HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Rothia mucilaginosa clade-681 (GCA_001064585.1)

Select a Genome:
BAKTA Annotations for GCA_001064585.1
Genome Selected: Rothia mucilaginosa clade-681
ContigsBases CDSrRNA tmRNAtRNA
102 2359913 1823 5 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3771 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3771 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JVLK01000069.1 GCA001064585_00301 CDS open 1549-4830 _na     1093_aa Rad50/SbcC-type AAA domain-containing protein
2002 JVLK01000069.1 GCA001064585_00302 CDS open 4866-6485 _na     539_aa mgtE Mg/Co/Ni transporter MgtE
2003 JVLK01000069.1 GCA001064585_00303 CDS open 6621-7265 _na     214_aa Zn-dependent hydrolase including glyoxylase
2004 JVLK01000069.1 GCA001064585_00304 CDS open 7275-8366 _na     363_aa frmA S-(hydroxymethyl)mycothiol dehydrogenase
2005 JVLK01000069.1 GCA001064585_00305 CDS open 8551-9570 _na     339_aa AB hydrolase-1 domain-containing protein
2006 JVLK01000069.1 GCA001064585_00306 CDS open 9655-11046 _na     463_aa yihY YihY family protein
2007 JVLK01000069.1 GCA001064585_00307 CDS open 11309-12790 _na     493_aa malate:quinone oxidoreductase
2008 JVLK01000069.1 GCA001064585_00308 CDS open 13115-15385 _na     756_aa Solute-binding protein family 5 domain-containing protein
2009 JVLK01000069.1 GCA001064585_00310 CDS open 15802-16278 _na     158_aa bcp thioredoxin-dependent thiol peroxidase
2010 JVLK01000069.1 GCA001064585_00300 gene open 356-1552
2011 JVLK01000069.1 GCA001064585_00301 gene open 1549-4830
2012 JVLK01000069.1 GCA001064585_00302 gene open 4866-6485 mgtE
2013 JVLK01000069.1 GCA001064585_00303 gene open 6621-7265
2014 JVLK01000069.1 GCA001064585_00304 gene open 7275-8366 frmA
2015 JVLK01000069.1 GCA001064585_00305 gene open 8551-9570
2016 JVLK01000069.1 GCA001064585_00306 gene open 9655-11046 yihY
2017 JVLK01000069.1 GCA001064585_00307 gene open 11309-12790
2018 JVLK01000069.1 GCA001064585_00308 gene open 13115-15385
2019 JVLK01000069.1 GCA001064585_00310 gene open 15802-16278 bcp
2020 JVLK01000069.1 GCA001064585_00309 gene open 15535-15616 trnL
2021 JVLK01000069.1 GCA001064585_00309 tRNA open 15535-15616 trnL tRNA-Leu(tag)
2022 JVLK01000070.1 repeat_region open 5636-6221 CRISPR array with 10 repeats of length 24%2C consensus sequence GGCTCATCCCCGCTCGCGCGGGGA and spacer length 37
2023 JVLK01000070.1 GCA001064585_00311 CDS open 550-1602 _na     350_aa hypothetical protein
2024 JVLK01000070.1 GCA001064585_00312 CDS open 3142-4221 _na     359_aa SLH domain-containing protein
2025 JVLK01000070.1 GCA001064585_00313 CDS open 4724-5476 _na     250_aa pnuC Nicotinamide mononucleotide transporter PnuC
2026 JVLK01000070.1 GCA001064585_00311 gene open 550-1602
2027 JVLK01000070.1 GCA001064585_00312 gene open 3142-4221
2028 JVLK01000070.1 GCA001064585_00313 gene open 4724-5476 pnuC
2029 JVLK01000071.1 GCA001064585_00327 CDS open 459-1055 _na     198_aa HTH tetR-type domain-containing protein
2030 JVLK01000071.1 GCA001064585_00328 CDS open 1193-1513 _na     106_aa putative conserved protein
2031 JVLK01000071.1 GCA001064585_00329 CDS open 1775-2587 _na     270_aa Nudix hydrolase domain-containing protein
2032 JVLK01000071.1 GCA001064585_00330 CDS open 3274-3438 _na     54_aa hypothetical protein
2033 JVLK01000071.1 GCA001064585_00327 gene open 459-1055
2034 JVLK01000071.1 GCA001064585_00328 gene open 1193-1513
2035 JVLK01000071.1 GCA001064585_00329 gene open 1775-2587
2036 JVLK01000071.1 GCA001064585_00330 gene open 3274-3438
2037 JVLK01000072.1 GCA001064585_00441 gene open 148731-148827 Bacteria_small_SRP
2038 JVLK01000072.1 GCA001064585_00441 ncRNA open 148731-148827 Bacterial small signal recognition particle RNA
2039 JVLK01000072.1 regulatory_region open 79730-79826 SAM riboswitch aptamer (S box leader)
2040 JVLK01000072.1 regulatory_region open 80002-80110 SAM (S-adenosyl methionine) riboswitch aptamer
2041 JVLK01000072.1 GCA001064585_00331 CDS open 165-1166 _na     333_aa NADP-dependent oxidoreductase domain-containing protein
2042 JVLK01000072.1 GCA001064585_00332 CDS open 1392-2834 _na     480_aa Permease of the major facilitator superfamily
2043 JVLK01000072.1 GCA001064585_00333 CDS open 2919-3212 _na     97_aa Antitoxin
2044 JVLK01000072.1 GCA001064585_00334 CDS open 3630-4841 _na     403_aa Cytochrome P450
2045 JVLK01000072.1 GCA001064585_00335 CDS open 5032-5916 _na     294_aa Soluble lytic murein transglycosylase
2046 JVLK01000072.1 GCA001064585_00336 CDS open 6131-9025 _na     964_aa Copper-containing nitrite reductase
2047 JVLK01000072.1 GCA001064585_00337 CDS open 9378-10784 _na     468_aa Sugar transporter
2048 JVLK01000072.1 GCA001064585_00338 CDS open 10781-12262 _na     493_aa Sugar transporter
2049 JVLK01000072.1 GCA001064585_00339 CDS open 12382-14565 _na     727_aa DUF4178 domain-containing protein
2050 JVLK01000072.1 GCA001064585_00340 CDS open 14808-15788 _na     326_aa Abortive infection protein
2051 JVLK01000072.1 GCA001064585_00341 CDS open 15933-17240 _na     435_aa M18 family aminopeptidase
2052 JVLK01000072.1 GCA001064585_00342 CDS open 17493-17840 _na     115_aa MAPEG family protein
2053 JVLK01000072.1 GCA001064585_00343 CDS open 17929-18675 _na     248_aa hypothetical protein
2054 JVLK01000072.1 GCA001064585_00344 CDS open 18987-19556 _na     189_aa Yip1 domain-containing protein
2055 JVLK01000072.1 GCA001064585_00345 CDS open 19884-20549 _na     221_aa Multidrug transporter
2056 JVLK01000072.1 GCA001064585_00346 CDS open 20660-21298 _na     212_aa pdxT pyridoxal 5'-phosphate synthase glutaminase subunit PdxT
2057 JVLK01000072.1 GCA001064585_00347 CDS open 21414-22319 _na     301_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
