na 241_aa | thiF | sulfur carrier protein ThiS adenylyltransferase ThiF |
| 211 | AP012331.1 | GCA001042635_00175 | CDS | open | 224500-224694 | _na 64_aa | thiS | sulfur carrier protein ThiS |
| 212 | AP012331.1 | GCA001042635_00176 | CDS | open | 225269-226255 | _na 328_aa | Putative oxidoreductase | |
| 213 | AP012331.1 | GCA001042635_00177 | CDS | open | 226268-226495 | _na 75_aa | hypothetical protein | |
| 214 | AP012331.1 | GCA001042635_00178 | CDS | open | 226906-227433 | _na 175_aa | Putative MarR-type transcriptional regulator | |
| 215 | AP012331.1 | GCA001042635_00179 | CDS | open | 227705-229576 | _na 623_aa | mdlB | ABC-type multidrug transport system%2C ATPase and permease component |
| 216 | AP012331.1 | GCA001042635_00180 | CDS | open | 229708-231543 | _na 611_aa | mdlB | ATP-binding and permease protein of ABC transporter system |
| 217 | AP012331.1 | GCA001042635_00181 | CDS | open | 231521-232525 | _na 334_aa | lacI | LacI family transcriptional regulator |
| 218 | AP012331.1 | GCA001042635_00182 | CDS | open | 233069-234424 | _na 451_aa | Sugar ABC transporter substrate-binding protein | |
| 219 | AP012331.1 | GCA001042635_00183 | CDS | open | 234607-235563 | _na 318_aa | ABC transporter permease | |
| 220 | AP012331.1 | GCA001042635_00184 | CDS | open | 235560-236441 | _na 293_aa | Sugar ABC transporter permease | |
| 221 | AP012331.1 | GCA001042635_00185 | CDS | open | 236904-237986 | _na 360_aa | FAD:protein FMN transferase | |
| 222 | AP012331.1 | GCA001042635_00186 | CDS | open | 238056-239477 | _na 473_aa | Transporter%2C major facilitator family protein | |
| 223 | AP012331.1 | GCA001042635_00187 | CDS | open | 239835-241625 | _na 596_aa | Iron permease | |
| 224 | AP012331.1 | GCA001042635_00188 | CDS | open | 241682-242374 | _na 230_aa | tpd | Fe2+ transport protein |
| 225 | AP012331.1 | GCA001042635_00189 | CDS | open | 242465-243733 | _na 422_aa | Membrane iron-sulfur containing protein FtrD-like domain-containing protein | |
| 226 | AP012331.1 | GCA001042635_00190 | CDS | open | 243791-245098 | _na 435_aa | Permease protein of ABC transporter system | |
| 227 | AP012331.1 | GCA001042635_00191 | CDS | open | 245258-246535 | _na 425_aa | ABC transporter permease | |
| 228 | AP012331.1 | GCA001042635_00192 | CDS | open | 246560-247363 | _na 267_aa | ATP-binding protein of ABC transporter system | |
| 229 | AP012331.1 | GCA001042635_00193 | CDS | open | 247514-248068 | _na 184_aa | Putative lipo protein | |
| 230 | AP012331.1 | GCA001042635_00194 | CDS | open | 248120-249406 | _na 428_aa | Membrane protein | |
| 231 | AP012331.1 | GCA001042635_00195 | CDS | open | 249598-250275 | _na 225_aa | ABC transporter permease | |
| 232 | AP012331.1 | GCA001042635_00196 | CDS | open | 250275-251048 | _na 257_aa | Cobalt ABC transporter permease | |
| 233 | AP012331.1 | GCA001042635_00197 | CDS | open | 251045-252775 | _na 576_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 234 | AP012331.1 | GCA001042635_00198 | CDS | open | 252798-253463 | _na 221_aa | ABC transporter ATP-binding protein | |
| 235 | AP012331.1 | GCA001042635_00199 | CDS | open | 253656-254648 | _na 330_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 236 | AP012331.1 | GCA001042635_00200 | CDS | open | 254759-256909 | _na 716_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 237 | AP012331.1 | GCA001042635_00201 | CDS | open | 257225-257713 | _na 162_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 238 | AP012331.1 | GCA001042635_00202 | CDS | open | 257710-257976 | _na 88_aa | nrdH | Glutaredoxin nrdH |
| 239 | AP012331.1 | GCA001042635_00203 | CDS | open | 258271-259926 | _na 551_aa | mlrC | MlrC domain-containing protein |
| 240 | AP012331.1 | GCA001042635_00205 | CDS | open | 261010-262323 | _na 437_aa | Divergent AAA domain protein | |
| 241 | AP012331.1 | GCA001042635_00206 | CDS | open | 263047-263928 | _na 293_aa | ABC transporter | |
| 242 | AP012331.1 | GCA001042635_00207 | CDS | open | 263925-264668 | _na 247_aa | ABC-2 type transporter | |
| 243 | AP012331.1 | GCA001042635_00208 | CDS | open | 264674-265849 | _na 391_aa | ABC transporter ATP-binding protein | |
| 244 | AP012331.1 | GCA001042635_00209 | CDS | open | 266499-266774 | _na 91_aa | Glutaredoxin-like protein | |
| 245 | AP012331.1 | GCA001042635_00210 | CDS | open | 266912-268483 | _na 523_aa | C69 family dipeptidase | |
