BAKTAGenome Explorer: Capnocytophaga ochracea (GCA_001057035.1)
Select a Genome:
|
BAKTA Annotations for GCA_001057035.1
|
Search & Sort all 4284 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | JVFB01000042.1 | GCA001057035_00762 | CDS | open | 28635-30401 | _na 588_aa | ABC transporter transmembrane region | |
| 1502 | JVFB01000042.1 | GCA001057035_00763 | CDS | open | 30507-32912 | _na 801_aa | FtsK/SpoIIIE family protein | |
| 1503 | JVFB01000042.1 | GCA001057035_00764 | CDS | open | 32942-34135 | _na 397_aa | Acetylornithine aminotransferase / N-succinyl-L%2CL-diaminopimelate aminotransferase | |
| 1504 | JVFB01000042.1 | GCA001057035_00765 | CDS | open | 34337-35509 | _na 390_aa | pncB | nicotinate phosphoribosyltransferase |
| 1505 | JVFB01000042.1 | GCA001057035_00766 | CDS | open | 35577-35777 | _na 66_aa | hypothetical protein | |
| 1506 | JVFB01000042.1 | GCA001057035_00767 | CDS | open | 35908-36453 | _na 181_aa | Smr domain-containing protein | |
| 1507 | JVFB01000042.1 | GCA001057035_00768 | CDS | open | 36454-37134 | _na 226_aa | ABC transporter%2C ATP-binding protein | |
| 1508 | JVFB01000042.1 | GCA001057035_00769 | CDS | open | 37176-37619 | _na 147_aa | Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein | |
| 1509 | JVFB01000042.1 | GCA001057035_00770 | CDS | open | 37696-38142 | _na 148_aa | Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein | |
| 1510 | JVFB01000042.1 | GCA001057035_00771 | CDS | open | 38144-38578 | _na 144_aa | Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein | |
| 1511 | JVFB01000042.1 | GCA001057035_00772 | CDS | open | 38581-39810 | _na 409_aa | BaiN-like insert domain-containing protein | |
| 1512 | JVFB01000042.1 | GCA001057035_00773 | CDS | open | 39883-40380 | _na 165_aa | tpx | thiol peroxidase |
| 1513 | JVFB01000042.1 | GCA001057035_00774 | CDS | open | 40438-42132 | _na 564_aa | recJ | single-stranded-DNA-specific exonuclease RecJ |
| 1514 | JVFB01000042.1 | GCA001057035_00775 | CDS | open | 42196-43059 | _na 287_aa | rpoD | RNA polymerase sigma factor rpoD |
| 1515 | JVFB01000042.1 | GCA001057035_00776 | CDS | open | 43161-44156 | _na 331_aa | Glycosyltransferase 2-like domain-containing protein | |
| 1516 | JVFB01000042.1 | GCA001057035_00777 | CDS | open | 44368-45306 | _na 312_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 1517 | JVFB01000042.1 | GCA001057035_00778 | CDS | open | 45310-45819 | _na 169_aa | cvpA | CvpA family protein |
| 1518 | JVFB01000042.1 | GCA001057035_00779 | CDS | open | 45844-48891 | _na 1015_aa | Reprolysin (M12B) family zinc metalloprotease | |
| 1519 | JVFB01000042.1 | GCA001057035_00780 | CDS | open | 48942-51323 | _na 793_aa | Peptidase M12B domain-containing protein | |
| 1520 | JVFB01000042.1 | GCA001057035_00781 | CDS | open | 51392-54418 | _na 1008_aa | Peptidase M12B domain-containing protein | |
| 1521 | JVFB01000042.1 | GCA001057035_00782 | CDS | open | 54559-56430 | _na 623_aa | Glycosyl hydrolase family 13 catalytic domain-containing protein | |
| 1522 | JVFB01000042.1 | GCA001057035_00783 | CDS | open | 56803-57561 | _na 252_aa | yaaA | peroxide stress protein YaaA |
| 1523 | JVFB01000042.1 | GCA001057035_00784 | CDS | open | 57600-58394 | _na 264_aa | DUF2797 domain-containing protein | |
| 1524 | JVFB01000042.1 | GCA001057035_00738 | gene | open | 65-508 | |||
| 1525 | JVFB01000042.1 | GCA001057035_00739 | gene | open | 533-1117 | ruvA | ||
| 1526 | JVFB01000042.1 | GCA001057035_00740 | gene | open | 1186-1677 | |||
| 1527 | JVFB01000042.1 | GCA001057035_00741 | gene | open | 1704-2540 | |||
| 1528 | JVFB01000042.1 | GCA001057035_00742 | gene | open | 2552-2929 | secG | ||
| 1529 | JVFB01000042.1 | GCA001057035_00743 | gene | open | 3133-3411 | |||
| 1530 | JVFB01000042.1 | GCA001057035_00744 | gene | open | 3436-5070 | groL | ||
| 1531 | JVFB01000042.1 | GCA001057035_00745 | gene | open | 5338-6501 | |||
| 1532 | JVFB01000042.1 | GCA001057035_00746 | gene | open | 7205-10363 | |||
| 1533 | JVFB01000042.1 | GCA001057035_00747 | gene | open | 10694-11128 | |||
| 1534 | JVFB01000042.1 | GCA001057035_00748 | gene | open | 11133-11879 | |||
| 1535 | JVFB01000042.1 | GCA001057035_00749 | gene | open | 11893-13728 | |||
| 1536 | JVFB01000042.1 | GCA001057035_00750 | gene | open | 13743-15047 | |||
| 1537 | JVFB01000042.1 | GCA001057035_00751 | gene | open | 15103-15816 | |||
| 1538 | JVFB01000042.1 | GCA001057035_00752 | gene | open | 15911-16396 | ribH | ||
| 1539 | JVFB01000042.1 | GCA001057035_00753 | gene | open | 16400-17188 | |||
| 1540 | JVFB01000042.1 | GCA001057035_00754 | gene | open | 18131-20608 | topA | ||
| 1541 | JVFB01000042.1 | GCA001057035_00755 | gene | open | 20687-21337 | rpe | ||
| 1542 | JVFB01000042.1 | GCA001057035_00756 | gene | open | 21427-22899 | sufB | ||
| 1543 | JVFB01000042.1 | GCA001057035_00757 | gene | open | 23060-23614 | |||
| 1544 | JVFB01000042.1 | GCA001057035_00758 | gene | open | 23735-24208 | |||
| 1545 | JVFB01000042.1 | GCA001057035_00759 | gene | open | 24213-26501 | |||
| 1546 | JVFB01000042.1 | GCA001057035_00760 | gene | open | 26494-27348 | |||
| 1547 | JVFB01000042.1 | GCA001057035_00761 | gene | open | 27493-27972 | |||
| 1548 | JVFB01000042.1 | GCA001057035_00762 | gene | open | 28635-30401 | |||
| 1549 | JVFB01000042.1 | GCA001057035_00763 | gene | open | 30507-32912 | |||
| 1550 | JVFB01000042.1 | GCA001057035_00764 | gene | open | 32942-34135 | |||
| 1551 | JVFB01000042.1 | GCA001057035_00765 | gene | open | 34337-35509 | pncB | ||
| 1552 | JVFB01000042.1 | GCA001057035_00766 | gene | open | 35577-35777 | |||
| 1553 | JVFB01000042.1 | GCA001057035_00767 | gene | open | 35908-36453 | |||
| 1554 | JVFB01000042.1 | GCA001057035_00768 | gene | open | 36454-37134 | |||
| 1555 | JVFB01000042.1 | GCA001057035_00769 | gene | open | 37176-37619 | |||
| 1556 | JVFB01000042.1 | GCA001057035_00770 | gene | open | 37696-38142 | |||
| 1557 | JVFB01000042.1 | GCA001057035_00771 | gene | open | 38144-38578 | |||
| 1558 | JVFB01000042.1 | GCA001057035_00772 | gene | open | 38581-39810 | |||
| 1559 | JVFB01000042.1 | GCA001057035_00773 | gene | open | 39883-40380 | tpx | ||
| 1560 | JVFB01000042.1 | GCA001057035_00774 | gene | open | 40438-42132 | recJ | ||
| 1561 | JVFB01000042.1 | GCA001057035_00775 | gene | open | 42196-43059 | rpoD | ||
| 1562 | JVFB01000042.1 | GCA001057035_00776 | gene | open | 43161-44156 | |||
| 1563 | JVFB01000042.1 | GCA001057035_00777 | gene | open | 44368-45306 | rsgA | ||
| 1564 | JVFB01000042.1 | GCA001057035_00778 | gene | open | 45310-45819 | cvpA | ||
