HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_001067255.1)

Select a Genome:
BAKTA Annotations for GCA_001067255.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
119 2158847 2042 3 1 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4191 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4191 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JUTK01000036.1 GCA001067255_00496 CDS open 48350-49180 _na     276_aa serB phosphoserine phosphatase SerB
1002 JUTK01000036.1 GCA001067255_00497 CDS open 49742-51949 _na     735_aa Fe(3+)-pyochelin receptor
1003 JUTK01000036.1 GCA001067255_00498 CDS open 52190-52729 _na     179_aa Transposase
1004 JUTK01000036.1 GCA001067255_00446 gene open 678-1031
1005 JUTK01000036.1 GCA001067255_00447 gene open 1044-1379
1006 JUTK01000036.1 GCA001067255_00448 gene open 2556-2684
1007 JUTK01000036.1 GCA001067255_00449 gene open 2885-4465 purH
1008 JUTK01000036.1 GCA001067255_00450 gene open 4629-5855
1009 JUTK01000036.1 GCA001067255_00451 gene open 5907-6725
1010 JUTK01000036.1 GCA001067255_00452 gene open 6791-7666 eamA
1011 JUTK01000036.1 GCA001067255_00453 gene open 7741-8475
1012 JUTK01000036.1 GCA001067255_00454 gene open 8519-8764
1013 JUTK01000036.1 GCA001067255_00455 gene open 8812-9816 dusB
1014 JUTK01000036.1 GCA001067255_00456 gene open 9948-10598
1015 JUTK01000036.1 GCA001067255_00457 gene open 10661-11905
1016 JUTK01000036.1 GCA001067255_00458 gene open 12115-13533 glnA
1017 JUTK01000036.1 GCA001067255_00459 gene open 13731-14540 aroE
1018 JUTK01000036.1 GCA001067255_00460 gene open 14543-15244 mtgA
1019 JUTK01000036.1 GCA001067255_00461 gene open 15284-16504 pncB
1020 JUTK01000036.1 GCA001067255_00462 gene open 16597-17892 mepM
1021 JUTK01000036.1 GCA001067255_00463 gene open 18256-19236 rpfE
1022 JUTK01000036.1 GCA001067255_00464 gene open 19243-20325 rfaQ
1023 JUTK01000036.1 GCA001067255_00465 gene open 20522-20995 queF
1024 JUTK01000036.1 GCA001067255_00466 gene open 21096-21773
1025 JUTK01000036.1 GCA001067255_00467 gene open 21841-23025 ubiM
1026 JUTK01000036.1 GCA001067255_00468 gene open 23300-23572 rpmA
1027 JUTK01000036.1 GCA001067255_00469 gene open 23600-23908 rplU
1028 JUTK01000036.1 GCA001067255_00470 gene open 24172-25146 ispA
1029 JUTK01000036.1 GCA001067255_00471 gene open 25151-25597
1030 JUTK01000036.1 GCA001067255_00473 gene open 25794-26951 nnrS
1031 JUTK01000036.1 GCA001067255_00474 gene open 27038-27418
1032 JUTK01000036.1 GCA001067255_00475 gene open 27565-28023
1033 JUTK01000036.1 GCA001067255_00477 gene open 28821-29672 folP
1034 JUTK01000036.1 GCA001067255_00478 gene open 29756-31417 fixX
1035 JUTK01000036.1 GCA001067255_00479 gene open 31550-31984
1036 JUTK01000036.1 GCA001067255_00480 gene open 31988-32647 exbB
1037 JUTK01000036.1 GCA001067255_00481 gene open 32750-33673 tonB
1038 JUTK01000036.1 GCA001067255_00482 gene open 34026-34922 xerC
1039 JUTK01000036.1 GCA001067255_00483 gene open 34924-35337
1040 JUTK01000036.1 GCA001067255_00484 gene open 35503-36567 fba
1041 JUTK01000036.1 GCA001067255_00485 gene open 36696-37418
1042 JUTK01000036.1 GCA001067255_00486 gene open 37382-37624
1043 JUTK01000036.1 GCA001067255_00487 gene open 37684-39360 fhs
1044 JUTK01000036.1 GCA001067255_00488 gene open 39540-39971 ribN
1045 JUTK01000036.1 GCA001067255_00489 gene open 40034-41176 potD
1046 JUTK01000036.1 GCA001067255_00490 gene open 41485-41748 rpsT
1047 JUTK01000036.1 GCA001067255_00491 gene open 41917-43059
1048 JUTK01000036.1 GCA001067255_00492 gene open 43172-43912
1049 JUTK01000036.1 GCA001067255_00493 gene open 43977-45785 aspS
1050 JUTK01000036.1 GCA001067255_00494 gene open 46031-47416
1051 JUTK01000036.1 GCA001067255_00495 gene open 47571-48278 lpxH
1052 JUTK01000036.1 GCA001067255_00496 gene open 48350-49180 serB
1053 JUTK01000036.1 GCA001067255_00497 gene open 49742-51949
1054 JUTK01000036.1 GCA001067255_00498 gene open 52190-52729
1055 JUTK01000036.1 GCA001067255_00472 gene open 25616-25690 trnR
1056 JUTK01000036.1 GCA001067255_00476 gene open 28652-28727 trnI
1057 JUTK01000036.1 GCA001067255_00472 tRNA open 25616-25690 trnR tRNA-Arg(cct)
1058 JUTK01000036.1 GCA001067255_00476 tRNA open 28652-28727 trnI tRNA-Ile2(cat)
1059 JUTK01000037.1 repeat_region open 1131-4223 CRISPR array with 47 repeats of length 32%2C consensus sequence CCAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 34
1060 JUTK01000037.1 GCA001067255_00499 CDS open 25-573 _na     182_aa cas1 CRISPR-associated endonuclease Cas1
1061 JUTK01000037.1 GCA001067255_00500 CDS open 648-941 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
1062 JUTK01000037.1 GCA001067255_00499 gene open 25-573 cas1
1063 JUTK01000037.1 GCA001067255_00500 gene open 648-941 cas2
1064 JUTK01000039.1 GCA001067255_00501 CDS open 160-2175 _na     671_aa preP Prolyl endopeptidase
1065 JUTK01000039.1 GCA001067255_00502 CDS open 2278-4335 _na     685_aa ppk1 polyphosphate kinase 1
1066 JUTK01000039.1 GCA001067255_00503 CDS open 4544-5332 _na     262_aa fabI enoyl-ACP reductase FabI
1067 JUTK01000039.1 GCA001067255_00504 CDS open 5780-6223 _na     147_aa mscL large conductance mechanosensitive channel protein MscL
1068 JUTK01000039.1 GCA001067255_00505 CDS open 6479-9373 _na     964_aa Rne/Rng family ribonuclease