| 246 | AP012331.1 | GCA001042635_00211 | CDS | open | 268793-270676 | _na 627_aa | DUF5696 domain-containing protein | |
| 247 | AP012331.1 | GCA001042635_00212 | CDS | open | 271013-272047 | _na 344_aa | Glycosyl transferase | |
| 248 | AP012331.1 | GCA001042635_00213 | CDS | open | 272448-273239 | _na 263_aa | Acrr-type transcriptional regulator | |
| 249 | AP012331.1 | GCA001042635_00214 | CDS | open | 273434-274690 | _na 418_aa | ftsY | signal recognition particle-docking protein FtsY |
| 250 | AP012331.1 | GCA001042635_00215 | CDS | open | 275040-276323 | _na 427_aa | Ammonium transporter | |
| 251 | AP012331.1 | GCA001042635_00216 | CDS | open | 276325-276663 | _na 112_aa | glnK | Nitrogen regulatory protein N-II |
| 252 | AP012331.1 | GCA001042635_00217 | CDS | open | 276810-278642 | _na 610_aa | Protein-PII uridylyltransferase | |
| 253 | AP012331.1 | GCA001042635_00218 | CDS | open | 278742-280151 | _na 469_aa | Na-driven multidrug efflux pump | |
| 254 | AP012331.1 | GCA001042635_00219 | CDS | open | 280704-282140 | _na 478_aa | dnaB | replicative DNA helicase |
| 255 | AP012331.1 | GCA001042635_00220 | CDS | open | 282144-283538 | _na 464_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 256 | AP012331.1 | GCA001042635_00221 | CDS | open | 283559-284314 | _na 251_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 257 | AP012331.1 | GCA001042635_00222 | CDS | open | 284446-284670 | _na 74_aa | Poly(Hydroxyalcanoate) granule associated protein (Phasin) | |
| 258 | AP012331.1 | GCA001042635_00223 | CDS | open | 284732-286426 | _na 564_aa | Ubiquinone biosynthesis protein | |
| 259 | AP012331.1 | GCA001042635_00224 | CDS | open | 286528-286953 | _na 141_aa | Transcriptional regulator | |
| 260 | AP012331.1 | GCA001042635_00225 | CDS | open | 287136-287996 | _na 286_aa | 2%2C5-diketo-D-gluconic acid reductase | |
| 261 | AP012331.1 | GCA001042635_00226 | CDS | open | 288147-289796 | _na 549_aa | Divergent AAA domain-containing protein | |
| 262 | AP012331.1 | GCA001042635_00227 | CDS | open | 290317-291609 | _na 430_aa | Phage integrase family protein | |
| 263 | AP012331.1 | GCA001042635_00228 | CDS | open | 291928-292665 | _na 245_aa | hypothetical protein | |
| 264 | AP012331.1 | GCA001042635_00229 | CDS | open | 295015-297246 | _na 743_aa | Cell wall anchor protein | |
| 265 | AP012331.1 | GCA001042635_00230 | CDS | open | 297917-298279 | _na 120_aa | hypothetical protein | |
| 266 | AP012331.1 | GCA001042635_00231 | CDS | open | 298276-298563 | _na 95_aa | hypothetical protein | |
| 267 | AP012331.1 | GCA001042635_00232 | CDS | open | 298880-299017 | _na 45_aa | hypothetical protein | |
| 268 | AP012331.1 | GCA001042635_00233 | CDS | open | 299087-300307 | _na 406_aa | site-specific DNA-methyltransferase (cytosine-N(4)-specific) | |
| 269 | AP012331.1 | GCA001042635_00234 | CDS | open | 300304-300696 | _na 130_aa | mluI | MluI |
| 270 | AP012331.1 | GCA001042635_00236 | CDS | open | 301884-302300 | _na 138_aa | Glycerophosphoryl diesterphosphodiesterase | |
| 271 | AP012331.1 | GCA001042635_00237 | CDS | open | 302832-303530 | _na 232_aa | hypothetical protein | |
| 272 | AP012331.1 | GCA001042635_00238 | CDS | open | 303825-304304 | _na 159_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 273 | AP012331.1 | GCA001042635_00239 | CDS | open | 304506-305684 | _na 392_aa | glf | UDP-galactopyranose mutase |
| 274 | AP012331.1 | GCA001042635_00240 | CDS | open | 305802-306815 | _na 337_aa | ribose-phosphate diphosphokinase | |
| 275 | AP012331.1 | GCA001042635_00241 | CDS | open | 307014-307310 | _na 98_aa | rpsF | 30S ribosomal protein S6 |
| 276 | AP012331.1 | GCA001042635_00242 | CDS | open | 307358-307990 | _na 210_aa | Single-stranded DNA-binding protein | |
| 277 | AP012331.1 | GCA001042635_00243 | CDS | open | 308077-308325 | _na 82_aa | rpsR | 30S ribosomal protein S18 |
| 278 | AP012331.1 | GCA001042635_00244 | CDS | open | 308346-308792 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 279 | AP012331.1 | GCA001042635_00246 | CDS | open | 309689-311191 | _na 500_aa | hypothetical protein | |
| 280 | AP012331.1 | GCA001042635_00247 | CDS | open | 311170-312975 | _na 601_aa | Outer membrane protein | |
| 281 | AP012331.1 | GCA001042635_00248 | CDS | open | 313059-314633 | _na 524_aa | Fimbrial protein | |