2058 JVLK01000072.1 GCA001064585_00348 CDS open 22748-24274 _na     508_aa mepA Multidrug export protein MepA
2059 JVLK01000072.1 GCA001064585_00349 CDS open 24364-25197 _na     277_aa nadE ammonia-dependent NAD(+) synthetase
2060 JVLK01000072.1 GCA001064585_00350 CDS open 25486-25788 _na     100_aa Recombinase
2061 JVLK01000072.1 GCA001064585_00351 CDS open 26113-30153 _na     1346_aa SLH domain-containing protein
2062 JVLK01000072.1 GCA001064585_00352 CDS open 30519-34505 _na     1328_aa SLH domain-containing protein
2063 JVLK01000072.1 GCA001064585_00353 CDS open 34750-38775 _na     1341_aa SLH domain-containing protein
2064 JVLK01000072.1 GCA001064585_00354 CDS open 39103-40320 _na     405_aa Pyruvate ferredoxin oxidoreductase
2065 JVLK01000072.1 GCA001064585_00355 CDS open 40597-41067 _na     156_aa DUF4870 domain-containing protein
2066 JVLK01000072.1 GCA001064585_00356 CDS open 41304-42596 _na     430_aa purA adenylosuccinate synthase
2067 JVLK01000072.1 GCA001064585_00357 CDS open 42766-43797 _na     343_aa Mg2+ and Co2+ transporter
2068 JVLK01000072.1 GCA001064585_00358 CDS open 43835-44518 _na     227_aa Integrase
2069 JVLK01000072.1 GCA001064585_00359 CDS open 44791-45843 _na     350_aa Enterobactin ABC transporter permease
2070 JVLK01000072.1 GCA001064585_00360 CDS open 45869-47140 _na     423_aa Fe3+-siderophore ABC transporter permease
2071 JVLK01000072.1 GCA001064585_00361 CDS open 47255-48286 _na     343_aa Fe/B12 periplasmic-binding domain-containing protein
2072 JVLK01000072.1 GCA001064585_00362 CDS open 48577-49488 _na     303_aa DUF1963 domain-containing protein
2073 JVLK01000072.1 GCA001064585_00363 CDS open 49538-50458 _na     306_aa DUF1963 domain-containing protein
2074 JVLK01000072.1 GCA001064585_00364 CDS open 50552-52153 _na     533_aa Transcriptional regulator
2075 JVLK01000072.1 GCA001064585_00365 CDS open 52550-54010 _na     486_aa O-acetylhomoserine aminocarboxypropyltransferase
2076 JVLK01000072.1 GCA001064585_00366 CDS open 54010-54516 _na     168_aa yccU CoA-binding domain-containing protein
2077 JVLK01000072.1 GCA001064585_00367 CDS open 54820-55818 _na     332_aa Abi-like protein
2078 JVLK01000072.1 GCA001064585_00368 CDS open 56302-57453 _na     383_aa Cystathionine gamma-synthase
2079 JVLK01000072.1 GCA001064585_00369 CDS open 57765-58925 _na     386_aa Cystathionine gamma-synthase
2080 JVLK01000072.1 GCA001064585_00370 CDS open 59024-59869 _na     281_aa ABC-type amino acid transport/signal transduction system%2C periplasmic component
2081 JVLK01000072.1 GCA001064585_00371 CDS open 60128-60946 _na     272_aa ABC-type amino acid transport/signal transduction system%2C periplasmic component
2082 JVLK01000072.1 GCA001064585_00372 CDS open 60975-61649 _na     224_aa ABC transmembrane type-1 domain-containing protein
2083 JVLK01000072.1 GCA001064585_00373 CDS open 61642-62391 _na     249_aa ABC-type polar amino acid transport system%2C ATPase component
2084 JVLK01000072.1 GCA001064585_00374 CDS open 62491-63282 _na     263_aa Glycine transporter domain-containing protein
2085 JVLK01000072.1 GCA001064585_00375 CDS open 63554-63727 _na     57_aa MFS transporter
2086 JVLK01000072.1 GCA001064585_00376 CDS open 63825-64475 _na     216_aa L-alanine-DL-glutamate epimerase
2087 JVLK01000072.1 GCA001064585_00377 CDS open 64605-65129 _na     174_aa GNAT family acetyltransferase
2088 JVLK01000072.1 GCA001064585_00378 CDS open 65203-65733 _na     176_aa ahpD Alkyl hydroperoxide reductase AhpD
2089 JVLK01000072.1 GCA001064585_00379 CDS open 65737-66318 _na     193_aa ahpC Alkyl hydroperoxide reductase
2090 JVLK01000072.1 GCA001064585_00380 CDS open 66584-67234 _na     216_aa [ribosomal protein uS5]-alanine N-acetyltransferase
2091 JVLK01000072.1 GCA001064585_00381 CDS open 67269-67586 _na     105_aa acylphosphatase
2092 JVLK01000072.1 GCA001064585_00382 CDS open 67851-69422 _na     523_aa Major facilitator superfamily (MFS) profile domain-containing protein
2093 JVLK01000072.1 GCA001064585_00383 CDS open 69605-69745 _na     46_aa Pyridoxal/pyridoxine/pyridoxamine kinase
2094 JVLK01000072.1 GCA001064585_00384 CDS open 69891-70499 _na     202_aa DUF1269 domain-containing protein
2095 JVLK01000072.1 GCA001064585_00385 CDS open 70950-71642 _na     230_aa NAD(P)-binding domain-containing protein
2096 JVLK01000072.1 GCA001064585_00386 CDS open 72041-72892 _na     283_aa Transcriptional initiation protein Tat
2097 JVLK01000072.1 GCA001064585_00387 CDS open 73125-74213 _na     362_aa C4-dicarboxylate ABC transporter substrate-binding protein
2098 JVLK01000072.1 GCA001064585_00388 CDS open 74360-76474 _na     704_aa acs acetate--CoA ligase
2099 JVLK01000072.1 GCA001064585_00389 CDS open 76918-77760 _na     280_aa ABC transmembrane type-1 domain-containing protein
2100 JVLK01000072.1 GCA001064585_00390 CDS open 77760-78824 _na     354_aa Alkanesulfonates-binding protein
2101 JVLK01000072.1 GCA001064585_00391 CDS open 78889-79725 _na     278_aa ABC transporter domain-containing protein
2102 JVLK01000072.1 GCA001064585_00392 CDS open 80225-81652 _na     475_aa Luciferase-like domain-containing protein
2103 JVLK01000072.1 GCA001064585_00393 CDS open 81886-82266 _na     126_aa UPF0225 protein RMDY18_18280
2104 JVLK01000072.1 GCA001064585_00394 CDS open 82401-83849 _na     482_aa Permease
2105 JVLK01000072.1 GCA001064585_00395 CDS open 84196-85662 _na     488_aa Permease
2106 JVLK01000072.1 GCA001064585_00396 CDS open 86005-86370 _na     121_aa DUF2218 domain-containing protein
2107 JVLK01000072.1 GCA001064585_00397 CDS open 86595-88070 _na     491_aa ferredoxin--NADP(+) reductase
2108 JVLK01000072.1 GCA001064585_00398 CDS open 88438-89019 _na     193_aa Transcriptional regulator