1069 JUTK01000039.1 GCA001067255_00506 CDS open 9888-10874 _na     328_aa Pseudouridine synthase
1070 JUTK01000039.1 GCA001067255_00507 CDS open 10885-11535 _na     216_aa Phosphoglycolate phosphatase
1071 JUTK01000039.1 GCA001067255_00508 CDS open 11631-12449 _na     272_aa DNA ligase
1072 JUTK01000039.1 GCA001067255_00501 gene open 160-2175 preP
1073 JUTK01000039.1 GCA001067255_00502 gene open 2278-4335 ppk1
1074 JUTK01000039.1 GCA001067255_00503 gene open 4544-5332 fabI
1075 JUTK01000039.1 GCA001067255_00504 gene open 5780-6223 mscL
1076 JUTK01000039.1 GCA001067255_00505 gene open 6479-9373
1077 JUTK01000039.1 GCA001067255_00506 gene open 9888-10874
1078 JUTK01000039.1 GCA001067255_00507 gene open 10885-11535
1079 JUTK01000039.1 GCA001067255_00508 gene open 11631-12449
1080 JUTK01000040.1 GCA001067255_00509 CDS open 353-1423 _na     356_aa leuB 3-isopropylmalate dehydrogenase
1081 JUTK01000040.1 GCA001067255_00510 CDS open 1490-2353 _na     287_aa DUF1444 domain-containing protein
1082 JUTK01000040.1 GCA001067255_00511 CDS open 2391-2852 _na     153_aa YhcH/YjgK/YiaL family protein
1083 JUTK01000040.1 GCA001067255_00512 CDS open 2917-3558 _na     213_aa leuD 3-isopropylmalate dehydratase small subunit
1084 JUTK01000040.1 GCA001067255_00513 CDS open 3604-3969 _na     121_aa Glyoxalase family protein
1085 JUTK01000040.1 GCA001067255_00514 CDS open 4073-4327 _na     84_aa Lipoprotein
1086 JUTK01000040.1 GCA001067255_00515 CDS open 4452-5861 _na     469_aa leuC 3-isopropylmalate dehydratase large subunit
1087 JUTK01000040.1 GCA001067255_00516 CDS open 6127-7485 _na     452_aa gshA glutamate--cysteine ligase
1088 JUTK01000040.1 GCA001067255_00517 CDS open 7588-8658 _na     356_aa corA magnesium/cobalt transporter CorA
1089 JUTK01000040.1 GCA001067255_00518 CDS open 8776-9258 _na     160_aa Acyl-CoA thioester hydrolase
1090 JUTK01000040.1 GCA001067255_00519 CDS open 9386-12157 _na     923_aa DNA gyrase subunit A
1091 JUTK01000040.1 GCA001067255_00520 CDS open 12222-14063 _na     613_aa uvrC excinuclease ABC subunit UvrC
1092 JUTK01000040.1 GCA001067255_00521 CDS open 14091-14840 _na     249_aa 3-dehydroquinate dehydratase
1093 JUTK01000040.1 GCA001067255_00522 CDS open 14975-15544 _na     189_aa acetate uptake transporter
1094 JUTK01000040.1 GCA001067255_00523 CDS open 15622-16026 _na     134_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
1095 JUTK01000040.1 GCA001067255_00524 CDS open 16027-17181 _na     384_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
1096 JUTK01000040.1 GCA001067255_00525 CDS open 17374-17631 _na     85_aa hypothetical protein
1097 JUTK01000040.1 GCA001067255_00526 CDS open 17684-19963 _na     759_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
1098 JUTK01000040.1 GCA001067255_00527 CDS open 20356-20688 _na     110_aa Stress response protein
1099 JUTK01000040.1 GCA001067255_00528 CDS open 20740-21474 _na     244_aa queH Epoxyqueuosine reductase QueH
1100 JUTK01000040.1 GCA001067255_00529 CDS open 21587-23023 _na     478_aa patatin-like phospholipase family protein
1101 JUTK01000040.1 GCA001067255_00530 CDS open 23164-23907 _na     247_aa recO DNA repair protein RecO
1102 JUTK01000040.1 GCA001067255_00531 CDS open 23976-24704 _na     242_aa pdxJ pyridoxine 5'-phosphate synthase
1103 JUTK01000040.1 GCA001067255_00532 CDS open 24793-25170 _na     125_aa acpS Holo-[acyl-carrier-protein] synthase
1104 JUTK01000040.1 GCA001067255_00533 CDS open 25321-26127 _na     268_aa 8-oxo-dGTP diphosphatase
1105 JUTK01000040.1 GCA001067255_00534 CDS open 26129-26551 _na     140_aa Secreted protein
1106 JUTK01000040.1 GCA001067255_00535 CDS open 26898-26993 _na     31_aa hypothetical protein
1107 JUTK01000040.1 GCA001067255_00536 CDS open 27314-28189 _na     291_aa prpB methylisocitrate lyase
1108 JUTK01000040.1 GCA001067255_00537 CDS open 28274-29428 _na     384_aa prpC 2-methylcitrate synthase
1109 JUTK01000040.1 GCA001067255_00538 CDS open 29828-32434 _na     868_aa acnD Fe/S-dependent 2-methylisocitrate dehydratase AcnD
1110 JUTK01000040.1 GCA001067255_00539 CDS open 32552-33721 _na     389_aa prpF 2-methylaconitate cis-trans isomerase PrpF
1111 JUTK01000040.1 GCA001067255_00540 CDS open 33934-35145 _na     403_aa Acetate kinase
1112 JUTK01000040.1 GCA001067255_00541 CDS open 35220-36254 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
1113 JUTK01000040.1 GCA001067255_00542 CDS open 36460-37530 _na     356_aa ATP synthase F0%2C A subunit
1114 JUTK01000040.1 GCA001067255_00543 CDS open 37597-38313 _na     238_aa S-methyl-5'-thioinosine phosphorylase
1115 JUTK01000040.1 GCA001067255_00544 CDS open 38360-38866 _na     168_aa hypothetical protein
1116 JUTK01000040.1 GCA001067255_00545 CDS open 38999-39433 _na     144_aa Lipoprotein
1117 JUTK01000040.1 GCA001067255_00546 CDS open 39426-40733 _na     435_aa homoserine dehydrogenase
1118 JUTK01000040.1 GCA001067255_00547 CDS open 40940-41314 _na     124_aa rodA Rod shape-determining protein RodA
1119 JUTK01000040.1 GCA001067255_00509 gene open 353-1423 leuB
1120 JUTK01000040.1 GCA001067255_00510 gene open 1490-2353
1121 JUTK01000040.1 GCA001067255_00511 gene open 2391-2852
1122 JUTK01000040.1 GCA001067255_00512 gene open 2917-3558 leuD
1123 JUTK01000040.1 GCA001067255_00513 gene open 3604-3969
