BAKTAGenome Explorer: Rothia mucilaginosa clade-681 (GCA_001065115.1)
Select a Genome:
|
BAKTA Annotations for GCA_001065115.1
|
Search & Sort all 3580 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | JVFT01000007.1 | GCA001065115_01344 | CDS | open | 221194-224340 | _na 1048_aa | Nuclease | |
| 2502 | JVFT01000007.1 | GCA001065115_01345 | CDS | open | 224872-226113 | _na 413_aa | Permease of the major facilitator superfamily | |
| 2503 | JVFT01000007.1 | GCA001065115_01346 | CDS | open | 226292-226975 | _na 227_aa | Single-stranded DNA-specific exonuclease | |
| 2504 | JVFT01000007.1 | GCA001065115_01347 | CDS | open | 227171-227902 | _na 243_aa | Manganese transport regulator | |
| 2505 | JVFT01000007.1 | GCA001065115_01348 | CDS | open | 228064-228948 | _na 294_aa | Metal ABC transporter permease | |
| 2506 | JVFT01000007.1 | GCA001065115_01349 | CDS | open | 228949-229773 | _na 274_aa | ABC transporter domain-containing protein | |
| 2507 | JVFT01000007.1 | GCA001065115_01350 | CDS | open | 229968-230930 | _na 320_aa | Iron-binding protein | |
| 2508 | JVFT01000007.1 | GCA001065115_01351 | CDS | open | 231267-232106 | _na 279_aa | exodeoxyribonuclease III | |
| 2509 | JVFT01000007.1 | GCA001065115_01352 | CDS | open | 232274-233086 | _na 270_aa | SLH domain-containing protein | |
| 2510 | JVFT01000007.1 | GCA001065115_01353 | CDS | open | 233582-234910 | _na 442_aa | Rhamnogalacturonase A/B/Epimerase-like pectate lyase domain-containing protein | |
| 2511 | JVFT01000007.1 | GCA001065115_01354 | CDS | open | 235326-236672 | _na 448_aa | Endopolygalacturonase | |
| 2512 | JVFT01000007.1 | GCA001065115_01355 | CDS | open | 237265-238263 | _na 332_aa | Bile acid:sodium symporter | |
| 2513 | JVFT01000007.1 | GCA001065115_01356 | CDS | open | 238456-240099 | _na 547_aa | Peptidase M48 domain-containing protein | |
| 2514 | JVFT01000007.1 | GCA001065115_01357 | CDS | open | 240391-241527 | _na 378_aa | Acetate kinase | |
| 2515 | JVFT01000007.1 | GCA001065115_01358 | CDS | open | 241864-243552 | _na 562_aa | Transposase | |
| 2516 | JVFT01000007.1 | GCA001065115_01359 | CDS | open | 243917-245005 | _na 362_aa | DAGKc domain-containing protein | |
| 2517 | JVFT01000007.1 | GCA001065115_01360 | CDS | open | 245275-246585 | _na 436_aa | serS | serine--tRNA ligase |
| 2518 | JVFT01000007.1 | GCA001065115_01361 | CDS | open | 246666-247613 | _na 315_aa | pheA | prephenate dehydratase |
| 2519 | JVFT01000007.1 | GCA001065115_01362 | CDS | open | 247784-248680 | _na 298_aa | Spermidine synthase | |
| 2520 | JVFT01000007.1 | GCA001065115_01363 | CDS | open | 248773-249396 | _na 207_aa | N-acetyltransferase domain-containing protein | |
| 2521 | JVFT01000007.1 | GCA001065115_01364 | CDS | open | 249590-251680 | _na 696_aa | pta | phosphate acetyltransferase |
| 2522 | JVFT01000007.1 | GCA001065115_01365 | CDS | open | 251966-253048 | _na 360_aa | putative restriction endonuclease | |
| 2523 | JVFT01000007.1 | GCA001065115_01366 | CDS | open | 253138-254457 | _na 439_aa | Cytosine-specific methyltransferase | |
| 2524 | JVFT01000007.1 | GCA001065115_01367 | CDS | open | 254652-256193 | _na 513_aa | Sau3AI family type II restriction endonuclease | |
| 2525 | JVFT01000007.1 | GCA001065115_01368 | CDS | open | 256740-257450 | _na 236_aa | Transposase | |
| 2526 | JVFT01000007.1 | GCA001065115_01369 | CDS | open | 257800-258603 | _na 267_aa | Peptide ABC transporter ATPase | |
| 2527 | JVFT01000007.1 | GCA001065115_01370 | CDS | open | 259303-259728 | _na 141_aa | csoR | Copper-sensing transcriptional repressor CsoR |
| 2528 | JVFT01000007.1 | GCA001065115_01371 | CDS | open | 259792-260007 | _na 71_aa | copZ | HMA domain-containing protein |
| 2529 | JVFT01000007.1 | GCA001065115_01372 | CDS | open | 260037-260423 | _na 128_aa | Chorismate mutase | |
| 2530 | JVFT01000007.1 | GCA001065115_01373 | CDS | open | 260763-263147 | _na 794_aa | Carbonate dehydratase | |
| 2531 | JVFT01000007.1 | GCA001065115_01374 | CDS | open | 263438-264094 | _na 218_aa | Nitroreductase | |
| 2532 | JVFT01000007.1 | GCA001065115_01375 | CDS | open | 264308-265780 | _na 490_aa | MATE efflux family protein | |
| 2533 | JVFT01000007.1 | GCA001065115_01376 | CDS | open | 265856-266248 | _na 130_aa | Ribosome-associated heat shock protein | |
| 2534 | JVFT01000007.1 | GCA001065115_01377 | CDS | open | 266594-267421 | _na 275_aa | UDP pyrophosphate synthase | |
| 2535 | JVFT01000007.1 | GCA001065115_01378 | CDS | open | 267564-268781 | _na 405_aa | ABC transporter permease | |
| 2536 | JVFT01000007.1 | GCA001065115_01379 | CDS | open | 268938-269561 | _na 207_aa | Transcriptional regulator | |
| 2537 | JVFT01000007.1 | GCA001065115_01380 | CDS | open | 269675-270835 | _na 386_aa | Sucrase ferredoxin | |
| 2538 | JVFT01000007.1 | GCA001065115_01381 | CDS | open | 271044-272705 | _na 553_aa | Aldehyde dehydrogenase domain-containing protein | |
| 2539 | JVFT01000007.1 | GCA001065115_01382 | CDS | open | 273089-274693 | _na 534_aa | GP-PDE domain-containing protein | |
| 2540 | JVFT01000007.1 | GCA001065115_01383 | CDS | open | 275085-275597 | _na 170_aa | PTS system glucose-specific IIA | |
| 2541 | JVFT01000007.1 | GCA001065115_01384 | CDS | open | 275876-276517 | _na 213_aa | arsD | Arsenical resistance operon trans-acting repressor ArsD |
| 2542 | JVFT01000007.1 | GCA001065115_01385 | CDS | open | 276684-277709 | _na 341_aa | fbaA | class II fructose-bisphosphate aldolase |
| 2543 | JVFT01000007.1 | GCA001065115_01386 | CDS | open | 277973-278359 | _na 128_aa | Cobalamin ABC transporter ATPase | |
| 2544 | JVFT01000007.1 | GCA001065115_01387 | CDS | open | 278666-280261 | _na 531_aa | Amino acid permease/ SLC12A domain-containing protein | |
| 2545 | JVFT01000007.1 | GCA001065115_01388 | CDS | open | 280563-281615 | _na 350_aa | oCDMu | Ornithine cyclodeaminase |
| 2546 | JVFT01000007.1 | GCA001065115_01389 | CDS | open | 281805-282620 | _na 271_aa | Lipoprotein | |
| 2547 | JVFT01000007.1 | GCA001065115_01390 | CDS | open | 282688-283044 | _na 118_aa | Lactococcin 972 family bacteriocin | |
