HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Rothia dentocariosa (GCA_001061305.1)

Select a Genome:
BAKTA Annotations for GCA_001061305.1
Genome Selected: Rothia dentocariosa
ContigsBases CDSrRNA tmRNAtRNA
93 2491306 2134 9 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4392 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4392 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 JVXR01000059.1 GCA001061305_00599 CDS open 11524-12387 _na     287_aa DUF1963 domain-containing protein
2502 JVXR01000059.1 GCA001061305_00600 CDS open 12422-13630 _na     402_aa draG ADP-ribosylglycohydrolase
2503 JVXR01000059.1 GCA001061305_00601 CDS open 13661-14848 _na     395_aa sbcD Nuclease SbcCD subunit D
2504 JVXR01000059.1 GCA001061305_00602 CDS open 14845-18036 _na     1063_aa sbcC Exonuclease SbcCD%2C C subunit
2505 JVXR01000059.1 GCA001061305_00603 CDS open 18126-19643 _na     505_aa MFS transporter
2506 JVXR01000059.1 GCA001061305_00604 CDS open 19747-20394 _na     215_aa gloB Putative hydrolase
2507 JVXR01000059.1 GCA001061305_00605 CDS open 20416-21507 _na     363_aa frmA S-(hydroxymethyl)mycothiol dehydrogenase
2508 JVXR01000059.1 GCA001061305_00606 CDS open 21702-22637 _na     311_aa menH Hydrolase%2C alpha/beta domain protein
2509 JVXR01000059.1 GCA001061305_00607 CDS open 22802-24097 _na     431_aa brkB YihY family protein
2510 JVXR01000059.1 GCA001061305_00608 CDS open 24329-25810 _na     493_aa lhgO malate:quinone oxidoreductase
2511 JVXR01000059.1 GCA001061305_00609 CDS open 25993-27975 _na     660_aa ddpA Dipeptide-binding protein
2512 JVXR01000059.1 GCA001061305_00611 CDS open 28380-28856 _na     158_aa bcp thioredoxin-dependent thiol peroxidase
2513 JVXR01000059.1 GCA001061305_00591 gene open 344-1711 lpdA
2514 JVXR01000059.1 GCA001061305_00592 gene open 2056-3549 pepB
2515 JVXR01000059.1 GCA001061305_00593 gene open 3775-4686
2516 JVXR01000059.1 GCA001061305_00594 gene open 4955-6592
2517 JVXR01000059.1 GCA001061305_00595 gene open 6867-8273 rpoD
2518 JVXR01000059.1 GCA001061305_00596 gene open 8683-9570 ywqG
2519 JVXR01000059.1 GCA001061305_00597 gene open 9715-10569 ywqG
2520 JVXR01000059.1 GCA001061305_00598 gene open 10582-11466 ywqG
2521 JVXR01000059.1 GCA001061305_00599 gene open 11524-12387
2522 JVXR01000059.1 GCA001061305_00600 gene open 12422-13630 draG
2523 JVXR01000059.1 GCA001061305_00601 gene open 13661-14848 sbcD
2524 JVXR01000059.1 GCA001061305_00602 gene open 14845-18036 sbcC
2525 JVXR01000059.1 GCA001061305_00603 gene open 18126-19643
2526 JVXR01000059.1 GCA001061305_00604 gene open 19747-20394 gloB
2527 JVXR01000059.1 GCA001061305_00605 gene open 20416-21507 frmA
2528 JVXR01000059.1 GCA001061305_00606 gene open 21702-22637 menH
2529 JVXR01000059.1 GCA001061305_00607 gene open 22802-24097 brkB
2530 JVXR01000059.1 GCA001061305_00608 gene open 24329-25810 lhgO
2531 JVXR01000059.1 GCA001061305_00609 gene open 25993-27975 ddpA
2532 JVXR01000059.1 GCA001061305_00611 gene open 28380-28856 bcp
2533 JVXR01000059.1 GCA001061305_00610 gene open 28230-28314 trnL
2534 JVXR01000059.1 GCA001061305_00610 tRNA open 28230-28314 trnL tRNA-Leu(tag)
2535 JVXR01000062.1 GCA001061305_00612 CDS open 258-2348 _na     696_aa srmB ATP-dependent RNA helicase DeaD
2536 JVXR01000062.1 GCA001061305_00613 CDS open 2814-4565 _na     583_aa DUF2079 domain-containing protein
2537 JVXR01000062.1 GCA001061305_00614 CDS open 4785-5924 _na     379_aa alkA 3-methyladenine DNA glycosylase
2538 JVXR01000062.1 GCA001061305_00615 CDS open 6026-6391 _na     121_aa cnoX Thioredoxin
2539 JVXR01000062.1 GCA001061305_00617 CDS open 6797-7153 _na     118_aa hypothetical protein
2540 JVXR01000062.1 GCA001061305_00618 CDS open 7303-7794 _na     163_aa yajQ YajQ family cyclic di-GMP-binding protein
2541 JVXR01000062.1 GCA001061305_00619 CDS open 7880-8761 _na     293_aa htpX zinc metalloprotease HtpX
2542 JVXR01000062.1 GCA001061305_00620 CDS open 9057-9635 _na     192_aa fur Transcriptional repressor
2543 JVXR01000062.1 GCA001061305_00621 CDS open 9765-11255 _na     496_aa katE Catalase
2544 JVXR01000062.1 GCA001061305_00622 CDS open 11467-12822 _na     451_aa sseB SseB protein N-terminal domain-containing protein
2545 JVXR01000062.1 GCA001061305_00623 CDS open 13077-14597 _na     506_aa Hydrolase
2546 JVXR01000062.1 GCA001061305_00624 CDS open 14436-14756 _na     106_aa hypothetical protein
2547 JVXR01000062.1 GCA001061305_00625 CDS open 14843-15940 _na     365_aa rarD EamA family transporter RarD
2548 JVXR01000062.1 GCA001061305_00626 CDS open 16090-16227 _na     45_aa Methionine/alanine importer small subunit
2549 JVXR01000062.1 GCA001061305_00627 CDS open 16227-17837 _na     536_aa yocR Tat pathway signal sequence domain protein
2550 JVXR01000062.1 GCA001061305_00628 CDS open 18127-19437 _na     436_aa Polysaccharide biosynthesis protein
2551 JVXR01000062.1 GCA001061305_00629 CDS open 19557-20618 _na     353_aa ispA Octaprenyl-diphosphate synthase
2552 JVXR01000062.1 GCA001061305_00630 CDS open 20687-21412 _na     241_aa ubiE demethylmenaquinone methyltransferase
2553 JVXR01000062.1 GCA001061305_00631 CDS open 21716-22549 _na     277_aa hisJ Arginine-binding extracellular protein ArtP
2554 JVXR01000062.1 GCA001061305_00632 CDS open 22637-23440 _na     267_aa hisM Inner membrane amino-acid ABC transporter permease protein yecS
2555 JVXR01000062.1 GCA001061305_00633 CDS open 23468-24271 _na     267_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
2556 JVXR01000062.1 GCA001061305_00634 CDS open 24476-25291 _na     271_aa Serine 3-dehydrogenase