| 282 | AP012331.1 | GCA001042635_00249 | CDS | open | 314860-315936 | _na 358_aa | Fimbrial protein | |
| 283 | AP012331.1 | GCA001042635_00250 | CDS | open | 316022-316756 | _na 244_aa | glpF | Aquaporin family protein |
| 284 | AP012331.1 | GCA001042635_00251 | CDS | open | 317153-318718 | _na 521_aa | Beta-xylosidase | |
| 285 | AP012331.1 | GCA001042635_00252 | CDS | open | 318846-320429 | _na 527_aa | Glycosyl hydrolase%2C family 43 | |
| 286 | AP012331.1 | GCA001042635_00253 | CDS | open | 320630-322867 | _na 745_aa | Beta-xylosidase | |
| 287 | AP012331.1 | GCA001042635_00254 | CDS | open | 322964-324022 | _na 352_aa | rbsR | RbsR family transcriptional regulator/Ribose operon repressor |
| 288 | AP012331.1 | GCA001042635_00255 | CDS | open | 324427-325476 | _na 349_aa | Alpha-N-arabinofuranosidase | |
| 289 | AP012331.1 | GCA001042635_00256 | CDS | open | 325921-327231 | _na 436_aa | ABC transporter%2C solute-binding protein | |
| 290 | AP012331.1 | GCA001042635_00257 | CDS | open | 327301-328245 | _na 314_aa | Sugar permease of ABC transporter system | |
| 291 | AP012331.1 | GCA001042635_00258 | CDS | open | 328242-329165 | _na 307_aa | ABC transporter%2C permease protein | |
| 292 | AP012331.1 | GCA001042635_00259 | CDS | open | 329982-330341 | _na 119_aa | lacI | LacI family transcriptional regulator |
| 293 | AP012331.1 | GCA001042635_00260 | CDS | open | 331049-332014 | _na 321_aa | gluQRS | tRNA glutamyl-Q(34) synthetase GluQRS |
| 294 | AP012331.1 | GCA001042635_00261 | CDS | open | 332388-333260 | _na 290_aa | Pyridoxal phosphate homeostasis protein | |
| 295 | AP012331.1 | GCA001042635_00262 | CDS | open | 333521-334615 | _na 364_aa | Sortase | |
| 296 | AP012331.1 | GCA001042635_00263 | CDS | open | 335119-339063 | _na 1314_aa | Fimbriae protein with LPXTG motif and von Willebrand factor typeA domain | |
| 297 | AP012331.1 | GCA001042635_00264 | CDS | open | 339305-340837 | _na 510_aa | fimA | Fimbrial subunit FimA |
| 298 | AP012331.1 | GCA001042635_00265 | CDS | open | 340955-342136 | _na 393_aa | hypothetical protein | |
| 299 | AP012331.1 | GCA001042635_00266 | CDS | open | 342853-343638 | _na 261_aa | Transposase | |
| 300 | AP012331.1 | GCA001042635_00267 | CDS | open | 343649-344464 | _na 271_aa | Putative 2-hydroxyhepta-2%2C 4-diene-1%2C 7-dioateisomerase | |
| 301 | AP012331.1 | GCA001042635_00268 | CDS | open | 345318-346247 | _na 309_aa | Transporter%2C auxin efflux carrier domain protein | |
| 302 | AP012331.1 | GCA001042635_00269 | CDS | open | 346543-349218 | _na 891_aa | clpB | ATP-dependent chaperone ClpB |
| 303 | AP012331.1 | GCA001042635_00270 | CDS | open | 349405-352128 | _na 907_aa | ABC1 family protein kinase | |
| 304 | AP012331.1 | GCA001042635_00271 | CDS | open | 352238-352519 | _na 93_aa | frmR | Transcriptional regulator |
| 305 | AP012331.1 | GCA001042635_00272 | CDS | open | 352603-353943 | _na 446_aa | 30S ribosomal protein S9 | |
| 306 | AP012331.1 | GCA001042635_00273 | CDS | open | 354529-355212 | _na 227_aa | Orotate phosphoribosyl transferase | |
| 307 | AP012331.1 | GCA001042635_00274 | CDS | open | 355316-356125 | _na 269_aa | RNA methyltransferase | |
| 308 | AP012331.1 | GCA001042635_00275 | CDS | open | 356168-357175 | _na 335_aa | ATP-binding protein of ABC transporter system | |
| 309 | AP012331.1 | GCA001042635_00276 | CDS | open | 357172-358281 | _na 369_aa | ABC transporter permease | |
| 310 | AP012331.1 | GCA001042635_00277 | CDS | open | 359489-359809 | _na 106_aa | Putative transposase | |
| 311 | AP012331.1 | GCA001042635_00278 | CDS | open | 359806-360123 | _na 105_aa | hypothetical protein | |
| 312 | AP012331.1 | GCA001042635_00279 | CDS | open | 360096-360236 | _na 46_aa | Transposase | |
| 313 | AP012331.1 | GCA001042635_00280 | CDS | open | 360345-361202 | _na 285_aa | IS3 family transposase | |
| 314 | AP012331.1 | GCA001042635_00281 | CDS | open | 361199-361666 | _na 155_aa | Transposase | |
| 315 | AP012331.1 | GCA001042635_00282 | CDS | open | 362114-363034 | _na 306_aa | CTP synthase | |
| 316 | AP012331.1 | GCA001042635_00283 | CDS | open | 364319-364618 | _na 99_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 317 | AP012331.1 | GCA001042635_00284 | CDS | open | 364623-366155 | _na 510_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 318 | AP012331.1 | GCA001042635_00285 | CDS | open | 366183-367682 | _na 499_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 319 | AP012331.1 | GCA001042635_00286 | CDS | open | 367869-368981 | _na 370_aa | GNAT family acetyltransferase | |