| 1565 | JVFB01000042.1 | GCA001057035_00779 | gene | open | 45844-48891 | |||
| 1566 | JVFB01000042.1 | GCA001057035_00780 | gene | open | 48942-51323 | |||
| 1567 | JVFB01000042.1 | GCA001057035_00781 | gene | open | 51392-54418 | |||
| 1568 | JVFB01000042.1 | GCA001057035_00782 | gene | open | 54559-56430 | |||
| 1569 | JVFB01000042.1 | GCA001057035_00783 | gene | open | 56803-57561 | yaaA | ||
| 1570 | JVFB01000042.1 | GCA001057035_00784 | gene | open | 57600-58394 | |||
| 1571 | JVFB01000043.1 | GCA001057035_00785 | CDS | open | 247-1251 | _na 334_aa | Acyl-CoA reductase (LuxC) | |
| 1572 | JVFB01000043.1 | GCA001057035_00786 | CDS | open | 1340-3856 | _na 838_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 1573 | JVFB01000043.1 | GCA001057035_00787 | CDS | open | 4675-6237 | _na 520_aa | Galactose-1-phosphate uridylyltransferase | |
| 1574 | JVFB01000043.1 | GCA001057035_00788 | CDS | open | 6278-7345 | _na 355_aa | Aldose 1-epimerase | |
| 1575 | JVFB01000043.1 | GCA001057035_00789 | CDS | open | 7358-8515 | _na 385_aa | galactokinase | |
| 1576 | JVFB01000043.1 | GCA001057035_00790 | CDS | open | 8640-9467 | _na 275_aa | AB hydrolase-1 domain-containing protein | |
| 1577 | JVFB01000043.1 | GCA001057035_00791 | CDS | open | 9547-10590 | _na 347_aa | Phosphotransferase enzyme family | |
| 1578 | JVFB01000043.1 | GCA001057035_00792 | CDS | open | 10659-11522 | _na 287_aa | Nucleotidyl transferase domain-containing protein | |
| 1579 | JVFB01000043.1 | GCA001057035_00793 | CDS | open | 11688-11849 | _na 53_aa | hypothetical protein | |
| 1580 | JVFB01000043.1 | GCA001057035_00794 | CDS | open | 12185-14656 | _na 823_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 1581 | JVFB01000043.1 | GCA001057035_00795 | CDS | open | 14877-15563 | _na 228_aa | PAS domain-containing protein | |
| 1582 | JVFB01000043.1 | GCA001057035_00796 | CDS | open | 15610-16287 | _na 225_aa | PAS fold-3 domain-containing protein | |
| 1583 | JVFB01000043.1 | GCA001057035_00797 | CDS | open | 16434-18233 | _na 599_aa | Long-chain-fatty-acid--CoA ligase | |
| 1584 | JVFB01000043.1 | GCA001057035_00798 | CDS | open | 18285-18833 | _na 182_aa | Tyrosine specific protein phosphatases domain-containing protein | |
| 1585 | JVFB01000043.1 | GCA001057035_00799 | CDS | open | 19055-20341 | _na 428_aa | Collagen triple helix repeat protein | |
| 1586 | JVFB01000043.1 | GCA001057035_00800 | CDS | open | 20390-21163 | _na 257_aa | drrA | Doxorubicin resistance ATP-binding protein DrrA |
| 1587 | JVFB01000043.1 | GCA001057035_00801 | CDS | open | 21227-21736 | _na 169_aa | N-acetyltransferase domain-containing protein | |
| 1588 | JVFB01000043.1 | GCA001057035_00802 | CDS | open | 21733-22395 | _na 220_aa | tRNA (guanosine(18)-2'-O)-methyltransferase | |
| 1589 | JVFB01000043.1 | GCA001057035_00803 | CDS | open | 22957-23910 | _na 317_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 1590 | JVFB01000043.1 | GCA001057035_00804 | CDS | open | 24000-25127 | _na 375_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 1591 | JVFB01000043.1 | GCA001057035_00805 | CDS | open | 25384-26202 | _na 272_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 1592 | JVFB01000043.1 | GCA001057035_00806 | CDS | open | 26204-26452 | _na 82_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 1593 | JVFB01000043.1 | GCA001057035_00807 | CDS | open | 26454-26804 | _na 116_aa | Txe/YoeB family addiction module toxin | |
| 1594 | JVFB01000043.1 | GCA001057035_00808 | CDS | open | 27566-28246 | _na 226_aa | rluA | Pseudouridine synthase%2C RluA family |
| 1595 | JVFB01000043.1 | GCA001057035_00809 | CDS | open | 28268-28762 | _na 164_aa | Shikimate kinase | |
| 1596 | JVFB01000043.1 | GCA001057035_00785 | gene | open | 247-1251 | |||
| 1597 | JVFB01000043.1 | GCA001057035_00786 | gene | open | 1340-3856 | |||
| 1598 | JVFB01000043.1 | GCA001057035_00787 | gene | open | 4675-6237 | |||
| 1599 | JVFB01000043.1 | GCA001057035_00788 | gene | open | 6278-7345 | |||
| 1600 | JVFB01000043.1 | GCA001057035_00789 | gene | open | 7358-8515 | |||
| 1601 | JVFB01000043.1 | GCA001057035_00790 | gene | open | 8640-9467 | |||
| 1602 | JVFB01000043.1 | GCA001057035_00791 | gene | open | 9547-10590 | |||
| 1603 | JVFB01000043.1 | GCA001057035_00792 | gene | open | 10659-11522 | |||
| 1604 | JVFB01000043.1 | GCA001057035_00793 | gene | open | 11688-11849 | |||
| 1605 | JVFB01000043.1 | GCA001057035_00794 | gene | open | 12185-14656 | |||
| 1606 | JVFB01000043.1 | GCA001057035_00795 | gene | open | 14877-15563 | |||
| 1607 | JVFB01000043.1 | GCA001057035_00796 | gene | open | 15610-16287 | |||
| 1608 | JVFB01000043.1 | GCA001057035_00797 | gene | open | 16434-18233 | |||
| 1609 | JVFB01000043.1 | GCA001057035_00798 | gene | open | 18285-18833 | |||
| 1610 | JVFB01000043.1 | GCA001057035_00799 | gene | open | 19055-20341 | |||
| 1611 | JVFB01000043.1 | GCA001057035_00800 | gene | open | 20390-21163 | drrA | ||
| 1612 | JVFB01000043.1 | GCA001057035_00801 | gene | open | 21227-21736 | |||
| 1613 | JVFB01000043.1 | GCA001057035_00802 | gene | open | 21733-22395 | |||
| 1614 | JVFB01000043.1 | GCA001057035_00803 | gene | open | 22957-23910 | |||
| 1615 | JVFB01000043.1 | GCA001057035_00804 | gene | open | 24000-25127 | folK | ||
| 1616 | JVFB01000043.1 | GCA001057035_00805 | gene | open | 25384-26202 | panB | ||
| 1617 | JVFB01000043.1 | GCA001057035_00806 | gene | open | 26204-26452 | |||
| 1618 | JVFB01000043.1 | GCA001057035_00807 | gene | open | 26454-26804 | |||
| 1619 | JVFB01000043.1 | GCA001057035_00808 | gene | open | 27566-28246 | rluA | ||
| 1620 | JVFB01000043.1 | GCA001057035_00809 | gene | open | 28268-28762 | |||
| 1621 | JVFB01000043.1 | GCA001057035_00810 | gene | open | 28926-28998 | trnK | ||
| 1622 | JVFB01000043.1 | GCA001057035_00810 | tRNA | open | 28926-28998 | trnK | tRNA-Lys(ctt) | |
| 1623 | JVFB01000044.1 | GCA001057035_00811 | CDS | open | 224-2167 | _na 647_aa | Colicin I receptor | |
| 1624 | JVFB01000044.1 | GCA001057035_00812 | CDS | open | 2243-2875 | _na 210_aa | hmuY | HmuY protein |
| 1625 | JVFB01000044.1 | GCA001057035_00813 | CDS | open | 2884-4083 | _na 399_aa | hmuY | HmuY protein |
| 1626 | JVFB01000044.1 | GCA001057035_00814 | CDS | open | 4206-4793 | _na 195_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 1627 | JVFB01000044.1 | GCA001057035_00815 | CDS | open | 4795-5670 | _na 291_aa | Glycosyl hydrolase family 25 | |
| 1628 | JVFB01000044.1 | GCA001057035_00816 | CDS | open | 6113-6694 | _na 193_aa | hypothetical protein | |