1124 JUTK01000040.1 GCA001067255_00514 gene open 4073-4327
1125 JUTK01000040.1 GCA001067255_00515 gene open 4452-5861 leuC
1126 JUTK01000040.1 GCA001067255_00516 gene open 6127-7485 gshA
1127 JUTK01000040.1 GCA001067255_00517 gene open 7588-8658 corA
1128 JUTK01000040.1 GCA001067255_00518 gene open 8776-9258
1129 JUTK01000040.1 GCA001067255_00519 gene open 9386-12157
1130 JUTK01000040.1 GCA001067255_00520 gene open 12222-14063 uvrC
1131 JUTK01000040.1 GCA001067255_00521 gene open 14091-14840
1132 JUTK01000040.1 GCA001067255_00522 gene open 14975-15544
1133 JUTK01000040.1 GCA001067255_00523 gene open 15622-16026 yfaE
1134 JUTK01000040.1 GCA001067255_00524 gene open 16027-17181 nrdB
1135 JUTK01000040.1 GCA001067255_00525 gene open 17374-17631
1136 JUTK01000040.1 GCA001067255_00526 gene open 17684-19963 nrdA
1137 JUTK01000040.1 GCA001067255_00527 gene open 20356-20688
1138 JUTK01000040.1 GCA001067255_00528 gene open 20740-21474 queH
1139 JUTK01000040.1 GCA001067255_00529 gene open 21587-23023
1140 JUTK01000040.1 GCA001067255_00530 gene open 23164-23907 recO
1141 JUTK01000040.1 GCA001067255_00531 gene open 23976-24704 pdxJ
1142 JUTK01000040.1 GCA001067255_00532 gene open 24793-25170 acpS
1143 JUTK01000040.1 GCA001067255_00533 gene open 25321-26127
1144 JUTK01000040.1 GCA001067255_00534 gene open 26129-26551
1145 JUTK01000040.1 GCA001067255_00535 gene open 26898-26993
1146 JUTK01000040.1 GCA001067255_00536 gene open 27314-28189 prpB
1147 JUTK01000040.1 GCA001067255_00537 gene open 28274-29428 prpC
1148 JUTK01000040.1 GCA001067255_00538 gene open 29828-32434 acnD
1149 JUTK01000040.1 GCA001067255_00539 gene open 32552-33721 prpF
1150 JUTK01000040.1 GCA001067255_00540 gene open 33934-35145
1151 JUTK01000040.1 GCA001067255_00541 gene open 35220-36254 purM
1152 JUTK01000040.1 GCA001067255_00542 gene open 36460-37530
1153 JUTK01000040.1 GCA001067255_00543 gene open 37597-38313
1154 JUTK01000040.1 GCA001067255_00544 gene open 38360-38866
1155 JUTK01000040.1 GCA001067255_00545 gene open 38999-39433
1156 JUTK01000040.1 GCA001067255_00546 gene open 39426-40733
1157 JUTK01000040.1 GCA001067255_00547 gene open 40940-41314 rodA
1158 JUTK01000041.1 GCA001067255_00548 CDS open 582-1772 _na     396_aa hypothetical protein
1159 JUTK01000041.1 GCA001067255_00549 CDS open 1880-2572 _na     230_aa VIT family protein
1160 JUTK01000041.1 GCA001067255_00550 CDS open 2871-3017 _na     48_aa CCGSCS motif protein
1161 JUTK01000041.1 GCA001067255_00551 CDS open 3209-3409 _na     66_aa Cytochrome C oxidase Cbb3
1162 JUTK01000041.1 GCA001067255_00552 CDS open 3499-4896 _na     465_aa aspA aspartate ammonia-lyase
1163 JUTK01000041.1 GCA001067255_00553 CDS open 5141-5803 _na     220_aa Nitroreductase family protein
1164 JUTK01000041.1 GCA001067255_00554 CDS open 5984-8185 _na     733_aa Ferrienterobactin receptor
1165 JUTK01000041.1 GCA001067255_00555 CDS open 8417-8635 _na     72_aa DUF465 domain-containing protein
1166 JUTK01000041.1 GCA001067255_00556 CDS open 8905-9231 _na     108_aa DUF4376 domain-containing protein
1167 JUTK01000041.1 GCA001067255_00557 CDS open 9365-10615 _na     416_aa glyA Serine hydroxymethyltransferase
1168 JUTK01000041.1 GCA001067255_00558 CDS open 10652-10873 _na     73_aa hypothetical protein
1169 JUTK01000041.1 GCA001067255_00559 CDS open 10980-12020 _na     346_aa yddG aromatic amino acid DMT transporter YddG
1170 JUTK01000041.1 GCA001067255_00560 CDS open 12077-12502 _na     141_aa sarZ HTH-type transcriptional regulator SarZ
1171 JUTK01000041.1 GCA001067255_00561 CDS open 12514-12702 _na     62_aa ABC transporter six-transmembrane domain-containing protein
1172 JUTK01000041.1 GCA001067255_00562 CDS open 12781-13383 _na     200_aa ABC transporter six-transmembrane domain-containing protein
1173 JUTK01000041.1 GCA001067255_00563 CDS open 13411-13734 _na     107_aa Guanidinium exporter
1174 JUTK01000041.1 GCA001067255_00564 CDS open 14260-14766 _na     168_aa hypothetical protein
1175 JUTK01000041.1 GCA001067255_00565 CDS open 14857-15444 _na     195_aa Membrane lipoprotein
1176 JUTK01000041.1 GCA001067255_00548 gene open 582-1772
1177 JUTK01000041.1 GCA001067255_00549 gene open 1880-2572
1178 JUTK01000041.1 GCA001067255_00550 gene open 2871-3017
1179 JUTK01000041.1 GCA001067255_00551 gene open 3209-3409
1180 JUTK01000041.1 GCA001067255_00552 gene open 3499-4896 aspA
1181 JUTK01000041.1 GCA001067255_00553 gene open 5141-5803
1182 JUTK01000041.1 GCA001067255_00554 gene open 5984-8185
1183 JUTK01000041.1 GCA001067255_00555 gene open 8417-8635
1184 JUTK01000041.1 GCA001067255_00556 gene open 8905-9231
1185 JUTK01000041.1 GCA001067255_00557 gene open 9365-10615 glyA
1186 JUTK01000041.1 GCA001067255_00558 gene open 10652-10873
1187 JUTK01000041.1 GCA001067255_00559 gene open 10980-12020 yddG
1188 JUTK01000041.1 GCA001067255_00560 gene open 12077-12502 sarZ
1189 JUTK01000041.1 GCA001067255_00561 gene open 12514-12702
1190 JUTK01000041.1 GCA001067255_00562 gene open 12781-13383
1191 JUTK01000041.1 GCA001067255_00563 gene open 13411-13734
1192 JUTK01000041.1 GCA001067255_00564 gene open 14260-14766
1193 JUTK01000041.1 GCA001067255_00565 gene open 14857-15444
1194 JUTK01000042.1 GCA001067255_00595 gene open 25926-26106 6S