| 320 | AP012331.1 | GCA001042635_00287 | CDS | open | 368981-369295 | _na 104_aa | Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII | |
| 321 | AP012331.1 | GCA001042635_00288 | CDS | open | 369680-371293 | _na 537_aa | FAD dependent oxidoreductase | |
| 322 | AP012331.1 | GCA001042635_00289 | CDS | open | 371616-373685 | _na 689_aa | rho | transcription termination factor Rho |
| 323 | AP012331.1 | GCA001042635_00290 | CDS | open | 374056-375279 | _na 407_aa | Aminotransferase | |
| 324 | AP012331.1 | GCA001042635_00291 | CDS | open | 375564-376049 | _na 161_aa | AsnC-type transcriptional regulator | |
| 325 | AP012331.1 | GCA001042635_00292 | CDS | open | 376144-376599 | _na 151_aa | chorismate mutase | |
| 326 | AP012331.1 | GCA001042635_00293 | CDS | open | 376826-378337 | _na 503_aa | Tubuliform spidroin | |
| 327 | AP012331.1 | GCA001042635_00294 | CDS | open | 378481-381258 | _na 925_aa | valS | valine--tRNA ligase |
| 328 | AP012331.1 | GCA001042635_00295 | CDS | open | 381350-382888 | _na 512_aa | ABC transporter substrate-binding protein | |
| 329 | AP012331.1 | GCA001042635_00296 | CDS | open | 382913-383701 | _na 262_aa | nth | endonuclease III |
| 330 | AP012331.1 | GCA001042635_00297 | CDS | open | 383691-384401 | _na 236_aa | DNA-binding response regulator | |
| 331 | AP012331.1 | GCA001042635_00298 | CDS | open | 384647-385384 | _na 245_aa | Membrane protein | |
| 332 | AP012331.1 | GCA001042635_00299 | CDS | open | 385456-385980 | _na 174_aa | mntP | Putative manganese efflux pump MntP |
| 333 | AP012331.1 | GCA001042635_00300 | CDS | open | 386254-386748 | _na 164_aa | ppa | Inorganic pyrophosphatase |
| 334 | AP012331.1 | GCA001042635_00301 | CDS | open | 386928-389153 | _na 741_aa | Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase | |
| 335 | AP012331.1 | GCA001042635_00302 | CDS | open | 389477-391753 | _na 758_aa | LPXTG-motif cell wall anchor domain-containing protein | |
| 336 | AP012331.1 | GCA001042635_00304 | CDS | open | 392127-393347 | _na 406_aa | Site-specific integrase | |
| 337 | AP012331.1 | GCA001042635_00305 | CDS | open | 393408-394010 | _na 200_aa | hypothetical protein | |
| 338 | AP012331.1 | GCA001042635_00306 | CDS | open | 394094-394870 | _na 258_aa | N-6 DNA methylase | |
| 339 | AP012331.1 | GCA001042635_00307 | CDS | open | 394845-395204 | _na 119_aa | hypothetical protein | |
| 340 | AP012331.1 | GCA001042635_00308 | CDS | open | 395452-395805 | _na 117_aa | xamI | XamI family restriction endonuclease |
| 341 | AP012331.1 | GCA001042635_00309 | CDS | open | 396206-396433 | _na 75_aa | DNA-binding protein | |
| 342 | AP012331.1 | GCA001042635_00310 | CDS | open | 396426-397037 | _na 203_aa | repB | RepB protein |
| 343 | AP012331.1 | GCA001042635_00311 | CDS | open | 397030-397917 | _na 295_aa | Plasmid transfer protein | |
| 344 | AP012331.1 | GCA001042635_00312 | CDS | open | 397914-398303 | _na 129_aa | ABC transporter permease | |
| 345 | AP012331.1 | GCA001042635_00313 | CDS | open | 398378-398545 | _na 55_aa | Transposase | |
| 346 | AP012331.1 | GCA001042635_00314 | CDS | open | 398687-399760 | _na 357_aa | HTH cro/C1-type domain-containing protein | |
| 347 | AP012331.1 | GCA001042635_00316 | CDS | open | 400135-401169 | _na 344_aa | metA | homoserine O-succinyltransferase |
| 348 | AP012331.1 | GCA001042635_00317 | CDS | open | 401508-402320 | _na 270_aa | atpB | F0F1 ATP synthase subunit A |
| 349 | AP012331.1 | GCA001042635_00318 | CDS | open | 402505-402735 | _na 76_aa | atpE | ATP synthase F0 subunit C |
| 350 | AP012331.1 | GCA001042635_00319 | CDS | open | 402789-403316 | _na 175_aa | F0F1 ATP synthase subunit B | |
| 351 | AP012331.1 | GCA001042635_00320 | CDS | open | 403346-404173 | _na 275_aa | F0F1 ATP synthase subunit delta | |
| 352 | AP012331.1 | GCA001042635_00321 | CDS | open | 404221-405900 | _na 559_aa | atpA | F0F1 ATP synthase subunit alpha |
| 353 | AP012331.1 | GCA001042635_00322 | CDS | open | 405904-406839 | _na 311_aa | F0F1 ATP synthase subunit gamma | |
| 354 | AP012331.1 | GCA001042635_00323 | CDS | open | 406848-408332 | _na 494_aa | atpD | F0F1 ATP synthase subunit beta |