| 1629 | JVFB01000044.1 | GCA001057035_00817 | CDS | open | 6678-7778 | _na 366_aa | Methylmalonyl-CoA mutase domain-containing protein | |
| 1630 | JVFB01000044.1 | GCA001057035_00818 | CDS | open | 7931-9205 | _na 424_aa | NADH:ubiquinone reductase (non-electrogenic) | |
| 1631 | JVFB01000044.1 | GCA001057035_00819 | CDS | open | 9265-11679 | _na 804_aa | SSD domain-containing protein | |
| 1632 | JVFB01000044.1 | GCA001057035_00820 | CDS | open | 12688-15471 | _na 927_aa | Ycf48-like protein | |
| 1633 | JVFB01000044.1 | GCA001057035_00821 | CDS | open | 15564-18671 | _na 1035_aa | Beta-galactosidase | |
| 1634 | JVFB01000044.1 | GCA001057035_00822 | CDS | open | 18719-20281 | _na 520_aa | Arylsulfatase | |
| 1635 | JVFB01000044.1 | GCA001057035_00823 | CDS | open | 20776-21399 | _na 207_aa | WbqC-like protein | |
| 1636 | JVFB01000044.1 | GCA001057035_00824 | CDS | open | 21401-22954 | _na 517_aa | lepB | signal peptidase I |
| 1637 | JVFB01000044.1 | GCA001057035_00825 | CDS | open | 22974-23855 | _na 293_aa | Cof-like hydrolase | |
| 1638 | JVFB01000044.1 | GCA001057035_00826 | CDS | open | 23905-24606 | _na 233_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 1639 | JVFB01000044.1 | GCA001057035_00827 | CDS | open | 24889-25665 | _na 258_aa | NlpC/P60 domain-containing protein | |
| 1640 | JVFB01000044.1 | GCA001057035_00828 | CDS | open | 25775-26689 | _na 304_aa | NTF2 fold immunity protein domain-containing protein | |
| 1641 | JVFB01000044.1 | GCA001057035_00829 | CDS | open | 26711-27454 | _na 247_aa | ubiE | Ubiquinone/menaquinone biosynthesis methyltransferase ubiE |
| 1642 | JVFB01000044.1 | GCA001057035_00830 | CDS | open | 27558-28157 | _na 199_aa | 50S ribosomal protein L25/general stress protein Ctc | |
| 1643 | JVFB01000044.1 | GCA001057035_00831 | CDS | open | 28257-29201 | _na 314_aa | ribose-phosphate diphosphokinase | |
| 1644 | JVFB01000044.1 | GCA001057035_00832 | CDS | open | 29818-31278 | _na 486_aa | DUF6850 domain-containing protein | |
| 1645 | JVFB01000044.1 | GCA001057035_00833 | CDS | open | 31428-32636 | _na 402_aa | DUF4876 domain-containing protein | |
| 1646 | JVFB01000044.1 | GCA001057035_00834 | CDS | open | 32651-35284 | _na 877_aa | TonB-dependent receptor plug domain-containing protein | |
| 1647 | JVFB01000044.1 | GCA001057035_00835 | CDS | open | 36133-36975 | _na 280_aa | Serine acetyltransferase | |
| 1648 | JVFB01000044.1 | GCA001057035_00836 | CDS | open | 37089-37997 | _na 302_aa | cysK | cysteine synthase A |
| 1649 | JVFB01000044.1 | GCA001057035_00837 | CDS | open | 38045-39946 | _na 633_aa | Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein | |
| 1650 | JVFB01000044.1 | GCA001057035_00838 | CDS | open | 39943-41082 | _na 379_aa | Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein | |
| 1651 | JVFB01000044.1 | GCA001057035_00839 | CDS | open | 41505-42056 | _na 183_aa | DUF4199 domain-containing protein | |
| 1652 | JVFB01000044.1 | GCA001057035_00840 | CDS | open | 42682-45168 | _na 828_aa | histidine kinase | |
| 1653 | JVFB01000044.1 | GCA001057035_00841 | CDS | open | 45218-46087 | _na 289_aa | Uridine phosphorylase | |
| 1654 | JVFB01000044.1 | GCA001057035_00842 | CDS | open | 46108-46473 | _na 121_aa | Na(+)-translocating NADH-quinone reductase subunit F | |
| 1655 | JVFB01000044.1 | GCA001057035_00843 | CDS | open | 46522-47523 | _na 333_aa | Cystathionine beta-synthase Rv1077 | |
| 1656 | JVFB01000044.1 | GCA001057035_00844 | CDS | open | 47558-48820 | _na 420_aa | 8-amino-7-oxononanoate synthase | |
| 1657 | JVFB01000044.1 | GCA001057035_00845 | CDS | open | 48934-49632 | _na 232_aa | Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase | |
| 1658 | JVFB01000044.1 | GCA001057035_00846 | CDS | open | 49649-50014 | _na 121_aa | Prokaryotic diacylglycerol kinase | |
| 1659 | JVFB01000044.1 | GCA001057035_00847 | CDS | open | 50023-50898 | _na 291_aa | eamA | EamA domain-containing protein |
| 1660 | JVFB01000044.1 | GCA001057035_00848 | CDS | open | 50931-52997 | _na 688_aa | metG | methionine--tRNA ligase |
| 1661 | JVFB01000044.1 | GCA001057035_00849 | CDS | open | 53434-54912 | _na 492_aa | C4-dicarboxylate ABC transporter | |
| 1662 | JVFB01000044.1 | GCA001057035_00850 | CDS | open | 54925-55551 | _na 208_aa | Peptidase S54 rhomboid domain-containing protein | |
| 1663 | JVFB01000044.1 | GCA001057035_00851 | CDS | open | 55578-58307 | _na 909_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 1664 | JVFB01000044.1 | GCA001057035_00852 | CDS | open | 58340-59560 | _na 406_aa | Cysteine desulfurase | |
| 1665 | JVFB01000044.1 | GCA001057035_00853 | CDS | open | 59595-61193 | _na 532_aa | bshC | bacillithiol biosynthesis cysteine-adding enzyme BshC |
| 1666 | JVFB01000044.1 | GCA001057035_00854 | CDS | open | 61212-61550 | _na 112_aa | DNA primase | |
| 1667 | JVFB01000044.1 | GCA001057035_00855 | CDS | open | 61644-62384 | _na 246_aa | 16S rRNA (uracil(1498)-N(3))-methyltransferase | |
| 1668 | JVFB01000044.1 | GCA001057035_00856 | CDS | open | 62732-65908 | _na 1058_aa | czcA | Heavy metal efflux pump%2C CzcA family |
| 1669 | JVFB01000044.1 | GCA001057035_00857 | CDS | open | 66025-66555 | _na 176_aa | DUF4136 domain-containing protein | |
| 1670 | JVFB01000044.1 | GCA001057035_00858 | CDS | open | 66616-67581 | _na 321_aa | Farnesyl diphosphate synthase | |
| 1671 | JVFB01000044.1 | GCA001057035_00859 | CDS | open | 67625-69283 | _na 552_aa | recN | DNA repair protein RecN |
| 1672 | JVFB01000044.1 | GCA001057035_00860 | CDS | open | 69289-70185 | _na 298_aa | DUF4835 domain-containing protein | |
| 1673 | JVFB01000044.1 | GCA001057035_00861 | CDS | open | 70214-71338 | _na 374_aa | 3%2C4-dihydroxy-2-butanone 4-phosphate synthase | |
| 1674 | JVFB01000044.1 | GCA001057035_00862 | CDS | open | 71422-71967 | _na 181_aa | Lipoprotein | |
| 1675 | JVFB01000044.1 | GCA001057035_00863 | CDS | open | 71967-73502 | _na 511_aa | AAA+ ATPase domain-containing protein | |
| 1676 | JVFB01000044.1 | GCA001057035_00864 | CDS | open | 74027-75010 | _na 327_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 1677 | JVFB01000044.1 | GCA001057035_00865 | CDS | open | 75094-76101 | _na 335_aa | Aldose 1-epimerase | |
| 1678 | JVFB01000044.1 | GCA001057035_00866 | CDS | open | 76178-77236 | _na 352_aa | 37-kD nucleoid-associated bacterial protein | |
| 1679 | JVFB01000044.1 | GCA001057035_00867 | CDS | open | 77267-77776 | _na 169_aa | Plasmid pRiA4b Orf3-like domain-containing protein | |
| 1680 | JVFB01000044.1 | GCA001057035_00868 | CDS | open | 77885-79015 | _na 376_aa | peptidylprolyl isomerase | |