| 2548 | JVFT01000007.1 | GCA001065115_01391 | CDS | open | 283031-283129 | _na 32_aa | hypothetical protein | |
| 2549 | JVFT01000007.1 | GCA001065115_01392 | CDS | open | 283495-284256 | _na 253_aa | spoU | tRNA/rRNA methyltransferase SpoU type domain-containing protein |
| 2550 | JVFT01000007.1 | GCA001065115_01393 | CDS | open | 284380-284961 | _na 193_aa | Orotate phosphoribosyltransferase | |
| 2551 | JVFT01000007.1 | GCA001065115_01394 | CDS | open | 285027-286595 | _na 522_aa | pabB | aminodeoxychorismate synthase component I |
| 2552 | JVFT01000007.1 | GCA001065115_01395 | CDS | open | 286631-286963 | _na 110_aa | Rhodanese-related sulfurtransferase | |
| 2553 | JVFT01000007.1 | GCA001065115_01396 | CDS | open | 287181-288734 | _na 517_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 2554 | JVFT01000007.1 | GCA001065115_01397 | CDS | open | 289237-289761 | _na 174_aa | DUF4242 domain-containing protein | |
| 2555 | JVFT01000007.1 | GCA001065115_01398 | CDS | open | 289792-290877 | _na 361_aa | nrtC | NrtC protein |
| 2556 | JVFT01000007.1 | GCA001065115_01399 | CDS | open | 291373-291609 | _na 78_aa | Transglycosylase | |
| 2557 | JVFT01000007.1 | GCA001065115_01400 | CDS | open | 291701-291991 | _na 96_aa | hypothetical protein | |
| 2558 | JVFT01000007.1 | GCA001065115_01401 | CDS | open | 292249-293583 | _na 444_aa | Nitrate reductase | |
| 2559 | JVFT01000007.1 | GCA001065115_01402 | CDS | open | 293715-295232 | _na 505_aa | trmB | TrmB family transcriptional regulator |
| 2560 | JVFT01000007.1 | GCA001065115_01403 | CDS | open | 295423-296235 | _na 270_aa | Haloacid dehalogenase | |
| 2561 | JVFT01000007.1 | GCA001065115_01404 | CDS | open | 296337-296882 | _na 181_aa | Kinase inhibitor | |
| 2562 | JVFT01000007.1 | GCA001065115_01405 | CDS | open | 296966-297901 | _na 311_aa | pfkB | Carbohydrate kinase PfkB domain-containing protein |
| 2563 | JVFT01000007.1 | GCA001065115_01406 | CDS | open | 298191-299627 | _na 478_aa | glyceraldehyde-3-phosphate dehydrogenase | |
| 2564 | JVFT01000007.1 | GCA001065115_01407 | CDS | open | 299892-300476 | _na 194_aa | mdaB | Modulator of drug activity B |
| 2565 | JVFT01000007.1 | GCA001065115_01408 | CDS | open | 300596-301792 | _na 398_aa | Protease/lipase ABC transporter permease/ATP-binding protein | |
| 2566 | JVFT01000007.1 | GCA001065115_01409 | CDS | open | 301782-303497 | _na 571_aa | pelF | GT4 family glycosyltransferase PelF |
| 2567 | JVFT01000007.1 | GCA001065115_01410 | CDS | open | 303531-304886 | _na 451_aa | Transcriptional regulator | |
| 2568 | JVFT01000007.1 | GCA001065115_01411 | CDS | open | 305369-310258 | _na 1629_aa | NAD-specific glutamate dehydrogenase | |
| 2569 | JVFT01000007.1 | GCA001065115_01412 | CDS | open | 310478-311413 | _na 311_aa | Shikimate 5-dehydrogenase | |
| 2570 | JVFT01000007.1 | GCA001065115_01413 | CDS | open | 311498-312790 | _na 430_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 2571 | JVFT01000007.1 | GCA001065115_01414 | CDS | open | 313187-313837 | _na 216_aa | N-acetylmuramoyl-L-alanine amidase | |
| 2572 | JVFT01000007.1 | GCA001065115_01415 | CDS | open | 314583-314684 | _na 33_aa | hypothetical protein | |
| 2573 | JVFT01000007.1 | GCA001065115_01416 | CDS | open | 314863-315462 | _na 199_aa | hypothetical protein | |
| 2574 | JVFT01000007.1 | GCA001065115_01417 | CDS | open | 315657-315881 | _na 74_aa | Transposase | |
| 2575 | JVFT01000007.1 | GCA001065115_01418 | CDS | open | 316192-317400 | _na 402_aa | Polysaccharide biosynthesis protein | |
| 2576 | JVFT01000007.1 | GCA001065115_01419 | CDS | open | 317553-318428 | _na 291_aa | bcsA | Glycosyltransferase%2C group 2 family protein |
| 2577 | JVFT01000007.1 | GCA001065115_01420 | CDS | open | 318483-318866 | _na 127_aa | DUF2304 domain-containing protein | |
| 2578 | JVFT01000007.1 | GCA001065115_01421 | CDS | open | 318869-319612 | _na 247_aa | Glycosyl transferase family 2 | |
| 2579 | JVFT01000007.1 | GCA001065115_01423 | CDS | open | 322193-322735 | _na 180_aa | Flavin reductase like domain-containing protein | |
| 2580 | JVFT01000007.1 | GCA001065115_01424 | CDS | open | 322867-324096 | _na 409_aa | argE | acetylornithine deacetylase |
| 2581 | JVFT01000007.1 | GCA001065115_01425 | CDS | open | 324576-325583 | _na 335_aa | Glycerol uptake facilitator | |
| 2582 | JVFT01000007.1 | GCA001065115_01426 | CDS | open | 325735-326376 | _na 213_aa | VanZ-like domain-containing protein | |
| 2583 | JVFT01000007.1 | GCA001065115_01427 | CDS | open | 326602-327054 | _na 150_aa | fluC | Fluoride-specific ion channel FluC |
| 2584 | JVFT01000007.1 | GCA001065115_01428 | CDS | open | 327054-327509 | _na 151_aa | Fluoride-specific ion channel | |
| 2585 | JVFT01000007.1 | GCA001065115_01429 | CDS | open | 327583-330396 | _na 937_aa | SSD domain-containing protein | |
| 2586 | JVFT01000007.1 | GCA001065115_01430 | CDS | open | 330575-331276 | _na 233_aa | HTH tetR-type domain-containing protein | |
| 2587 | JVFT01000007.1 | GCA001065115_01431 | CDS | open | 331555-333213 | _na 552_aa | histidine kinase | |
| 2588 | JVFT01000007.1 | GCA001065115_01432 | CDS | open | 333313-334056 | _na 247_aa | ompR | DNA-binding response regulator |
| 2589 | JVFT01000007.1 | GCA001065115_01433 | CDS | open | 334316-335185 | _na 289_aa | PRD domain-containing protein | |
| 2590 | JVFT01000007.1 | GCA001065115_01434 | CDS | open | 335964-336944 | _na 326_aa | PTS system mannose-specific EIIAB component | |
| 2591 | JVFT01000007.1 | GCA001065115_01435 | CDS | open | 336941-337807 | _na 288_aa | PTS mannose/fructose/sorbose transporter subunit IIC | |
| 2592 | JVFT01000007.1 | GCA001065115_01436 | CDS | open | 337819-338673 | _na 284_aa | PTS mannose transporter subunit IID | |
| 2593 | JVFT01000007.1 | GCA001065115_01437 | CDS | open | 338846-339619 | _na 257_aa | Hydrolase | |
| 2594 | JVFT01000007.1 | GCA001065115_01438 | CDS | open | 339755-340279 | _na 174_aa | Chemotaxis protein | |
| 2595 | JVFT01000007.1 | GCA001065115_01439 | CDS | open | 340462-340809 | _na 115_aa | ATPase | |