| 355 | AP012331.1 | GCA001042635_00324 | CDS | open | 408332-408634 | _na 100_aa | F0F1 ATP synthase subunit epsilon | |
| 356 | AP012331.1 | GCA001042635_00325 | CDS | open | 409159-409932 | _na 257_aa | nucS | endonuclease NucS |
| 357 | AP012331.1 | GCA001042635_00326 | CDS | open | 410299-411300 | _na 333_aa | peptidylprolyl isomerase | |
| 358 | AP012331.1 | GCA001042635_00327 | CDS | open | 411379-412599 | _na 406_aa | GTPase regulator-like protein | |
| 359 | AP012331.1 | GCA001042635_00328 | CDS | open | 412596-413603 | _na 335_aa | Lipoprotein | |
| 360 | AP012331.1 | GCA001042635_00329 | CDS | open | 413851-414813 | _na 320_aa | Thioredoxin domain-containing protein | |
| 361 | AP012331.1 | GCA001042635_00330 | CDS | open | 414923-415549 | _na 208_aa | Adenylate cyclase | |
| 362 | AP012331.1 | GCA001042635_00332 | CDS | open | 416095-417843 | _na 582_aa | Peptidase | |
| 363 | AP012331.1 | GCA001042635_00333 | CDS | open | 417873-418451 | _na 192_aa | Transposase | |
| 364 | AP012331.1 | GCA001042635_00334 | CDS | open | 418385-419593 | _na 402_aa | Selenocysteine lyase / isopenicillin N epimerase | |
| 365 | AP012331.1 | GCA001042635_00335 | CDS | open | 419930-421564 | _na 544_aa | ABC transporter substrate-binding protein | |
| 366 | AP012331.1 | GCA001042635_00336 | CDS | open | 421748-423253 | _na 501_aa | pepV | M20 family peptidase PepV |
| 367 | AP012331.1 | GCA001042635_00337 | CDS | open | 423425-423814 | _na 129_aa | ridA | Enamine/imine deaminase |
| 368 | AP012331.1 | GCA001042635_00338 | CDS | open | 424319-425347 | _na 342_aa | Glycerophosphodiester phosphodiesterase | |
| 369 | AP012331.1 | GCA001042635_00339 | CDS | open | 425398-427227 | _na 609_aa | argS | arginine--tRNA ligase |
| 370 | AP012331.1 | GCA001042635_00340 | CDS | open | 427536-429206 | _na 556_aa | lysA | diaminopimelate decarboxylase |
| 371 | AP012331.1 | GCA001042635_00341 | CDS | open | 429831-430340 | _na 169_aa | PTS system glucose-specific transporter subunit IICBA | |
| 372 | AP012331.1 | GCA001042635_00342 | CDS | open | 430337-431878 | _na 513_aa | PTS system%2C N-acetylglucosamine-specific IIC subunit | |
| 373 | AP012331.1 | GCA001042635_00343 | CDS | open | 432252-433565 | _na 437_aa | Homoserine dehydrogenase | |
| 374 | AP012331.1 | GCA001042635_00344 | CDS | open | 433603-434601 | _na 332_aa | thrB | homoserine kinase |
| 375 | AP012331.1 | GCA001042635_00345 | CDS | open | 434811-434963 | _na 50_aa | hypothetical protein | |
| 376 | AP012331.1 | GCA001042635_00346 | CDS | open | 435023-436480 | _na 485_aa | Nucleoside triphosphate pyrophosphatase | |
| 377 | AP012331.1 | GCA001042635_00347 | CDS | open | 436821-437618 | _na 265_aa | Short-chain dehydrogenase/reductase SDR | |
| 378 | AP012331.1 | GCA001042635_00348 | CDS | open | 437888-438682 | _na 264_aa | ATP-binding protein of ABC transporter system | |
| 379 | AP012331.1 | GCA001042635_00349 | CDS | open | 438679-440133 | _na 484_aa | Permease | |
| 380 | AP012331.1 | GCA001042635_00350 | CDS | open | 440758-442263 | _na 501_aa | ddpA | Solute-binding protein family 5 domain-containing protein |
| 381 | AP012331.1 | GCA001042635_00351 | CDS | open | 442318-443424 | _na 368_aa | Oligopeptide/dipeptide ABC transporter ATPase | |
| 382 | AP012331.1 | GCA001042635_00352 | CDS | open | 443421-444068 | _na 215_aa | oppC | Oligopeptide transport system permease protein oppC |
| 383 | AP012331.1 | GCA001042635_00353 | CDS | open | 444150-444419 | _na 89_aa | hypothetical protein | |
| 384 | AP012331.1 | GCA001042635_00354 | CDS | open | 444445-445116 | _na 223_aa | Binding-protein-dependent transport system inner membrane protein | |
| 385 | AP012331.1 | GCA001042635_00355 | CDS | open | 445374-446315 | _na 313_aa | Transporter%2C auxin efflux carrier domain protein | |
| 386 | AP012331.1 | GCA001042635_00356 | CDS | open | 446502-447782 | _na 426_aa | dapE | succinyl-diaminopimelate desuccinylase |
| 387 | AP012331.1 | GCA001042635_00357 | CDS | open | 448114-448947 | _na 277_aa | Binding-protein-dependent transport system inner membrane protein | |
| 388 | AP012331.1 | GCA001042635_00358 | CDS | open | 448950-449966 | _na 338_aa | Binding-protein-dependent transport system inner membrane protein | |