| 1681 | JVFB01000044.1 | GCA001057035_00869 | CDS | open | 79041-79583 | _na 180_aa | gldI | gliding motility-associated peptidyl-prolyl isomerase GldI |
| 1682 | JVFB01000044.1 | GCA001057035_00870 | CDS | open | 79620-80627 | _na 335_aa | nrnA | Bifunctional oligoribonuclease and PAP phosphatase nrnA |
| 1683 | JVFB01000044.1 | GCA001057035_00871 | CDS | open | 81075-81377 | _na 100_aa | hypothetical protein | |
| 1684 | JVFB01000044.1 | GCA001057035_00872 | CDS | open | 81494-81628 | _na 44_aa | hypothetical protein | |
| 1685 | JVFB01000044.1 | GCA001057035_00873 | CDS | open | 81649-83553 | _na 634_aa | dnaK | molecular chaperone DnaK |
| 1686 | JVFB01000044.1 | GCA001057035_00874 | CDS | open | 83706-86312 | _na 868_aa | clpB | ATP-dependent chaperone ClpB |
| 1687 | JVFB01000044.1 | GCA001057035_00875 | CDS | open | 87225-87710 | _na 161_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 1688 | JVFB01000044.1 | GCA001057035_00876 | CDS | open | 87703-89250 | _na 515_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1689 | JVFB01000044.1 | GCA001057035_00877 | CDS | open | 89310-91238 | _na 642_aa | cwlS | D-gamma-glutamyl-meso-diaminopimelic acid endopeptidase CwlS |
| 1690 | JVFB01000044.1 | GCA001057035_00878 | CDS | open | 91258-92247 | _na 329_aa | aspartate-semialdehyde dehydrogenase | |
| 1691 | JVFB01000044.1 | GCA001057035_00811 | gene | open | 224-2167 | |||
| 1692 | JVFB01000044.1 | GCA001057035_00812 | gene | open | 2243-2875 | hmuY | ||
| 1693 | JVFB01000044.1 | GCA001057035_00813 | gene | open | 2884-4083 | hmuY | ||
| 1694 | JVFB01000044.1 | GCA001057035_00814 | gene | open | 4206-4793 | |||
| 1695 | JVFB01000044.1 | GCA001057035_00815 | gene | open | 4795-5670 | |||
| 1696 | JVFB01000044.1 | GCA001057035_00816 | gene | open | 6113-6694 | |||
| 1697 | JVFB01000044.1 | GCA001057035_00817 | gene | open | 6678-7778 | |||
| 1698 | JVFB01000044.1 | GCA001057035_00818 | gene | open | 7931-9205 | |||
| 1699 | JVFB01000044.1 | GCA001057035_00819 | gene | open | 9265-11679 | |||
| 1700 | JVFB01000044.1 | GCA001057035_00820 | gene | open | 12688-15471 | |||
| 1701 | JVFB01000044.1 | GCA001057035_00821 | gene | open | 15564-18671 | |||
| 1702 | JVFB01000044.1 | GCA001057035_00822 | gene | open | 18719-20281 | |||
| 1703 | JVFB01000044.1 | GCA001057035_00823 | gene | open | 20776-21399 | |||
| 1704 | JVFB01000044.1 | GCA001057035_00824 | gene | open | 21401-22954 | lepB | ||
| 1705 | JVFB01000044.1 | GCA001057035_00825 | gene | open | 22974-23855 | |||
| 1706 | JVFB01000044.1 | GCA001057035_00826 | gene | open | 23905-24606 | dapB | ||
| 1707 | JVFB01000044.1 | GCA001057035_00827 | gene | open | 24889-25665 | |||
| 1708 | JVFB01000044.1 | GCA001057035_00828 | gene | open | 25775-26689 | |||
| 1709 | JVFB01000044.1 | GCA001057035_00829 | gene | open | 26711-27454 | ubiE | ||
| 1710 | JVFB01000044.1 | GCA001057035_00830 | gene | open | 27558-28157 | |||
| 1711 | JVFB01000044.1 | GCA001057035_00831 | gene | open | 28257-29201 | |||
| 1712 | JVFB01000044.1 | GCA001057035_00832 | gene | open | 29818-31278 | |||
| 1713 | JVFB01000044.1 | GCA001057035_00833 | gene | open | 31428-32636 | |||
| 1714 | JVFB01000044.1 | GCA001057035_00834 | gene | open | 32651-35284 | |||
| 1715 | JVFB01000044.1 | GCA001057035_00835 | gene | open | 36133-36975 | |||
| 1716 | JVFB01000044.1 | GCA001057035_00836 | gene | open | 37089-37997 | cysK | ||
| 1717 | JVFB01000044.1 | GCA001057035_00837 | gene | open | 38045-39946 | |||
| 1718 | JVFB01000044.1 | GCA001057035_00838 | gene | open | 39943-41082 | |||
| 1719 | JVFB01000044.1 | GCA001057035_00839 | gene | open | 41505-42056 | |||
| 1720 | JVFB01000044.1 | GCA001057035_00840 | gene | open | 42682-45168 | |||
| 1721 | JVFB01000044.1 | GCA001057035_00841 | gene | open | 45218-46087 | |||
| 1722 | JVFB01000044.1 | GCA001057035_00842 | gene | open | 46108-46473 | |||
| 1723 | JVFB01000044.1 | GCA001057035_00843 | gene | open | 46522-47523 | |||
| 1724 | JVFB01000044.1 | GCA001057035_00844 | gene | open | 47558-48820 | |||
| 1725 | JVFB01000044.1 | GCA001057035_00845 | gene | open | 48934-49632 | |||
| 1726 | JVFB01000044.1 | GCA001057035_00846 | gene | open | 49649-50014 | |||
| 1727 | JVFB01000044.1 | GCA001057035_00847 | gene | open | 50023-50898 | eamA | ||
| 1728 | JVFB01000044.1 | GCA001057035_00848 | gene | open | 50931-52997 | metG | ||
| 1729 | JVFB01000044.1 | GCA001057035_00849 | gene | open | 53434-54912 | |||
| 1730 | JVFB01000044.1 | GCA001057035_00850 | gene | open | 54925-55551 | |||
| 1731 | JVFB01000044.1 | GCA001057035_00851 | gene | open | 55578-58307 | |||
| 1732 | JVFB01000044.1 | GCA001057035_00852 | gene | open | 58340-59560 | |||
| 1733 | JVFB01000044.1 | GCA001057035_00853 | gene | open | 59595-61193 | bshC | ||
| 1734 | JVFB01000044.1 | GCA001057035_00854 | gene | open | 61212-61550 | |||
| 1735 | JVFB01000044.1 | GCA001057035_00855 | gene | open | 61644-62384 | |||
| 1736 | JVFB01000044.1 | GCA001057035_00856 | gene | open | 62732-65908 | czcA | ||
| 1737 | JVFB01000044.1 | GCA001057035_00857 | gene | open | 66025-66555 | |||
| 1738 | JVFB01000044.1 | GCA001057035_00858 | gene | open | 66616-67581 | |||
| 1739 | JVFB01000044.1 | GCA001057035_00859 | gene | open | 67625-69283 | recN | ||
| 1740 | JVFB01000044.1 | GCA001057035_00860 | gene | open | 69289-70185 | |||
| 1741 | JVFB01000044.1 | GCA001057035_00861 | gene | open | 70214-71338 | |||
| 1742 | JVFB01000044.1 | GCA001057035_00862 | gene | open | 71422-71967 | |||
| 1743 | JVFB01000044.1 | GCA001057035_00863 | gene | open | 71967-73502 | |||
| 1744 | JVFB01000044.1 | GCA001057035_00864 | gene | open | 74027-75010 | murB | ||
| 1745 | JVFB01000044.1 | GCA001057035_00865 | gene | open | 75094-76101 | |||
| 1746 | JVFB01000044.1 | GCA001057035_00866 | gene | open | 76178-77236 | |||
| 1747 | JVFB01000044.1 | GCA001057035_00867 | gene | open | 77267-77776 | |||
| 1748 | JVFB01000044.1 | GCA001057035_00868 | gene | open | 77885-79015 | |||
| 1749 | JVFB01000044.1 | GCA001057035_00869 | gene | open | 79041-79583 | gldI | ||
| 1750 | JVFB01000044.1 | GCA001057035_00870 | gene | open | 79620-80627 | nrnA | ||
| 1751 | JVFB01000044.1 | GCA001057035_00871 | gene | open | 81075-81377 | |||
| 1752 | JVFB01000044.1 | GCA001057035_00872 | gene | open | 81494-81628 | |||
| 1753 | JVFB01000044.1 | GCA001057035_00873 | gene | open | 81649-83553 | dnaK | ||
| 1754 | JVFB01000044.1 | GCA001057035_00874 | gene | open | 83706-86312 | clpB | ||
| 1755 | JVFB01000044.1 | GCA001057035_00875 | gene | open | 87225-87710 | |||
| 1756 | JVFB01000044.1 | GCA001057035_00876 | gene | open | 87703-89250 | guaA | ||