2557 JVXR01000062.1 GCA001061305_00635 CDS open 25306-26289 _na     327_aa HTH araC/xylS-type domain-containing protein
2558 JVXR01000062.1 GCA001061305_00636 CDS open 26398-26775 _na     125_aa qdoI Cupin domain protein
2559 JVXR01000062.1 GCA001061305_00637 CDS open 26921-28414 _na     497_aa PAP2 family protein
2560 JVXR01000062.1 GCA001061305_00638 CDS open 28556-29608 _na     350_aa rspA o-succinylbenzoate synthase
2561 JVXR01000062.1 GCA001061305_00639 CDS open 29711-31642 _na     643_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
2562 JVXR01000062.1 GCA001061305_00640 CDS open 31800-32693 _na     297_aa gloB MBL fold metallo-hydrolase
2563 JVXR01000062.1 GCA001061305_00641 CDS open 32867-33859 _na     330_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
2564 JVXR01000062.1 GCA001061305_00642 CDS open 34161-35657 _na     498_aa putP sodium/proline symporter PutP
2565 JVXR01000062.1 GCA001061305_00643 CDS open 35767-37149 _na     460_aa Pentapeptide repeat-containing protein
2566 JVXR01000062.1 GCA001061305_00644 CDS open 37424-38410 _na     328_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
2567 JVXR01000062.1 GCA001061305_00645 CDS open 38422-39948 _na     508_aa O-succinylbenzoic acid--CoA ligase
2568 JVXR01000062.1 GCA001061305_00646 CDS open 39999-40913 _na     304_aa menA 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
2569 JVXR01000062.1 GCA001061305_00647 CDS open 41285-42529 _na     414_aa eMpr Serine protease
2570 JVXR01000062.1 GCA001061305_00648 CDS open 42725-43012 _na     95_aa DUF4229 domain-containing protein
2571 JVXR01000062.1 GCA001061305_00649 CDS open 43152-43568 _na     138_aa Cardiolipin synthase N-terminal domain-containing protein
2572 JVXR01000062.1 GCA001061305_00612 gene open 258-2348 srmB
2573 JVXR01000062.1 GCA001061305_00613 gene open 2814-4565
2574 JVXR01000062.1 GCA001061305_00614 gene open 4785-5924 alkA
2575 JVXR01000062.1 GCA001061305_00615 gene open 6026-6391 cnoX
2576 JVXR01000062.1 GCA001061305_00617 gene open 6797-7153
2577 JVXR01000062.1 GCA001061305_00618 gene open 7303-7794 yajQ
2578 JVXR01000062.1 GCA001061305_00619 gene open 7880-8761 htpX
2579 JVXR01000062.1 GCA001061305_00620 gene open 9057-9635 fur
2580 JVXR01000062.1 GCA001061305_00621 gene open 9765-11255 katE
2581 JVXR01000062.1 GCA001061305_00622 gene open 11467-12822 sseB
2582 JVXR01000062.1 GCA001061305_00623 gene open 13077-14597
2583 JVXR01000062.1 GCA001061305_00624 gene open 14436-14756
2584 JVXR01000062.1 GCA001061305_00625 gene open 14843-15940 rarD
2585 JVXR01000062.1 GCA001061305_00626 gene open 16090-16227
2586 JVXR01000062.1 GCA001061305_00627 gene open 16227-17837 yocR
2587 JVXR01000062.1 GCA001061305_00628 gene open 18127-19437
2588 JVXR01000062.1 GCA001061305_00629 gene open 19557-20618 ispA
2589 JVXR01000062.1 GCA001061305_00630 gene open 20687-21412 ubiE
2590 JVXR01000062.1 GCA001061305_00631 gene open 21716-22549 hisJ
2591 JVXR01000062.1 GCA001061305_00632 gene open 22637-23440 hisM
2592 JVXR01000062.1 GCA001061305_00633 gene open 23468-24271 glnQ
2593 JVXR01000062.1 GCA001061305_00634 gene open 24476-25291
2594 JVXR01000062.1 GCA001061305_00635 gene open 25306-26289
2595 JVXR01000062.1 GCA001061305_00636 gene open 26398-26775 qdoI
2596 JVXR01000062.1 GCA001061305_00637 gene open 26921-28414
2597 JVXR01000062.1 GCA001061305_00638 gene open 28556-29608 rspA
2598 JVXR01000062.1 GCA001061305_00639 gene open 29711-31642 menD
2599 JVXR01000062.1 GCA001061305_00640 gene open 31800-32693 gloB
2600 JVXR01000062.1 GCA001061305_00641 gene open 32867-33859 gluQRS
2601 JVXR01000062.1 GCA001061305_00642 gene open 34161-35657 putP
2602 JVXR01000062.1 GCA001061305_00643 gene open 35767-37149
2603 JVXR01000062.1 GCA001061305_00644 gene open 37424-38410 menB
2604 JVXR01000062.1 GCA001061305_00645 gene open 38422-39948
2605 JVXR01000062.1 GCA001061305_00646 gene open 39999-40913 menA
2606 JVXR01000062.1 GCA001061305_00647 gene open 41285-42529 eMpr
2607 JVXR01000062.1 GCA001061305_00648 gene open 42725-43012
2608 JVXR01000062.1 GCA001061305_00649 gene open 43152-43568
2609 JVXR01000062.1 GCA001061305_00616 gene open 6570-6651 trnY
2610 JVXR01000062.1 GCA001061305_00616 tRNA open 6570-6651 trnY tRNA-Tyr(gta)
2611 JVXR01000063.1 GCA001061305_00650 CDS open 71-376 _na     101_aa hypothetical protein
2612 JVXR01000063.1 GCA001061305_00651 CDS open 470-946 _na     158_aa Mutator family transposase
2613 JVXR01000063.1 GCA001061305_00652 CDS open 946-1407 _na     153_aa hypothetical protein
2614 JVXR01000063.1 GCA001061305_00650 gene open 71-376
2615 JVXR01000063.1 GCA001061305_00651 gene open 470-946
2616 JVXR01000063.1 GCA001061305_00652 gene open 946-1407
2617 JVXR01000064.1 GCA001061305_00659 gene open 6944-8470 rrs
2618 JVXR01000064.1 GCA001061305_00660 gene open 8815-11917 rrl
2619 JVXR01000064.1 GCA001061305_00659 rRNA open 6944-8470 rrs 16S ribosomal RNA
2620 JVXR01000064.1 GCA001061305_00660 rRNA open 8815-11917 rrl 23S ribosomal RNA
2621 JVXR01000064.1 GCA001061305_00653 CDS open 71-376 _na     101_aa hypothetical protein
2622 JVXR01000064.1 GCA001061305_00654 CDS open 496-813 _na     105_aa hypothetical protein
2623 JVXR01000064.1 GCA001061305_00655 CDS open 1553-2353 _na     266_aa ubiE putative S-adenosylmethionine-dependent methyltransferase MSMEG_2350
2624 JVXR01000064.1 GCA001061305_00656 CDS open 2493-3698 _na     401_aa yjiC Erythromycin biosynthesis protein CIII-like C-terminal domain-containing protein
2625 JVXR01000064.1 GCA001061305_00657 CDS open 3742-4605 _na     287_aa Divinyl chlorophyllide a 8-vinyl-reductase%2C chloroplastic