| 389 | AP012331.1 | GCA001042635_00359 | CDS | open | 450083-451387 | _na 434_aa | Extracellular solute-binding protein | |
| 390 | AP012331.1 | GCA001042635_00360 | CDS | open | 451446-452666 | _na 406_aa | Selenocysteine lyase / isopenicillin N epimerase | |
| 391 | AP012331.1 | GCA001042635_00361 | CDS | open | 452860-453564 | _na 234_aa | gntR | GntR family transcriptional regulator |
| 392 | AP012331.1 | GCA001042635_00362 | CDS | open | 453875-456712 | _na 945_aa | Rne/Rng family ribonuclease | |
| 393 | AP012331.1 | GCA001042635_00363 | CDS | open | 456943-457251 | _na 102_aa | rplU | 50S ribosomal protein L21 |
| 394 | AP012331.1 | GCA001042635_00364 | CDS | open | 457282-457530 | _na 82_aa | rpmA | 50S ribosomal protein L27 |
| 395 | AP012331.1 | GCA001042635_00365 | CDS | open | 457650-459320 | _na 556_aa | obgE | GTPase ObgE |
| 396 | AP012331.1 | GCA001042635_00366 | CDS | open | 459464-460594 | _na 376_aa | Glutamate 5-kinase | |
| 397 | AP012331.1 | GCA001042635_00367 | CDS | open | 460725-461930 | _na 401_aa | Aminotransferase | |
| 398 | AP012331.1 | GCA001042635_00369 | CDS | open | 462273-462500 | _na 75_aa | secE | preprotein translocase subunit SecE |
| 399 | AP012331.1 | GCA001042635_00370 | CDS | open | 462531-463412 | _na 293_aa | nusG | transcription termination/antitermination protein NusG |
| 400 | AP012331.1 | GCA001042635_00371 | CDS | open | 463679-464110 | _na 143_aa | rplK | 50S ribosomal protein L11 |
| 401 | AP012331.1 | GCA001042635_00372 | CDS | open | 464125-464817 | _na 230_aa | rplA | 50S ribosomal protein L1 |
| 402 | AP012331.1 | GCA001042635_00373 | CDS | open | 465149-465949 | _na 266_aa | Transcriptional regulator | |
| 403 | AP012331.1 | GCA001042635_00374 | CDS | open | 465956-468088 | _na 710_aa | Membrane protein | |
| 404 | AP012331.1 | GCA001042635_00375 | CDS | open | 468144-469034 | _na 296_aa | Biotin-(Acetyl-CoA carboxylase) ligase | |
| 405 | AP012331.1 | GCA001042635_00376 | CDS | open | 469213-469896 | _na 227_aa | Biotin transporter | |
| 406 | AP012331.1 | GCA001042635_00377 | CDS | open | 470087-472120 | _na 677_aa | biotin carboxylase | |
| 407 | AP012331.1 | GCA001042635_00378 | CDS | open | 472117-473751 | _na 544_aa | Acetyl-/propionyl-CoA carboxylase beta chain | |
| 408 | AP012331.1 | GCA001042635_00379 | CDS | open | 473804-483310 | _na 3168_aa | Type I multifunctional fatty acid synthase | |
| 409 | AP012331.1 | GCA001042635_00380 | CDS | open | 483776-484234 | _na 152_aa | Holo-[acyl-carrier-protein] synthase | |
| 410 | AP012331.1 | GCA001042635_00381 | CDS | open | 484746-485234 | _na 162_aa | Putative transposase | |
| 411 | AP012331.1 | GCA001042635_00382 | CDS | open | 485382-487196 | _na 604_aa | Putative amylosucrase | |
| 412 | AP012331.1 | GCA001042635_00384 | CDS | open | 487576-488793 | _na 405_aa | Site-specific recombinase%2C phage integrase family | |
| 413 | AP012331.1 | GCA001042635_00385 | CDS | open | 488835-489065 | _na 76_aa | Gp28 phagic protein | |
| 414 | AP012331.1 | GCA001042635_00386 | CDS | open | 489062-489208 | _na 48_aa | Lipoprotein | |
| 415 | AP012331.1 | GCA001042635_00387 | CDS | open | 489287-489436 | _na 49_aa | hypothetical protein | |
| 416 | AP012331.1 | GCA001042635_00388 | CDS | open | 489685-490650 | _na 321_aa | hypothetical protein | |
| 417 | AP012331.1 | GCA001042635_00389 | CDS | open | 490763-491206 | _na 147_aa | hypothetical protein | |
| 418 | AP012331.1 | GCA001042635_00390 | CDS | open | 491442-491654 | _na 70_aa | hypothetical protein | |
| 419 | AP012331.1 | GCA001042635_00391 | CDS | open | 491651-492415 | _na 254_aa | hypothetical protein | |
| 420 | AP012331.1 | GCA001042635_00392 | CDS | open | 492550-493650 | _na 366_aa | hsdR | Type I restriction enzyme HsdR protein N-terminal domain protein |
| 421 | AP012331.1 | GCA001042635_00393 | CDS | open | 493716-494078 | _na 120_aa | hypothetical protein | |
| 422 | AP012331.1 | GCA001042635_00394 | CDS | open | 494185-494433 | _na 82_aa | XRE family transcriptional regulator | |
| 423 | AP012331.1 | GCA001042635_00395 | CDS | open | 494433-494600 | _na 55_aa | hypothetical protein | |
| 424 | AP012331.1 | GCA001042635_00396 | CDS | open | 494603-494818 | _na 71_aa | hypothetical protein | |
| 425 | AP012331.1 | GCA001042635_00397 | CDS | open | 494980-495627 | _na 215_aa | Lipoprotein | |