| 2596 | JVFT01000007.1 | GCA001065115_01440 | CDS | open | 340821-341333 | _na 170_aa | ATPase | |
| 2597 | JVFT01000007.1 | GCA001065115_01441 | CDS | open | 341518-343260 | _na 580_aa | Cation/H+ exchanger transmembrane domain-containing protein | |
| 2598 | JVFT01000007.1 | GCA001065115_01442 | CDS | open | 343510-344460 | _na 316_aa | Biotin synthase | |
| 2599 | JVFT01000007.1 | GCA001065115_01443 | CDS | open | 344752-345354 | _na 200_aa | Transcriptional regulator | |
| 2600 | JVFT01000007.1 | GCA001065115_01444 | CDS | open | 345629-347026 | _na 465_aa | Galactokinase | |
| 2601 | JVFT01000007.1 | GCA001065115_01445 | CDS | open | 347462-347626 | _na 54_aa | Small-conductance mechanosensitive channel | |
| 2602 | JVFT01000007.1 | GCA001065115_01446 | CDS | open | 348119-348439 | _na 106_aa | Glutaredoxin-related protein | |
| 2603 | JVFT01000007.1 | GCA001065115_01447 | CDS | open | 348441-349259 | _na 272_aa | shikimate 5-dehydrogenase | |
| 2604 | JVFT01000007.1 | GCA001065115_01448 | CDS | open | 349603-350424 | _na 273_aa | Rhomboid family intramembrane serine protease | |
| 2605 | JVFT01000007.1 | GCA001065115_01449 | CDS | open | 350482-351306 | _na 274_aa | Peptidase S54 rhomboid domain-containing protein | |
| 2606 | JVFT01000007.1 | GCA001065115_01450 | CDS | open | 351479-352036 | _na 185_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 2607 | JVFT01000007.1 | GCA001065115_01451 | CDS | open | 352180-352515 | _na 111_aa | hypothetical protein | |
| 2608 | JVFT01000007.1 | GCA001065115_01454 | CDS | open | 353124-354323 | _na 399_aa | Acetamidase | |
| 2609 | JVFT01000007.1 | GCA001065115_01455 | CDS | open | 354530-354982 | _na 150_aa | Sodium:melibiose symporter | |
| 2610 | JVFT01000007.1 | GCA001065115_01456 | CDS | open | 355033-355326 | _na 97_aa | DUF2516 domain-containing protein | |
| 2611 | JVFT01000007.1 | GCA001065115_01457 | CDS | open | 355341-356567 | _na 408_aa | Phosphate transporter | |
| 2612 | JVFT01000007.1 | GCA001065115_01460 | CDS | open | 357371-357472 | _na 33_aa | hypothetical protein | |
| 2613 | JVFT01000007.1 | GCA001065115_01462 | CDS | open | 357767-358363 | _na 198_aa | DUF3566 domain-containing protein | |
| 2614 | JVFT01000007.1 | GCA001065115_01463 | CDS | open | 358363-360993 | _na 876_aa | gyrA | DNA gyrase subunit A |
| 2615 | JVFT01000007.1 | GCA001065115_01464 | CDS | open | 361073-363103 | _na 676_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 2616 | JVFT01000007.1 | GCA001065115_01465 | CDS | open | 363562-364257 | _na 231_aa | RNA-binding protein | |
| 2617 | JVFT01000007.1 | GCA001065115_01466 | CDS | open | 364250-365491 | _na 413_aa | recF | DNA replication/repair protein RecF |
| 2618 | JVFT01000007.1 | GCA001065115_01467 | CDS | open | 365682-366806 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 2619 | JVFT01000007.1 | GCA001065115_01468 | CDS | open | 367607-369307 | _na 566_aa | dnaA | chromosomal replication initiator protein DnaA |
| 2620 | JVFT01000007.1 | GCA001065115_01469 | CDS | open | 369877-370014 | _na 45_aa | rpmH | 50S ribosomal protein L34 |
| 2621 | JVFT01000007.1 | GCA001065115_01470 | CDS | open | 370276-370503 | _na 75_aa | Ribonuclease P | |
| 2622 | JVFT01000007.1 | GCA001065115_01471 | CDS | open | 370500-370973 | _na 157_aa | yidD | membrane protein insertion efficiency factor YidD |
| 2623 | JVFT01000007.1 | GCA001065115_01472 | CDS | open | 371025-372014 | _na 329_aa | yidC | membrane protein insertase YidC |
| 2624 | JVFT01000007.1 | GCA001065115_01473 | CDS | open | 372126-372692 | _na 188_aa | R3H domain-containing protein | |
| 2625 | JVFT01000007.1 | GCA001065115_01474 | CDS | open | 372694-373335 | _na 213_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 2626 | JVFT01000007.1 | GCA001065115_01475 | CDS | open | 373789-374631 | _na 280_aa | ATPase involved in chromosome partitioning | |
| 2627 | JVFT01000007.1 | GCA001065115_01476 | CDS | open | 374868-376166 | _na 432_aa | ParB/Sulfiredoxin domain-containing protein | |
| 2628 | JVFT01000007.1 | GCA001065115_01477 | CDS | open | 376279-376605 | _na 108_aa | trxA | thioredoxin |
| 2629 | JVFT01000007.1 | GCA001065115_01478 | CDS | open | 376659-377693 | _na 344_aa | trxB | thioredoxin-disulfide reductase |
| 2630 | JVFT01000007.1 | GCA001065115_01479 | CDS | open | 377941-379131 | _na 396_aa | Serine/threonine protein kinase | |
| 2631 | JVFT01000007.1 | GCA001065115_01480 | CDS | open | 379326-380990 | _na 554_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 2632 | JVFT01000007.1 | GCA001065115_01481 | CDS | open | 381057-381560 | _na 167_aa | NTP pyrophosphohydrolase including oxidative damage repair enzyme | |
| 2633 | JVFT01000007.1 | GCA001065115_01482 | CDS | open | 381687-383111 | _na 474_aa | CCA tRNA nucleotidyltransferase | |
| 2634 | JVFT01000007.1 | GCA001065115_01483 | CDS | open | 383302-383607 | _na 101_aa | rpsF | 30S ribosomal protein S6 |
| 2635 | JVFT01000007.1 | GCA001065115_01484 | CDS | open | 383703-384335 | _na 210_aa | Single-stranded DNA-binding protein | |
| 2636 | JVFT01000007.1 | GCA001065115_01485 | CDS | open | 384419-384655 | _na 78_aa | rpsR | 30S ribosomal protein S18 |
| 2637 | JVFT01000007.1 | GCA001065115_01486 | CDS | open | 384676-385128 | _na 150_aa | rplI | 50S ribosomal protein L9 |
| 2638 | JVFT01000007.1 | GCA001065115_01487 | CDS | open | 385370-385675 | _na 101_aa | Transmembrane protein | |
| 2639 | JVFT01000007.1 | GCA001065115_01488 | CDS | open | 386320-387126 | _na 268_aa | SAM-dependent methyltransferase | |
| 2640 | JVFT01000007.1 | GCA001065115_01489 | CDS | open | 387286-388485 | _na 399_aa | Erythromycin biosynthesis protein CIII-like C-terminal domain-containing protein | |
| 2641 | JVFT01000007.1 | GCA001065115_01490 | CDS | open | 388591-389946 | _na 451_aa | dnaB | replicative DNA helicase |
| 2642 | JVFT01000007.1 | GCA001065115_01153 | gene | open | 17-349 | |||
| 2643 | JVFT01000007.1 | GCA001065115_01154 | gene | open | 349-1524 | |||