2109 JVLK01000072.1 GCA001064585_00402 CDS open 90532-91479 _na     315_aa ABC transporter domain-containing protein
2110 JVLK01000072.1 GCA001064585_00403 CDS open 91476-92240 _na     254_aa ABC transmembrane type-1 domain-containing protein
2111 JVLK01000072.1 GCA001064585_00404 CDS open 92244-92942 _na     232_aa ABC transmembrane type-1 domain-containing protein
2112 JVLK01000072.1 GCA001064585_00405 CDS open 92948-93898 _na     316_aa Glycine/betaine ABC transporter substrate-binding protein
2113 JVLK01000072.1 GCA001064585_00406 CDS open 94056-95879 _na     607_aa Glycosyl hydrolase family 13 catalytic domain-containing protein
2114 JVLK01000072.1 GCA001064585_00407 CDS open 96295-98139 _na     614_aa ilvD dihydroxy-acid dehydratase
2115 JVLK01000072.1 GCA001064585_00408 CDS open 98402-99436 _na     344_aa 2-oxoglutarate dehydrogenase
2116 JVLK01000072.1 GCA001064585_00409 CDS open 99572-99850 _na     92_aa ABM domain-containing protein
2117 JVLK01000072.1 GCA001064585_00410 CDS open 100121-101317 _na     398_aa RNase H type-1 domain-containing protein
2118 JVLK01000072.1 GCA001064585_00411 CDS open 101564-102121 _na     185_aa putative protein conserved in archaea
2119 JVLK01000072.1 GCA001064585_00412 CDS open 102185-103663 _na     492_aa cls cardiolipin synthase
2120 JVLK01000072.1 GCA001064585_00413 CDS open 103673-104506 _na     277_aa HTH tetR-type domain-containing protein
2121 JVLK01000072.1 GCA001064585_00414 CDS open 104639-106381 _na     580_aa Major facilitator superfamily (MFS) profile domain-containing protein
2122 JVLK01000072.1 GCA001064585_00415 CDS open 106908-107903 _na     331_aa ABC-type dipeptide/oligopeptide/nickel transport system%2C permease component
2123 JVLK01000072.1 GCA001064585_00416 CDS open 107900-108901 _na     333_aa ABC-type dipeptide/oligopeptide/nickel transport system%2C permease component
2124 JVLK01000072.1 GCA001064585_00417 CDS open 108901-110994 _na     697_aa oppF murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF
2125 JVLK01000072.1 GCA001064585_00418 CDS open 111425-113125 _na     566_aa Solute-binding protein family 5 domain-containing protein
2126 JVLK01000072.1 GCA001064585_00419 CDS open 113494-115224 _na     576_aa Solute-binding protein family 5 domain-containing protein
2127 JVLK01000072.1 GCA001064585_00420 CDS open 115633-117333 _na     566_aa Solute-binding protein family 5 domain-containing protein
2128 JVLK01000072.1 GCA001064585_00421 CDS open 117775-119484 _na     569_aa Solute-binding protein family 5 domain-containing protein
2129 JVLK01000072.1 GCA001064585_00422 CDS open 119815-121521 _na     568_aa Solute-binding protein family 5 domain-containing protein
2130 JVLK01000072.1 GCA001064585_00423 CDS open 121771-123474 _na     567_aa Solute-binding protein family 5 domain-containing protein
2131 JVLK01000072.1 GCA001064585_00424 CDS open 123659-124687 _na     342_aa Dihydrodipicolinate synthase
2132 JVLK01000072.1 GCA001064585_00425 CDS open 124868-126940 _na     690_aa PTS beta-glucoside transporter subunit EIIBCA
2133 JVLK01000072.1 GCA001064585_00426 CDS open 127550-130108 _na     852_aa Cation-transporting P-type ATPase N-terminal domain-containing protein
2134 JVLK01000072.1 GCA001064585_00427 CDS open 130368-131138 _na     256_aa heme ABC transporter ATP-binding protein
2135 JVLK01000072.1 GCA001064585_00428 CDS open 131135-132214 _na     359_aa ABC-type Fe3+-siderophore transport system%2C permease component
2136 JVLK01000072.1 GCA001064585_00429 CDS open 132214-133377 _na     387_aa Fe/B12 periplasmic-binding domain-containing protein
2137 JVLK01000072.1 GCA001064585_00430 CDS open 133561-135918 _na     785_aa DNA-directed RNA polymerase%2C beta subunit
2138 JVLK01000072.1 GCA001064585_00431 CDS open 136156-136818 _na     220_aa Heme oxygenase
2139 JVLK01000072.1 GCA001064585_00432 CDS open 136943-139261 _na     772_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
2140 JVLK01000072.1 GCA001064585_00433 CDS open 139287-140099 _na     270_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
2141 JVLK01000072.1 GCA001064585_00434 CDS open 140105-140356 _na     83_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
2142 JVLK01000072.1 GCA001064585_00435 CDS open 140479-141429 _na     316_aa 3-methyladenine DNA glycosylase
2143 JVLK01000072.1 GCA001064585_00436 CDS open 141482-142141 _na     219_aa Toxin PIN
2144 JVLK01000072.1 GCA001064585_00437 CDS open 142135-142599 _na     154_aa Excisionase
2145 JVLK01000072.1 GCA001064585_00438 CDS open 142820-144115 _na     431_aa aspartate kinase
2146 JVLK01000072.1 GCA001064585_00439 CDS open 144326-145504 _na     392_aa recR recombination mediator RecR
2147 JVLK01000072.1 GCA001064585_00440 CDS open 145695-148502 _na     935_aa DNA polymerase III subunit gamma and tau
2148 JVLK01000072.1 GCA001064585_00443 CDS open 149234-149557 _na     107_aa Transcriptional regulator
2149 JVLK01000072.1 GCA001064585_00444 CDS open 149701-150396 _na     231_aa HTH tetR-type domain-containing protein
2150 JVLK01000072.1 GCA001064585_00445 CDS open 150506-151558 _na     350_aa Alpha/beta hydrolase
2151 JVLK01000072.1 GCA001064585_00446 CDS open 151792-152520 _na     242_aa queuosine precursor transporter
2152 JVLK01000072.1 GCA001064585_00447 CDS open 152628-154082 _na     484_aa Amino acid permease/ SLC12A domain-containing protein
2153 JVLK01000072.1 GCA001064585_00448 CDS open 154315-155820 _na     501_aa Gamma-aminobutyrate permease
2154 JVLK01000072.1 GCA001064585_00449 CDS open 156180-156692 _na     170_aa Thioesterase domain-containing protein
2155 JVLK01000072.1 GCA001064585_00450 CDS open 156798-157931 _na     377_aa Phosphoglycerol transferase
2156 JVLK01000072.1 GCA001064585_00451 CDS open 158145-158852 _na     235_aa hypothetical protein