2626 JVXR01000064.1 GCA001061305_00658 CDS open 4717-6075 _na     452_aa dnaB replicative DNA helicase
2627 JVXR01000064.1 GCA001061305_00653 gene open 71-376
2628 JVXR01000064.1 GCA001061305_00654 gene open 496-813
2629 JVXR01000064.1 GCA001061305_00655 gene open 1553-2353 ubiE
2630 JVXR01000064.1 GCA001061305_00656 gene open 2493-3698 yjiC
2631 JVXR01000064.1 GCA001061305_00657 gene open 3742-4605
2632 JVXR01000064.1 GCA001061305_00658 gene open 4717-6075 dnaB
2633 JVXR01000065.1 GCA001061305_00661 CDS open 1079-3835 _na     918_aa ybbP Efflux ABC transporter%2C permease protein
2634 JVXR01000065.1 GCA001061305_00662 CDS open 3838-4599 _na     253_aa lolD Peptide ABC transporter ATP-binding protein
2635 JVXR01000065.1 GCA001061305_00663 CDS open 4853-7591 _na     912_aa ybbP Macrolide export ATP-binding/permease protein MacB
2636 JVXR01000065.1 GCA001061305_00664 CDS open 7818-8543 _na     241_aa citB Nitrogen regulation protein C
2637 JVXR01000065.1 GCA001061305_00665 CDS open 8592-9863 _na     423_aa comP histidine kinase
2638 JVXR01000065.1 GCA001061305_00666 CDS open 10067-11122 _na     351_aa leuB 3-isopropylmalate dehydrogenase
2639 JVXR01000065.1 GCA001061305_00667 CDS open 11372-12469 _na     365_aa ilvE branched-chain amino acid aminotransferase
2640 JVXR01000065.1 GCA001061305_00668 CDS open 12586-13362 _na     258_aa ycgM 2-keto-4-pentenoate hydratase/2-oxohepta-3-ene-1%2C7-dioic acid hydratase (Catechol pathway)
2641 JVXR01000065.1 GCA001061305_00669 CDS open 13463-14977 _na     504_aa gltX glutamate--tRNA ligase
2642 JVXR01000065.1 GCA001061305_00670 CDS open 15108-15470 _na     120_aa Holin
2643 JVXR01000065.1 GCA001061305_00671 CDS open 15467-15832 _na     121_aa hypothetical protein
2644 JVXR01000065.1 GCA001061305_00661 gene open 1079-3835 ybbP
2645 JVXR01000065.1 GCA001061305_00662 gene open 3838-4599 lolD
2646 JVXR01000065.1 GCA001061305_00663 gene open 4853-7591 ybbP
2647 JVXR01000065.1 GCA001061305_00664 gene open 7818-8543 citB
2648 JVXR01000065.1 GCA001061305_00665 gene open 8592-9863 comP
2649 JVXR01000065.1 GCA001061305_00666 gene open 10067-11122 leuB
2650 JVXR01000065.1 GCA001061305_00667 gene open 11372-12469 ilvE
2651 JVXR01000065.1 GCA001061305_00668 gene open 12586-13362 ycgM
2652 JVXR01000065.1 GCA001061305_00669 gene open 13463-14977 gltX
2653 JVXR01000065.1 GCA001061305_00670 gene open 15108-15470
2654 JVXR01000065.1 GCA001061305_00671 gene open 15467-15832
2655 JVXR01000066.1 GCA001061305_00734 gene open 72137-75239 rrl
2656 JVXR01000066.1 GCA001061305_00735 gene open 75584-77110 rrs
2657 JVXR01000066.1 GCA001061305_00734 rRNA open 72137-75239 rrl 23S ribosomal RNA
2658 JVXR01000066.1 GCA001061305_00735 rRNA open 75584-77110 rrs 16S ribosomal RNA
2659 JVXR01000066.1 GCA001061305_00672 CDS open 18-431 _na     137_aa YcxB-like protein domain-containing protein
2660 JVXR01000066.1 GCA001061305_00673 CDS open 506-4837 _na     1443_aa ftsK Cell division protein FtsK
2661 JVXR01000066.1 GCA001061305_00674 CDS open 4917-6272 _na     451_aa Leucine-binding protein domain-containing protein
2662 JVXR01000066.1 GCA001061305_00675 CDS open 6274-9444 _na     1056_aa 1%2C4-beta-xylanase
2663 JVXR01000066.1 GCA001061305_00676 CDS open 9615-11567 _na     650_aa sPS1 non-specific serine/threonine protein kinase
2664 JVXR01000066.1 GCA001061305_00677 CDS open 11819-14701 _na     960_aa Actinobacterial surface-anchored domain protein
2665 JVXR01000066.1 GCA001061305_00678 CDS open 14847-17117 _na     756_aa Putative ABC transporter-associated repeat protein
2666 JVXR01000066.1 GCA001061305_00679 CDS open 17107-18783 _na     558_aa znuA anchored repeat ABC transporter%2C substrate-binding protein
2667 JVXR01000066.1 GCA001061305_00680 CDS open 18849-19892 _na     347_aa Actinobacterial surface-anchored domain protein
2668 JVXR01000066.1 GCA001061305_00681 CDS open 19885-20805 _na     306_aa znuC anchored repeat-type ABC transporter ATP-binding subunit
2669 JVXR01000066.1 GCA001061305_00682 CDS open 20802-21674 _na     290_aa znuB anchored repeat-type ABC transporter permease subunit
2670 JVXR01000066.1 GCA001061305_00683 CDS open 21715-22404 _na     229_aa PF13338 domain protein
2671 JVXR01000066.1 GCA001061305_00684 CDS open 22519-22920 _na     133_aa hypothetical protein
2672 JVXR01000066.1 GCA001061305_00685 CDS open 23233-24297 _na     354_aa tdh Enoyl reductase (ER) domain-containing protein
2673 JVXR01000066.1 GCA001061305_00686 CDS open 24505-25086 _na     193_aa Tat pathway signal sequence domain protein
2674 JVXR01000066.1 GCA001061305_00687 CDS open 25305-25808 _na     167_aa Muramidase
2675 JVXR01000066.1 GCA001061305_00688 CDS open 25913-26293 _na     126_aa Tat (Twin-arginine translocation) pathway signal sequence
2676 JVXR01000066.1 GCA001061305_00689 CDS open 26364-26885 _na     173_aa Muramidase
2677 JVXR01000066.1 GCA001061305_00690 CDS open 26957-27427 _na     156_aa Tat pathway signal sequence domain protein
2678 JVXR01000066.1 GCA001061305_00691 CDS open 27538-27897 _na     119_aa DUF4398 domain-containing protein
2679 JVXR01000066.1 GCA001061305_00692 CDS open 27966-28499 _na     177_aa cheA Chemotaxis protein CheA
2680 JVXR01000066.1 GCA001061305_00693 CDS open 28582-29088 _na     168_aa Peptidoglycan binding domain-containing protein
2681 JVXR01000066.1 GCA001061305_00694 CDS open 29174-29698 _na     174_aa Tat pathway signal sequence domain protein
2682 JVXR01000066.1 GCA001061305_00695 CDS open 30327-30836 _na     169_aa yxjI LURP-one-related family protein