| 2644 | JVFT01000007.1 | GCA001065115_01155 | gene | open | 1850-2923 | |||
| 2645 | JVFT01000007.1 | GCA001065115_01156 | gene | open | 3006-4661 | |||
| 2646 | JVFT01000007.1 | GCA001065115_01157 | gene | open | 4840-5811 | |||
| 2647 | JVFT01000007.1 | GCA001065115_01158 | gene | open | 6121-8937 | topA | ||
| 2648 | JVFT01000007.1 | GCA001065115_01159 | gene | open | 9278-9736 | |||
| 2649 | JVFT01000007.1 | GCA001065115_01160 | gene | open | 9809-11632 | |||
| 2650 | JVFT01000007.1 | GCA001065115_01161 | gene | open | 11635-11898 | |||
| 2651 | JVFT01000007.1 | GCA001065115_01162 | gene | open | 12053-12202 | |||
| 2652 | JVFT01000007.1 | GCA001065115_01163 | gene | open | 12244-12942 | |||
| 2653 | JVFT01000007.1 | GCA001065115_01164 | gene | open | 12885-13244 | |||
| 2654 | JVFT01000007.1 | GCA001065115_01165 | gene | open | 13440-14528 | |||
| 2655 | JVFT01000007.1 | GCA001065115_01166 | gene | open | 14826-15323 | |||
| 2656 | JVFT01000007.1 | GCA001065115_01167 | gene | open | 15323-16234 | trhO | ||
| 2657 | JVFT01000007.1 | GCA001065115_01168 | gene | open | 16455-19193 | |||
| 2658 | JVFT01000007.1 | GCA001065115_01169 | gene | open | 19307-19891 | |||
| 2659 | JVFT01000007.1 | GCA001065115_01170 | gene | open | 19899-20402 | |||
| 2660 | JVFT01000007.1 | GCA001065115_01171 | gene | open | 20499-21188 | |||
| 2661 | JVFT01000007.1 | GCA001065115_01172 | gene | open | 21318-22571 | |||
| 2662 | JVFT01000007.1 | GCA001065115_01173 | gene | open | 22612-24231 | |||
| 2663 | JVFT01000007.1 | GCA001065115_01174 | gene | open | 24365-26437 | |||
| 2664 | JVFT01000007.1 | GCA001065115_01175 | gene | open | 26601-27386 | |||
| 2665 | JVFT01000007.1 | GCA001065115_01176 | gene | open | 27437-28342 | nth | ||
| 2666 | JVFT01000007.1 | GCA001065115_01177 | gene | open | 28501-28941 | aroQ | ||
| 2667 | JVFT01000007.1 | GCA001065115_01178 | gene | open | 29022-30200 | marP | ||
| 2668 | JVFT01000007.1 | GCA001065115_01179 | gene | open | 30682-31359 | crp | ||
| 2669 | JVFT01000007.1 | GCA001065115_01180 | gene | open | 31506-32675 | |||
| 2670 | JVFT01000007.1 | GCA001065115_01181 | gene | open | 32668-33150 | |||
| 2671 | JVFT01000007.1 | GCA001065115_01182 | gene | open | 33336-33539 | |||
| 2672 | JVFT01000007.1 | GCA001065115_01183 | gene | open | 33754-35850 | |||
| 2673 | JVFT01000007.1 | GCA001065115_01184 | gene | open | 35891-36904 | |||
| 2674 | JVFT01000007.1 | GCA001065115_01185 | gene | open | 36904-38943 | |||
| 2675 | JVFT01000007.1 | GCA001065115_01186 | gene | open | 38943-40817 | |||
| 2676 | JVFT01000007.1 | GCA001065115_01188 | gene | open | 41141-42274 | |||
| 2677 | JVFT01000007.1 | GCA001065115_01189 | gene | open | 42653-44236 | |||
| 2678 | JVFT01000007.1 | GCA001065115_01190 | gene | open | 44840-46399 | |||
| 2679 | JVFT01000007.1 | GCA001065115_01191 | gene | open | 46617-47261 | |||
| 2680 | JVFT01000007.1 | GCA001065115_01192 | gene | open | 47261-48889 | |||
| 2681 | JVFT01000007.1 | GCA001065115_01193 | gene | open | 48906-49700 | |||
| 2682 | JVFT01000007.1 | GCA001065115_01194 | gene | open | 50545-52218 | |||
| 2683 | JVFT01000007.1 | GCA001065115_01195 | gene | open | 52440-53288 | |||
| 2684 | JVFT01000007.1 | GCA001065115_01196 | gene | open | 53412-54338 | |||
| 2685 | JVFT01000007.1 | GCA001065115_01197 | gene | open | 54606-55958 | |||
| 2686 | JVFT01000007.1 | GCA001065115_01198 | gene | open | 56044-56382 | |||
| 2687 | JVFT01000007.1 | GCA001065115_01199 | gene | open | 56822-57949 | |||
| 2688 | JVFT01000007.1 | GCA001065115_01200 | gene | open | 57952-58404 | |||
| 2689 | JVFT01000007.1 | GCA001065115_01201 | gene | open | 58645-60396 | purF | ||
| 2690 | JVFT01000007.1 | GCA001065115_01202 | gene | open | 60396-61541 | |||
| 2691 | JVFT01000007.1 | GCA001065115_01203 | gene | open | 62183-64138 | |||
| 2692 | JVFT01000007.1 | GCA001065115_01204 | gene | open | 64235-66124 | |||
| 2693 | JVFT01000007.1 | GCA001065115_01205 | gene | open | 66734-68452 | |||
| 2694 | JVFT01000007.1 | GCA001065115_01206 | gene | open | 68671-69864 | |||
| 2695 | JVFT01000007.1 | GCA001065115_01207 | gene | open | 69861-70931 | |||
| 2696 | JVFT01000007.1 | GCA001065115_01208 | gene | open | 71264-71473 | |||
| 2697 | JVFT01000007.1 | GCA001065115_01209 | gene | open | 71841-73571 | |||
| 2698 | JVFT01000007.1 | GCA001065115_01210 | gene | open | 73800-74720 | |||
| 2699 | JVFT01000007.1 | GCA001065115_01211 | gene | open | 74843-75577 | |||
| 2700 | JVFT01000007.1 | GCA001065115_01212 | gene | open | 75893-76951 | |||
| 2701 | JVFT01000007.1 | GCA001065115_01213 | gene | open | 77258-78475 | |||
| 2702 | JVFT01000007.1 | GCA001065115_01214 | gene | open | 78648-79616 | |||
| 2703 | JVFT01000007.1 | GCA001065115_01215 | gene | open | 79780-82389 | clpB | ||
| 2704 | JVFT01000007.1 | GCA001065115_01216 | gene | open | 82678-83361 | |||
| 2705 | JVFT01000007.1 | GCA001065115_01217 | gene | open | 83380-84036 | |||
| 2706 | JVFT01000007.1 | GCA001065115_01218 | gene | open | 84351-84848 | dps | ||
| 2707 | JVFT01000007.1 | GCA001065115_01219 | gene | open | 85223-86401 | |||
| 2708 | JVFT01000007.1 | GCA001065115_01220 | gene | open | 86599-87525 | |||
| 2709 | JVFT01000007.1 | GCA001065115_01221 | gene | open | 87886-88803 | sucD | ||
| 2710 | JVFT01000007.1 | GCA001065115_01222 | gene | open | 88833-89999 | sucC | ||
| 2711 | JVFT01000007.1 | GCA001065115_01223 | gene | open | 90461-93424 | pcrA | ||
| 2712 | JVFT01000007.1 | GCA001065115_01225 | gene | open | 93725-94792 | |||
| 2713 | JVFT01000007.1 | GCA001065115_01226 | gene | open | 94960-95649 | |||
| 2714 | JVFT01000007.1 | GCA001065115_01227 | gene | open | 96419-97123 | |||
| 2715 | JVFT01000007.1 | GCA001065115_01228 | gene | open | 97350-98081 | |||
| 2716 | JVFT01000007.1 | GCA001065115_01229 | gene | open | 98223-98495 | |||
| 2717 | JVFT01000007.1 | GCA001065115_01230 | gene | open | 98570-99274 | ompR | ||
| 2718 | JVFT01000007.1 | GCA001065115_01231 | gene | open | 99276-100775 | |||
| 2719 | JVFT01000007.1 | GCA001065115_01232 | gene | open | 101169-101459 | |||