2157 JVLK01000072.1 GCA001064585_00452 CDS open 158973-159482 _na     169_aa Activator of Hsp90 ATPase-like ue 1/2-like C-terminal domain-containing protein
2158 JVLK01000072.1 GCA001064585_00453 CDS open 159515-160825 _na     436_aa tgt tRNA guanosine(34) transglycosylase Tgt
2159 JVLK01000072.1 GCA001064585_00454 CDS open 160940-161878 _na     312_aa Dyp-type peroxidase
2160 JVLK01000072.1 GCA001064585_00455 CDS open 162013-163275 _na     420_aa putative glycosyl hydrolase
2161 JVLK01000072.1 GCA001064585_00456 CDS open 163438-164577 _na     379_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
2162 JVLK01000072.1 GCA001064585_00457 CDS open 165150-165734 _na     194_aa HTH tetR-type domain-containing protein
2163 JVLK01000072.1 GCA001064585_00458 CDS open 165731-165943 _na     70_aa hypothetical protein
2164 JVLK01000072.1 GCA001064585_00459 CDS open 166016-171595 _na     1859_aa ATP-dependent helicase
2165 JVLK01000072.1 GCA001064585_00460 CDS open 171738-172325 _na     195_aa malonic semialdehyde reductase
2166 JVLK01000072.1 GCA001064585_00461 CDS open 172478-173410 _na     310_aa DUF4232 domain-containing protein
2167 JVLK01000072.1 GCA001064585_00462 CDS open 173413-173733 _na     106_aa Ferredoxin
2168 JVLK01000072.1 GCA001064585_00463 CDS open 174013-175266 _na     417_aa Cell wall biosynthesis glycosyltransferase
2169 JVLK01000072.1 GCA001064585_00464 CDS open 175266-176852 _na     528_aa DNA repair protein
2170 JVLK01000072.1 GCA001064585_00466 CDS open 177804-179654 _na     616_aa pepCK phosphoenolpyruvate carboxykinase (GTP)
2171 JVLK01000072.1 GCA001064585_00467 CDS open 180014-180484 _na     156_aa putative transcriptional regulator
2172 JVLK01000072.1 GCA001064585_00468 CDS open 181109-182290 _na     393_aa nitric oxide dioxygenase
2173 JVLK01000072.1 GCA001064585_00469 CDS open 182425-183861 _na     478_aa manB phosphomannomutase/phosphoglucomutase
2174 JVLK01000072.1 GCA001064585_00470 CDS open 183969-185156 _na     395_aa manA mannose-6-phosphate isomerase%2C class I
2175 JVLK01000072.1 GCA001064585_00471 CDS open 185490-185759 _na     89_aa ACT domain-containing protein
2176 JVLK01000072.1 GCA001064585_00472 CDS open 185770-187125 _na     451_aa UPF0210 protein RMDY18_17400
2177 JVLK01000072.1 GCA001064585_00473 CDS open 187258-188400 _na     380_aa DNA polymerase III subunit delta'
2178 JVLK01000072.1 GCA001064585_00474 CDS open 188397-189113 _na     238_aa tmk dTMP kinase
2179 JVLK01000072.1 GCA001064585_00475 CDS open 189273-190475 _na     400_aa Cystathionine gamma-synthase
2180 JVLK01000072.1 GCA001064585_00476 CDS open 190524-190841 _na     105_aa DUF2516 domain-containing protein
2181 JVLK01000072.1 GCA001064585_00477 CDS open 191062-191799 _na     245_aa gpmA phosphoglyceromutase
2182 JVLK01000072.1 GCA001064585_00478 CDS open 191982-193109 _na     375_aa senX3 Sensor-like histidine kinase SenX3
2183 JVLK01000072.1 GCA001064585_00479 CDS open 193151-193834 _na     227_aa regX3 Sensory transduction protein RegX3
2184 JVLK01000072.1 GCA001064585_00480 CDS open 193850-194593 _na     247_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
2185 JVLK01000072.1 GCA001064585_00481 CDS open 194667-195149 _na     160_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
2186 JVLK01000072.1 GCA001064585_00482 CDS open 195238-196650 _na     470_aa cysS cysteine--tRNA ligase
2187 JVLK01000072.1 GCA001064585_00483 CDS open 196746-197732 _na     328_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
2188 JVLK01000072.1 GCA001064585_00331 gene open 165-1166
2189 JVLK01000072.1 GCA001064585_00332 gene open 1392-2834
2190 JVLK01000072.1 GCA001064585_00333 gene open 2919-3212
2191 JVLK01000072.1 GCA001064585_00334 gene open 3630-4841
2192 JVLK01000072.1 GCA001064585_00335 gene open 5032-5916
2193 JVLK01000072.1 GCA001064585_00336 gene open 6131-9025
2194 JVLK01000072.1 GCA001064585_00337 gene open 9378-10784
2195 JVLK01000072.1 GCA001064585_00338 gene open 10781-12262
2196 JVLK01000072.1 GCA001064585_00339 gene open 12382-14565
2197 JVLK01000072.1 GCA001064585_00340 gene open 14808-15788
2198 JVLK01000072.1 GCA001064585_00341 gene open 15933-17240
2199 JVLK01000072.1 GCA001064585_00342 gene open 17493-17840
2200 JVLK01000072.1 GCA001064585_00343 gene open 17929-18675
2201 JVLK01000072.1 GCA001064585_00344 gene open 18987-19556
2202 JVLK01000072.1 GCA001064585_00345 gene open 19884-20549
2203 JVLK01000072.1 GCA001064585_00346 gene open 20660-21298 pdxT
2204 JVLK01000072.1 GCA001064585_00347 gene open 21414-22319 pdxS
2205 JVLK01000072.1 GCA001064585_00348 gene open 22748-24274 mepA
2206 JVLK01000072.1 GCA001064585_00349 gene open 24364-25197 nadE
2207 JVLK01000072.1 GCA001064585_00350 gene open 25486-25788
2208 JVLK01000072.1 GCA001064585_00351 gene open 26113-30153
2209 JVLK01000072.1 GCA001064585_00352 gene open 30519-34505
2210 JVLK01000072.1 GCA001064585_00353 gene open 34750-38775
2211 JVLK01000072.1 GCA001064585_00354 gene open 39103-40320
2212 JVLK01000072.1 GCA001064585_00355 gene open 40597-41067
2213 JVLK01000072.1 GCA001064585_00356 gene open 41304-42596 purA
2214 JVLK01000072.1 GCA001064585_00357 gene open 42766-43797
2215 JVLK01000072.1 GCA001064585_00358 gene open 43835-44518
2216 JVLK01000072.1 GCA001064585_00359 gene open 44791-45843
2217 JVLK01000072.1 GCA001064585_00360 gene open 45869-47140
2218 JVLK01000072.1 GCA001064585_00361 gene open 47255-48286
2219 JVLK01000072.1 GCA001064585_00362 gene open 48577-49488
2220 JVLK01000072.1 GCA001064585_00363 gene open 49538-50458
2221 JVLK01000072.1 GCA001064585_00364 gene open 50552-52153
2222 JVLK01000072.1 GCA001064585_00365 gene open 52550-54010
2223 JVLK01000072.1 GCA001064585_00366 gene open 54010-54516 yccU
