HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_001067255.1)

Select a Genome:
BAKTA Annotations for GCA_001067255.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
119 2158847 2042 3 1 35
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4191 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4191 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JUTK01000094.1 GCA001067255_01503 CDS open 14162-15502 _na     446_aa rseP RIP metalloprotease RseP
3002 JUTK01000094.1 GCA001067255_01504 CDS open 15634-16851 _na     405_aa ispC 1-deoxy-D-xylulose-5-phosphate reductoisomerase
3003 JUTK01000094.1 GCA001067255_01505 CDS open 16933-17682 _na     249_aa SIMPL domain-containing protein
3004 JUTK01000094.1 GCA001067255_01506 CDS open 17716-18510 _na     264_aa Phosphatidate cytidylyltransferase
3005 JUTK01000094.1 GCA001067255_01507 CDS open 18516-19262 _na     248_aa isoprenyl transferase
3006 JUTK01000094.1 GCA001067255_01508 CDS open 19320-19877 _na     185_aa frr ribosome recycling factor
3007 JUTK01000094.1 GCA001067255_01509 CDS open 20053-20352 _na     99_aa Inner membrane protein
3008 JUTK01000094.1 GCA001067255_01510 CDS open 20573-22015 _na     480_aa nuoN NADH-quinone oxidoreductase subunit NuoN
3009 JUTK01000094.1 GCA001067255_01511 CDS open 22025-23521 _na     498_aa nuoM NADH-quinone oxidoreductase subunit M
3010 JUTK01000094.1 GCA001067255_01512 CDS open 23617-25641 _na     674_aa nuoL NADH-quinone oxidoreductase subunit L
3011 JUTK01000094.1 GCA001067255_01513 CDS open 25644-25949 _na     101_aa nuoK NADH-quinone oxidoreductase subunit NuoK
3012 JUTK01000094.1 GCA001067255_01514 CDS open 25946-26617 _na     223_aa nuoJ NADH-quinone oxidoreductase subunit J
3013 JUTK01000094.1 GCA001067255_01515 CDS open 26629-27108 _na     159_aa nuoI NADH-quinone oxidoreductase subunit NuoI
3014 JUTK01000094.1 GCA001067255_01516 CDS open 27163-27558 _na     131_aa CENP-V/GFA domain-containing protein
3015 JUTK01000094.1 GCA001067255_01517 CDS open 27634-28710 _na     358_aa nuoH NADH-quinone oxidoreductase subunit NuoH
3016 JUTK01000094.1 GCA001067255_01518 CDS open 28713-30974 _na     753_aa nuoG NADH-quinone oxidoreductase subunit NuoG
3017 JUTK01000094.1 GCA001067255_01519 CDS open 31261-31572 _na     103_aa Endonuclease
3018 JUTK01000094.1 GCA001067255_01520 CDS open 31783-32157 _na     124_aa hypothetical protein
3019 JUTK01000094.1 GCA001067255_01521 CDS open 32157-33458 _na     433_aa nuoF NADH-quinone oxidoreductase subunit NuoF
3020 JUTK01000094.1 GCA001067255_01522 CDS open 33516-33989 _na     157_aa nuoE NADH-quinone oxidoreductase subunit NuoE
3021 JUTK01000094.1 GCA001067255_01523 CDS open 33989-35245 _na     418_aa nuoD NADH-quinone oxidoreductase subunit D
3022 JUTK01000094.1 GCA001067255_01524 CDS open 35235-35828 _na     197_aa nuoC NADH-quinone oxidoreductase subunit C
3023 JUTK01000094.1 GCA001067255_01525 CDS open 35841-36323 _na     160_aa nuoB NADH-quinone oxidoreductase subunit B
3024 JUTK01000094.1 GCA001067255_01526 CDS open 36314-36670 _na     118_aa nuoA NADH-quinone oxidoreductase subunit A
3025 JUTK01000094.1 GCA001067255_01527 CDS open 37005-38462 _na     485_aa Di-/tripeptide transporter