2683 JVXR01000066.1 GCA001061305_00696 CDS open 31001-31747 _na     248_aa Uracil phosphoribosyltransferase
2684 JVXR01000066.1 GCA001061305_00697 CDS open 31734-32468 _na     244_aa Permease
2685 JVXR01000066.1 GCA001061305_00698 CDS open 32641-34035 _na     464_aa CoA-disulfide reductase
2686 JVXR01000066.1 GCA001061305_00699 CDS open 34354-36060 _na     568_aa uhpC Antiseptic resistance protein
2687 JVXR01000066.1 GCA001061305_00700 CDS open 36103-36702 _na     199_aa acrR Transcriptional regulator%2C TetR family
2688 JVXR01000066.1 GCA001061305_00701 CDS open 36817-37302 _na     161_aa Polyketide cyclase
2689 JVXR01000066.1 GCA001061305_00702 CDS open 37489-37812 _na     107_aa ygiN Monooxygenase ycnE
2690 JVXR01000066.1 GCA001061305_00703 CDS open 37942-38745 _na     267_aa nadQ NUDIX hydrolase
2691 JVXR01000066.1 GCA001061305_00704 CDS open 39318-41078 _na     586_aa ABC transporter ATP-binding protein
2692 JVXR01000066.1 GCA001061305_00705 CDS open 41075-41203 _na     42_aa hypothetical protein
2693 JVXR01000066.1 GCA001061305_00706 CDS open 41311-42168 _na     285_aa araC Methylated-DNA--[protein]-cysteine S-methyltransferase
2694 JVXR01000066.1 GCA001061305_00707 CDS open 42467-43939 _na     490_aa ATP-dependent DNA helicase
2695 JVXR01000066.1 GCA001061305_00708 CDS open 44061-44690 _na     209_aa sodA Superoxide dismutase
2696 JVXR01000066.1 GCA001061305_00709 CDS open 45497-45718 _na     73_aa hypothetical protein
2697 JVXR01000066.1 GCA001061305_00710 CDS open 46365-46907 _na     180_aa marR Transcriptional repressor MprA
2698 JVXR01000066.1 GCA001061305_00711 CDS open 47131-47655 _na     174_aa ftnA Ferritin
2699 JVXR01000066.1 GCA001061305_00712 CDS open 47894-49249 _na     451_aa nhaA Na+/H+ antiporter NhaA
2700 JVXR01000066.1 GCA001061305_00713 CDS open 49646-52948 _na     1100_aa lysX bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX
2701 JVXR01000066.1 GCA001061305_00714 CDS open 53290-54843 _na     517_aa alsT Amino acid carrier protein
2702 JVXR01000066.1 GCA001061305_00715 CDS open 54893-55243 _na     116_aa Cardiolipin synthase N-terminal domain-containing protein
2703 JVXR01000066.1 GCA001061305_00717 CDS open 55706-56617 _na     303_aa fHA FHA domain-containing protein
2704 JVXR01000066.1 GCA001061305_00718 CDS open 56617-57093 _na     158_aa fHA FHA domain-containing protein
2705 JVXR01000066.1 GCA001061305_00719 CDS open 57097-58683 _na     528_aa pTC1 PP2C-family Ser/Thr phosphatase
2706 JVXR01000066.1 GCA001061305_00720 CDS open 58676-60139 _na     487_aa ftsW peptidoglycan glycosyltransferase
2707 JVXR01000066.1 GCA001061305_00721 CDS open 60132-61571 _na     479_aa ftsI Penicillin-binding protein A
2708 JVXR01000066.1 GCA001061305_00722 CDS open 61568-63292 _na     574_aa pASTA non-specific serine/threonine protein kinase
2709 JVXR01000066.1 GCA001061305_00723 CDS open 63341-65518 _na     725_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2710 JVXR01000066.1 GCA001061305_00724 CDS open 65679-66311 _na     210_aa pabA aminodeoxychorismate/anthranilate synthase component II
2711 JVXR01000066.1 GCA001061305_00725 CDS open 66335-66496 _na     53_aa DUF4175 domain-containing protein
2712 JVXR01000066.1 GCA001061305_00726 CDS open 66513-67265 _na     250_aa srtA Sortase (Surface protein transpeptidase)
2713 JVXR01000066.1 GCA001061305_00727 CDS open 67423-67764 _na     113_aa crgA Cell division protein CrgA
2714 JVXR01000066.1 GCA001061305_00728 CDS open 67774-67983 _na     69_aa Long-chain fatty acid--CoA ligase
2715 JVXR01000066.1 GCA001061305_00729 CDS open 68619-69536 _na     305_aa lysR Transcriptional regulator%2C ArgP family
2716 JVXR01000066.1 GCA001061305_00730 CDS open 69737-70057 _na     106_aa hypothetical protein
2717 JVXR01000066.1 GCA001061305_00731 CDS open 70245-70592 _na     115_aa hypothetical protein
2718 JVXR01000066.1 GCA001061305_00732 CDS open 70669-71229 _na     186_aa ATPase
2719 JVXR01000066.1 GCA001061305_00733 CDS open 71417-71878 _na     153_aa Imm-5-like domain-containing protein
2720 JVXR01000066.1 GCA001061305_00672 gene open 18-431
2721 JVXR01000066.1 GCA001061305_00673 gene open 506-4837 ftsK
2722 JVXR01000066.1 GCA001061305_00674 gene open 4917-6272
2723 JVXR01000066.1 GCA001061305_00675 gene open 6274-9444
2724 JVXR01000066.1 GCA001061305_00676 gene open 9615-11567 sPS1
2725 JVXR01000066.1 GCA001061305_00677 gene open 11819-14701
2726 JVXR01000066.1 GCA001061305_00678 gene open 14847-17117
2727 JVXR01000066.1 GCA001061305_00679 gene open 17107-18783 znuA
2728 JVXR01000066.1 GCA001061305_00680 gene open 18849-19892
2729 JVXR01000066.1 GCA001061305_00681 gene open 19885-20805 znuC
2730 JVXR01000066.1 GCA001061305_00682 gene open 20802-21674 znuB
2731 JVXR01000066.1 GCA001061305_00683 gene open 21715-22404
2732 JVXR01000066.1 GCA001061305_00684 gene open 22519-22920
2733 JVXR01000066.1 GCA001061305_00685 gene open 23233-24297 tdh
2734 JVXR01000066.1 GCA001061305_00686 gene open 24505-25086
2735 JVXR01000066.1 GCA001061305_00687 gene open 25305-25808
2736 JVXR01000066.1 GCA001061305_00688 gene open 25913-26293
2737 JVXR01000066.1 GCA001061305_00689 gene open 26364-26885
2738 JVXR01000066.1 GCA001061305_00690 gene open 26957-27427
2739 JVXR01000066.1 GCA001061305_00691 gene open 27538-27897
2740 JVXR01000066.1 GCA001061305_00692 gene open 27966-28499 cheA
2741 JVXR01000066.1 GCA001061305_00693 gene open 28582-29088
2742 JVXR01000066.1 GCA001061305_00694 gene open 29174-29698
2743 JVXR01000066.1 GCA001061305_00695 gene open 30327-30836 yxjI