2224 JVLK01000072.1 GCA001064585_00367 gene open 54820-55818
2225 JVLK01000072.1 GCA001064585_00368 gene open 56302-57453
2226 JVLK01000072.1 GCA001064585_00369 gene open 57765-58925
2227 JVLK01000072.1 GCA001064585_00370 gene open 59024-59869
2228 JVLK01000072.1 GCA001064585_00371 gene open 60128-60946
2229 JVLK01000072.1 GCA001064585_00372 gene open 60975-61649
2230 JVLK01000072.1 GCA001064585_00373 gene open 61642-62391
2231 JVLK01000072.1 GCA001064585_00374 gene open 62491-63282
2232 JVLK01000072.1 GCA001064585_00375 gene open 63554-63727
2233 JVLK01000072.1 GCA001064585_00376 gene open 63825-64475
2234 JVLK01000072.1 GCA001064585_00377 gene open 64605-65129
2235 JVLK01000072.1 GCA001064585_00378 gene open 65203-65733 ahpD
2236 JVLK01000072.1 GCA001064585_00379 gene open 65737-66318 ahpC
2237 JVLK01000072.1 GCA001064585_00380 gene open 66584-67234
2238 JVLK01000072.1 GCA001064585_00381 gene open 67269-67586
2239 JVLK01000072.1 GCA001064585_00382 gene open 67851-69422
2240 JVLK01000072.1 GCA001064585_00383 gene open 69605-69745
2241 JVLK01000072.1 GCA001064585_00384 gene open 69891-70499
2242 JVLK01000072.1 GCA001064585_00385 gene open 70950-71642
2243 JVLK01000072.1 GCA001064585_00386 gene open 72041-72892
2244 JVLK01000072.1 GCA001064585_00387 gene open 73125-74213
2245 JVLK01000072.1 GCA001064585_00388 gene open 74360-76474 acs
2246 JVLK01000072.1 GCA001064585_00389 gene open 76918-77760
2247 JVLK01000072.1 GCA001064585_00390 gene open 77760-78824
2248 JVLK01000072.1 GCA001064585_00391 gene open 78889-79725
2249 JVLK01000072.1 GCA001064585_00392 gene open 80225-81652
2250 JVLK01000072.1 GCA001064585_00393 gene open 81886-82266
2251 JVLK01000072.1 GCA001064585_00394 gene open 82401-83849
2252 JVLK01000072.1 GCA001064585_00395 gene open 84196-85662
2253 JVLK01000072.1 GCA001064585_00396 gene open 86005-86370
2254 JVLK01000072.1 GCA001064585_00397 gene open 86595-88070
2255 JVLK01000072.1 GCA001064585_00398 gene open 88438-89019
2256 JVLK01000072.1 GCA001064585_00402 gene open 90532-91479
2257 JVLK01000072.1 GCA001064585_00403 gene open 91476-92240
2258 JVLK01000072.1 GCA001064585_00404 gene open 92244-92942
2259 JVLK01000072.1 GCA001064585_00405 gene open 92948-93898
2260 JVLK01000072.1 GCA001064585_00406 gene open 94056-95879
2261 JVLK01000072.1 GCA001064585_00407 gene open 96295-98139 ilvD
2262 JVLK01000072.1 GCA001064585_00408 gene open 98402-99436
2263 JVLK01000072.1 GCA001064585_00409 gene open 99572-99850
2264 JVLK01000072.1 GCA001064585_00410 gene open 100121-101317
2265 JVLK01000072.1 GCA001064585_00411 gene open 101564-102121
2266 JVLK01000072.1 GCA001064585_00412 gene open 102185-103663 cls
2267 JVLK01000072.1 GCA001064585_00413 gene open 103673-104506
2268 JVLK01000072.1 GCA001064585_00414 gene open 104639-106381
2269 JVLK01000072.1 GCA001064585_00415 gene open 106908-107903
2270 JVLK01000072.1 GCA001064585_00416 gene open 107900-108901
2271 JVLK01000072.1 GCA001064585_00417 gene open 108901-110994 oppF
2272 JVLK01000072.1 GCA001064585_00418 gene open 111425-113125
2273 JVLK01000072.1 GCA001064585_00419 gene open 113494-115224
2274 JVLK01000072.1 GCA001064585_00420 gene open 115633-117333
2275 JVLK01000072.1 GCA001064585_00421 gene open 117775-119484
2276 JVLK01000072.1 GCA001064585_00422 gene open 119815-121521
2277 JVLK01000072.1 GCA001064585_00423 gene open 121771-123474
2278 JVLK01000072.1 GCA001064585_00424 gene open 123659-124687
2279 JVLK01000072.1 GCA001064585_00425 gene open 124868-126940
2280 JVLK01000072.1 GCA001064585_00426 gene open 127550-130108
2281 JVLK01000072.1 GCA001064585_00427 gene open 130368-131138
2282 JVLK01000072.1 GCA001064585_00428 gene open 131135-132214
2283 JVLK01000072.1 GCA001064585_00429 gene open 132214-133377
2284 JVLK01000072.1 GCA001064585_00430 gene open 133561-135918
2285 JVLK01000072.1 GCA001064585_00431 gene open 136156-136818
2286 JVLK01000072.1 GCA001064585_00432 gene open 136943-139261 purL
2287 JVLK01000072.1 GCA001064585_00433 gene open 139287-140099 purQ
2288 JVLK01000072.1 GCA001064585_00434 gene open 140105-140356 purS
2289 JVLK01000072.1 GCA001064585_00435 gene open 140479-141429
2290 JVLK01000072.1 GCA001064585_00436 gene open 141482-142141
2291 JVLK01000072.1 GCA001064585_00437 gene open 142135-142599
2292 JVLK01000072.1 GCA001064585_00438 gene open 142820-144115
2293 JVLK01000072.1 GCA001064585_00439 gene open 144326-145504 recR
2294 JVLK01000072.1 GCA001064585_00440 gene open 145695-148502
2295 JVLK01000072.1 GCA001064585_00443 gene open 149234-149557
2296 JVLK01000072.1 GCA001064585_00444 gene open 149701-150396
2297 JVLK01000072.1 GCA001064585_00445 gene open 150506-151558
2298 JVLK01000072.1 GCA001064585_00446 gene open 151792-152520
2299 JVLK01000072.1 GCA001064585_00447 gene open 152628-154082
2300 JVLK01000072.1 GCA001064585_00448 gene open 154315-155820
2301 JVLK01000072.1 GCA001064585_00449 gene open 156180-156692
2302 JVLK01000072.1 GCA001064585_00450 gene open 156798-157931
2303 JVLK01000072.1 GCA001064585_00451 gene open 158145-158852
2304 JVLK01000072.1 GCA001064585_00452 gene open 158973-159482
2305 JVLK01000072.1 GCA001064585_00453 gene open 159515-160825 tgt
2306 JVLK01000072.1 GCA001064585_00454 gene open 160940-161878
2307 JVLK01000072.1 GCA001064585_00455 gene open 162013-163275
2308 JVLK01000072.1 GCA001064585_00456 gene open 163438-164577
2309 JVLK01000072.1 GCA001064585_00457 gene open 165150-165734
2310 JVLK01000072.1 GCA001064585_00458 gene open 165731-165943
2311 JVLK01000072.1 GCA001064585_00459 gene open 166016-171595
2312 JVLK01000072.1 GCA001064585_00460 gene open 171738-172325
2313 JVLK01000072.1 GCA001064585_00461 gene open 172478-173410
2314 JVLK01000072.1 GCA001064585_00462 gene open 173413-173733