3026 JUTK01000094.1 GCA001067255_01528 CDS open 39168-40271 _na     367_aa prfB peptide chain release factor 2
3027 JUTK01000094.1 GCA001067255_01529 CDS open 40369-41085 _na     238_aa truC tRNA pseudouridine(65) synthase TruC
3028 JUTK01000094.1 GCA001067255_01530 CDS open 41226-41954 _na     242_aa ppnN Cytokinin riboside 5'-monophosphate phosphoribohydrolase
3029 JUTK01000094.1 GCA001067255_01531 CDS open 42063-43919 _na     618_aa mdlB Multidrug export ATP-binding/permease protein
3030 JUTK01000094.1 GCA001067255_01532 CDS open 44147-45370 _na     407_aa sstT serine/threonine transporter SstT
3031 JUTK01000094.1 GCA001067255_01533 CDS open 45818-47659 _na     613_aa tamA Translocation and assembly module subunit TamA
3032 JUTK01000094.1 GCA001067255_01534 CDS open 47740-51888 _na     1382_aa tamB Translocation/assembly module TamB
3033 JUTK01000094.1 GCA001067255_01535 CDS open 52128-52301 _na     57_aa Zinc-finger domain-containing protein
3034 JUTK01000094.1 GCA001067255_01536 CDS open 52314-52892 _na     192_aa RNA polymerase sigma factor
3035 JUTK01000094.1 GCA001067255_01537 CDS open 53196-53897 _na     233_aa DUF2063 domain-containing protein
3036 JUTK01000094.1 GCA001067255_01538 CDS open 53887-54729 _na     280_aa UPF0276 protein NMB2142
3037 JUTK01000094.1 GCA001067255_01539 CDS open 54816-55133 _na     105_aa Periplasmic protein
3038 JUTK01000094.1 GCA001067255_01540 CDS open 55217-55666 _na     149_aa doxX DoxX family protein
3039 JUTK01000094.1 GCA001067255_01541 CDS open 55890-58199 _na     769_aa recQ DNA helicase RecQ
3040 JUTK01000094.1 GCA001067255_01542 CDS open 58417-58752 _na     111_aa phnA Putative alkylphosphonate utilization operon protein PhnA
3041 JUTK01000094.1 GCA001067255_01543 CDS open 58815-59150 _na     111_aa Periplasmic protein
3042 JUTK01000094.1 GCA001067255_01544 CDS open 59593-60549 _na     318_aa DUF2167 domain-containing protein
3043 JUTK01000094.1 GCA001067255_01545 CDS open 60615-62009 _na     464_aa gltX glutamate--tRNA ligase
3044 JUTK01000094.1 GCA001067255_01546 CDS open 62174-63268 _na     364_aa Vitamin B12-binding protein
3045 JUTK01000094.1 GCA001067255_01547 CDS open 63386-63637 _na     83_aa hypothetical protein
3046 JUTK01000094.1 GCA001067255_01548 CDS open 63708-64364 _na     218_aa DUF218 domain-containing protein
3047 JUTK01000094.1 GCA001067255_01549 CDS open 64390-64749 _na     119_aa arsC arsenate reductase (glutaredoxin)
3048 JUTK01000094.1 GCA001067255_01550 CDS open 64919-65401 _na     160_aa Redoxin family protein
3049 JUTK01000094.1 GCA001067255_01551 CDS open 65650-66300 _na     216_aa ftsE Cell division ATP-binding protein FtsE
3050 JUTK01000094.1 GCA001067255_01552 CDS open 66297-67214 _na     305_aa ftsX permease-like cell division protein FtsX
3051 JUTK01000094.1 GCA001067255_01553 CDS open 67384-68664 _na     426_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
3052 JUTK01000094.1 GCA001067255_01554 CDS open 68929-69414 _na     161_aa protein-(glutamine-N5) methyltransferase
3053 JUTK01000094.1 GCA001067255_01555 CDS open 69476-70177 _na     233_aa Lipoprotein
3054 JUTK01000094.1 GCA001067255_01556 CDS open 70174-71535 _na     453_aa lipase family protein