| 2720 | JVFT01000007.1 | GCA001065115_01233 | gene | open | 101692-103113 | |||
| 2721 | JVFT01000007.1 | GCA001065115_01234 | gene | open | 103273-104262 | |||
| 2722 | JVFT01000007.1 | GCA001065115_01235 | gene | open | 104383-105486 | |||
| 2723 | JVFT01000007.1 | GCA001065115_01236 | gene | open | 105550-106317 | |||
| 2724 | JVFT01000007.1 | GCA001065115_01237 | gene | open | 106314-107033 | |||
| 2725 | JVFT01000007.1 | GCA001065115_01238 | gene | open | 107340-108749 | |||
| 2726 | JVFT01000007.1 | GCA001065115_01239 | gene | open | 108945-109472 | |||
| 2727 | JVFT01000007.1 | GCA001065115_01240 | gene | open | 109868-111046 | |||
| 2728 | JVFT01000007.1 | GCA001065115_01241 | gene | open | 111251-112408 | rlmC | ||
| 2729 | JVFT01000007.1 | GCA001065115_01242 | gene | open | 113019-114641 | groL | ||
| 2730 | JVFT01000007.1 | GCA001065115_01243 | gene | open | 115053-115643 | |||
| 2731 | JVFT01000007.1 | GCA001065115_01244 | gene | open | 115905-116246 | |||
| 2732 | JVFT01000007.1 | GCA001065115_01245 | gene | open | 116434-117105 | |||
| 2733 | JVFT01000007.1 | GCA001065115_01246 | gene | open | 117245-119383 | |||
| 2734 | JVFT01000007.1 | GCA001065115_01247 | gene | open | 119791-120069 | ptsH | ||
| 2735 | JVFT01000007.1 | GCA001065115_01248 | gene | open | 120304-121998 | |||
| 2736 | JVFT01000007.1 | GCA001065115_01249 | gene | open | 122098-124101 | |||
| 2737 | JVFT01000007.1 | GCA001065115_01250 | gene | open | 124293-125243 | |||
| 2738 | JVFT01000007.1 | GCA001065115_01251 | gene | open | 125243-126034 | |||
| 2739 | JVFT01000007.1 | GCA001065115_01252 | gene | open | 126422-126901 | |||
| 2740 | JVFT01000007.1 | GCA001065115_01253 | gene | open | 126891-128180 | |||
| 2741 | JVFT01000007.1 | GCA001065115_01254 | gene | open | 128446-129432 | |||
| 2742 | JVFT01000007.1 | GCA001065115_01255 | gene | open | 129432-130850 | |||
| 2743 | JVFT01000007.1 | GCA001065115_01256 | gene | open | 131005-131769 | |||
| 2744 | JVFT01000007.1 | GCA001065115_01257 | gene | open | 131904-132599 | |||
| 2745 | JVFT01000007.1 | GCA001065115_01258 | gene | open | 132600-133655 | |||
| 2746 | JVFT01000007.1 | GCA001065115_01259 | gene | open | 133797-134681 | |||
| 2747 | JVFT01000007.1 | GCA001065115_01260 | gene | open | 134999-136765 | |||
| 2748 | JVFT01000007.1 | GCA001065115_01261 | gene | open | 136913-137062 | |||
| 2749 | JVFT01000007.1 | GCA001065115_01262 | gene | open | 137062-137724 | |||
| 2750 | JVFT01000007.1 | GCA001065115_01263 | gene | open | 137758-138870 | |||
| 2751 | JVFT01000007.1 | GCA001065115_01264 | gene | open | 139025-140500 | |||
| 2752 | JVFT01000007.1 | GCA001065115_01265 | gene | open | 140600-141586 | |||
| 2753 | JVFT01000007.1 | GCA001065115_01266 | gene | open | 141589-142755 | |||
| 2754 | JVFT01000007.1 | GCA001065115_01267 | gene | open | 143158-144285 | |||
| 2755 | JVFT01000007.1 | GCA001065115_01268 | gene | open | 144558-146837 | |||
| 2756 | JVFT01000007.1 | GCA001065115_01269 | gene | open | 146857-147450 | |||
| 2757 | JVFT01000007.1 | GCA001065115_01270 | gene | open | 147742-149175 | purB | ||
| 2758 | JVFT01000007.1 | GCA001065115_01271 | gene | open | 149286-150167 | |||
| 2759 | JVFT01000007.1 | GCA001065115_01272 | gene | open | 150439-151500 | eamA | ||
| 2760 | JVFT01000007.1 | GCA001065115_01273 | gene | open | 151699-152673 | eamA | ||
| 2761 | JVFT01000007.1 | GCA001065115_01274 | gene | open | 152776-153564 | |||
| 2762 | JVFT01000007.1 | GCA001065115_01275 | gene | open | 153564-154328 | |||
| 2763 | JVFT01000007.1 | GCA001065115_01277 | gene | open | 154829-155095 | |||
| 2764 | JVFT01000007.1 | GCA001065115_01278 | gene | open | 155222-156097 | |||
| 2765 | JVFT01000007.1 | GCA001065115_01279 | gene | open | 156421-156960 | |||
| 2766 | JVFT01000007.1 | GCA001065115_01280 | gene | open | 157209-158219 | |||
| 2767 | JVFT01000007.1 | GCA001065115_01282 | gene | open | 158535-158978 | |||
| 2768 | JVFT01000007.1 | GCA001065115_01283 | gene | open | 159046-159327 | |||
| 2769 | JVFT01000007.1 | GCA001065115_01284 | gene | open | 159465-159938 | |||
| 2770 | JVFT01000007.1 | GCA001065115_01285 | gene | open | 160174-160596 | |||
| 2771 | JVFT01000007.1 | GCA001065115_01286 | gene | open | 160705-161139 | |||
| 2772 | JVFT01000007.1 | GCA001065115_01287 | gene | open | 161226-161660 | |||
| 2773 | JVFT01000007.1 | GCA001065115_01288 | gene | open | 161833-162462 | |||
| 2774 | JVFT01000007.1 | GCA001065115_01289 | gene | open | 162673-163020 | |||
| 2775 | JVFT01000007.1 | GCA001065115_01291 | gene | open | 163431-164291 | |||
| 2776 | JVFT01000007.1 | GCA001065115_01292 | gene | open | 164291-164803 | |||
| 2777 | JVFT01000007.1 | GCA001065115_01293 | gene | open | 164923-165468 | sixA | ||
| 2778 | JVFT01000007.1 | GCA001065115_01294 | gene | open | 165622-166374 | |||
| 2779 | JVFT01000007.1 | GCA001065115_01295 | gene | open | 166944-167582 | upp | ||
| 2780 | JVFT01000007.1 | GCA001065115_01297 | gene | open | 168045-168665 | |||
| 2781 | JVFT01000007.1 | GCA001065115_01298 | gene | open | 168746-171352 | |||
| 2782 | JVFT01000007.1 | GCA001065115_01299 | gene | open | 171355-172089 | |||
| 2783 | JVFT01000007.1 | GCA001065115_01300 | gene | open | 172391-172918 | |||
| 2784 | JVFT01000007.1 | GCA001065115_01301 | gene | open | 172960-175119 | recQ | ||
| 2785 | JVFT01000007.1 | GCA001065115_01302 | gene | open | 175458-176114 | |||
| 2786 | JVFT01000007.1 | GCA001065115_01303 | gene | open | 176302-176829 | |||
| 2787 | JVFT01000007.1 | GCA001065115_01304 | gene | open | 176832-177716 | |||
| 2788 | JVFT01000007.1 | GCA001065115_01305 | gene | open | 177809-179497 | |||
| 2789 | JVFT01000007.1 | GCA001065115_01306 | gene | open | 179598-180191 | |||
| 2790 | JVFT01000007.1 | GCA001065115_01307 | gene | open | 180302-181105 | ostA | ||
| 2791 | JVFT01000007.1 | GCA001065115_01308 | gene | open | 181293-181958 | |||
| 2792 | JVFT01000007.1 | GCA001065115_01309 | gene | open | 181960-182469 | |||
| 2793 | JVFT01000007.1 | GCA001065115_01311 | gene | open | 182800-183573 | |||