1195 JUTK01000042.1 GCA001067255_00595 ncRNA open 25926-26106 6S / SsrS RNA
1196 JUTK01000042.1 GCA001067255_00572 CDS open 130-1263 _na     377_aa araJ Transporter%2C major facilitator family protein
1197 JUTK01000042.1 GCA001067255_00573 CDS open 1608-3047 _na     479_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
1198 JUTK01000042.1 GCA001067255_00574 CDS open 3156-3896 _na     246_aa Slam-dependent surface lipoprotein
1199 JUTK01000042.1 GCA001067255_00575 CDS open 4180-5022 _na     280_aa yafJ Class II glutamine amidotransferase
1200 JUTK01000042.1 GCA001067255_00576 CDS open 5222-5674 _na     150_aa nrdR transcriptional regulator NrdR
1201 JUTK01000042.1 GCA001067255_00577 CDS open 5659-6792 _na     377_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1202 JUTK01000042.1 GCA001067255_00578 CDS open 7366-8673 _na     435_aa wecC UDP-N-acetyl-D-mannosamine dehydrogenase
1203 JUTK01000042.1 GCA001067255_00579 CDS open 8842-10269 _na     475_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
1204 JUTK01000042.1 GCA001067255_00580 CDS open 10306-11622 _na     438_aa O-antigen ligase-related domain-containing protein
1205 JUTK01000042.1 GCA001067255_00581 CDS open 11619-12689 _na     356_aa Glycosyl transferase
1206 JUTK01000042.1 GCA001067255_00582 CDS open 12703-13875 _na     390_aa rfaB Glycosyltransferase family 4 protein
1207 JUTK01000042.1 GCA001067255_00583 CDS open 13868-14485 _na     205_aa Bacterial sugar transferase
1208 JUTK01000042.1 GCA001067255_00584 CDS open 14472-15446 _na     324_aa ATP-grasp domain protein
1209 JUTK01000042.1 GCA001067255_00585 CDS open 15439-16131 _na     230_aa yjjG Pyrimidine 5'-nucleotidase YjjG
1210 JUTK01000042.1 GCA001067255_00586 CDS open 16145-16924 _na     259_aa Formyl transferase
1211 JUTK01000042.1 GCA001067255_00587 CDS open 16917-18092 _na     391_aa wecE Putative 8-amino-7-oxononanoate synthase
1212 JUTK01000042.1 GCA001067255_00588 CDS open 18201-20102 _na     633_aa UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase
1213 JUTK01000042.1 GCA001067255_00589 CDS open 20146-21273 _na     375_aa Polysaccharide biosynthesis/export protein
1214 JUTK01000042.1 GCA001067255_00590 CDS open 21445-21894 _na     149_aa protein-tyrosine-phosphatase
1215 JUTK01000042.1 GCA001067255_00591 CDS open 21921-24080 _na     719_aa Tyrosine-protein kinase wzc
1216 JUTK01000042.1 GCA001067255_00592 CDS open 24216-25205 _na     329_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
1217 JUTK01000042.1 GCA001067255_00593 CDS open 25280-25603 _na     107_aa BZIP transcription factor
1218 JUTK01000042.1 GCA001067255_00594 CDS open 25615-25917 _na     100_aa zapA Cell division protein ZapA
1219 JUTK01000042.1 GCA001067255_00596 CDS open 26285-26716 _na     143_aa rplM 50S ribosomal protein L13
1220 JUTK01000042.1 GCA001067255_00597 CDS open 26729-27121 _na     130_aa rpsI 30S ribosomal protein S9
1221 JUTK01000042.1 GCA001067255_00598 CDS open 27206-27715 _na     169_aa Soluble secreted antigen MPT53
1222 JUTK01000042.1 GCA001067255_00599 CDS open 28056-28493 _na     145_aa hpaR homoprotocatechuate degradation operon regulator HpaR
1223 JUTK01000042.1 GCA001067255_00600 CDS open 28549-29004 _na     151_aa hpaC 4-hydroxyphenylacetate 3-monooxygenase%2C reductase component
1224 JUTK01000042.1 GCA001067255_00601 CDS open 29091-29786 _na     231_aa murU N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU
1225 JUTK01000042.1 GCA001067255_00602 CDS open 29880-30782 _na     300_aa rarD EamA family transporter RarD
1226 JUTK01000042.1 GCA001067255_00603 CDS open 30983-32053 _na     356_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1227 JUTK01000042.1 GCA001067255_00604 CDS open 32153-33340 _na     395_aa ccsB c-type cytochrome biogenesis protein CcsB
1228 JUTK01000042.1 GCA001067255_00605 CDS open 33333-35285 _na     650_aa ccsB Cytochrome c biogenesis protein CcsB
1229 JUTK01000042.1 GCA001067255_00606 CDS open 35553-36176 _na     207_aa Cytochrome C
1230 JUTK01000042.1 GCA001067255_00607 CDS open 36392-37018 _na     208_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1231 JUTK01000042.1 GCA001067255_00608 CDS open 37375-37836 _na     153_aa Peptidase propeptide and YPEB domain protein
1232 JUTK01000042.1 GCA001067255_00609 CDS open 37920-38138 _na     72_aa Oxidoreductase-like domain-containing protein
1233 JUTK01000042.1 GCA001067255_00610 CDS open 38116-38349 _na     77_aa ybcJ RNA-binding protein
1234 JUTK01000042.1 GCA001067255_00611 CDS open 38515-41949 _na     1144_aa dnaE DNA polymerase III subunit alpha
1235 JUTK01000042.1 GCA001067255_00612 CDS open 42295-42630 _na     111_aa Threonine dehydratase
1236 JUTK01000042.1 GCA001067255_00613 CDS open 42921-43415 _na     164_aa Restriction endonuclease
1237 JUTK01000042.1 GCA001067255_00614 CDS open 43436-44287 _na     283_aa mscS Mechanosensitive ion channel MscS domain-containing protein
1238 JUTK01000042.1 GCA001067255_00615 CDS open 44359-45225 _na     288_aa Glycosyltransferase 2-like domain-containing protein
1239 JUTK01000042.1 GCA001067255_00616 CDS open 45347-47383 _na     678_aa oligopeptidase A
1240 JUTK01000042.1 GCA001067255_00617 CDS open 47742-48005 _na     87_aa hypothetical protein
1241 JUTK01000042.1 GCA001067255_00618 CDS open 48242-48661 _na     139_aa Protoporphyrinogen IX oxidase