3055 JUTK01000094.1 GCA001067255_01557 CDS open 71662-73716 _na     684_aa Methionine--tRNA ligase
3056 JUTK01000094.1 GCA001067255_01558 CDS open 73741-73935 _na     64_aa Virulence regulator
3057 JUTK01000094.1 GCA001067255_01491 gene open 266-1270
3058 JUTK01000094.1 GCA001067255_01492 gene open 1327-2019 rnhB
3059 JUTK01000094.1 GCA001067255_01493 gene open 2074-3210
3060 JUTK01000094.1 GCA001067255_01495 gene open 3760-5649
3061 JUTK01000094.1 GCA001067255_01496 gene open 5741-7279 murJ
3062 JUTK01000094.1 GCA001067255_01497 gene open 7289-8464 lpxB
3063 JUTK01000094.1 GCA001067255_01498 gene open 8625-9401 lpxA
3064 JUTK01000094.1 GCA001067255_01499 gene open 9476-9925 fabZ
3065 JUTK01000094.1 GCA001067255_01500 gene open 9999-11039 lpxD
3066 JUTK01000094.1 GCA001067255_01501 gene open 11141-11650
3067 JUTK01000094.1 GCA001067255_01502 gene open 11762-14158 bamA
3068 JUTK01000094.1 GCA001067255_01503 gene open 14162-15502 rseP
3069 JUTK01000094.1 GCA001067255_01504 gene open 15634-16851 ispC
3070 JUTK01000094.1 GCA001067255_01505 gene open 16933-17682
3071 JUTK01000094.1 GCA001067255_01506 gene open 17716-18510
3072 JUTK01000094.1 GCA001067255_01507 gene open 18516-19262
3073 JUTK01000094.1 GCA001067255_01508 gene open 19320-19877 frr
3074 JUTK01000094.1 GCA001067255_01509 gene open 20053-20352
3075 JUTK01000094.1 GCA001067255_01510 gene open 20573-22015 nuoN
3076 JUTK01000094.1 GCA001067255_01511 gene open 22025-23521 nuoM
3077 JUTK01000094.1 GCA001067255_01512 gene open 23617-25641 nuoL
3078 JUTK01000094.1 GCA001067255_01513 gene open 25644-25949 nuoK
3079 JUTK01000094.1 GCA001067255_01514 gene open 25946-26617 nuoJ
3080 JUTK01000094.1 GCA001067255_01515 gene open 26629-27108 nuoI
3081 JUTK01000094.1 GCA001067255_01516 gene open 27163-27558
3082 JUTK01000094.1 GCA001067255_01517 gene open 27634-28710 nuoH
3083 JUTK01000094.1 GCA001067255_01518 gene open 28713-30974 nuoG
3084 JUTK01000094.1 GCA001067255_01519 gene open 31261-31572
3085 JUTK01000094.1 GCA001067255_01520 gene open 31783-32157
3086 JUTK01000094.1 GCA001067255_01521 gene open 32157-33458 nuoF
3087 JUTK01000094.1 GCA001067255_01522 gene open 33516-33989 nuoE
3088 JUTK01000094.1 GCA001067255_01523 gene open 33989-35245 nuoD
3089 JUTK01000094.1 GCA001067255_01524 gene open 35235-35828 nuoC
3090 JUTK01000094.1 GCA001067255_01525 gene open 35841-36323 nuoB
3091 JUTK01000094.1 GCA001067255_01526 gene open 36314-36670 nuoA
3092 JUTK01000094.1 GCA001067255_01527 gene open 37005-38462
3093 JUTK01000094.1 GCA001067255_01528 gene open 39168-40271 prfB
3094 JUTK01000094.1 GCA001067255_01529 gene open 40369-41085 truC
3095 JUTK01000094.1 GCA001067255_01530 gene open 41226-41954 ppnN
3096 JUTK01000094.1 GCA001067255_01531 gene open 42063-43919 mdlB
3097 JUTK01000094.1 GCA001067255_01532 gene open 44147-45370 sstT
3098 JUTK01000094.1 GCA001067255_01533 gene open 45818-47659 tamA
3099 JUTK01000094.1 GCA001067255_01534 gene open 47740-51888 tamB
3100 JUTK01000094.1 GCA001067255_01535 gene open 52128-52301
3101 JUTK01000094.1 GCA001067255_01536 gene open 52314-52892
3102 JUTK01000094.1 GCA001067255_01537 gene open 53196-53897