| 2794 | JVFT01000007.1 | GCA001065115_01312 | gene | open | 183970-184587 | |||
| 2795 | JVFT01000007.1 | GCA001065115_01313 | gene | open | 184587-185621 | |||
| 2796 | JVFT01000007.1 | GCA001065115_01314 | gene | open | 185764-186831 | |||
| 2797 | JVFT01000007.1 | GCA001065115_01315 | gene | open | 186835-188592 | |||
| 2798 | JVFT01000007.1 | GCA001065115_01316 | gene | open | 188753-190081 | |||
| 2799 | JVFT01000007.1 | GCA001065115_01317 | gene | open | 190191-191633 | radA | ||
| 2800 | JVFT01000007.1 | GCA001065115_01318 | gene | open | 191842-192918 | disA | ||
| 2801 | JVFT01000007.1 | GCA001065115_01319 | gene | open | 193062-193301 | |||
| 2802 | JVFT01000007.1 | GCA001065115_01320 | gene | open | 193393-194214 | |||
| 2803 | JVFT01000007.1 | GCA001065115_01321 | gene | open | 194272-195327 | |||
| 2804 | JVFT01000007.1 | GCA001065115_01322 | gene | open | 195462-198044 | clpC | ||
| 2805 | JVFT01000007.1 | GCA001065115_01323 | gene | open | 199132-199485 | |||
| 2806 | JVFT01000007.1 | GCA001065115_01324 | gene | open | 200164-201747 | lysS | ||
| 2807 | JVFT01000007.1 | GCA001065115_01325 | gene | open | 201800-202747 | panC | ||
| 2808 | JVFT01000007.1 | GCA001065115_01326 | gene | open | 202744-203556 | |||
| 2809 | JVFT01000007.1 | GCA001065115_01327 | gene | open | 203835-205646 | |||
| 2810 | JVFT01000007.1 | GCA001065115_01328 | gene | open | 205646-206479 | |||
| 2811 | JVFT01000007.1 | GCA001065115_01329 | gene | open | 206466-206984 | |||
| 2812 | JVFT01000007.1 | GCA001065115_01330 | gene | open | 207030-207650 | folK | ||
| 2813 | JVFT01000007.1 | GCA001065115_01331 | gene | open | 207650-208063 | folB | ||
| 2814 | JVFT01000007.1 | GCA001065115_01332 | gene | open | 208105-209106 | folP | ||
| 2815 | JVFT01000007.1 | GCA001065115_01333 | gene | open | 209219-209419 | |||
| 2816 | JVFT01000007.1 | GCA001065115_01334 | gene | open | 209582-210547 | |||
| 2817 | JVFT01000007.1 | GCA001065115_01335 | gene | open | 210984-211568 | folE | ||
| 2818 | JVFT01000007.1 | GCA001065115_01336 | gene | open | 211555-213783 | ftsH | ||
| 2819 | JVFT01000007.1 | GCA001065115_01337 | gene | open | 214080-214631 | hpt | ||
| 2820 | JVFT01000007.1 | GCA001065115_01338 | gene | open | 214828-215961 | |||
| 2821 | JVFT01000007.1 | GCA001065115_01339 | gene | open | 215994-216218 | |||
| 2822 | JVFT01000007.1 | GCA001065115_01340 | gene | open | 216478-217308 | |||
| 2823 | JVFT01000007.1 | GCA001065115_01341 | gene | open | 217531-218361 | |||
| 2824 | JVFT01000007.1 | GCA001065115_01342 | gene | open | 218604-219089 | ppa | ||
| 2825 | JVFT01000007.1 | GCA001065115_01343 | gene | open | 219420-220988 | dacB | ||
| 2826 | JVFT01000007.1 | GCA001065115_01344 | gene | open | 221194-224340 | |||
| 2827 | JVFT01000007.1 | GCA001065115_01345 | gene | open | 224872-226113 | |||
| 2828 | JVFT01000007.1 | GCA001065115_01346 | gene | open | 226292-226975 | |||
| 2829 | JVFT01000007.1 | GCA001065115_01347 | gene | open | 227171-227902 | |||
| 2830 | JVFT01000007.1 | GCA001065115_01348 | gene | open | 228064-228948 | |||
| 2831 | JVFT01000007.1 | GCA001065115_01349 | gene | open | 228949-229773 | |||
| 2832 | JVFT01000007.1 | GCA001065115_01350 | gene | open | 229968-230930 | |||
| 2833 | JVFT01000007.1 | GCA001065115_01351 | gene | open | 231267-232106 | |||
| 2834 | JVFT01000007.1 | GCA001065115_01352 | gene | open | 232274-233086 | |||
| 2835 | JVFT01000007.1 | GCA001065115_01353 | gene | open | 233582-234910 | |||
| 2836 | JVFT01000007.1 | GCA001065115_01354 | gene | open | 235326-236672 | |||
| 2837 | JVFT01000007.1 | GCA001065115_01355 | gene | open | 237265-238263 | |||
| 2838 | JVFT01000007.1 | GCA001065115_01356 | gene | open | 238456-240099 | |||
| 2839 | JVFT01000007.1 | GCA001065115_01357 | gene | open | 240391-241527 | |||
| 2840 | JVFT01000007.1 | GCA001065115_01358 | gene | open | 241864-243552 | |||
| 2841 | JVFT01000007.1 | GCA001065115_01359 | gene | open | 243917-245005 | |||
| 2842 | JVFT01000007.1 | GCA001065115_01360 | gene | open | 245275-246585 | serS | ||
| 2843 | JVFT01000007.1 | GCA001065115_01361 | gene | open | 246666-247613 | pheA | ||
| 2844 | JVFT01000007.1 | GCA001065115_01362 | gene | open | 247784-248680 | |||
| 2845 | JVFT01000007.1 | GCA001065115_01363 | gene | open | 248773-249396 | |||
| 2846 | JVFT01000007.1 | GCA001065115_01364 | gene | open | 249590-251680 | pta | ||
| 2847 | JVFT01000007.1 | GCA001065115_01365 | gene | open | 251966-253048 | |||
| 2848 | JVFT01000007.1 | GCA001065115_01366 | gene | open | 253138-254457 | |||
| 2849 | JVFT01000007.1 | GCA001065115_01367 | gene | open | 254652-256193 | |||
| 2850 | JVFT01000007.1 | GCA001065115_01368 | gene | open | 256740-257450 | |||
| 2851 | JVFT01000007.1 | GCA001065115_01369 | gene | open | 257800-258603 | |||
| 2852 | JVFT01000007.1 | GCA001065115_01370 | gene | open | 259303-259728 | csoR | ||
| 2853 | JVFT01000007.1 | GCA001065115_01371 | gene | open | 259792-260007 | copZ | ||
| 2854 | JVFT01000007.1 | GCA001065115_01372 | gene | open | 260037-260423 | |||
| 2855 | JVFT01000007.1 | GCA001065115_01373 | gene | open | 260763-263147 | |||
| 2856 | JVFT01000007.1 | GCA001065115_01374 | gene | open | 263438-264094 | |||
| 2857 | JVFT01000007.1 | GCA001065115_01375 | gene | open | 264308-265780 | |||
| 2858 | JVFT01000007.1 | GCA001065115_01376 | gene | open | 265856-266248 | |||
| 2859 | JVFT01000007.1 | GCA001065115_01377 | gene | open | 266594-267421 | |||
| 2860 | JVFT01000007.1 | GCA001065115_01378 | gene | open | 267564-268781 | |||
| 2861 | JVFT01000007.1 | GCA001065115_01379 | gene | open | 268938-269561 | |||
| 2862 | JVFT01000007.1 | GCA001065115_01380 | gene | open | 269675-270835 | |||
| 2863 | JVFT01000007.1 | GCA001065115_01381 | gene | open | 271044-272705 | |||
| 2864 | JVFT01000007.1 | GCA001065115_01382 | gene | open | 273089-274693 | |||
| 2865 | JVFT01000007.1 | GCA001065115_01383 | gene | open | 275085-275597 | |||
| 2866 | JVFT01000007.1 | GCA001065115_01384 | gene | open | 275876-276517 | arsD | ||