1242 JUTK01000042.1 GCA001067255_00619 CDS open 48700-49170 _na     156_aa Inorganic triphosphatase
1243 JUTK01000042.1 GCA001067255_00572 gene open 130-1263 araJ
1244 JUTK01000042.1 GCA001067255_00573 gene open 1608-3047
1245 JUTK01000042.1 GCA001067255_00574 gene open 3156-3896
1246 JUTK01000042.1 GCA001067255_00575 gene open 4180-5022 yafJ
1247 JUTK01000042.1 GCA001067255_00576 gene open 5222-5674 nrdR
1248 JUTK01000042.1 GCA001067255_00577 gene open 5659-6792 ribD
1249 JUTK01000042.1 GCA001067255_00578 gene open 7366-8673 wecC
1250 JUTK01000042.1 GCA001067255_00579 gene open 8842-10269
1251 JUTK01000042.1 GCA001067255_00580 gene open 10306-11622
1252 JUTK01000042.1 GCA001067255_00581 gene open 11619-12689
1253 JUTK01000042.1 GCA001067255_00582 gene open 12703-13875 rfaB
1254 JUTK01000042.1 GCA001067255_00583 gene open 13868-14485
1255 JUTK01000042.1 GCA001067255_00584 gene open 14472-15446
1256 JUTK01000042.1 GCA001067255_00585 gene open 15439-16131 yjjG
1257 JUTK01000042.1 GCA001067255_00586 gene open 16145-16924
1258 JUTK01000042.1 GCA001067255_00587 gene open 16917-18092 wecE
1259 JUTK01000042.1 GCA001067255_00588 gene open 18201-20102
1260 JUTK01000042.1 GCA001067255_00589 gene open 20146-21273
1261 JUTK01000042.1 GCA001067255_00590 gene open 21445-21894
1262 JUTK01000042.1 GCA001067255_00591 gene open 21921-24080
1263 JUTK01000042.1 GCA001067255_00592 gene open 24216-25205
1264 JUTK01000042.1 GCA001067255_00593 gene open 25280-25603
1265 JUTK01000042.1 GCA001067255_00594 gene open 25615-25917 zapA
1266 JUTK01000042.1 GCA001067255_00596 gene open 26285-26716 rplM
1267 JUTK01000042.1 GCA001067255_00597 gene open 26729-27121 rpsI
1268 JUTK01000042.1 GCA001067255_00598 gene open 27206-27715
1269 JUTK01000042.1 GCA001067255_00599 gene open 28056-28493 hpaR
1270 JUTK01000042.1 GCA001067255_00600 gene open 28549-29004 hpaC
1271 JUTK01000042.1 GCA001067255_00601 gene open 29091-29786 murU
1272 JUTK01000042.1 GCA001067255_00602 gene open 29880-30782 rarD
1273 JUTK01000042.1 GCA001067255_00603 gene open 30983-32053 tsaD
1274 JUTK01000042.1 GCA001067255_00604 gene open 32153-33340 ccsB
1275 JUTK01000042.1 GCA001067255_00605 gene open 33333-35285 ccsB
1276 JUTK01000042.1 GCA001067255_00606 gene open 35553-36176
1277 JUTK01000042.1 GCA001067255_00607 gene open 36392-37018 yihA
1278 JUTK01000042.1 GCA001067255_00608 gene open 37375-37836
1279 JUTK01000042.1 GCA001067255_00609 gene open 37920-38138
1280 JUTK01000042.1 GCA001067255_00610 gene open 38116-38349 ybcJ
1281 JUTK01000042.1 GCA001067255_00611 gene open 38515-41949 dnaE
1282 JUTK01000042.1 GCA001067255_00612 gene open 42295-42630
1283 JUTK01000042.1 GCA001067255_00613 gene open 42921-43415
1284 JUTK01000042.1 GCA001067255_00614 gene open 43436-44287 mscS
1285 JUTK01000042.1 GCA001067255_00615 gene open 44359-45225
1286 JUTK01000042.1 GCA001067255_00616 gene open 45347-47383
1287 JUTK01000042.1 GCA001067255_00617 gene open 47742-48005
1288 JUTK01000042.1 GCA001067255_00618 gene open 48242-48661
1289 JUTK01000042.1 GCA001067255_00619 gene open 48700-49170
1290 JUTK01000043.1 GCA001067255_00620 CDS open 157-1548 _na     463_aa DNA polymerase III PolC-type
1291 JUTK01000043.1 GCA001067255_00621 CDS open 1745-2536 _na     263_aa Bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase
1292 JUTK01000043.1 GCA001067255_00622 CDS open 2603-2809 _na     68_aa DUF2788 domain-containing protein
1293 JUTK01000043.1 GCA001067255_00623 CDS open 2896-4065 _na     389_aa metZ O-succinylhomoserine sulfhydrylase
1294 JUTK01000043.1 GCA001067255_00624 CDS open 4181-4741 _na     186_aa DUF3465 domain-containing protein
1295 JUTK01000043.1 GCA001067255_00625 CDS open 4864-5664 _na     266_aa DUF2894 domain-containing protein
1296 JUTK01000043.1 GCA001067255_00626 CDS open 5827-6078 _na     83_aa NGO1151 family protein
1297 JUTK01000043.1 GCA001067255_00627 CDS open 6155-6958 _na     267_aa ABC transporter arginine-binding protein 2
1298 JUTK01000043.1 GCA001067255_00628 CDS open 7089-7328 _na     79_aa Hemolysin
1299 JUTK01000043.1 GCA001067255_00629 CDS open 7395-8690 _na     431_aa serS serine--tRNA ligase
1300 JUTK01000043.1 GCA001067255_00631 CDS open 9024-9923 _na     299_aa rdgC Recombination-associated protein RdgC
1301 JUTK01000043.1 GCA001067255_00632 CDS open 10001-10783 _na     260_aa ADP-ribosylglycohydrolase
1302 JUTK01000043.1 GCA001067255_00633 CDS open 10809-11237 _na     142_aa MORN repeat protein
1303 JUTK01000043.1 GCA001067255_00634 CDS open 11363-11929 _na     188_aa dcd dCTP deaminase
1304 JUTK01000043.1 GCA001067255_00635 CDS open 11985-12806 _na     273_aa Putative phosphoenolpyruvate synthase regulatory protein
1305 JUTK01000043.1 GCA001067255_00636 CDS open 13079-14218 _na     379_aa hypothetical protein
1306 JUTK01000043.1 GCA001067255_00620 gene open 157-1548
1307 JUTK01000043.1 GCA001067255_00621 gene open 1745-2536
1308 JUTK01000043.1 GCA001067255_00622 gene open 2603-2809
1309 JUTK01000043.1 GCA001067255_00623 gene open 2896-4065 metZ
1310 JUTK01000043.1 GCA001067255_00624 gene open 4181-4741
1311 JUTK01000043.1 GCA001067255_00625 gene open 4864-5664
1312 JUTK01000043.1 GCA001067255_00626 gene open 5827-6078
1313 JUTK01000043.1 GCA001067255_00627 gene open 6155-6958