3103 JUTK01000094.1 GCA001067255_01538 gene open 53887-54729
3104 JUTK01000094.1 GCA001067255_01539 gene open 54816-55133
3105 JUTK01000094.1 GCA001067255_01540 gene open 55217-55666 doxX
3106 JUTK01000094.1 GCA001067255_01541 gene open 55890-58199 recQ
3107 JUTK01000094.1 GCA001067255_01542 gene open 58417-58752 phnA
3108 JUTK01000094.1 GCA001067255_01543 gene open 58815-59150
3109 JUTK01000094.1 GCA001067255_01544 gene open 59593-60549
3110 JUTK01000094.1 GCA001067255_01545 gene open 60615-62009 gltX
3111 JUTK01000094.1 GCA001067255_01546 gene open 62174-63268
3112 JUTK01000094.1 GCA001067255_01547 gene open 63386-63637
3113 JUTK01000094.1 GCA001067255_01548 gene open 63708-64364
3114 JUTK01000094.1 GCA001067255_01549 gene open 64390-64749 arsC
3115 JUTK01000094.1 GCA001067255_01550 gene open 64919-65401
3116 JUTK01000094.1 GCA001067255_01551 gene open 65650-66300 ftsE
3117 JUTK01000094.1 GCA001067255_01552 gene open 66297-67214 ftsX
3118 JUTK01000094.1 GCA001067255_01553 gene open 67384-68664 murA
3119 JUTK01000094.1 GCA001067255_01554 gene open 68929-69414
3120 JUTK01000094.1 GCA001067255_01555 gene open 69476-70177
3121 JUTK01000094.1 GCA001067255_01556 gene open 70174-71535
3122 JUTK01000094.1 GCA001067255_01557 gene open 71662-73716
3123 JUTK01000094.1 GCA001067255_01558 gene open 73741-73935
3124 JUTK01000094.1 GCA001067255_01494 gene open 3380-3456 trnfM
3125 JUTK01000094.1 GCA001067255_01494 tRNA open 3380-3456 trnfM tRNA-fMet(cat)
3126 JUTK01000095.1 GCA001067255_01559 CDS open 397-3018 _na     873_aa pepN aminopeptidase N
3127 JUTK01000095.1 GCA001067255_01560 CDS open 3174-3683 _na     169_aa hypothetical protein
3128 JUTK01000095.1 GCA001067255_01559 gene open 397-3018 pepN
3129 JUTK01000095.1 GCA001067255_01560 gene open 3174-3683
3130 JUTK01000096.1 GCA001067255_01561 CDS open 407-1069 _na     220_aa hypothetical protein
3131 JUTK01000096.1 GCA001067255_01562 CDS open 1148-2725 _na     525_aa hypothetical protein
3132 JUTK01000096.1 GCA001067255_01563 CDS open 2740-4671 _na     643_aa adhesin
3133 JUTK01000096.1 GCA001067255_01561 gene open 407-1069
3134 JUTK01000096.1 GCA001067255_01562 gene open 1148-2725
3135 JUTK01000096.1 GCA001067255_01563 gene open 2740-4671
3136 JUTK01000097.1 GCA001067255_01564 CDS open 294-2501 _na     735_aa uvrD DNA helicase II
3137 JUTK01000097.1 GCA001067255_01565 CDS open 2602-3630 _na     342_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
3138 JUTK01000097.1 GCA001067255_01566 CDS open 4406-5941 _na     511_aa Transporter
3139 JUTK01000097.1 GCA001067255_01567 CDS open 5941-6033 _na     30_aa Methionine/alanine import family NSS transporter small subunit
3140 JUTK01000097.1 GCA001067255_01568 CDS open 6266-7738 _na     490_aa mgtE magnesium transporter
3141 JUTK01000097.1 GCA001067255_01569 CDS open 7888-8154 _na     88_aa MtN3/saliva family protein
3142 JUTK01000097.1 GCA001067255_01570 CDS open 8390-8902 _na     170_aa ISXO2-like transposase domain-containing protein
3143 JUTK01000097.1 GCA001067255_01571 CDS open 8923-9306 _na     127_aa DNA breaking-rejoining protein
3144 JUTK01000097.1 GCA001067255_01572 CDS open 9514-10131 _na     205_aa thiE Thiamine-phosphate synthase