2744 JVXR01000066.1 GCA001061305_00696 gene open 31001-31747
2745 JVXR01000066.1 GCA001061305_00697 gene open 31734-32468
2746 JVXR01000066.1 GCA001061305_00698 gene open 32641-34035
2747 JVXR01000066.1 GCA001061305_00699 gene open 34354-36060 uhpC
2748 JVXR01000066.1 GCA001061305_00700 gene open 36103-36702 acrR
2749 JVXR01000066.1 GCA001061305_00701 gene open 36817-37302
2750 JVXR01000066.1 GCA001061305_00702 gene open 37489-37812 ygiN
2751 JVXR01000066.1 GCA001061305_00703 gene open 37942-38745 nadQ
2752 JVXR01000066.1 GCA001061305_00704 gene open 39318-41078
2753 JVXR01000066.1 GCA001061305_00705 gene open 41075-41203
2754 JVXR01000066.1 GCA001061305_00706 gene open 41311-42168 araC
2755 JVXR01000066.1 GCA001061305_00707 gene open 42467-43939
2756 JVXR01000066.1 GCA001061305_00708 gene open 44061-44690 sodA
2757 JVXR01000066.1 GCA001061305_00709 gene open 45497-45718
2758 JVXR01000066.1 GCA001061305_00710 gene open 46365-46907 marR
2759 JVXR01000066.1 GCA001061305_00711 gene open 47131-47655 ftnA
2760 JVXR01000066.1 GCA001061305_00712 gene open 47894-49249 nhaA
2761 JVXR01000066.1 GCA001061305_00713 gene open 49646-52948 lysX
2762 JVXR01000066.1 GCA001061305_00714 gene open 53290-54843 alsT
2763 JVXR01000066.1 GCA001061305_00715 gene open 54893-55243
2764 JVXR01000066.1 GCA001061305_00717 gene open 55706-56617 fHA
2765 JVXR01000066.1 GCA001061305_00718 gene open 56617-57093 fHA
2766 JVXR01000066.1 GCA001061305_00719 gene open 57097-58683 pTC1
2767 JVXR01000066.1 GCA001061305_00720 gene open 58676-60139 ftsW
2768 JVXR01000066.1 GCA001061305_00721 gene open 60132-61571 ftsI
2769 JVXR01000066.1 GCA001061305_00722 gene open 61568-63292 pASTA
2770 JVXR01000066.1 GCA001061305_00723 gene open 63341-65518 pknB
2771 JVXR01000066.1 GCA001061305_00724 gene open 65679-66311 pabA
2772 JVXR01000066.1 GCA001061305_00725 gene open 66335-66496
2773 JVXR01000066.1 GCA001061305_00726 gene open 66513-67265 srtA
2774 JVXR01000066.1 GCA001061305_00727 gene open 67423-67764 crgA
2775 JVXR01000066.1 GCA001061305_00728 gene open 67774-67983
2776 JVXR01000066.1 GCA001061305_00729 gene open 68619-69536 lysR
2777 JVXR01000066.1 GCA001061305_00730 gene open 69737-70057
2778 JVXR01000066.1 GCA001061305_00731 gene open 70245-70592
2779 JVXR01000066.1 GCA001061305_00732 gene open 70669-71229
2780 JVXR01000066.1 GCA001061305_00733 gene open 71417-71878
2781 JVXR01000066.1 GCA001061305_00716 gene open 55365-55451 trnL
2782 JVXR01000066.1 GCA001061305_00716 tRNA open 55365-55451 trnL tRNA-Leu(cag)
2783 JVXR01000067.1 repeat_region open 41302-42318 CRISPR array with 17 repeats of length 28%2C consensus sequence GAACCATCCATGCACACGCGGGGCAGAC and spacer length 33
2784 JVXR01000067.1 GCA001061305_00736 CDS open 26-1318 _na     430_aa tnpB RNA-guided endonuclease TnpB family protein
2785 JVXR01000067.1 GCA001061305_00737 CDS open 1412-1702 _na     96_aa Putative transposase
2786 JVXR01000067.1 GCA001061305_00738 CDS open 1948-2898 _na     316_aa DUF4870 domain-containing protein
2787 JVXR01000067.1 GCA001061305_00739 CDS open 3050-3628 _na     192_aa Peptidase
2788 JVXR01000067.1 GCA001061305_00740 CDS open 3791-4297 _na     168_aa ansA L-asparaginase N-terminal domain-containing protein
2789 JVXR01000067.1 GCA001061305_00741 CDS open 4742-7000 _na     752_aa uvrA excinuclease ABC subunit UvrA
2790 JVXR01000067.1 GCA001061305_00742 CDS open 7071-7415 _na     114_aa UvrABC system protein A
2791 JVXR01000067.1 GCA001061305_00743 CDS open 7944-8174 _na     76_aa hypothetical protein
2792 JVXR01000067.1 GCA001061305_00744 CDS open 8989-9135 _na     48_aa hypothetical protein
2793 JVXR01000067.1 GCA001061305_00745 CDS open 9453-9764 _na     103_aa hypothetical protein
2794 JVXR01000067.1 GCA001061305_00746 CDS open 9751-9990 _na     79_aa hypothetical protein
2795 JVXR01000067.1 GCA001061305_00748 CDS open 10666-11361 _na     231_aa Histone acetyltransferase
2796 JVXR01000067.1 GCA001061305_00749 CDS open 11500-11652 _na     50_aa hypothetical protein
2797 JVXR01000067.1 GCA001061305_00750 CDS open 11972-13273 _na     433_aa hypothetical protein
2798 JVXR01000067.1 GCA001061305_00751 CDS open 13285-14553 _na     422_aa Chromosome partition protein Smc
2799 JVXR01000067.1 GCA001061305_00752 CDS open 14927-15544 _na     205_aa Phosphate transport regulator
2800 JVXR01000067.1 GCA001061305_00753 CDS open 15544-16545 _na     333_aa pitA Phosphate transporter
2801 JVXR01000067.1 GCA001061305_00754 CDS open 16635-17642 _na     335_aa bcsA Glycosyltransferase%2C group 2 family protein
2802 JVXR01000067.1 GCA001061305_00755 CDS open 17651-19189 _na     512_aa wcaK Polysaccharide pyruvyl transferase
2803 JVXR01000067.1 GCA001061305_00756 CDS open 19338-20600 _na     420_aa ygaE Integral membrane bound transporter domain-containing protein
2804 JVXR01000067.1 GCA001061305_00757 CDS open 20774-22201 _na     475_aa radA DNA repair protein RadA
2805 JVXR01000067.1 GCA001061305_00758 CDS open 22327-23391 _na     354_aa disA DNA integrity scanning diadenylate cyclase DisA
2806 JVXR01000067.1 GCA001061305_00759 CDS open 23536-24315 _na     259_aa DUF4232 domain-containing protein
2807 JVXR01000067.1 GCA001061305_00760 CDS open 24450-25385 _na     311_aa mutY Adenine DNA glycosylase
2808 JVXR01000067.1 GCA001061305_00761 CDS open 25514-26281 _na     255_aa ybjT SDR family oxidoreductase
2809 JVXR01000067.1 GCA001061305_00762 CDS open 26358-26867 _na     169_aa marR Salmolysin
2810 JVXR01000067.1 GCA001061305_00763 CDS open 27089-29641 _na     850_aa clpC ATP-dependent Clp protease ClpC