| 1757 | JVFB01000044.1 | GCA001057035_00877 | gene | open | 89310-91238 | cwlS | ||
| 1758 | JVFB01000044.1 | GCA001057035_00878 | gene | open | 91258-92247 | |||
| 1759 | JVFB01000045.1 | repeat_region | open | 1-360 | CRISPR array with 5 repeats of length 46%2C consensus sequence GTTGTTATCAATCGCAAAACTACAAAATTTGAAAGCAATTCACAAC and spacer length 30 | |||
| 1760 | JVFB01000046.1 | GCA001057035_00879 | CDS | open | 425-808 | _na 127_aa | DUF4345 domain-containing protein | |
| 1761 | JVFB01000046.1 | GCA001057035_00880 | CDS | open | 798-1040 | _na 80_aa | F0F1-ATPase subunit Ca2+/Mg2+ transporter | |
| 1762 | JVFB01000046.1 | GCA001057035_00881 | CDS | open | 991-1437 | _na 148_aa | Polymer-forming cytoskeletal | |
| 1763 | JVFB01000046.1 | GCA001057035_00882 | CDS | open | 1615-2166 | _na 183_aa | dTTP/UTP pyrophosphatase | |
| 1764 | JVFB01000046.1 | GCA001057035_00883 | CDS | open | 2166-4025 | _na 619_aa | mrdA | penicillin-binding protein 2 |
| 1765 | JVFB01000046.1 | GCA001057035_00884 | CDS | open | 4022-4528 | _na 168_aa | mreD | rod shape-determining protein MreD |
| 1766 | JVFB01000046.1 | GCA001057035_00885 | CDS | open | 4525-5361 | _na 278_aa | mreC | rod shape-determining protein MreC |
| 1767 | JVFB01000046.1 | GCA001057035_00886 | CDS | open | 5397-6425 | _na 342_aa | mreB | Cell shape-determining protein MreB |
| 1768 | JVFB01000046.1 | GCA001057035_00887 | CDS | open | 7148-7633 | _na 161_aa | Transmembrane protein | |
| 1769 | JVFB01000046.1 | GCA001057035_00888 | CDS | open | 7665-8339 | _na 224_aa | cmk | (d)CMP kinase |
| 1770 | JVFB01000046.1 | GCA001057035_00889 | CDS | open | 8393-9526 | _na 377_aa | bioB | biotin synthase BioB |
| 1771 | JVFB01000046.1 | GCA001057035_00890 | CDS | open | 9575-9802 | _na 75_aa | DNA polymerase III subunit epsilon | |
| 1772 | JVFB01000046.1 | GCA001057035_00891 | CDS | open | 9783-10292 | _na 169_aa | Transferase hexapeptide repeat containing protein | |
| 1773 | JVFB01000046.1 | GCA001057035_00892 | CDS | open | 10637-11164 | _na 175_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1774 | JVFB01000046.1 | GCA001057035_00893 | CDS | open | 11232-12047 | _na 271_aa | 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase | |
| 1775 | JVFB01000046.1 | GCA001057035_00894 | CDS | open | 12059-14695 | _na 878_aa | valine--tRNA ligase | |
| 1776 | JVFB01000046.1 | GCA001057035_00895 | CDS | open | 15120-16751 | _na 543_aa | Peptidase C45 acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase | |
| 1777 | JVFB01000046.1 | GCA001057035_00896 | CDS | open | 17078-18301 | _na 407_aa | Nuclease SbcCD subunit D | |
| 1778 | JVFB01000046.1 | GCA001057035_00897 | CDS | open | 18384-19532 | _na 382_aa | THUMP domain-containing protein | |
| 1779 | JVFB01000046.1 | GCA001057035_00898 | CDS | open | 19537-20298 | _na 253_aa | Acyltransferase 3 domain-containing protein | |
| 1780 | JVFB01000046.1 | GCA001057035_00899 | CDS | open | 20304-20840 | _na 178_aa | cytochrome c | |
| 1781 | JVFB01000046.1 | GCA001057035_00900 | CDS | open | 20851-22653 | _na 600_aa | nrfD | Polysulfide reductase%2C NrfD |
| 1782 | JVFB01000046.1 | GCA001057035_00901 | CDS | open | 22668-25529 | _na 953_aa | Anaerobic dimethyl sulfoxide reductase chain B | |
| 1783 | JVFB01000046.1 | GCA001057035_00902 | CDS | open | 25553-26254 | _na 233_aa | Class III cytochrome C domain-containing protein | |
| 1784 | JVFB01000046.1 | GCA001057035_00903 | CDS | open | 26297-26887 | _na 196_aa | coaE | dephospho-CoA kinase |
| 1785 | JVFB01000046.1 | GCA001057035_00904 | CDS | open | 26884-27816 | _na 310_aa | YbbR-like protein | |
| 1786 | JVFB01000046.1 | GCA001057035_00905 | CDS | open | 28014-28853 | _na 279_aa | prephenate dehydrogenase | |
| 1787 | JVFB01000046.1 | GCA001057035_00906 | CDS | open | 28861-31209 | _na 782_aa | hypothetical protein | |
| 1788 | JVFB01000046.1 | GCA001057035_00879 | gene | open | 425-808 | |||
| 1789 | JVFB01000046.1 | GCA001057035_00880 | gene | open | 798-1040 | |||
| 1790 | JVFB01000046.1 | GCA001057035_00881 | gene | open | 991-1437 | |||
| 1791 | JVFB01000046.1 | GCA001057035_00882 | gene | open | 1615-2166 | |||
| 1792 | JVFB01000046.1 | GCA001057035_00883 | gene | open | 2166-4025 | mrdA | ||
| 1793 | JVFB01000046.1 | GCA001057035_00884 | gene | open | 4022-4528 | mreD | ||
| 1794 | JVFB01000046.1 | GCA001057035_00885 | gene | open | 4525-5361 | mreC | ||
| 1795 | JVFB01000046.1 | GCA001057035_00886 | gene | open | 5397-6425 | mreB | ||
| 1796 | JVFB01000046.1 | GCA001057035_00887 | gene | open | 7148-7633 | |||
| 1797 | JVFB01000046.1 | GCA001057035_00888 | gene | open | 7665-8339 | cmk | ||
| 1798 | JVFB01000046.1 | GCA001057035_00889 | gene | open | 8393-9526 | bioB | ||
| 1799 | JVFB01000046.1 | GCA001057035_00890 | gene | open | 9575-9802 | |||
| 1800 | JVFB01000046.1 | GCA001057035_00891 | gene | open | 9783-10292 | |||
| 1801 | JVFB01000046.1 | GCA001057035_00892 | gene | open | 10637-11164 | |||
| 1802 | JVFB01000046.1 | GCA001057035_00893 | gene | open | 11232-12047 | |||
| 1803 | JVFB01000046.1 | GCA001057035_00894 | gene | open | 12059-14695 | |||
| 1804 | JVFB01000046.1 | GCA001057035_00895 | gene | open | 15120-16751 | |||
| 1805 | JVFB01000046.1 | GCA001057035_00896 | gene | open | 17078-18301 | |||
| 1806 | JVFB01000046.1 | GCA001057035_00897 | gene | open | 18384-19532 | |||
| 1807 | JVFB01000046.1 | GCA001057035_00898 | gene | open | 19537-20298 | |||
| 1808 | JVFB01000046.1 | GCA001057035_00899 | gene | open | 20304-20840 | |||
| 1809 | JVFB01000046.1 | GCA001057035_00900 | gene | open | 20851-22653 | nrfD | ||
| 1810 | JVFB01000046.1 | GCA001057035_00901 | gene | open | 22668-25529 | |||
| 1811 | JVFB01000046.1 | GCA001057035_00902 | gene | open | 25553-26254 | |||
| 1812 | JVFB01000046.1 | GCA001057035_00903 | gene | open | 26297-26887 | coaE | ||
| 1813 | JVFB01000046.1 | GCA001057035_00904 | gene | open | 26884-27816 | |||
| 1814 | JVFB01000046.1 | GCA001057035_00905 | gene | open | 28014-28853 | |||
| 1815 | JVFB01000046.1 | GCA001057035_00906 | gene | open | 28861-31209 | |||
| 1816 | JVFB01000047.1 | GCA001057035_00907 | CDS | open | 361-1395 | _na 344_aa | Peptidase | |
| 1817 | JVFB01000047.1 | GCA001057035_00908 | CDS | open | 1457-1903 | _na 148_aa | Lipoprotein | |
| 1818 | JVFB01000047.1 | GCA001057035_00909 | CDS | open | 1979-4453 | _na 824_aa | Beta-galactosidase | |
| 1819 | JVFB01000047.1 | GCA001057035_00910 | CDS | open | 4606-5253 | _na 215_aa | GCN5-related N-acetyltransferase | |
| 1820 | JVFB01000047.1 | GCA001057035_00911 | CDS | open | 5339-8746 | _na 1135_aa | ileS | isoleucine--tRNA ligase |