3145 JUTK01000097.1 GCA001067255_01573 CDS open 10238-10432 _na     64_aa thiS sulfur carrier protein ThiS
3146 JUTK01000097.1 GCA001067255_01574 CDS open 10491-10784 _na     97_aa YCII-related domain-containing protein
3147 JUTK01000097.1 GCA001067255_01575 CDS open 10840-11628 _na     262_aa thiG Thiazole synthase
3148 JUTK01000097.1 GCA001067255_01576 CDS open 11698-12465 _na     255_aa Uracil-DNA glycosylase%2C family 4
3149 JUTK01000097.1 GCA001067255_01577 CDS open 12459-12902 _na     147_aa rimI ribosomal protein S18-alanine N-acetyltransferase
3150 JUTK01000097.1 GCA001067255_01578 CDS open 12899-13606 _na     235_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
3151 JUTK01000097.1 GCA001067255_01579 CDS open 13736-14410 _na     224_aa Glutathione S-transferase%2C C-terminal domain protein
3152 JUTK01000097.1 GCA001067255_01580 CDS open 14419-14814 _na     131_aa HTH cro/C1-type domain-containing protein
3153 JUTK01000097.1 GCA001067255_01581 CDS open 14815-15981 _na     388_aa 3-oxoacyl-[acyl-carrier-protein] synthase 3
3154 JUTK01000097.1 GCA001067255_01582 CDS open 16001-16246 _na     81_aa Acetyltransferase
3155 JUTK01000097.1 GCA001067255_01583 CDS open 16362-16781 _na     139_aa SnoaL-like domain-containing protein
3156 JUTK01000097.1 GCA001067255_01584 CDS open 16819-17727 _na     302_aa Dialkylrecorsinol condensing enzyme
3157 JUTK01000097.1 GCA001067255_01564 gene open 294-2501 uvrD
3158 JUTK01000097.1 GCA001067255_01565 gene open 2602-3630 gap
3159 JUTK01000097.1 GCA001067255_01566 gene open 4406-5941
3160 JUTK01000097.1 GCA001067255_01567 gene open 5941-6033
3161 JUTK01000097.1 GCA001067255_01568 gene open 6266-7738 mgtE
3162 JUTK01000097.1 GCA001067255_01569 gene open 7888-8154
3163 JUTK01000097.1 GCA001067255_01570 gene open 8390-8902
3164 JUTK01000097.1 GCA001067255_01571 gene open 8923-9306
3165 JUTK01000097.1 GCA001067255_01572 gene open 9514-10131 thiE
3166 JUTK01000097.1 GCA001067255_01573 gene open 10238-10432 thiS
3167 JUTK01000097.1 GCA001067255_01574 gene open 10491-10784
3168 JUTK01000097.1 GCA001067255_01575 gene open 10840-11628 thiG
3169 JUTK01000097.1 GCA001067255_01576 gene open 11698-12465
3170 JUTK01000097.1 GCA001067255_01577 gene open 12459-12902 rimI
3171 JUTK01000097.1 GCA001067255_01578 gene open 12899-13606 tsaB
3172 JUTK01000097.1 GCA001067255_01579 gene open 13736-14410
3173 JUTK01000097.1 GCA001067255_01580 gene open 14419-14814
3174 JUTK01000097.1 GCA001067255_01581 gene open 14815-15981
3175 JUTK01000097.1 GCA001067255_01582 gene open 16001-16246
3176 JUTK01000097.1 GCA001067255_01583 gene open 16362-16781
3177 JUTK01000097.1 GCA001067255_01584 gene open 16819-17727
3178 JUTK01000098.1 GCA001067255_01585 CDS open 155-388 _na     77_aa hypothetical protein
3179 JUTK01000098.1 GCA001067255_01585 gene open 155-388
3180 JUTK01000099.1 GCA001067255_01586 CDS open 233-1168 _na     311_aa hypothetical protein
3181 JUTK01000099.1 GCA001067255_01587 CDS open 1200-1412 _na     70_aa uvrB UvrB
3182 JUTK01000099.1 GCA001067255_01588 CDS open 1412-2221 _na     269_aa murI glutamate racemase