| 426 | AP012331.1 | GCA001042635_00398 | CDS | open | 495669-495890 | _na 73_aa | Unassigned protein | |
| 427 | AP012331.1 | GCA001042635_00399 | CDS | open | 495890-496222 | _na 110_aa | Helix-turn-helix domain-containing protein | |
| 428 | AP012331.1 | GCA001042635_00400 | CDS | open | 496225-496407 | _na 60_aa | hypothetical protein | |
| 429 | AP012331.1 | GCA001042635_00401 | CDS | open | 496411-496863 | _na 150_aa | Single-stranded DNA-binding protein | |
| 430 | AP012331.1 | GCA001042635_00402 | CDS | open | 496880-497488 | _na 202_aa | hypothetical protein | |
| 431 | AP012331.1 | GCA001042635_00403 | CDS | open | 497485-497892 | _na 135_aa | Gp53 family protein | |
| 432 | AP012331.1 | GCA001042635_00404 | CDS | open | 497999-499699 | _na 566_aa | parB | Chromosome partitioning protein ParB |
| 433 | AP012331.1 | GCA001042635_00405 | CDS | open | 499671-499931 | _na 86_aa | Transposase | |
| 434 | AP012331.1 | GCA001042635_00406 | CDS | open | 499928-500128 | _na 66_aa | hypothetical protein | |
| 435 | AP012331.1 | GCA001042635_00407 | CDS | open | 500135-500623 | _na 162_aa | Transposase | |
| 436 | AP012331.1 | GCA001042635_00408 | CDS | open | 500620-501642 | _na 340_aa | DNA-binding helix-turn-helix protein | |
| 437 | AP012331.1 | GCA001042635_00409 | CDS | open | 501642-501947 | _na 101_aa | Cryptic prophage protein | |
| 438 | AP012331.1 | GCA001042635_00410 | CDS | open | 501944-502069 | _na 41_aa | hypothetical protein | |
| 439 | AP012331.1 | GCA001042635_00411 | CDS | open | 502066-502344 | _na 92_aa | Lipoprotein | |
| 440 | AP012331.1 | GCA001042635_00412 | CDS | open | 502341-502544 | _na 67_aa | hypothetical protein | |
| 441 | AP012331.1 | GCA001042635_00413 | CDS | open | 502532-502759 | _na 75_aa | WGR domain-containing protein | |
| 442 | AP012331.1 | GCA001042635_00414 | CDS | open | 502767-502892 | _na 41_aa | hypothetical protein | |
| 443 | AP012331.1 | GCA001042635_00415 | CDS | open | 502980-503696 | _na 238_aa | phnA | PhnA protein |
| 444 | AP012331.1 | GCA001042635_00416 | CDS | open | 503896-504630 | _na 244_aa | hypothetical protein | |
| 445 | AP012331.1 | GCA001042635_00417 | CDS | open | 504728-505138 | _na 136_aa | HNH endonuclease | |
| 446 | AP012331.1 | GCA001042635_00418 | CDS | open | 505258-505683 | _na 141_aa | Terminase small subunit | |
| 447 | AP012331.1 | GCA001042635_00419 | CDS | open | 505661-507097 | _na 478_aa | Terminase | |
| 448 | AP012331.1 | GCA001042635_00420 | CDS | open | 507097-508629 | _na 510_aa | Phage portal protein gp6-like protein | |
| 449 | AP012331.1 | GCA001042635_00421 | CDS | open | 508697-509881 | _na 394_aa | Phage protein | |
| 450 | AP012331.1 | GCA001042635_00422 | CDS | open | 509872-510177 | _na 101_aa | hypothetical protein | |
| 451 | AP012331.1 | GCA001042635_00423 | CDS | open | 510341-510850 | _na 169_aa | Scaffold protein | |
| 452 | AP012331.1 | GCA001042635_00424 | CDS | open | 510900-511799 | _na 299_aa | phage major capsid protein | |
| 453 | AP012331.1 | GCA001042635_00425 | CDS | open | 511811-512377 | _na 188_aa | Head fiber protein | |
| 454 | AP012331.1 | GCA001042635_00426 | CDS | open | 512392-512838 | _na 148_aa | Phage protein Gp19/Gp15/Gp42 | |
| 455 | AP012331.1 | GCA001042635_00427 | CDS | open | 512838-513161 | _na 107_aa | Head-to-tail stopper | |
| 456 | AP012331.1 | GCA001042635_00428 | CDS | open | 513165-513410 | _na 81_aa | hypothetical protein | |
| 457 | AP012331.1 | GCA001042635_00429 | CDS | open | 513407-513802 | _na 131_aa | Phage protein | |
| 458 | AP012331.1 | GCA001042635_00430 | CDS | open | 513862-514722 | _na 286_aa | BIG2 domain-containing protein | |
| 459 | AP012331.1 | GCA001042635_00431 | CDS | open | 514845-515222 | _na 125_aa | Tail assembly chaperone | |
| 460 | AP012331.1 | GCA001042635_00432 | CDS | open | 515652-518264 | _na 870_aa | Membrane protein | |
| 461 | AP012331.1 | GCA001042635_00433 | CDS | open | 518280-519014 | _na 244_aa | Phage tail protein | |
| 462 | AP012331.1 | GCA001042635_00434 | CDS | open | 519019-520149 | _na 376_aa | Minor tail protein | |
| 463 | AP012331.1 | GCA001042635_00435 | CDS | open | 520146-521300 | _na 384_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 464 | AP012331.1 | GCA001042635_00436 | CDS | open | 521326-521691 | _na 121_aa | Putative tail fiber protein | |