| 1821 | JVFB01000047.1 | GCA001057035_00912 | CDS | open | 9040-9180 | _na 46_aa | hypothetical protein | |
| 1822 | JVFB01000047.1 | GCA001057035_00913 | CDS | open | 9739-11529 | _na 596_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 1823 | JVFB01000047.1 | GCA001057035_00914 | CDS | open | 11510-11995 | _na 161_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 1824 | JVFB01000047.1 | GCA001057035_00915 | CDS | open | 12165-13352 | _na 395_aa | ybhR | Inner membrane transport permease ybhR |
| 1825 | JVFB01000047.1 | GCA001057035_00916 | CDS | open | 13339-14490 | _na 383_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 1826 | JVFB01000047.1 | GCA001057035_00917 | CDS | open | 14517-14999 | _na 160_aa | DUF2262 domain-containing protein | |
| 1827 | JVFB01000047.1 | GCA001057035_00918 | CDS | open | 14996-15421 | _na 141_aa | DUF4381 domain-containing protein | |
| 1828 | JVFB01000047.1 | GCA001057035_00919 | CDS | open | 15463-15993 | _na 176_aa | Integral membrane protein | |
| 1829 | JVFB01000047.1 | GCA001057035_00920 | CDS | open | 16063-16416 | _na 117_aa | MmcQ-like protein | |
| 1830 | JVFB01000047.1 | GCA001057035_00921 | CDS | open | 16413-17318 | _na 301_aa | Lipoprotein | |
| 1831 | JVFB01000047.1 | GCA001057035_00922 | CDS | open | 17460-17921 | _na 153_aa | GCN5-related N-acetyltransferase | |
| 1832 | JVFB01000047.1 | GCA001057035_00923 | CDS | open | 17918-18898 | _na 326_aa | hlyD | Secretion protein HlyD family protein |
| 1833 | JVFB01000047.1 | GCA001057035_00924 | CDS | open | 19140-20552 | _na 470_aa | Outer membrane channel protein | |
| 1834 | JVFB01000047.1 | GCA001057035_00925 | CDS | open | 20663-22780 | _na 705_aa | Heparinase II/III-like C-terminal domain-containing protein | |
| 1835 | JVFB01000047.1 | GCA001057035_00926 | CDS | open | 23367-23561 | _na 64_aa | hypothetical protein | |
| 1836 | JVFB01000047.1 | GCA001057035_00927 | CDS | open | 23863-24039 | _na 58_aa | gldL | Gliding motility-associated protein GldL |
| 1837 | JVFB01000047.1 | GCA001057035_00928 | CDS | open | 24152-24901 | _na 249_aa | Putative uroporphyrinogen-III synthase | |
| 1838 | JVFB01000047.1 | GCA001057035_00929 | CDS | open | 24935-25639 | _na 234_aa | DUF4271 domain-containing protein | |
| 1839 | JVFB01000047.1 | GCA001057035_00930 | CDS | open | 25653-26033 | _na 126_aa | DUF4296 domain-containing protein | |
| 1840 | JVFB01000047.1 | GCA001057035_00931 | CDS | open | 26038-27375 | _na 445_aa | dihydroorotase | |
| 1841 | JVFB01000047.1 | GCA001057035_00932 | CDS | open | 27381-27923 | _na 180_aa | N-acetyltransferase domain-containing protein | |
| 1842 | JVFB01000047.1 | GCA001057035_00933 | CDS | open | 27923-28213 | _na 96_aa | Zn-ribbon-containing%2C possibly RNA-binding protein and truncated derivatives | |
| 1843 | JVFB01000047.1 | GCA001057035_00934 | CDS | open | 28477-29268 | _na 263_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1844 | JVFB01000047.1 | GCA001057035_00935 | CDS | open | 29245-30009 | _na 254_aa | Ser/Thr phosphatase family protein | |
| 1845 | JVFB01000047.1 | GCA001057035_00936 | CDS | open | 30098-30607 | _na 169_aa | hypothetical protein | |
| 1846 | JVFB01000047.1 | GCA001057035_00937 | CDS | open | 30769-31212 | _na 147_aa | 6-carboxy-5%2C6%2C7%2C8-tetrahydropterin synthase | |
| 1847 | JVFB01000047.1 | GCA001057035_00938 | CDS | open | 31487-32410 | _na 307_aa | besA | Ferri-bacillibactin esterase BesA |
| 1848 | JVFB01000047.1 | GCA001057035_00939 | CDS | open | 32462-33802 | _na 446_aa | DUF4374 domain-containing protein | |
| 1849 | JVFB01000047.1 | GCA001057035_00940 | CDS | open | 33835-35976 | _na 713_aa | cysA | Sulfate/thiosulfate import ATP-binding protein CysA |
| 1850 | JVFB01000047.1 | GCA001057035_00941 | CDS | open | 37008-37985 | _na 325_aa | Mevalonate kinase | |
| 1851 | JVFB01000047.1 | GCA001057035_00942 | CDS | open | 38032-39918 | _na 628_aa | Amidophosphoribosyltransferase | |
| 1852 | JVFB01000047.1 | GCA001057035_00907 | gene | open | 361-1395 | |||
| 1853 | JVFB01000047.1 | GCA001057035_00908 | gene | open | 1457-1903 | |||
| 1854 | JVFB01000047.1 | GCA001057035_00909 | gene | open | 1979-4453 | |||
| 1855 | JVFB01000047.1 | GCA001057035_00910 | gene | open | 4606-5253 | |||
| 1856 | JVFB01000047.1 | GCA001057035_00911 | gene | open | 5339-8746 | ileS | ||
| 1857 | JVFB01000047.1 | GCA001057035_00912 | gene | open | 9040-9180 | |||
| 1858 | JVFB01000047.1 | GCA001057035_00913 | gene | open | 9739-11529 | nrdD | ||
| 1859 | JVFB01000047.1 | GCA001057035_00914 | gene | open | 11510-11995 | nrdG | ||
| 1860 | JVFB01000047.1 | GCA001057035_00915 | gene | open | 12165-13352 | ybhR | ||
| 1861 | JVFB01000047.1 | GCA001057035_00916 | gene | open | 13339-14490 | |||
| 1862 | JVFB01000047.1 | GCA001057035_00917 | gene | open | 14517-14999 | |||
| 1863 | JVFB01000047.1 | GCA001057035_00918 | gene | open | 14996-15421 | |||
| 1864 | JVFB01000047.1 | GCA001057035_00919 | gene | open | 15463-15993 | |||
| 1865 | JVFB01000047.1 | GCA001057035_00920 | gene | open | 16063-16416 | |||
| 1866 | JVFB01000047.1 | GCA001057035_00921 | gene | open | 16413-17318 | |||
| 1867 | JVFB01000047.1 | GCA001057035_00922 | gene | open | 17460-17921 | |||
| 1868 | JVFB01000047.1 | GCA001057035_00923 | gene | open | 17918-18898 | hlyD | ||
| 1869 | JVFB01000047.1 | GCA001057035_00924 | gene | open | 19140-20552 | |||
| 1870 | JVFB01000047.1 | GCA001057035_00925 | gene | open | 20663-22780 | |||
| 1871 | JVFB01000047.1 | GCA001057035_00926 | gene | open | 23367-23561 | |||
| 1872 | JVFB01000047.1 | GCA001057035_00927 | gene | open | 23863-24039 | gldL | ||
| 1873 | JVFB01000047.1 | GCA001057035_00928 | gene | open | 24152-24901 | |||
| 1874 | JVFB01000047.1 | GCA001057035_00929 | gene | open | 24935-25639 | |||
| 1875 | JVFB01000047.1 | GCA001057035_00930 | gene | open | 25653-26033 | |||
| 1876 | JVFB01000047.1 | GCA001057035_00931 | gene | open | 26038-27375 | |||
| 1877 | JVFB01000047.1 | GCA001057035_00932 | gene | open | 27381-27923 | |||
| 1878 | JVFB01000047.1 | GCA001057035_00933 | gene | open | 27923-28213 | |||
| 1879 | JVFB01000047.1 | GCA001057035_00934 | gene | open | 28477-29268 | |||
| 1880 | JVFB01000047.1 | GCA001057035_00935 | gene | open | 29245-30009 | |||
| 1881 | JVFB01000047.1 | GCA001057035_00936 | gene | open | 30098-30607 | |||
| 1882 | JVFB01000047.1 | GCA001057035_00937 | gene | open | 30769-31212 | |||
| 1883 | JVFB01000047.1 | GCA001057035_00938 | gene | open | 31487-32410 | besA | ||
| 1884 | JVFB01000047.1 | GCA001057035_00939 | gene | open | 32462-33802 | |||