3183 JUTK01000099.1 GCA001067255_01589 CDS open 2283-3512 _na     409_aa Bcr/CflA family efflux transporter
3184 JUTK01000099.1 GCA001067255_01590 CDS open 3754-5283 _na     509_aa cedB AAA+ ATPase domain-containing protein
3185 JUTK01000099.1 GCA001067255_01591 CDS open 5350-6705 _na     451_aa UPF0210 protein NMA1908
3186 JUTK01000099.1 GCA001067255_01592 CDS open 6722-6994 _na     90_aa aCT ACT domain-containing protein
3187 JUTK01000099.1 GCA001067255_01593 CDS open 7102-8241 _na     379_aa Putrescine-binding periplasmic protein
3188 JUTK01000099.1 GCA001067255_01594 CDS open 8570-9106 _na     178_aa RNA pyrophosphohydrolase
3189 JUTK01000099.1 GCA001067255_01595 CDS open 9175-11160 _na     661_aa parE DNA topoisomerase IV subunit B
3190 JUTK01000099.1 GCA001067255_01586 gene open 233-1168
3191 JUTK01000099.1 GCA001067255_01587 gene open 1200-1412 uvrB
3192 JUTK01000099.1 GCA001067255_01588 gene open 1412-2221 murI
3193 JUTK01000099.1 GCA001067255_01589 gene open 2283-3512
3194 JUTK01000099.1 GCA001067255_01590 gene open 3754-5283 cedB
3195 JUTK01000099.1 GCA001067255_01591 gene open 5350-6705
3196 JUTK01000099.1 GCA001067255_01592 gene open 6722-6994 aCT
3197 JUTK01000099.1 GCA001067255_01593 gene open 7102-8241
3198 JUTK01000099.1 GCA001067255_01594 gene open 8570-9106
3199 JUTK01000099.1 GCA001067255_01595 gene open 9175-11160 parE
3200 JUTK01000100.1 regulatory_region open 24759-24856 Glycine riboswitch aptamer
3201 JUTK01000100.1 GCA001067255_01596 CDS open 240-602 _na     120_aa Adhesin
3202 JUTK01000100.1 GCA001067255_01597 CDS open 900-2486 _na     528_aa lldP L-lactate permease
3203 JUTK01000100.1 GCA001067255_01598 CDS open 2818-3453 _na     211_aa 7-carboxy-7-deazaguanine synthase
3204 JUTK01000100.1 GCA001067255_01599 CDS open 3560-3931 _na     123_aa DUF1304 domain-containing protein
3205 JUTK01000100.1 GCA001067255_01600 CDS open 4005-4427 _na     140_aa queD 6-carboxytetrahydropterin synthase QueD
3206 JUTK01000100.1 GCA001067255_01601 CDS open 4491-5048 _na     185_aa orn oligoribonuclease
3207 JUTK01000100.1 GCA001067255_01602 CDS open 5182-7071 _na     629_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
3208 JUTK01000100.1 GCA001067255_01603 CDS open 7137-8537 _na     466_aa L-serine ammonia-lyase
3209 JUTK01000100.1 GCA001067255_01604 CDS open 8617-8838 _na     73_aa Phage associated protein
3210 JUTK01000100.1 GCA001067255_01605 CDS open 8847-9476 _na     209_aa NlpC/P60 domain-containing protein
3211 JUTK01000100.1 GCA001067255_01606 CDS open 9737-10633 _na     298_aa hslO Hsp33 family molecular chaperone HslO
3212 JUTK01000100.1 GCA001067255_01607 CDS open 10805-12103 _na     432_aa tyrS tyrosine--tRNA ligase
3213 JUTK01000100.1 GCA001067255_01608 CDS open 12126-13595 _na     489_aa KAP NTPase domain-containing protein
3214 JUTK01000100.1 GCA001067255_01609 CDS open 13643-14734 _na     363_aa ychF redox-regulated ATPase YchF
3215 JUTK01000100.1 GCA001067255_01610 CDS open 14875-17577 _na     900_aa ppc phosphoenolpyruvate carboxylase
3216 JUTK01000100.1 GCA001067255_01611 CDS open 17765-18229 _na     154_aa Cyclic pyranopterin monophosphate synthase 2
3217 JUTK01000100.1 GCA001067255_01612 CDS open 18276-19025 _na     249_aa Molybdopterin-synthase adenylyltransferase