1314 JUTK01000043.1 GCA001067255_00628 gene open 7089-7328
1315 JUTK01000043.1 GCA001067255_00629 gene open 7395-8690 serS
1316 JUTK01000043.1 GCA001067255_00631 gene open 9024-9923 rdgC
1317 JUTK01000043.1 GCA001067255_00632 gene open 10001-10783
1318 JUTK01000043.1 GCA001067255_00633 gene open 10809-11237
1319 JUTK01000043.1 GCA001067255_00634 gene open 11363-11929 dcd
1320 JUTK01000043.1 GCA001067255_00635 gene open 11985-12806
1321 JUTK01000043.1 GCA001067255_00636 gene open 13079-14218
1322 JUTK01000043.1 GCA001067255_00630 gene open 8816-8891 trnE
1323 JUTK01000043.1 GCA001067255_00630 tRNA open 8816-8891 trnE tRNA-Glu(ttc)
1324 JUTK01000044.1 GCA001067255_00637 CDS open 100-546 _na     148_aa hypothetical protein
1325 JUTK01000044.1 GCA001067255_00638 CDS open 778-1308 _na     176_aa hypothetical protein
1326 JUTK01000044.1 GCA001067255_00637 gene open 100-546
1327 JUTK01000044.1 GCA001067255_00638 gene open 778-1308
1328 JUTK01000045.1 GCA001067255_00639 CDS open 241-405 _na     54_aa hypothetical protein
1329 JUTK01000045.1 GCA001067255_00640 CDS open 442-906 _na     154_aa Integral membrane protein
1330 JUTK01000045.1 GCA001067255_00641 CDS open 1182-2045 _na     287_aa Aminoalkylphosphonate N-acetyltransferase
1331 JUTK01000045.1 GCA001067255_00642 CDS open 2260-2763 _na     167_aa Integral membrane protein
1332 JUTK01000045.1 GCA001067255_00643 CDS open 2977-4449 _na     490_aa pyk pyruvate kinase
1333 JUTK01000045.1 GCA001067255_00644 CDS open 4649-6064 _na     471_aa Transporter
1334 JUTK01000045.1 GCA001067255_00645 CDS open 6379-7644 _na     421_aa lysM LysM domain-containing protein
1335 JUTK01000045.1 GCA001067255_00646 CDS open 7879-8382 _na     167_aa def peptide deformylase
1336 JUTK01000045.1 GCA001067255_00647 CDS open 8518-9444 _na     308_aa fmt methionyl-tRNA formyltransferase
1337 JUTK01000045.1 GCA001067255_00648 CDS open 9478-9996 _na     172_aa O-acetyl-ADP-ribose deacetylase
1338 JUTK01000045.1 GCA001067255_00649 CDS open 9950-11302 _na     450_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
1339 JUTK01000045.1 GCA001067255_00650 CDS open 11268-11861 _na     197_aa DUF4390 domain-containing protein
1340 JUTK01000045.1 GCA001067255_00651 CDS open 11865-13991 _na     708_aa histidine kinase
1341 JUTK01000045.1 GCA001067255_00652 CDS open 13978-15252 _na     424_aa zraR Transcriptional regulatory protein ZraR
1342 JUTK01000045.1 GCA001067255_00653 CDS open 15487-16677 _na     396_aa dprA DNA-processing protein DprA
1343 JUTK01000045.1 GCA001067255_00654 CDS open 16702-17157 _na     151_aa Protein Smg-like protein
1344 JUTK01000045.1 GCA001067255_00655 CDS open 17237-19543 _na     768_aa topA type I DNA topoisomerase
1345 JUTK01000045.1 GCA001067255_00656 CDS open 19692-20264 _na     190_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1346 JUTK01000045.1 GCA001067255_00657 CDS open 20387-20638 _na     83_aa nuoI YfhL family 4Fe-4S dicluster ferredoxin
1347 JUTK01000045.1 GCA001067255_00639 gene open 241-405
1348 JUTK01000045.1 GCA001067255_00640 gene open 442-906
1349 JUTK01000045.1 GCA001067255_00641 gene open 1182-2045
1350 JUTK01000045.1 GCA001067255_00642 gene open 2260-2763
1351 JUTK01000045.1 GCA001067255_00643 gene open 2977-4449 pyk
1352 JUTK01000045.1 GCA001067255_00644 gene open 4649-6064
1353 JUTK01000045.1 GCA001067255_00645 gene open 6379-7644 lysM
1354 JUTK01000045.1 GCA001067255_00646 gene open 7879-8382 def
1355 JUTK01000045.1 GCA001067255_00647 gene open 8518-9444 fmt
1356 JUTK01000045.1 GCA001067255_00648 gene open 9478-9996
1357 JUTK01000045.1 GCA001067255_00649 gene open 9950-11302 rsmB
1358 JUTK01000045.1 GCA001067255_00650 gene open 11268-11861
1359 JUTK01000045.1 GCA001067255_00651 gene open 11865-13991
1360 JUTK01000045.1 GCA001067255_00652 gene open 13978-15252 zraR
1361 JUTK01000045.1 GCA001067255_00653 gene open 15487-16677 dprA
1362 JUTK01000045.1 GCA001067255_00654 gene open 16702-17157
1363 JUTK01000045.1 GCA001067255_00655 gene open 17237-19543 topA
1364 JUTK01000045.1 GCA001067255_00656 gene open 19692-20264 rsmD
1365 JUTK01000045.1 GCA001067255_00657 gene open 20387-20638 nuoI
1366 JUTK01000045.1 GCA001067255_00658 gene open 20737-20820 trnY
1367 JUTK01000045.1 GCA001067255_00659 gene open 20852-20925 trnG
1368 JUTK01000045.1 GCA001067255_00660 gene open 20935-21009 trnT
1369 JUTK01000045.1 GCA001067255_00658 tRNA open 20737-20820 trnY tRNA-Tyr(gta)
1370 JUTK01000045.1 GCA001067255_00659 tRNA open 20852-20925 trnG tRNA-Gly(tcc)
1371 JUTK01000045.1 GCA001067255_00660 tRNA open 20935-21009 trnT tRNA-Thr(ggt)
1372 JUTK01000046.1 GCA001067255_00661 CDS open 168-761 _na     197_aa GTP cyclohydrolase-2
1373 JUTK01000046.1 GCA001067255_00662 CDS open 754-1419 _na     221_aa GAF domain-containing protein
1374 JUTK01000046.1 GCA001067255_00664 CDS open 1863-3086 _na     407_aa Integrase
1375 JUTK01000046.1 GCA001067255_00665 CDS open 3267-3428 _na     53_aa hypothetical protein
1376 JUTK01000046.1 GCA001067255_00666 CDS open 3430-4227 _na     265_aa Nucleotidyltransferase
1377 JUTK01000046.1 GCA001067255_00667 CDS open 4325-4531 _na     68_aa alpA AlpA family phage regulatory protein
1378 JUTK01000046.1 GCA001067255_00668 CDS open 5186-5524 _na     112_aa DUF3077 domain-containing protein