| 2867 | JVFT01000007.1 | GCA001065115_01385 | gene | open | 276684-277709 | fbaA | ||
| 2868 | JVFT01000007.1 | GCA001065115_01386 | gene | open | 277973-278359 | |||
| 2869 | JVFT01000007.1 | GCA001065115_01387 | gene | open | 278666-280261 | |||
| 2870 | JVFT01000007.1 | GCA001065115_01388 | gene | open | 280563-281615 | oCDMu | ||
| 2871 | JVFT01000007.1 | GCA001065115_01389 | gene | open | 281805-282620 | |||
| 2872 | JVFT01000007.1 | GCA001065115_01390 | gene | open | 282688-283044 | |||
| 2873 | JVFT01000007.1 | GCA001065115_01391 | gene | open | 283031-283129 | |||
| 2874 | JVFT01000007.1 | GCA001065115_01392 | gene | open | 283495-284256 | spoU | ||
| 2875 | JVFT01000007.1 | GCA001065115_01393 | gene | open | 284380-284961 | |||
| 2876 | JVFT01000007.1 | GCA001065115_01394 | gene | open | 285027-286595 | pabB | ||
| 2877 | JVFT01000007.1 | GCA001065115_01395 | gene | open | 286631-286963 | |||
| 2878 | JVFT01000007.1 | GCA001065115_01396 | gene | open | 287181-288734 | |||
| 2879 | JVFT01000007.1 | GCA001065115_01397 | gene | open | 289237-289761 | |||
| 2880 | JVFT01000007.1 | GCA001065115_01398 | gene | open | 289792-290877 | nrtC | ||
| 2881 | JVFT01000007.1 | GCA001065115_01399 | gene | open | 291373-291609 | |||
| 2882 | JVFT01000007.1 | GCA001065115_01400 | gene | open | 291701-291991 | |||
| 2883 | JVFT01000007.1 | GCA001065115_01401 | gene | open | 292249-293583 | |||
| 2884 | JVFT01000007.1 | GCA001065115_01402 | gene | open | 293715-295232 | trmB | ||
| 2885 | JVFT01000007.1 | GCA001065115_01403 | gene | open | 295423-296235 | |||
| 2886 | JVFT01000007.1 | GCA001065115_01404 | gene | open | 296337-296882 | |||
| 2887 | JVFT01000007.1 | GCA001065115_01405 | gene | open | 296966-297901 | pfkB | ||
| 2888 | JVFT01000007.1 | GCA001065115_01406 | gene | open | 298191-299627 | |||
| 2889 | JVFT01000007.1 | GCA001065115_01407 | gene | open | 299892-300476 | mdaB | ||
| 2890 | JVFT01000007.1 | GCA001065115_01408 | gene | open | 300596-301792 | |||
| 2891 | JVFT01000007.1 | GCA001065115_01409 | gene | open | 301782-303497 | pelF | ||
| 2892 | JVFT01000007.1 | GCA001065115_01410 | gene | open | 303531-304886 | |||
| 2893 | JVFT01000007.1 | GCA001065115_01411 | gene | open | 305369-310258 | |||
| 2894 | JVFT01000007.1 | GCA001065115_01412 | gene | open | 310478-311413 | |||
| 2895 | JVFT01000007.1 | GCA001065115_01413 | gene | open | 311498-312790 | |||
| 2896 | JVFT01000007.1 | GCA001065115_01414 | gene | open | 313187-313837 | |||
| 2897 | JVFT01000007.1 | GCA001065115_01415 | gene | open | 314583-314684 | |||
| 2898 | JVFT01000007.1 | GCA001065115_01416 | gene | open | 314863-315462 | |||
| 2899 | JVFT01000007.1 | GCA001065115_01417 | gene | open | 315657-315881 | |||
| 2900 | JVFT01000007.1 | GCA001065115_01418 | gene | open | 316192-317400 | |||
| 2901 | JVFT01000007.1 | GCA001065115_01419 | gene | open | 317553-318428 | bcsA | ||
| 2902 | JVFT01000007.1 | GCA001065115_01420 | gene | open | 318483-318866 | |||
| 2903 | JVFT01000007.1 | GCA001065115_01421 | gene | open | 318869-319612 | |||
| 2904 | JVFT01000007.1 | GCA001065115_01423 | gene | open | 322193-322735 | |||
| 2905 | JVFT01000007.1 | GCA001065115_01424 | gene | open | 322867-324096 | argE | ||
| 2906 | JVFT01000007.1 | GCA001065115_01425 | gene | open | 324576-325583 | |||
| 2907 | JVFT01000007.1 | GCA001065115_01426 | gene | open | 325735-326376 | |||
| 2908 | JVFT01000007.1 | GCA001065115_01427 | gene | open | 326602-327054 | fluC | ||
| 2909 | JVFT01000007.1 | GCA001065115_01428 | gene | open | 327054-327509 | |||
| 2910 | JVFT01000007.1 | GCA001065115_01429 | gene | open | 327583-330396 | |||
| 2911 | JVFT01000007.1 | GCA001065115_01430 | gene | open | 330575-331276 | |||
| 2912 | JVFT01000007.1 | GCA001065115_01431 | gene | open | 331555-333213 | |||
| 2913 | JVFT01000007.1 | GCA001065115_01432 | gene | open | 333313-334056 | ompR | ||
| 2914 | JVFT01000007.1 | GCA001065115_01433 | gene | open | 334316-335185 | |||
| 2915 | JVFT01000007.1 | GCA001065115_01434 | gene | open | 335964-336944 | |||
| 2916 | JVFT01000007.1 | GCA001065115_01435 | gene | open | 336941-337807 | |||
| 2917 | JVFT01000007.1 | GCA001065115_01436 | gene | open | 337819-338673 | |||
| 2918 | JVFT01000007.1 | GCA001065115_01437 | gene | open | 338846-339619 | |||
| 2919 | JVFT01000007.1 | GCA001065115_01438 | gene | open | 339755-340279 | |||
| 2920 | JVFT01000007.1 | GCA001065115_01439 | gene | open | 340462-340809 | |||
| 2921 | JVFT01000007.1 | GCA001065115_01440 | gene | open | 340821-341333 | |||
| 2922 | JVFT01000007.1 | GCA001065115_01441 | gene | open | 341518-343260 | |||
| 2923 | JVFT01000007.1 | GCA001065115_01442 | gene | open | 343510-344460 | |||
| 2924 | JVFT01000007.1 | GCA001065115_01443 | gene | open | 344752-345354 | |||
| 2925 | JVFT01000007.1 | GCA001065115_01444 | gene | open | 345629-347026 | |||
| 2926 | JVFT01000007.1 | GCA001065115_01445 | gene | open | 347462-347626 | |||
| 2927 | JVFT01000007.1 | GCA001065115_01446 | gene | open | 348119-348439 | |||
| 2928 | JVFT01000007.1 | GCA001065115_01447 | gene | open | 348441-349259 | |||
| 2929 | JVFT01000007.1 | GCA001065115_01448 | gene | open | 349603-350424 | |||
| 2930 | JVFT01000007.1 | GCA001065115_01449 | gene | open | 350482-351306 | |||
| 2931 | JVFT01000007.1 | GCA001065115_01450 | gene | open | 351479-352036 | ppiB | ||
| 2932 | JVFT01000007.1 | GCA001065115_01451 | gene | open | 352180-352515 | |||
| 2933 | JVFT01000007.1 | GCA001065115_01454 | gene | open | 353124-354323 | |||
| 2934 | JVFT01000007.1 | GCA001065115_01455 | gene | open | 354530-354982 | |||
| 2935 | JVFT01000007.1 | GCA001065115_01456 | gene | open | 355033-355326 | |||
| 2936 | JVFT01000007.1 | GCA001065115_01457 | gene | open | 355341-356567 | |||
| 2937 | JVFT01000007.1 | GCA001065115_01460 | gene | open | 357371-357472 | |||
| 2938 | JVFT01000007.1 | GCA001065115_01462 | gene | open | 357767-358363 | |||
| 2939 | JVFT01000007.1 | GCA001065115_01463 | gene | open | 358363-360993 | gyrA | ||