| 465 | AP012331.1 | GCA001042635_00437 | CDS | open | 522007-523899 | _na 630_aa | Rhamnogalacturonase A/B/Epimerase-like pectate lyase domain-containing protein | |
| 466 | AP012331.1 | GCA001042635_00438 | CDS | open | 523966-524166 | _na 66_aa | Transposase | |
| 467 | AP012331.1 | GCA001042635_00439 | CDS | open | 524268-524606 | _na 112_aa | DUF2746 domain-containing protein | |
| 468 | AP012331.1 | GCA001042635_00440 | CDS | open | 524622-525620 | _na 332_aa | N-acetylmuramoyl-L-alanine amidase | |
| 469 | AP012331.1 | GCA001042635_00441 | CDS | open | 525638-525934 | _na 98_aa | Holin | |
| 470 | AP012331.1 | GCA001042635_00443 | CDS | open | 526445-527470 | _na 341_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 471 | AP012331.1 | GCA001042635_00444 | CDS | open | 527854-528594 | _na 246_aa | The export of O-antigen and teichoic acid related membrane protein | |
| 472 | AP012331.1 | GCA001042635_00445 | CDS | open | 528772-529041 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 473 | AP012331.1 | GCA001042635_00446 | CDS | open | 529216-531915 | _na 899_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 474 | AP012331.1 | GCA001042635_00447 | CDS | open | 532417-532983 | _na 188_aa | lemA | LemA family protein |
| 475 | AP012331.1 | GCA001042635_00448 | CDS | open | 532990-535239 | _na 749_aa | Membrane protein | |
| 476 | AP012331.1 | GCA001042635_00449 | CDS | open | 535480-536343 | _na 287_aa | Aldo/keto reductase | |
| 477 | AP012331.1 | GCA001042635_00450 | CDS | open | 536465-537943 | _na 492_aa | norG | Putative HTH-type transcriptional regulator NorG |
| 478 | AP012331.1 | GCA001042635_00451 | CDS | open | 538216-538875 | _na 219_aa | Lysine exporter protein | |
| 479 | AP012331.1 | GCA001042635_00452 | CDS | open | 539123-540805 | _na 560_aa | Peptidase family U32 | |
| 480 | AP012331.1 | GCA001042635_00453 | CDS | open | 540823-541821 | _na 332_aa | polyphenol oxidase family protein | |
| 481 | AP012331.1 | GCA001042635_00454 | CDS | open | 541933-542685 | _na 250_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 482 | AP012331.1 | GCA001042635_00455 | CDS | open | 542713-543393 | _na 226_aa | Pyroglutamyl-peptidase I | |
| 483 | AP012331.1 | GCA001042635_00456 | CDS | open | 543579-544979 | _na 466_aa | Cell division protein | |
| 484 | AP012331.1 | GCA001042635_00457 | CDS | open | 545099-546445 | _na 448_aa | Aminopeptidase | |
| 485 | AP012331.1 | GCA001042635_00458 | CDS | open | 546700-547734 | _na 344_aa | Putative transcriptional regulator | |
| 486 | AP012331.1 | GCA001042635_00459 | CDS | open | 547911-549194 | _na 427_aa | L-fuconate dehydratase | |
| 487 | AP012331.1 | GCA001042635_00460 | CDS | open | 549250-550041 | _na 263_aa | SDR family oxidoreductase | |
| 488 | AP012331.1 | GCA001042635_00461 | CDS | open | 550050-550844 | _na 264_aa | Amidohydrolase family protein | |
| 489 | AP012331.1 | GCA001042635_00462 | CDS | open | 550884-551819 | _na 311_aa | Dihydrodipicolinate synthase | |
| 490 | AP012331.1 | GCA001042635_00463 | CDS | open | 551983-553122 | _na 379_aa | 3-deoxy-7-phosphoheptulonate synthase | |
| 491 | AP012331.1 | GCA001042635_00464 | CDS | open | 553185-554453 | _na 422_aa | 3-deoxy-7-phosphoheptulonate synthase | |
| 492 | AP012331.1 | GCA001042635_00465 | CDS | open | 554549-555256 | _na 235_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 493 | AP012331.1 | GCA001042635_00466 | CDS | open | 555393-556718 | _na 441_aa | senX3 | Sensor-like histidine kinase SenX3 |
| 494 | AP012331.1 | GCA001042635_00467 | CDS | open | 556851-557555 | _na 234_aa | ompR | Sensory transduction protein RegX3 |
| 495 | AP012331.1 | GCA001042635_00468 | CDS | open | 557763-558890 | _na 375_aa | pstS | phosphate ABC transporter substrate-binding protein PstS |
| 496 | AP012331.1 | GCA001042635_00469 | CDS | open | 559040-559993 | _na 317_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 497 | AP012331.1 | GCA001042635_00470 | CDS | open | 559993-560991 | _na 332_aa | pstA | phosphate ABC transporter permease PstA |
| 498 | AP012331.1 | GCA001042635_00471 | CDS | open | 561033-561812 | _na 259_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 499 | AP012331.1 | GCA001042635_00472 | CDS | open | 562149-563546 | _na 465_aa | Permease family protein | |
| 500 | AP012331.1 | GCA001042635_00473 | CDS | open | 563835-565151 | _na 438_aa | Transporter |