2315 JVLK01000072.1 GCA001064585_00463 gene open 174013-175266
2316 JVLK01000072.1 GCA001064585_00464 gene open 175266-176852
2317 JVLK01000072.1 GCA001064585_00466 gene open 177804-179654 pepCK
2318 JVLK01000072.1 GCA001064585_00467 gene open 180014-180484
2319 JVLK01000072.1 GCA001064585_00468 gene open 181109-182290
2320 JVLK01000072.1 GCA001064585_00469 gene open 182425-183861 manB
2321 JVLK01000072.1 GCA001064585_00470 gene open 183969-185156 manA
2322 JVLK01000072.1 GCA001064585_00471 gene open 185490-185759
2323 JVLK01000072.1 GCA001064585_00472 gene open 185770-187125
2324 JVLK01000072.1 GCA001064585_00473 gene open 187258-188400
2325 JVLK01000072.1 GCA001064585_00474 gene open 188397-189113 tmk
2326 JVLK01000072.1 GCA001064585_00475 gene open 189273-190475
2327 JVLK01000072.1 GCA001064585_00476 gene open 190524-190841
2328 JVLK01000072.1 GCA001064585_00477 gene open 191062-191799 gpmA
2329 JVLK01000072.1 GCA001064585_00478 gene open 191982-193109 senX3
2330 JVLK01000072.1 GCA001064585_00479 gene open 193151-193834 regX3
2331 JVLK01000072.1 GCA001064585_00480 gene open 193850-194593
2332 JVLK01000072.1 GCA001064585_00481 gene open 194667-195149
2333 JVLK01000072.1 GCA001064585_00482 gene open 195238-196650 cysS
2334 JVLK01000072.1 GCA001064585_00483 gene open 196746-197732 rlmB
2335 JVLK01000072.1 GCA001064585_00399 gene open 89970-90042 trnE
2336 JVLK01000072.1 GCA001064585_00400 gene open 90111-90184 trnD
2337 JVLK01000072.1 GCA001064585_00401 gene open 90258-90330 trnF
2338 JVLK01000072.1 GCA001064585_00442 gene open 149027-149115 trnS
2339 JVLK01000072.1 GCA001064585_00465 gene open 177229-177304 trnR
2340 JVLK01000072.1 GCA001064585_00399 tRNA open 89970-90042 trnE tRNA-Glu(ttc)
2341 JVLK01000072.1 GCA001064585_00400 tRNA open 90111-90184 trnD tRNA-Asp(gtc)
2342 JVLK01000072.1 GCA001064585_00401 tRNA open 90258-90330 trnF tRNA-Phe(gaa)
2343 JVLK01000072.1 GCA001064585_00442 tRNA open 149027-149115 trnS tRNA-Ser(gga)
2344 JVLK01000072.1 GCA001064585_00465 tRNA open 177229-177304 trnR tRNA-Arg(acg)
2345 JVLK01000073.1 regulatory_region open 103608-103722 SAM (S-adenosyl methionine) riboswitch aptamer
2346 JVLK01000073.1 GCA001064585_00484 CDS open 64-561 _na     165_aa Cytidylyltransferase
2347 JVLK01000073.1 GCA001064585_00485 CDS open 1088-1558 _na     156_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2348 JVLK01000073.1 GCA001064585_00486 CDS open 1625-2923 _na     432_aa Cysteine desulfurase
2349 JVLK01000073.1 GCA001064585_00487 CDS open 3127-3714 _na     195_aa pth aminoacyl-tRNA hydrolase
2350 JVLK01000073.1 GCA001064585_00488 CDS open 3861-4520 _na     219_aa 50S ribosomal protein L25/general stress protein Ctc
2351 JVLK01000073.1 GCA001064585_00489 CDS open 4765-6189 _na     474_aa rfbD dTDP-4-dehydrorhamnose reductase
2352 JVLK01000073.1 GCA001064585_00490 CDS open 6189-7187 _na     332_aa rfbB dTDP-glucose 4%2C6-dehydratase
2353 JVLK01000073.1 GCA001064585_00491 CDS open 7262-8122 _na     286_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2354 JVLK01000073.1 GCA001064585_00492 CDS open 8219-9691 _na     490_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
2355 JVLK01000073.1 GCA001064585_00493 CDS open 9737-10660 _na     307_aa 2-nitropropane dioxygenase
2356 JVLK01000073.1 GCA001064585_00494 CDS open 10657-10965 _na     102_aa Chemotaxis protein
2357 JVLK01000073.1 GCA001064585_00495 CDS open 11050-12297 _na     415_aa D-inositol 3-phosphate glycosyltransferase
2358 JVLK01000073.1 GCA001064585_00496 CDS open 12310-13257 _na     315_aa Glycosyltransferase involved in cell wall biogenesis
2359 JVLK01000073.1 GCA001064585_00497 CDS open 13323-14363 _na     346_aa Glycosyl transferase family 1 domain-containing protein
2360 JVLK01000073.1 GCA001064585_00498 CDS open 14366-15769 _na     467_aa Zinc ABC transporter permease
2361 JVLK01000073.1 GCA001064585_00499 CDS open 15766-16881 _na     371_aa Glycosyltransferase
2362 JVLK01000073.1 GCA001064585_00500 CDS open 16878-17963 _na     361_aa Acyltransferase 3 domain-containing protein
2363 JVLK01000073.1 GCA001064585_00501 CDS open 17975-20218 _na     747_aa spsE Spore coat polysaccharide biosynthesis protein spsE
2364 JVLK01000073.1 GCA001064585_00502 CDS open 20309-21037 _na     242_aa Acylneuraminate cytidylyltransferase
2365 JVLK01000073.1 GCA001064585_00503 CDS open 21037-22137 _na     366_aa RNA-binding protein
2366 JVLK01000073.1 GCA001064585_00504 CDS open 22128-23126 _na     332_aa Spore protein YkvP/CgeB glycosyl transferase-like domain-containing protein
2367 JVLK01000073.1 GCA001064585_00505 CDS open 23385-24305 _na     306_aa Glycosyltransferase 2-like domain-containing protein
2368 JVLK01000073.1 GCA001064585_00506 CDS open 24487-25449 _na     320_aa Glycosyl transferase family 11
2369 JVLK01000073.1 GCA001064585_00507 CDS open 25446-26414 _na     322_aa Glycosyltransferase 2-like domain-containing protein
2370 JVLK01000073.1 GCA001064585_00508 CDS open 26525-28342 _na     605_aa ABC transporter ATP-binding protein
2371 JVLK01000073.1 GCA001064585_00509 CDS open 28351-29460 _na     369_aa Acyltransferase 3 domain-containing protein
2372 JVLK01000073.1 GCA001064585_00510 CDS open 29460-30434 _na     324_aa Glycosyltransferase family 2 protein
2373 JVLK01000073.1 GCA001064585_00511 CDS open 30753-31877 _na     374_aa Phosphotyrosine protein phosphatase
2374 JVLK01000073.1 GCA001064585_00512 CDS open 32039-33019 _na     326_aa ribose-phosphate diphosphokinase
2375 JVLK01000073.1 GCA001064585_00513 CDS open 33040-34494 _na     484_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2376 JVLK01000073.1 GCA001064585_00515 CDS open 34885-36714 _na     609_aa ccmA heme ABC exporter ATP-binding protein CcmA