1379 JUTK01000046.1 GCA001067255_00669 CDS open 5667-5882 _na     71_aa PTS sugar transporter subunit IID
1380 JUTK01000046.1 GCA001067255_00670 CDS open 5879-6064 _na     61_aa Polyribonucleotide nucleotidyltransferase
1381 JUTK01000046.1 GCA001067255_00671 CDS open 6061-7161 _na     366_aa DNA primase
1382 JUTK01000046.1 GCA001067255_00672 CDS open 7158-8903 _na     581_aa DUF927 domain-containing protein
1383 JUTK01000046.1 GCA001067255_00673 CDS open 9519-11006 _na     495_aa DUF2868 domain-containing protein
1384 JUTK01000046.1 GCA001067255_00674 CDS open 11080-11298 _na     72_aa NERD domain-containing protein
1385 JUTK01000046.1 GCA001067255_00675 CDS open 11566-13494 _na     642_aa dnaK molecular chaperone DnaK
1386 JUTK01000046.1 GCA001067255_00676 CDS open 13800-14363 _na     187_aa grpE nucleotide exchange factor GrpE
1387 JUTK01000046.1 GCA001067255_00677 CDS open 14523-15341 _na     272_aa cysE serine O-acetyltransferase
1388 JUTK01000046.1 GCA001067255_00678 CDS open 15415-16002 _na     195_aa diphosphoinositol-polyphosphate diphosphatase
1389 JUTK01000046.1 GCA001067255_00679 CDS open 16128-17738 _na     536_aa FAD dependent oxidoreductase domain-containing protein
1390 JUTK01000046.1 GCA001067255_00680 CDS open 17948-20365 _na     805_aa cirA TonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein
1391 JUTK01000046.1 GCA001067255_00681 CDS open 20420-21415 _na     331_aa Slam-dependent surface lipoprotein
1392 JUTK01000046.1 GCA001067255_00682 CDS open 21784-23325 _na     513_aa DUF560 domain-containing protein
1393 JUTK01000046.1 GCA001067255_00683 CDS open 23446-24069 _na     207_aa hemO HemO
1394 JUTK01000046.1 GCA001067255_00684 CDS open 24472-25782 _na     436_aa Paraquat-inducible protein A
1395 JUTK01000046.1 GCA001067255_00685 CDS open 25779-27440 _na     553_aa pqiB intermembrane transport protein PqiB
1396 JUTK01000046.1 GCA001067255_00686 CDS open 27440-27958 _na     172_aa ABC-type transport auxiliary lipoprotein component domain-containing protein
1397 JUTK01000046.1 GCA001067255_00687 CDS open 28015-28650 _na     211_aa grxB GrxB family glutaredoxin
1398 JUTK01000046.1 GCA001067255_00688 CDS open 28814-31027 _na     737_aa GTP pyrophosphokinase
1399 JUTK01000046.1 GCA001067255_00689 CDS open 31278-32072 _na     264_aa Formate/nitrite transporter
1400 JUTK01000046.1 GCA001067255_00690 CDS open 32528-34054 _na     508_aa putP sodium/proline symporter PutP
1401 JUTK01000046.1 GCA001067255_00691 CDS open 34279-37887 _na     1202_aa putA bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA
1402 JUTK01000046.1 GCA001067255_00692 CDS open 37944-38573 _na     209_aa nth endonuclease III
1403 JUTK01000046.1 GCA001067255_00693 CDS open 38711-40090 _na     459_aa nhaC Na+/H+ antiporter NhaC
1404 JUTK01000046.1 GCA001067255_00694 CDS open 40271-40894 _na     207_aa AB hydrolase-1 domain-containing protein
1405 JUTK01000046.1 GCA001067255_00695 CDS open 40987-42210 _na     407_aa Glucose/galactose transporter WARNING
1406 JUTK01000046.1 GCA001067255_00696 CDS open 42483-42896 _na     137_aa yqaA Inner membrane protein YqaA
1407 JUTK01000046.1 GCA001067255_00697 CDS open 42962-44155 _na     397_aa tyrB Aminotransferase
1408 JUTK01000046.1 GCA001067255_00698 CDS open 44255-44905 _na     216_aa Phosphoglycolate phosphatase
1409 JUTK01000046.1 GCA001067255_00699 CDS open 44975-45919 _na     314_aa Cation efflux protein cytoplasmic domain-containing protein
1410 JUTK01000046.1 GCA001067255_00700 CDS open 45935-46768 _na     277_aa Ferritin-like domain-containing protein
1411 JUTK01000046.1 GCA001067255_00701 CDS open 47058-47678 _na     206_aa lolA outer membrane lipoprotein chaperone LolA
1412 JUTK01000046.1 GCA001067255_00702 CDS open 47755-49092 _na     445_aa glmM phosphoglucosamine mutase
1413 JUTK01000046.1 GCA001067255_00703 CDS open 49292-50149 _na     285_aa Cytochrome c5 family protein
1414 JUTK01000046.1 GCA001067255_00705 CDS open 50602-51795 _na     397_aa Aminotransferase
1415 JUTK01000046.1 GCA001067255_00706 CDS open 51905-52678 _na     257_aa Pyruvate dehydrogenase complex repressor
1416 JUTK01000046.1 GCA001067255_00707 CDS open 53108-55084 _na     658_aa fepA TonB-dependent copper receptor
1417 JUTK01000046.1 GCA001067255_00708 CDS open 55212-56549 _na     445_aa Transporter
1418 JUTK01000046.1 GCA001067255_00709 CDS open 56817-57722 _na     301_aa znuA ABC transporter substrate-binding protein
1419 JUTK01000046.1 GCA001067255_00710 CDS open 57802-58677 _na     291_aa mntB Manganese transport system membrane protein MntB
1420 JUTK01000046.1 GCA001067255_00711 CDS open 58754-59479 _na     241_aa ABC transporter%2C ATP-binding protein
1421 JUTK01000046.1 GCA001067255_00712 CDS open 59750-60046 _na     98_aa DUF2288 domain-containing protein
1422 JUTK01000046.1 GCA001067255_00713 CDS open 60115-60483 _na     122_aa apaG Co2+/Mg2+ efflux protein ApaG
1423 JUTK01000046.1 GCA001067255_00714 CDS open 60580-61068 _na     162_aa Phosphatidylglycerophosphatase A
1424 JUTK01000046.1 GCA001067255_00715 CDS open 61061-62017 _na     318_aa thiL thiamine-phosphate kinase
1425 JUTK01000046.1 GCA001067255_00716 CDS open 62205-62924 _na     239_aa SDR family oxidoreductase