2811 JVXR01000067.1 GCA001061305_00764 CDS open 30189-30548 _na     119_aa Lsr2
2812 JVXR01000067.1 GCA001061305_00765 CDS open 30722-30937 _na     71_aa Lysyl-tRNA synthetase
2813 JVXR01000067.1 GCA001061305_00766 CDS open 31086-32669 _na     527_aa lysS lysine--tRNA ligase
2814 JVXR01000067.1 GCA001061305_00767 CDS open 32714-33661 _na     315_aa panC pantoate--beta-alanine ligase
2815 JVXR01000067.1 GCA001061305_00768 CDS open 33658-34665 _na     335_aa Chalcone/stilbene synthase family protein
2816 JVXR01000067.1 GCA001061305_00769 CDS open 34704-36416 _na     570_aa ydbT YdbS-like PH domain-containing protein
2817 JVXR01000067.1 GCA001061305_00770 CDS open 36416-36991 _na     191_aa ydbS YdbS-like PH domain-containing protein
2818 JVXR01000067.1 GCA001061305_00771 CDS open 37001-37534 _na     177_aa DUF3180 domain-containing protein
2819 JVXR01000067.1 GCA001061305_00772 CDS open 37531-38190 _na     219_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2820 JVXR01000067.1 GCA001061305_00773 CDS open 38171-38605 _na     144_aa folB dihydroneopterin aldolase
2821 JVXR01000067.1 GCA001061305_00774 CDS open 38643-39593 _na     316_aa folP dihydropteroate synthase
2822 JVXR01000067.1 GCA001061305_00775 CDS open 39852-40055 _na     67_aa hypothetical protein
2823 JVXR01000067.1 GCA001061305_00776 CDS open 40094-40690 _na     198_aa GNAT family N-acetyltransferase
2824 JVXR01000067.1 GCA001061305_00777 CDS open 40964-41143 _na     59_aa hicB HicB
2825 JVXR01000067.1 GCA001061305_00778 CDS open 42396-44024 _na     542_aa Transposase
2826 JVXR01000067.1 GCA001061305_00779 CDS open 44318-44521 _na     67_aa vbhA Antitoxin VbhA domain-containing protein
2827 JVXR01000067.1 GCA001061305_00780 CDS open 44670-45257 _na     195_aa folE GTP cyclohydrolase I FolE
2828 JVXR01000067.1 GCA001061305_00781 CDS open 45244-47541 _na     765_aa ftsH ATP-dependent zinc metalloprotease FtsH
2829 JVXR01000067.1 GCA001061305_00782 CDS open 47723-47929 _na     68_aa hicB Putative toxin-antitoxin system%2C antitoxin component%2C HicB family
2830 JVXR01000067.1 GCA001061305_00783 CDS open 48110-48646 _na     178_aa hpt hypoxanthine phosphoribosyltransferase
2831 JVXR01000067.1 GCA001061305_00784 CDS open 48839-49003 _na     54_aa hypothetical protein
2832 JVXR01000067.1 GCA001061305_00785 CDS open 49219-50415 _na     398_aa ttcA tRNA(Ile)-lysidine synthase
2833 JVXR01000067.1 GCA001061305_00786 CDS open 50493-52043 _na     516_aa Divergent AAA domain protein
2834 JVXR01000067.1 GCA001061305_00787 CDS open 52356-53483 _na     375_aa zincin Zinc-dependent metalloprotease
2835 JVXR01000067.1 GCA001061305_00788 CDS open 53567-53794 _na     75_aa Transcriptional regulator
2836 JVXR01000067.1 GCA001061305_00789 CDS open 54058-55164 _na     368_aa Integral membrane protein
2837 JVXR01000067.1 GCA001061305_00790 CDS open 55206-55382 _na     58_aa hypothetical protein
2838 JVXR01000067.1 GCA001061305_00791 CDS open 55554-56039 _na     161_aa ppa inorganic diphosphatase
2839 JVXR01000067.1 GCA001061305_00792 CDS open 56223-57905 _na     560_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
2840 JVXR01000067.1 GCA001061305_00793 CDS open 58039-60792 _na     917_aa dNA2 DNA2/NAM7 helicase-like C-terminal domain-containing protein
2841 JVXR01000067.1 GCA001061305_00794 CDS open 60952-61563 _na     203_aa recJ Recombinase RecJ
2842 JVXR01000067.1 GCA001061305_00795 CDS open 61636-61860 _na     74_aa 3-phosphoshikimate 1-carboxyvinyltransferase
2843 JVXR01000067.1 GCA001061305_00796 CDS open 61892-62458 _na     188_aa hypothetical protein
2844 JVXR01000067.1 GCA001061305_00797 CDS open 62574-62972 _na     132_aa yuxK DUF393 domain-containing protein
2845 JVXR01000067.1 GCA001061305_00798 CDS open 63120-63836 _na     238_aa feoA Manganese transport regulator
2846 JVXR01000067.1 GCA001061305_00799 CDS open 63968-64837 _na     289_aa znuB Metal ABC transporter permease
2847 JVXR01000067.1 GCA001061305_00800 CDS open 64839-65615 _na     258_aa znuC Manganese transport system ATP-binding protein MntA
2848 JVXR01000067.1 GCA001061305_00801 CDS open 65754-66728 _na     324_aa znuA Iron/manganese ABC transporter%2C periplasmic iron/manganese-binding protein
2849 JVXR01000067.1 GCA001061305_00802 CDS open 67062-67268 _na     68_aa hypothetical protein
2850 JVXR01000067.1 GCA001061305_00803 CDS open 67292-67501 _na     69_aa hypothetical protein
2851 JVXR01000067.1 GCA001061305_00804 CDS open 67597-68130 _na     177_aa TrbC/VirB2 family protein
2852 JVXR01000067.1 GCA001061305_00736 gene open 26-1318 tnpB
2853 JVXR01000067.1 GCA001061305_00737 gene open 1412-1702
2854 JVXR01000067.1 GCA001061305_00738 gene open 1948-2898
2855 JVXR01000067.1 GCA001061305_00739 gene open 3050-3628
2856 JVXR01000067.1 GCA001061305_00740 gene open 3791-4297 ansA
2857 JVXR01000067.1 GCA001061305_00741 gene open 4742-7000 uvrA
2858 JVXR01000067.1 GCA001061305_00742 gene open 7071-7415
2859 JVXR01000067.1 GCA001061305_00743 gene open 7944-8174
2860 JVXR01000067.1 GCA001061305_00744 gene open 8989-9135
2861 JVXR01000067.1 GCA001061305_00745 gene open 9453-9764
2862 JVXR01000067.1 GCA001061305_00746 gene open 9751-9990
2863 JVXR01000067.1 GCA001061305_00748 gene open 10666-11361
2864 JVXR01000067.1 GCA001061305_00749 gene open 11500-11652
2865 JVXR01000067.1 GCA001061305_00750 gene open 11972-13273
2866 JVXR01000067.1 GCA001061305_00751 gene open 13285-14553
2867 JVXR01000067.1 GCA001061305_00752 gene open 14927-15544
2868 JVXR01000067.1 GCA001061305_00753 gene open 15544-16545 pitA