2377 JVLK01000073.1 GCA001064585_00516 CDS open 36874-37896 _na     340_aa 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase
2378 JVLK01000073.1 GCA001064585_00517 CDS open 37967-38839 _na     290_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
2379 JVLK01000073.1 GCA001064585_00518 CDS open 38885-39706 _na     273_aa LPS biosynthesis protein
2380 JVLK01000073.1 GCA001064585_00519 CDS open 40092-40913 _na     273_aa LPS biosynthesis protein
2381 JVLK01000073.1 GCA001064585_00520 CDS open 41144-42217 _na     357_aa Mg-dependent DNase
2382 JVLK01000073.1 GCA001064585_00521 CDS open 42284-43249 _na     321_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2383 JVLK01000073.1 GCA001064585_00522 CDS open 43447-45093 _na     548_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
2384 JVLK01000073.1 GCA001064585_00523 CDS open 45240-46574 _na     444_aa Integral membrane protein
2385 JVLK01000073.1 GCA001064585_00524 CDS open 46721-46942 _na     73_aa DUF3499 domain-containing protein
2386 JVLK01000073.1 GCA001064585_00525 CDS open 46963-47379 _na     138_aa whiB Transcriptional regulator WhiB
2387 JVLK01000073.1 GCA001064585_00526 CDS open 48074-48877 _na     267_aa TIGR03089 family protein
2388 JVLK01000073.1 GCA001064585_00527 CDS open 49058-49675 _na     205_aa GtrA/DPMS transmembrane domain-containing protein
2389 JVLK01000073.1 GCA001064585_00528 CDS open 50045-51235 _na     396_aa 5-(carboxyamino)imidazole ribonucleotide synthase
2390 JVLK01000073.1 GCA001064585_00529 CDS open 51335-51973 _na     212_aa N5-carboxyaminoimidazole ribonucleotide mutase
2391 JVLK01000073.1 GCA001064585_00530 CDS open 51993-52994 _na     333_aa putative protein involved in methicillin resistance
2392 JVLK01000073.1 GCA001064585_00531 CDS open 53159-54166 _na     335_aa glpX class II fructose-bisphosphatase
2393 JVLK01000073.1 GCA001064585_00532 CDS open 54584-55303 _na     239_aa Carbonic anhydrase
2394 JVLK01000073.1 GCA001064585_00533 CDS open 55506-56933 _na     475_aa fumC Fumarate hydratase class II
2395 JVLK01000073.1 GCA001064585_00534 CDS open 57067-58284 _na     405_aa Major facilitator superfamily (MFS) profile domain-containing protein
2396 JVLK01000073.1 GCA001064585_00535 CDS open 58756-59262 _na     168_aa NTP pyrophosphohydrolase including oxidative damage repair enzyme
2397 JVLK01000073.1 GCA001064585_00536 CDS open 59390-59917 _na     175_aa Prepilin type IV endopeptidase peptidase domain-containing protein
2398 JVLK01000073.1 GCA001064585_00537 CDS open 60029-60838 _na     269_aa uppS polyprenyl diphosphate synthase
2399 JVLK01000073.1 GCA001064585_00538 CDS open 61118-62089 _na     323_aa mca mycothiol conjugate amidase Mca
2400 JVLK01000073.1 GCA001064585_00539 CDS open 62509-63006 _na     165_aa greA transcription elongation factor GreA
2401 JVLK01000073.1 GCA001064585_00540 CDS open 63178-64431 _na     417_aa ilvA threonine ammonia-lyase
2402 JVLK01000073.1 GCA001064585_00541 CDS open 64665-65942 _na     425_aa AI-2E family transporter
2403 JVLK01000073.1 GCA001064585_00542 CDS open 66115-67104 _na     329_aa MFS transporter permease
2404 JVLK01000073.1 GCA001064585_00543 CDS open 67302-68186 _na     294_aa Phosphoglycolate phosphatase
2405 JVLK01000073.1 GCA001064585_00545 CDS open 68830-70215 _na     461_aa NAD(P)/FAD-dependent oxidoreductase
2406 JVLK01000073.1 GCA001064585_00546 CDS open 70672-72270 _na     532_aa Peptidase S8/S53 domain-containing protein
2407 JVLK01000073.1 GCA001064585_00547 CDS open 72334-73287 _na     317_aa Ppx/GppA phosphatase N-terminal domain-containing protein
2408 JVLK01000073.1 GCA001064585_00548 CDS open 73440-74039 _na     199_aa Septum formation initiator family protein
2409 JVLK01000073.1 GCA001064585_00549 CDS open 74124-74768 _na     214_aa Septum formation inhibitor
2410 JVLK01000073.1 GCA001064585_00550 CDS open 74992-76272 _na     426_aa eno phosphopyruvate hydratase
2411 JVLK01000073.1 GCA001064585_00551 CDS open 76644-77390 _na     248_aa putative pyrophosphatase
2412 JVLK01000073.1 GCA001064585_00552 CDS open 77479-81321 _na     1280_aa Ornithinee aminotransferase
2413 JVLK01000073.1 GCA001064585_00553 CDS open 81572-82846 _na     424_aa abgB N-acetyldiaminopimelate deacetylase
2414 JVLK01000073.1 GCA001064585_00554 CDS open 83065-83853 _na     262_aa sdhB Fumarate reductase iron-sulfur subunit
2415 JVLK01000073.1 GCA001064585_00555 CDS open 83855-85618 _na     587_aa sdhA succinate dehydrogenase flavoprotein subunit
2416 JVLK01000073.1 GCA001064585_00556 CDS open 85670-86155 _na     161_aa sdhD Succinate dehydrogenase%2C hydrophobic anchor subunit
2417 JVLK01000073.1 GCA001064585_00557 CDS open 86159-86617 _na     152_aa sdhC succinate dehydrogenase%2C cytochrome b556 subunit
2418 JVLK01000073.1 GCA001064585_00558 CDS open 86964-88073 _na     369_aa Mannose-1-phosphate guanylyltransferase
2419 JVLK01000073.1 GCA001064585_00559 CDS open 88355-89764 _na     469_aa Tat pathway signal sequence domain protein
2420 JVLK01000073.1 GCA001064585_00560 CDS open 89869-90447 _na     192_aa 2'-5' RNA ligase
2421 JVLK01000073.1 GCA001064585_00561 CDS open 90499-91563 _na     354_aa trpS tryptophan--tRNA ligase
2422 JVLK01000073.1 GCA001064585_00562 CDS open 91650-92525 _na     291_aa exodeoxyribonuclease III
2423 JVLK01000073.1 GCA001064585_00563 CDS open 92609-93439 _na     276_aa HTH gntR-type domain-containing protein
2424 JVLK01000073.1 GCA001064585_00564 CDS open 93546-94424 _na     292_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
2425 JVLK01000073.1 GCA001064585_00565 CDS open 94630-95904 _na     424_aa Serine hydroxymethyltransferase
2426 JVLK01000073.1 GCA001064585_00566 CDS open 96181-96762 _na     193_aa Transcriptional regulator