| 2940 | JVFT01000007.1 | GCA001065115_01464 | gene | open | 361073-363103 | gyrB | ||
| 2941 | JVFT01000007.1 | GCA001065115_01465 | gene | open | 363562-364257 | |||
| 2942 | JVFT01000007.1 | GCA001065115_01466 | gene | open | 364250-365491 | recF | ||
| 2943 | JVFT01000007.1 | GCA001065115_01467 | gene | open | 365682-366806 | dnaN | ||
| 2944 | JVFT01000007.1 | GCA001065115_01468 | gene | open | 367607-369307 | dnaA | ||
| 2945 | JVFT01000007.1 | GCA001065115_01469 | gene | open | 369877-370014 | rpmH | ||
| 2946 | JVFT01000007.1 | GCA001065115_01470 | gene | open | 370276-370503 | |||
| 2947 | JVFT01000007.1 | GCA001065115_01471 | gene | open | 370500-370973 | yidD | ||
| 2948 | JVFT01000007.1 | GCA001065115_01472 | gene | open | 371025-372014 | yidC | ||
| 2949 | JVFT01000007.1 | GCA001065115_01473 | gene | open | 372126-372692 | |||
| 2950 | JVFT01000007.1 | GCA001065115_01474 | gene | open | 372694-373335 | rsmG | ||
| 2951 | JVFT01000007.1 | GCA001065115_01475 | gene | open | 373789-374631 | |||
| 2952 | JVFT01000007.1 | GCA001065115_01476 | gene | open | 374868-376166 | |||
| 2953 | JVFT01000007.1 | GCA001065115_01477 | gene | open | 376279-376605 | trxA | ||
| 2954 | JVFT01000007.1 | GCA001065115_01478 | gene | open | 376659-377693 | trxB | ||
| 2955 | JVFT01000007.1 | GCA001065115_01479 | gene | open | 377941-379131 | |||
| 2956 | JVFT01000007.1 | GCA001065115_01480 | gene | open | 379326-380990 | murJ | ||
| 2957 | JVFT01000007.1 | GCA001065115_01481 | gene | open | 381057-381560 | |||
| 2958 | JVFT01000007.1 | GCA001065115_01482 | gene | open | 381687-383111 | |||
| 2959 | JVFT01000007.1 | GCA001065115_01483 | gene | open | 383302-383607 | rpsF | ||
| 2960 | JVFT01000007.1 | GCA001065115_01484 | gene | open | 383703-384335 | |||
| 2961 | JVFT01000007.1 | GCA001065115_01485 | gene | open | 384419-384655 | rpsR | ||
| 2962 | JVFT01000007.1 | GCA001065115_01486 | gene | open | 384676-385128 | rplI | ||
| 2963 | JVFT01000007.1 | GCA001065115_01487 | gene | open | 385370-385675 | |||
| 2964 | JVFT01000007.1 | GCA001065115_01488 | gene | open | 386320-387126 | |||
| 2965 | JVFT01000007.1 | GCA001065115_01489 | gene | open | 387286-388485 | |||
| 2966 | JVFT01000007.1 | GCA001065115_01490 | gene | open | 388591-389946 | dnaB | ||
| 2967 | JVFT01000007.1 | GCA001065115_01187 | gene | open | 40927-41000 | trnP | ||
| 2968 | JVFT01000007.1 | GCA001065115_01224 | gene | open | 93605-93677 | trnR | ||
| 2969 | JVFT01000007.1 | GCA001065115_01276 | gene | open | 154649-154723 | trnT | ||
| 2970 | JVFT01000007.1 | GCA001065115_01281 | gene | open | 158345-158432 | trnS | ||
| 2971 | JVFT01000007.1 | GCA001065115_01290 | gene | open | 163276-163367 | trnS | ||
| 2972 | JVFT01000007.1 | GCA001065115_01296 | gene | open | 167789-167875 | trnS | ||
| 2973 | JVFT01000007.1 | GCA001065115_01310 | gene | open | 182640-182712 | trnK | ||
| 2974 | JVFT01000007.1 | GCA001065115_01453 | gene | open | 352960-353032 | trnA | ||
| 2975 | JVFT01000007.1 | GCA001065115_01459 | gene | open | 357278-357350 | trnA | ||
| 2976 | JVFT01000007.1 | GCA001065115_01461 | gene | open | 357495-357568 | trnI | ||
| 2977 | JVFT01000007.1 | GCA001065115_01187 | tRNA | open | 40927-41000 | trnP | tRNA-Pro(cgg) | |
| 2978 | JVFT01000007.1 | GCA001065115_01224 | tRNA | open | 93605-93677 | trnR | tRNA-Arg(cct) | |
| 2979 | JVFT01000007.1 | GCA001065115_01276 | tRNA | open | 154649-154723 | trnT | tRNA-Thr(cgt) | |
| 2980 | JVFT01000007.1 | GCA001065115_01281 | tRNA | open | 158345-158432 | trnS | tRNA-Ser(tga) | |
| 2981 | JVFT01000007.1 | GCA001065115_01290 | tRNA | open | 163276-163367 | trnS | tRNA-Ser(gct) | |
| 2982 | JVFT01000007.1 | GCA001065115_01296 | tRNA | open | 167789-167875 | trnS | tRNA-Ser(cga) | |
| 2983 | JVFT01000007.1 | GCA001065115_01310 | tRNA | open | 182640-182712 | trnK | tRNA-Lys(ttt) | |
| 2984 | JVFT01000007.1 | GCA001065115_01453 | tRNA | open | 352960-353032 | trnA | tRNA-Ala(tgc) | |
| 2985 | JVFT01000007.1 | GCA001065115_01459 | tRNA | open | 357278-357350 | trnA | tRNA-Ala(tgc) | |
| 2986 | JVFT01000007.1 | GCA001065115_01461 | tRNA | open | 357495-357568 | trnI | tRNA-Ile(gat) | |
| 2987 | JVFT01000008.1 | repeat_region | open | 46456-47376 | CRISPR array with 13 repeats of length 34%2C consensus sequence CTCAATGAAAGTCCCCACCCGAAGGCGGGGAAAT and spacer length 39 | |||
| 2988 | JVFT01000008.1 | repeat_region | open | 50271-50519 | CRISPR array with 4 repeats of length 20%2C consensus sequence GCCTCAATGAAAGCCCTTCC and spacer length 53 | |||
| 2989 | JVFT01000008.1 | repeat_region | open | 50724-53672 | CRISPR array with 41 repeats of length 36%2C consensus sequence CCCTCAATGAAAGTCCCTCCGAAAAGGAAGGGAAAT and spacer length 36 | |||
| 2990 | JVFT01000008.1 | GCA001065115_01491 | CDS | open | 197-1963 | _na 588_aa | superoxide dismutase | |
| 2991 | JVFT01000008.1 | GCA001065115_01492 | CDS | open | 1990-4254 | _na 754_aa | SLH domain-containing protein | |
| 2992 | JVFT01000008.1 | GCA001065115_01493 | CDS | open | 4674-6506 | _na 610_aa | SLH domain-containing protein | |
| 2993 | JVFT01000008.1 | GCA001065115_01494 | CDS | open | 6979-7860 | _na 293_aa | SLH domain-containing protein | |
| 2994 | JVFT01000008.1 | GCA001065115_01495 | CDS | open | 8242-10185 | _na 647_aa | Gluconolactonase | |
| 2995 | JVFT01000008.1 | GCA001065115_01496 | CDS | open | 10517-12052 | _na 511_aa | putative nucleic acid-binding protein | |
| 2996 | JVFT01000008.1 | GCA001065115_01497 | CDS | open | 12420-13988 | _na 522_aa | Nuclear protein export factor | |
| 2997 | JVFT01000008.1 | GCA001065115_01498 | CDS | open | 14263-15834 | _na 523_aa | Parvulin-like peptidyl-prolyl isomerase | |
| 2998 | JVFT01000008.1 | GCA001065115_01499 | CDS | open | 16175-17803 | _na 542_aa | SLH domain-containing protein | |
| 2999 | JVFT01000008.1 | GCA001065115_01500 | CDS | open | 17923-18855 | _na 310_aa | Nif3-like dinuclear metal center hexameric protein | |
| 3000 | JVFT01000008.1 | GCA001065115_01501 | CDS | open | 18954-19475 | _na 173_aa | msrA | Peptide methionine sulfoxide reductase MsrA |