2869 JVXR01000067.1 GCA001061305_00754 gene open 16635-17642 bcsA
2870 JVXR01000067.1 GCA001061305_00755 gene open 17651-19189 wcaK
2871 JVXR01000067.1 GCA001061305_00756 gene open 19338-20600 ygaE
2872 JVXR01000067.1 GCA001061305_00757 gene open 20774-22201 radA
2873 JVXR01000067.1 GCA001061305_00758 gene open 22327-23391 disA
2874 JVXR01000067.1 GCA001061305_00759 gene open 23536-24315
2875 JVXR01000067.1 GCA001061305_00760 gene open 24450-25385 mutY
2876 JVXR01000067.1 GCA001061305_00761 gene open 25514-26281 ybjT
2877 JVXR01000067.1 GCA001061305_00762 gene open 26358-26867 marR
2878 JVXR01000067.1 GCA001061305_00763 gene open 27089-29641 clpC
2879 JVXR01000067.1 GCA001061305_00764 gene open 30189-30548
2880 JVXR01000067.1 GCA001061305_00765 gene open 30722-30937
2881 JVXR01000067.1 GCA001061305_00766 gene open 31086-32669 lysS
2882 JVXR01000067.1 GCA001061305_00767 gene open 32714-33661 panC
2883 JVXR01000067.1 GCA001061305_00768 gene open 33658-34665
2884 JVXR01000067.1 GCA001061305_00769 gene open 34704-36416 ydbT
2885 JVXR01000067.1 GCA001061305_00770 gene open 36416-36991 ydbS
2886 JVXR01000067.1 GCA001061305_00771 gene open 37001-37534
2887 JVXR01000067.1 GCA001061305_00772 gene open 37531-38190 folK
2888 JVXR01000067.1 GCA001061305_00773 gene open 38171-38605 folB
2889 JVXR01000067.1 GCA001061305_00774 gene open 38643-39593 folP
2890 JVXR01000067.1 GCA001061305_00775 gene open 39852-40055
2891 JVXR01000067.1 GCA001061305_00776 gene open 40094-40690
2892 JVXR01000067.1 GCA001061305_00777 gene open 40964-41143 hicB
2893 JVXR01000067.1 GCA001061305_00778 gene open 42396-44024
2894 JVXR01000067.1 GCA001061305_00779 gene open 44318-44521 vbhA
2895 JVXR01000067.1 GCA001061305_00780 gene open 44670-45257 folE
2896 JVXR01000067.1 GCA001061305_00781 gene open 45244-47541 ftsH
2897 JVXR01000067.1 GCA001061305_00782 gene open 47723-47929 hicB
2898 JVXR01000067.1 GCA001061305_00783 gene open 48110-48646 hpt
2899 JVXR01000067.1 GCA001061305_00784 gene open 48839-49003
2900 JVXR01000067.1 GCA001061305_00785 gene open 49219-50415 ttcA
2901 JVXR01000067.1 GCA001061305_00786 gene open 50493-52043
2902 JVXR01000067.1 GCA001061305_00787 gene open 52356-53483 zincin
2903 JVXR01000067.1 GCA001061305_00788 gene open 53567-53794
2904 JVXR01000067.1 GCA001061305_00789 gene open 54058-55164
2905 JVXR01000067.1 GCA001061305_00790 gene open 55206-55382
2906 JVXR01000067.1 GCA001061305_00791 gene open 55554-56039 ppa
2907 JVXR01000067.1 GCA001061305_00792 gene open 56223-57905 dacB
2908 JVXR01000067.1 GCA001061305_00793 gene open 58039-60792 dNA2
2909 JVXR01000067.1 GCA001061305_00794 gene open 60952-61563 recJ
2910 JVXR01000067.1 GCA001061305_00795 gene open 61636-61860
2911 JVXR01000067.1 GCA001061305_00796 gene open 61892-62458
2912 JVXR01000067.1 GCA001061305_00797 gene open 62574-62972 yuxK
2913 JVXR01000067.1 GCA001061305_00798 gene open 63120-63836 feoA
2914 JVXR01000067.1 GCA001061305_00799 gene open 63968-64837 znuB
2915 JVXR01000067.1 GCA001061305_00800 gene open 64839-65615 znuC
2916 JVXR01000067.1 GCA001061305_00801 gene open 65754-66728 znuA
2917 JVXR01000067.1 GCA001061305_00802 gene open 67062-67268
2918 JVXR01000067.1 GCA001061305_00803 gene open 67292-67501
2919 JVXR01000067.1 GCA001061305_00804 gene open 67597-68130
2920 JVXR01000067.1 GCA001061305_00747 gene open 10461-10533 trnK
2921 JVXR01000067.1 GCA001061305_00747 tRNA open 10461-10533 trnK tRNA-Lys(ttt)
2922 JVXR01000068.1 GCA001061305_00805 CDS open 47-337 _na     96_aa Putative transposase
2923 JVXR01000068.1 GCA001061305_00806 CDS open 431-1723 _na     430_aa tnpB RNA-guided endonuclease TnpB family protein
2924 JVXR01000068.1 GCA001061305_00807 CDS open 1819-2202 _na     127_aa hypothetical protein
2925 JVXR01000068.1 GCA001061305_00808 CDS open 2302-3270 _na     322_aa Skin secretory protein xP2 (Protein APEG)
2926 JVXR01000068.1 GCA001061305_00809 CDS open 3401-4012 _na     203_aa Multidrug ABC transporter permease
2927 JVXR01000068.1 GCA001061305_00810 CDS open 4250-5077 _na     275_aa ABC transporter permease
2928 JVXR01000068.1 GCA001061305_00811 CDS open 5242-5958 _na     238_aa hypothetical protein
2929 JVXR01000068.1 GCA001061305_00812 CDS open 6073-6918 _na     281_aa hypothetical protein
2930 JVXR01000068.1 GCA001061305_00813 CDS open 7265-7798 _na     177_aa mscS Mechanosensitive ion channel protein MscS
2931 JVXR01000068.1 GCA001061305_00814 CDS open 8105-8992 _na     295_aa hypothetical protein
2932 JVXR01000068.1 GCA001061305_00815 CDS open 9153-9917 _na     254_aa hypothetical protein
2933 JVXR01000068.1 GCA001061305_00816 CDS open 10089-10793 _na     234_aa hypothetical protein
2934 JVXR01000068.1 GCA001061305_00817 CDS open 10900-11559 _na     219_aa dedA SNARE associated Golgi protein
2935 JVXR01000068.1 GCA001061305_00818 CDS open 11919-14051 _na     710_aa recQ ATP-dependent DNA helicase RecQ
2936 JVXR01000068.1 GCA001061305_00819 CDS open 14107-14637 _na     176_aa tadA tRNA adenosine(34) deaminase TadA
2937 JVXR01000068.1 GCA001061305_00820 CDS open 15002-15928 _na     308_aa rbbA Multidrug ABC transporter ATPase
2938 JVXR01000068.1 GCA001061305_00821 CDS open 15931-18495 _na     854_aa yhgE YhgE/Pip domain protein
2939 JVXR01000068.1 GCA001061305_00822 CDS open 18505-19155 _na     216_aa acrR TetR family transcriptional regulator
2940 JVXR01000068.1 GCA001061305_00824 CDS open 19551-20312 _na     253_aa Transmembrane protein
2941 JVXR01000068.1 GCA001061305_00805 gene open 47-337
2942 JVXR01000068.1 GCA001061305_00806 gene open 431-1723 tnpB