1426 JUTK01000046.1 GCA001067255_00717 CDS open 63020-64327 _na     435_aa hpnE hydroxysqualene dehydroxylase HpnE
1427 JUTK01000046.1 GCA001067255_00718 CDS open 64324-65172 _na     282_aa hpnD presqualene diphosphate synthase HpnD
1428 JUTK01000046.1 GCA001067255_00661 gene open 168-761
1429 JUTK01000046.1 GCA001067255_00662 gene open 754-1419
1430 JUTK01000046.1 GCA001067255_00664 gene open 1863-3086
1431 JUTK01000046.1 GCA001067255_00665 gene open 3267-3428
1432 JUTK01000046.1 GCA001067255_00666 gene open 3430-4227
1433 JUTK01000046.1 GCA001067255_00667 gene open 4325-4531 alpA
1434 JUTK01000046.1 GCA001067255_00668 gene open 5186-5524
1435 JUTK01000046.1 GCA001067255_00669 gene open 5667-5882
1436 JUTK01000046.1 GCA001067255_00670 gene open 5879-6064
1437 JUTK01000046.1 GCA001067255_00671 gene open 6061-7161
1438 JUTK01000046.1 GCA001067255_00672 gene open 7158-8903
1439 JUTK01000046.1 GCA001067255_00673 gene open 9519-11006
1440 JUTK01000046.1 GCA001067255_00674 gene open 11080-11298
1441 JUTK01000046.1 GCA001067255_00675 gene open 11566-13494 dnaK
1442 JUTK01000046.1 GCA001067255_00676 gene open 13800-14363 grpE
1443 JUTK01000046.1 GCA001067255_00677 gene open 14523-15341 cysE
1444 JUTK01000046.1 GCA001067255_00678 gene open 15415-16002
1445 JUTK01000046.1 GCA001067255_00679 gene open 16128-17738
1446 JUTK01000046.1 GCA001067255_00680 gene open 17948-20365 cirA
1447 JUTK01000046.1 GCA001067255_00681 gene open 20420-21415
1448 JUTK01000046.1 GCA001067255_00682 gene open 21784-23325
1449 JUTK01000046.1 GCA001067255_00683 gene open 23446-24069 hemO
1450 JUTK01000046.1 GCA001067255_00684 gene open 24472-25782
1451 JUTK01000046.1 GCA001067255_00685 gene open 25779-27440 pqiB
1452 JUTK01000046.1 GCA001067255_00686 gene open 27440-27958
1453 JUTK01000046.1 GCA001067255_00687 gene open 28015-28650 grxB
1454 JUTK01000046.1 GCA001067255_00688 gene open 28814-31027
1455 JUTK01000046.1 GCA001067255_00689 gene open 31278-32072
1456 JUTK01000046.1 GCA001067255_00690 gene open 32528-34054 putP
1457 JUTK01000046.1 GCA001067255_00691 gene open 34279-37887 putA
1458 JUTK01000046.1 GCA001067255_00692 gene open 37944-38573 nth
1459 JUTK01000046.1 GCA001067255_00693 gene open 38711-40090 nhaC
1460 JUTK01000046.1 GCA001067255_00694 gene open 40271-40894
1461 JUTK01000046.1 GCA001067255_00695 gene open 40987-42210
1462 JUTK01000046.1 GCA001067255_00696 gene open 42483-42896 yqaA
1463 JUTK01000046.1 GCA001067255_00697 gene open 42962-44155 tyrB
1464 JUTK01000046.1 GCA001067255_00698 gene open 44255-44905
1465 JUTK01000046.1 GCA001067255_00699 gene open 44975-45919
1466 JUTK01000046.1 GCA001067255_00700 gene open 45935-46768
1467 JUTK01000046.1 GCA001067255_00701 gene open 47058-47678 lolA
1468 JUTK01000046.1 GCA001067255_00702 gene open 47755-49092 glmM
1469 JUTK01000046.1 GCA001067255_00703 gene open 49292-50149
1470 JUTK01000046.1 GCA001067255_00705 gene open 50602-51795
1471 JUTK01000046.1 GCA001067255_00706 gene open 51905-52678
1472 JUTK01000046.1 GCA001067255_00707 gene open 53108-55084 fepA
1473 JUTK01000046.1 GCA001067255_00708 gene open 55212-56549
1474 JUTK01000046.1 GCA001067255_00709 gene open 56817-57722 znuA
1475 JUTK01000046.1 GCA001067255_00710 gene open 57802-58677 mntB
1476 JUTK01000046.1 GCA001067255_00711 gene open 58754-59479
1477 JUTK01000046.1 GCA001067255_00712 gene open 59750-60046
1478 JUTK01000046.1 GCA001067255_00713 gene open 60115-60483 apaG
1479 JUTK01000046.1 GCA001067255_00714 gene open 60580-61068
1480 JUTK01000046.1 GCA001067255_00715 gene open 61061-62017 thiL
1481 JUTK01000046.1 GCA001067255_00716 gene open 62205-62924
1482 JUTK01000046.1 GCA001067255_00717 gene open 63020-64327 hpnE
1483 JUTK01000046.1 GCA001067255_00718 gene open 64324-65172 hpnD
1484 JUTK01000046.1 GCA001067255_00663 gene open 1581-1665 trnL
1485 JUTK01000046.1 GCA001067255_00704 gene open 50435-50510 trnR
1486 JUTK01000046.1 GCA001067255_00663 tRNA open 1581-1665 trnL tRNA-Leu(tag)
1487 JUTK01000046.1 GCA001067255_00704 tRNA open 50435-50510 trnR tRNA-Arg(ccg)
1488 JUTK01000050.1 GCA001067255_00737 CDS open 690-2441 _na     583_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
1489 JUTK01000050.1 GCA001067255_00738 CDS open 2447-3574 _na     375_aa Cytosine-specific methyltransferase
1490 JUTK01000050.1 GCA001067255_00737 gene open 690-2441
1491 JUTK01000050.1 GCA001067255_00738 gene open 2447-3574
1492 JUTK01000051.1 GCA001067255_00744 CDS open 367-963 _na     198_aa Serine acetyltransferase
1493 JUTK01000051.1 GCA001067255_00745 CDS open 1246-1884 _na     212_aa Metallo-beta-lactamase domain-containing protein
1494 JUTK01000051.1 GCA001067255_00746 CDS open 2344-2856 _na     170_aa omlA SmpA / OmlA family protein
1495 JUTK01000051.1 GCA001067255_00747 CDS open 2865-3293 _na     142_aa ykuD YkuD domain-containing protein
1496 JUTK01000051.1 GCA001067255_00748 CDS open 3595-4059 _na     154_aa Ferredoxin
1497 JUTK01000051.1 GCA001067255_00749 CDS open 4121-4654 _na     177_aa Acetyltransferase
1498 JUTK01000051.1 GCA001067255_00750 CDS open 4936-5151 _na     71_aa rpmE 50S ribosomal protein L31
1499 JUTK01000051.1 GCA001067255_00751 CDS open 5387-7045 _na     552_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
1500 JUTK01000051.1 GCA001067255_00752 CDS open 7277-7936 _na     219_aa hypothetical protein