| 1885 | JVFB01000047.1 | GCA001057035_00940 | gene | open | 33835-35976 | cysA | ||
| 1886 | JVFB01000047.1 | GCA001057035_00941 | gene | open | 37008-37985 | |||
| 1887 | JVFB01000047.1 | GCA001057035_00942 | gene | open | 38032-39918 | |||
| 1888 | JVFB01000048.1 | regulatory_region | open | 10465-10497 | DUF805b RNA | |||
| 1889 | JVFB01000048.1 | repeat_region | open | 1309-2276 | CRISPR array with 13 repeats of length 46%2C consensus sequence GTTGTGAATTGCTTTCAAATTTTGTAGTTTTGCGATTGATAACAAC and spacer length 30 | |||
| 1890 | JVFB01000048.1 | GCA001057035_00943 | CDS | open | 2384-2725 | _na 113_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1891 | JVFB01000048.1 | GCA001057035_00944 | CDS | open | 2722-3612 | _na 296_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 1892 | JVFB01000048.1 | GCA001057035_00945 | CDS | open | 3649-8025 | _na 1458_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 1893 | JVFB01000048.1 | GCA001057035_00946 | CDS | open | 8206-8658 | _na 150_aa | dtd | D-aminoacyl-tRNA deacylase |
| 1894 | JVFB01000048.1 | GCA001057035_00947 | CDS | open | 9197-9823 | _na 208_aa | WYL domain-containing protein | |
| 1895 | JVFB01000048.1 | GCA001057035_00948 | CDS | open | 10521-10748 | _na 75_aa | BNR/Asp-box repeat protein | |
| 1896 | JVFB01000048.1 | GCA001057035_00949 | CDS | open | 10824-11132 | _na 102_aa | hypothetical protein | |
| 1897 | JVFB01000048.1 | GCA001057035_00950 | CDS | open | 11181-11939 | _na 252_aa | Schlafen AlbA-2 domain-containing protein | |
| 1898 | JVFB01000048.1 | GCA001057035_00943 | gene | open | 2384-2725 | cas2 | ||
| 1899 | JVFB01000048.1 | GCA001057035_00944 | gene | open | 2722-3612 | cas1 | ||
| 1900 | JVFB01000048.1 | GCA001057035_00945 | gene | open | 3649-8025 | cas9 | ||
| 1901 | JVFB01000048.1 | GCA001057035_00946 | gene | open | 8206-8658 | dtd | ||
| 1902 | JVFB01000048.1 | GCA001057035_00947 | gene | open | 9197-9823 | |||
| 1903 | JVFB01000048.1 | GCA001057035_00948 | gene | open | 10521-10748 | |||
| 1904 | JVFB01000048.1 | GCA001057035_00949 | gene | open | 10824-11132 | |||
| 1905 | JVFB01000048.1 | GCA001057035_00950 | gene | open | 11181-11939 | |||
| 1906 | JVFB01000049.1 | GCA001057035_00988 | gene | open | 40588-40988 | ssrA | ||
| 1907 | JVFB01000049.1 | GCA001057035_00988 | tmRNA | open | 40588-40988 | ssrA | transfer-messenger RNA%2C SsrA | |
| 1908 | JVFB01000049.1 | GCA001057035_00951 | CDS | open | 208-369 | _na 53_aa | hypothetical protein | |
| 1909 | JVFB01000049.1 | GCA001057035_00952 | CDS | open | 557-1891 | _na 444_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 1910 | JVFB01000049.1 | GCA001057035_00953 | CDS | open | 1894-3126 | _na 410_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 1911 | JVFB01000049.1 | GCA001057035_00954 | CDS | open | 3152-4183 | _na 343_aa | hemH | ferrochelatase |
| 1912 | JVFB01000049.1 | GCA001057035_00955 | CDS | open | 4269-4814 | _na 181_aa | Protoporphyrinogen IX oxidase | |
| 1913 | JVFB01000049.1 | GCA001057035_00956 | CDS | open | 4990-6699 | _na 569_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 1914 | JVFB01000049.1 | GCA001057035_00957 | CDS | open | 7208-8260 | _na 350_aa | DUF3078 domain-containing protein | |
| 1915 | JVFB01000049.1 | GCA001057035_00958 | CDS | open | 8264-8857 | _na 197_aa | thymidine kinase | |
| 1916 | JVFB01000049.1 | GCA001057035_00959 | CDS | open | 9002-10285 | _na 427_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 1917 | JVFB01000049.1 | GCA001057035_00960 | CDS | open | 10398-11840 | _na 480_aa | Arylsulfatase | |
| 1918 | JVFB01000049.1 | GCA001057035_00961 | CDS | open | 12532-12801 | _na 89_aa | Glutaredoxin-2 domain protein | |
| 1919 | JVFB01000049.1 | GCA001057035_00962 | CDS | open | 12798-13274 | _na 158_aa | PIN domain-containing protein | |
| 1920 | JVFB01000049.1 | GCA001057035_00963 | CDS | open | 13400-15691 | _na 763_aa | Phosphate transporter | |
| 1921 | JVFB01000049.1 | GCA001057035_00964 | CDS | open | 15769-16959 | _na 396_aa | Phosphoglycerate kinase | |
| 1922 | JVFB01000049.1 | GCA001057035_00965 | CDS | open | 17147-18595 | _na 482_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 1923 | JVFB01000049.1 | GCA001057035_00966 | CDS | open | 18672-19175 | _na 167_aa | Phosphoesterase | |
| 1924 | JVFB01000049.1 | GCA001057035_00967 | CDS | open | 19172-19930 | _na 252_aa | rnc | ribonuclease III |
| 1925 | JVFB01000049.1 | GCA001057035_00968 | CDS | open | 19938-21185 | _na 415_aa | fabF | beta-ketoacyl-ACP synthase II |
| 1926 | JVFB01000049.1 | GCA001057035_00969 | CDS | open | 21283-21519 | _na 78_aa | acpP | acyl carrier protein |
| 1927 | JVFB01000049.1 | GCA001057035_00970 | CDS | open | 21695-22783 | _na 362_aa | 3-oxoacyl-(Acyl carrier protein) synthase II | |
| 1928 | JVFB01000049.1 | GCA001057035_00971 | CDS | open | 22801-23658 | _na 285_aa | NAD dependent epimerase/dehydratase family protein | |
| 1929 | JVFB01000049.1 | GCA001057035_00972 | CDS | open | 23760-24131 | _na 123_aa | DUF2809 domain-containing protein | |
| 1930 | JVFB01000049.1 | GCA001057035_00973 | CDS | open | 24170-24826 | _na 218_aa | TIGR02453 family protein | |
| 1931 | JVFB01000049.1 | GCA001057035_00974 | CDS | open | 25121-25648 | _na 175_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1932 | JVFB01000049.1 | GCA001057035_00975 | CDS | open | 25701-26144 | _na 147_aa | Lipoprotein | |
| 1933 | JVFB01000049.1 | GCA001057035_00976 | CDS | open | 26197-26664 | _na 155_aa | Lipoprotein | |
| 1934 | JVFB01000049.1 | GCA001057035_00977 | CDS | open | 26748-27881 | _na 377_aa | Clostripain family protein | |
| 1935 | JVFB01000049.1 | GCA001057035_00978 | CDS | open | 27996-28355 | _na 119_aa | DUF4397 domain-containing protein | |
| 1936 | JVFB01000049.1 | GCA001057035_00979 | CDS | open | 28366-28827 | _na 153_aa | Lipoprotein | |
| 1937 | JVFB01000049.1 | GCA001057035_00980 | CDS | open | 28830-30413 | _na 527_aa | Peptidase C10 family protein | |
| 1938 | JVFB01000049.1 | GCA001057035_00981 | CDS | open | 30511-32673 | _na 720_aa | TonB-dependent receptor | |
| 1939 | JVFB01000049.1 | GCA001057035_00982 | CDS | open | 32904-34208 | _na 434_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 1940 | JVFB01000049.1 | GCA001057035_00983 | CDS | open | 34248-35129 | _na 293_aa | 3-beta hydroxysteroid dehydrogenase/isomerase | |
| 1941 | JVFB01000049.1 | GCA001057035_00984 | CDS | open | 35207-35497 | _na 96_aa | DUF35 domain-containing protein | |
| 1942 | JVFB01000049.1 | GCA001057035_00985 | CDS | open | 35789-36592 | _na 267_aa | CPBP family glutamic-type intramembrane protease | |