2943 JVXR01000068.1 GCA001061305_00807 gene open 1819-2202
2944 JVXR01000068.1 GCA001061305_00808 gene open 2302-3270
2945 JVXR01000068.1 GCA001061305_00809 gene open 3401-4012
2946 JVXR01000068.1 GCA001061305_00810 gene open 4250-5077
2947 JVXR01000068.1 GCA001061305_00811 gene open 5242-5958
2948 JVXR01000068.1 GCA001061305_00812 gene open 6073-6918
2949 JVXR01000068.1 GCA001061305_00813 gene open 7265-7798 mscS
2950 JVXR01000068.1 GCA001061305_00814 gene open 8105-8992
2951 JVXR01000068.1 GCA001061305_00815 gene open 9153-9917
2952 JVXR01000068.1 GCA001061305_00816 gene open 10089-10793
2953 JVXR01000068.1 GCA001061305_00817 gene open 10900-11559 dedA
2954 JVXR01000068.1 GCA001061305_00818 gene open 11919-14051 recQ
2955 JVXR01000068.1 GCA001061305_00819 gene open 14107-14637 tadA
2956 JVXR01000068.1 GCA001061305_00820 gene open 15002-15928 rbbA
2957 JVXR01000068.1 GCA001061305_00821 gene open 15931-18495 yhgE
2958 JVXR01000068.1 GCA001061305_00822 gene open 18505-19155 acrR
2959 JVXR01000068.1 GCA001061305_00824 gene open 19551-20312
2960 JVXR01000068.1 GCA001061305_00823 gene open 19381-19467 trnS
2961 JVXR01000068.1 GCA001061305_00823 tRNA open 19381-19467 trnS tRNA-Ser(cga)
2962 JVXR01000069.1 GCA001061305_00873 gene open 63825-63921 Bacteria_small_SRP
2963 JVXR01000069.1 GCA001061305_00873 ncRNA open 63825-63921 Bacterial small signal recognition particle RNA
2964 JVXR01000069.1 GCA001061305_00825 CDS open 309-1772 _na     487_aa nCS2 Guanine/hypoxanthine permease pbuG
2965 JVXR01000069.1 GCA001061305_00826 CDS open 2095-2430 _na     111_aa DUF2218 domain-containing protein
2966 JVXR01000069.1 GCA001061305_00827 CDS open 2817-4220 _na     467_aa gltD ferredoxin--NADP(+) reductase
2967 JVXR01000069.1 GCA001061305_00831 CDS open 5328-6233 _na     301_aa opuBA Glycine betaine/L-proline transport ATP-binding protein ProV
2968 JVXR01000069.1 GCA001061305_00832 CDS open 6235-6927 _na     230_aa opuBB Osmoprotectant uptake system permease protein yehY
2969 JVXR01000069.1 GCA001061305_00833 CDS open 6924-7682 _na     252_aa opuBB ABC transporter permease
2970 JVXR01000069.1 GCA001061305_00834 CDS open 7766-8686 _na     306_aa osmF Osmoprotectant-binding protein
2971 JVXR01000069.1 GCA001061305_00835 CDS open 9149-9469 _na     106_aa hypothetical protein
2972 JVXR01000069.1 GCA001061305_00836 CDS open 9466-9969 _na     167_aa Type IV secretion protein Rhs
2973 JVXR01000069.1 GCA001061305_00837 CDS open 9992-10666 _na     224_aa hypothetical protein
2974 JVXR01000069.1 GCA001061305_00838 CDS open 10739-11383 _na     214_aa hypothetical protein
2975 JVXR01000069.1 GCA001061305_00839 CDS open 11505-11972 _na     155_aa hypothetical protein
2976 JVXR01000069.1 GCA001061305_00840 CDS open 12154-14016 _na     620_aa amyA Trehalose-6-phosphate hydrolase
2977 JVXR01000069.1 GCA001061305_00841 CDS open 14395-16239 _na     614_aa ilvD dihydroxy-acid dehydratase
2978 JVXR01000069.1 GCA001061305_00842 CDS open 16352-16648 _na     98_aa ygiN Monooxygenase ycnE
2979 JVXR01000069.1 GCA001061305_00843 CDS open 16917-18113 _na     398_aa RNase H type-1 domain-containing protein
2980 JVXR01000069.1 GCA001061305_00844 CDS open 18371-19915 _na     514_aa cls cardiolipin synthase
2981 JVXR01000069.1 GCA001061305_00845 CDS open 19959-20630 _na     223_aa tetR Transcriptional regulator%2C TetR family
2982 JVXR01000069.1 GCA001061305_00846 CDS open 20633-22399 _na     588_aa araJ Multidrug-efflux transporter 3
2983 JVXR01000069.1 GCA001061305_00847 CDS open 22539-23492 _na     317_aa serA 4-phosphoerythronate dehydrogenase
2984 JVXR01000069.1 GCA001061305_00848 CDS open 24021-25016 _na     331_aa dppB ABC transporter permease
2985 JVXR01000069.1 GCA001061305_00849 CDS open 25013-26086 _na     357_aa dppC ABC transporter permease
2986 JVXR01000069.1 GCA001061305_00850 CDS open 26092-28206 _na     704_aa oppF murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF
2987 JVXR01000069.1 GCA001061305_00851 CDS open 28361-30163 _na     600_aa ddpA Nickel-binding periplasmic protein
2988 JVXR01000069.1 GCA001061305_00852 CDS open 30547-32265 _na     572_aa ddpA Nickel-binding periplasmic protein
2989 JVXR01000069.1 GCA001061305_00853 CDS open 32626-34344 _na     572_aa ddpA Glutathione-binding protein gsiB
2990 JVXR01000069.1 GCA001061305_00854 CDS open 34732-36438 _na     568_aa ddpA Tat pathway signal sequence domain protein
2991 JVXR01000069.1 GCA001061305_00855 CDS open 36549-38624 _na     691_aa nagE EIIBCA-Bgl
2992 JVXR01000069.1 GCA001061305_00856 CDS open 39086-41647 _na     853_aa mgtA Calcium-transporting ATPase lmo0841
2993 JVXR01000069.1 GCA001061305_00857 CDS open 41894-42655 _na     253_aa fepC heme ABC transporter ATP-binding protein
2994 JVXR01000069.1 GCA001061305_00858 CDS open 42655-43737 _na     360_aa fepD Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
2995 JVXR01000069.1 GCA001061305_00859 CDS open 43750-44934 _na     394_aa chuT Hemin-binding periplasmic protein hmuT
2996 JVXR01000069.1 GCA001061305_00860 CDS open 45135-47690 _na     851_aa tonB LPXTG-motif cell wall anchor domain protein
2997 JVXR01000069.1 GCA001061305_00861 CDS open 47929-48606 _na     225_aa Heme oxygenase
2998 JVXR01000069.1 GCA001061305_00862 CDS open 48852-49061 _na     69_aa Transcriptional regulator%2C y4mF family
2999 JVXR01000069.1 GCA001061305_00863 CDS open 49359-50684 _na     441_aa DUF2029 domain-containing protein
3000 JVXR01000069.1 GCA001061305_00864 CDS open 50902-53220 _na     772_aa purL phosphoribosylformylglycinamidine synthase subunit PurL