2427 JVLK01000073.1 GCA001064585_00567 CDS open 97031-98641 _na     536_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2428 JVLK01000073.1 GCA001064585_00568 CDS open 98853-99449 _na     198_aa purN phosphoribosylglycinamide formyltransferase
2429 JVLK01000073.1 GCA001064585_00569 CDS open 99691-100281 _na     196_aa 4-hydroxyphenylpyruvate dioxygenase
2430 JVLK01000073.1 GCA001064585_00570 CDS open 100294-102717 _na     807_aa hypothetical protein
2431 JVLK01000073.1 GCA001064585_00571 CDS open 102880-103314 _na     144_aa putative nucleic acid-binding protein
2432 JVLK01000073.1 GCA001064585_00572 CDS open 103325-103552 _na     75_aa Nuclease PIN
2433 JVLK01000073.1 GCA001064585_00573 CDS open 103977-108155 _na     1392_aa DEAD/DEAH box helicase
2434 JVLK01000073.1 GCA001064585_00574 CDS open 108330-109166 _na     278_aa NADP-dependent oxidoreductase domain-containing protein
2435 JVLK01000073.1 GCA001064585_00575 CDS open 109331-111910 _na     859_aa S1 motif domain-containing protein
2436 JVLK01000073.1 GCA001064585_00576 CDS open 112291-113907 _na     538_aa Dehydrogenase
2437 JVLK01000073.1 GCA001064585_00577 CDS open 114114-115589 _na     491_aa Amino acid permease/ SLC12A domain-containing protein
2438 JVLK01000073.1 GCA001064585_00578 CDS open 116050-117519 _na     489_aa Gamma-aminobutyrate permease
2439 JVLK01000073.1 GCA001064585_00579 CDS open 118021-118419 _na     132_aa doxX DoxX family protein
2440 JVLK01000073.1 GCA001064585_00580 CDS open 118661-119467 _na     268_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2441 JVLK01000073.1 GCA001064585_00581 CDS open 119576-119893 _na     105_aa hypothetical protein
2442 JVLK01000073.1 GCA001064585_00582 CDS open 120562-121311 _na     249_aa hypothetical protein
2443 JVLK01000073.1 GCA001064585_00583 CDS open 121978-123216 _na     412_aa Transposase
2444 JVLK01000073.1 GCA001064585_00584 CDS open 123370-123876 _na     168_aa hspR heat shock protein transcriptional repressor HspR
2445 JVLK01000073.1 GCA001064585_00585 CDS open 123880-124872 _na     330_aa J domain-containing protein
2446 JVLK01000073.1 GCA001064585_00586 CDS open 125197-125775 _na     192_aa grpE Protein GrpE
2447 JVLK01000073.1 GCA001064585_00587 CDS open 125778-127610 _na     610_aa dnaK molecular chaperone DnaK
2448 JVLK01000073.1 GCA001064585_00588 CDS open 128330-130054 _na     574_aa pentapeptide repeat-containing protein
2449 JVLK01000073.1 GCA001064585_00589 CDS open 130189-131829 _na     546_aa Pentapeptide repeat-containing protein
2450 JVLK01000073.1 GCA001064585_00590 CDS open 132003-133667 _na     554_aa pentapeptide repeat-containing protein
2451 JVLK01000073.1 GCA001064585_00591 CDS open 135099-135395 _na     98_aa hypothetical protein
2452 JVLK01000073.1 GCA001064585_00484 gene open 64-561
2453 JVLK01000073.1 GCA001064585_00485 gene open 1088-1558 sufU
2454 JVLK01000073.1 GCA001064585_00486 gene open 1625-2923
2455 JVLK01000073.1 GCA001064585_00487 gene open 3127-3714 pth
2456 JVLK01000073.1 GCA001064585_00488 gene open 3861-4520
2457 JVLK01000073.1 GCA001064585_00489 gene open 4765-6189 rfbD
2458 JVLK01000073.1 GCA001064585_00490 gene open 6189-7187 rfbB
2459 JVLK01000073.1 GCA001064585_00491 gene open 7262-8122 rfbA
2460 JVLK01000073.1 GCA001064585_00492 gene open 8219-9691
2461 JVLK01000073.1 GCA001064585_00493 gene open 9737-10660
2462 JVLK01000073.1 GCA001064585_00494 gene open 10657-10965
2463 JVLK01000073.1 GCA001064585_00495 gene open 11050-12297
2464 JVLK01000073.1 GCA001064585_00496 gene open 12310-13257
2465 JVLK01000073.1 GCA001064585_00497 gene open 13323-14363
2466 JVLK01000073.1 GCA001064585_00498 gene open 14366-15769
2467 JVLK01000073.1 GCA001064585_00499 gene open 15766-16881
2468 JVLK01000073.1 GCA001064585_00500 gene open 16878-17963
2469 JVLK01000073.1 GCA001064585_00501 gene open 17975-20218 spsE
2470 JVLK01000073.1 GCA001064585_00502 gene open 20309-21037
2471 JVLK01000073.1 GCA001064585_00503 gene open 21037-22137
2472 JVLK01000073.1 GCA001064585_00504 gene open 22128-23126
2473 JVLK01000073.1 GCA001064585_00505 gene open 23385-24305
2474 JVLK01000073.1 GCA001064585_00506 gene open 24487-25449
2475 JVLK01000073.1 GCA001064585_00507 gene open 25446-26414
2476 JVLK01000073.1 GCA001064585_00508 gene open 26525-28342
2477 JVLK01000073.1 GCA001064585_00509 gene open 28351-29460
2478 JVLK01000073.1 GCA001064585_00510 gene open 29460-30434
2479 JVLK01000073.1 GCA001064585_00511 gene open 30753-31877
2480 JVLK01000073.1 GCA001064585_00512 gene open 32039-33019
2481 JVLK01000073.1 GCA001064585_00513 gene open 33040-34494 glmU
2482 JVLK01000073.1 GCA001064585_00515 gene open 34885-36714 ccmA
2483 JVLK01000073.1 GCA001064585_00516 gene open 36874-37896
2484 JVLK01000073.1 GCA001064585_00517 gene open 37967-38839 rsmA
2485 JVLK01000073.1 GCA001064585_00518 gene open 38885-39706
2486 JVLK01000073.1 GCA001064585_00519 gene open 40092-40913
2487 JVLK01000073.1 GCA001064585_00520 gene open 41144-42217
2488 JVLK01000073.1 GCA001064585_00521 gene open 42284-43249 rsmI
2489 JVLK01000073.1 GCA001064585_00522 gene open 43447-45093
2490 JVLK01000073.1 GCA001064585_00523 gene open 45240-46574
2491 JVLK01000073.1 GCA001064585_00524 gene open 46721-46942
2492 JVLK01000073.1 GCA001064585_00525 gene open 46963-47379 whiB
2493 JVLK01000073.1 GCA001064585_00526 gene open 48074-48877
2494 JVLK01000073.1 GCA001064585_00527 gene open 49058-49675
2495 JVLK01000073.1 GCA001064585_00528 gene open 50045-51235
2496 JVLK01000073.1 GCA001064585_00529 gene open 51335-51973
2497 JVLK01000073.1 GCA001064585_00530 gene open 51993-52994
2498 JVLK01000073.1 GCA001064585_00531 gene open 53159-54166 glpX
2499 JVLK01000073.1 GCA001064585_00532 gene open 54584-55303
2500 JVLK01000073.1 GCA001064585_00533 gene open 55506-56933 fumC