| 1943 | JVFB01000049.1 | GCA001057035_00986 | CDS | open | 36624-38963 | _na 779_aa | TonB-dependent receptor plug domain-containing protein | |
| 1944 | JVFB01000049.1 | GCA001057035_00987 | CDS | open | 39221-40393 | _na 390_aa | HTH araC/xylS-type domain-containing protein | |
| 1945 | JVFB01000049.1 | GCA001057035_00989 | CDS | open | 41211-42029 | _na 272_aa | PI-PLC Y-box domain-containing protein | |
| 1946 | JVFB01000049.1 | GCA001057035_00990 | CDS | open | 42089-42241 | _na 50_aa | hypothetical protein | |
| 1947 | JVFB01000049.1 | GCA001057035_00991 | CDS | open | 42980-43756 | _na 258_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase FabG |
| 1948 | JVFB01000049.1 | GCA001057035_00992 | CDS | open | 43753-43980 | _na 75_aa | hypothetical protein | |
| 1949 | JVFB01000049.1 | GCA001057035_00993 | CDS | open | 44080-44412 | _na 110_aa | HTH merR-type domain-containing protein | |
| 1950 | JVFB01000049.1 | GCA001057035_00994 | CDS | open | 44412-45077 | _na 221_aa | Winged helix DNA-binding domain-containing protein | |
| 1951 | JVFB01000049.1 | GCA001057035_00995 | CDS | open | 45096-45491 | _na 131_aa | putative protein conserved in bacteria | |
| 1952 | JVFB01000049.1 | GCA001057035_00996 | CDS | open | 45567-45986 | _na 139_aa | slyB | SlyB protein |
| 1953 | JVFB01000049.1 | GCA001057035_00997 | CDS | open | 46071-46493 | _na 140_aa | General stress protein 17o | |
| 1954 | JVFB01000049.1 | GCA001057035_00998 | CDS | open | 46626-47468 | _na 280_aa | Oxidoreductase%2C aldo/keto reductase family protein | |
| 1955 | JVFB01000049.1 | GCA001057035_00999 | CDS | open | 47573-48133 | _na 186_aa | DUF4469 domain-containing protein | |
| 1956 | JVFB01000049.1 | GCA001057035_01000 | CDS | open | 48441-49403 | _na 320_aa | BASS family bile acid:Na+ symporter | |
| 1957 | JVFB01000049.1 | GCA001057035_01001 | CDS | open | 49574-50566 | _na 330_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1958 | JVFB01000049.1 | GCA001057035_01002 | CDS | open | 50573-51394 | _na 273_aa | TonB-linked outer membrane protein%2C SusC/RagA family | |
| 1959 | JVFB01000049.1 | GCA001057035_01003 | CDS | open | 51552-52019 | _na 155_aa | ACR | |
| 1960 | JVFB01000049.1 | GCA001057035_01004 | CDS | open | 52107-52646 | _na 179_aa | Sigma-70 region 2 | |
| 1961 | JVFB01000049.1 | GCA001057035_01005 | CDS | open | 52649-53335 | _na 228_aa | Anti-sigma factor | |
| 1962 | JVFB01000049.1 | GCA001057035_01006 | CDS | open | 53352-54416 | _na 354_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1963 | JVFB01000049.1 | GCA001057035_01007 | CDS | open | 54969-59210 | _na 1413_aa | Alpha-glucan phosphorylase | |
| 1964 | JVFB01000049.1 | GCA001057035_01008 | CDS | open | 59415-60785 | _na 456_aa | OmpA-like domain-containing protein | |
| 1965 | JVFB01000049.1 | GCA001057035_01009 | CDS | open | 60884-62674 | _na 596_aa | uvrC | excinuclease ABC subunit UvrC |
| 1966 | JVFB01000049.1 | GCA001057035_01010 | CDS | open | 63001-63105 | _na 34_aa | hypothetical protein | |
| 1967 | JVFB01000049.1 | GCA001057035_01011 | CDS | open | 63149-66817 | _na 1222_aa | purL | phosphoribosylformylglycinamidine synthase |
| 1968 | JVFB01000049.1 | GCA001057035_01012 | CDS | open | 67054-67395 | _na 113_aa | Transcriptional regulator | |
| 1969 | JVFB01000049.1 | GCA001057035_01013 | CDS | open | 67649-67942 | _na 97_aa | relE | Toxin-antitoxin system%2C toxin component%2C RelE family |
| 1970 | JVFB01000049.1 | GCA001057035_01014 | CDS | open | 67932-68186 | _na 84_aa | Toxin-antitoxin system%2C antitoxin component%2C PHD family | |
| 1971 | JVFB01000049.1 | GCA001057035_01015 | CDS | open | 69380-70687 | _na 435_aa | corB | Mg2+ and Co2+ transporter CorB |
| 1972 | JVFB01000049.1 | GCA001057035_01016 | CDS | open | 70793-71266 | _na 157_aa | Cytochrome c domain-containing protein | |
| 1973 | JVFB01000049.1 | GCA001057035_01017 | CDS | open | 71456-72442 | _na 328_aa | hemB | porphobilinogen synthase |
| 1974 | JVFB01000049.1 | GCA001057035_01018 | CDS | open | 72501-73028 | _na 175_aa | Alpha/beta hydrolase | |
| 1975 | JVFB01000049.1 | GCA001057035_01019 | CDS | open | 73382-75397 | _na 671_aa | Peptidyl-dipeptidase Dcp | |
| 1976 | JVFB01000049.1 | GCA001057035_01020 | CDS | open | 75440-75976 | _na 178_aa | Isochorismatase family protein | |
| 1977 | JVFB01000049.1 | GCA001057035_01021 | CDS | open | 76047-76874 | _na 275_aa | Universal stress family protein | |
| 1978 | JVFB01000049.1 | GCA001057035_01022 | CDS | open | 77324-77791 | _na 155_aa | rimP | ribosome assembly cofactor RimP |
| 1979 | JVFB01000049.1 | GCA001057035_01023 | CDS | open | 77802-79034 | _na 410_aa | nusA | Transcription termination/antitermination protein NusA |
| 1980 | JVFB01000049.1 | GCA001057035_01024 | CDS | open | 79152-81989 | _na 945_aa | infB | translation initiation factor IF-2 |
| 1981 | JVFB01000049.1 | GCA001057035_01025 | CDS | open | 82042-84486 | _na 814_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1982 | JVFB01000049.1 | GCA001057035_01026 | CDS | open | 84490-85827 | _na 445_aa | PKD domain containing protein | |
| 1983 | JVFB01000049.1 | GCA001057035_01027 | CDS | open | 85962-86108 | _na 48_aa | hypothetical protein | |
| 1984 | JVFB01000049.1 | GCA001057035_00951 | gene | open | 208-369 | |||
| 1985 | JVFB01000049.1 | GCA001057035_00952 | gene | open | 557-1891 | murD | ||
| 1986 | JVFB01000049.1 | GCA001057035_00953 | gene | open | 1894-3126 | ftsW | ||
| 1987 | JVFB01000049.1 | GCA001057035_00954 | gene | open | 3152-4183 | hemH | ||
| 1988 | JVFB01000049.1 | GCA001057035_00955 | gene | open | 4269-4814 | |||
| 1989 | JVFB01000049.1 | GCA001057035_00956 | gene | open | 4990-6699 | dxs | ||
| 1990 | JVFB01000049.1 | GCA001057035_00957 | gene | open | 7208-8260 | |||
| 1991 | JVFB01000049.1 | GCA001057035_00958 | gene | open | 8264-8857 | |||
| 1992 | JVFB01000049.1 | GCA001057035_00959 | gene | open | 9002-10285 | |||
| 1993 | JVFB01000049.1 | GCA001057035_00960 | gene | open | 10398-11840 | |||
| 1994 | JVFB01000049.1 | GCA001057035_00961 | gene | open | 12532-12801 | |||
| 1995 | JVFB01000049.1 | GCA001057035_00962 | gene | open | 12798-13274 | |||
| 1996 | JVFB01000049.1 | GCA001057035_00963 | gene | open | 13400-15691 | |||
| 1997 | JVFB01000049.1 | GCA001057035_00964 | gene | open | 15769-16959 | |||
| 1998 | JVFB01000049.1 | GCA001057035_00965 | gene | open | 17147-18595 | miaB | ||
| 1999 | JVFB01000049.1 | GCA001057035_00966 | gene | open | 18672-19175 | |||
| 2000 | JVFB01000049.1 | GCA001057035_00967 | gene | open | 19172-19930 | rnc |