3218 JUTK01000100.1 GCA001067255_01613 CDS open 19211-19555 _na     114_aa lrgA Murein hydrolase transporter LrgA
3219 JUTK01000100.1 GCA001067255_01614 CDS open 19555-20253 _na     232_aa TIGR00659 family protein
3220 JUTK01000100.1 GCA001067255_01615 CDS open 20297-21517 _na     406_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
3221 JUTK01000100.1 GCA001067255_01616 CDS open 21595-22965 _na     456_aa clcA H(+)/Cl(-) exchange transporter ClcA
3222 JUTK01000100.1 GCA001067255_01617 CDS open 23041-24552 _na     503_aa ubiB ubiquinone biosynthesis regulatory protein kinase UbiB
3223 JUTK01000100.1 GCA001067255_01618 CDS open 25065-26165 _na     366_aa gcvT glycine cleavage system aminomethyltransferase GcvT
3224 JUTK01000100.1 GCA001067255_01619 CDS open 26313-26852 _na     179_aa Lipoprotein
3225 JUTK01000100.1 GCA001067255_01620 CDS open 26904-27287 _na     127_aa gcvH glycine cleavage system protein GcvH
3226 JUTK01000100.1 GCA001067255_01621 CDS open 27395-27946 _na     183_aa DNA-3-methyladenine glycosylase I
3227 JUTK01000100.1 GCA001067255_01622 CDS open 28082-30934 _na     950_aa gcvP aminomethyl-transferring glycine dehydrogenase
3228 JUTK01000100.1 GCA001067255_01623 CDS open 31159-31968 _na     269_aa hydroxymethylpyrimidine kinase
3229 JUTK01000100.1 GCA001067255_01624 CDS open 32110-32499 _na     129_aa osmC OsmC family protein
3230 JUTK01000100.1 GCA001067255_01625 CDS open 32762-33475 _na     237_aa gntR Transcriptional regulator%2C GntR family
3231 JUTK01000100.1 GCA001067255_01626 CDS open 33548-34327 _na     259_aa Glycerol-3-phosphate regulon repressor
3232 JUTK01000100.1 GCA001067255_01627 CDS open 34433-36121 _na     562_aa Glutamine--tRNA ligase
3233 JUTK01000100.1 GCA001067255_01628 CDS open 36449-36667 _na     72_aa hypothetical protein
3234 JUTK01000100.1 GCA001067255_01629 CDS open 36713-36892 _na     59_aa hypothetical protein
3235 JUTK01000100.1 GCA001067255_01596 gene open 240-602
3236 JUTK01000100.1 GCA001067255_01597 gene open 900-2486 lldP
3237 JUTK01000100.1 GCA001067255_01598 gene open 2818-3453
3238 JUTK01000100.1 GCA001067255_01599 gene open 3560-3931
3239 JUTK01000100.1 GCA001067255_01600 gene open 4005-4427 queD
3240 JUTK01000100.1 GCA001067255_01601 gene open 4491-5048 orn
3241 JUTK01000100.1 GCA001067255_01602 gene open 5182-7071 dxs
3242 JUTK01000100.1 GCA001067255_01603 gene open 7137-8537
3243 JUTK01000100.1 GCA001067255_01604 gene open 8617-8838
3244 JUTK01000100.1 GCA001067255_01605 gene open 8847-9476
3245 JUTK01000100.1 GCA001067255_01606 gene open 9737-10633 hslO
3246 JUTK01000100.1 GCA001067255_01607 gene open 10805-12103 tyrS
3247 JUTK01000100.1 GCA001067255_01608 gene open 12126-13595
3248 JUTK01000100.1 GCA001067255_01609 gene open 13643-14734 ychF
3249 JUTK01000100.1 GCA001067255_01610 gene open 14875-17577 ppc
3250 JUTK01000100.1 GCA001067255_01611 gene open 17765-18229
3251 JUTK01000100.1 GCA001067255_01612 gene open 18276-19025
3252 JUTK01000100.1 GCA001067255_01613 gene open 19211-19555 lrgA
3253 JUTK01000100.1 GCA001067255_01614 gene open 19555-20253
3254 JUTK01000100.1 GCA001067255_01615 gene open 20297-21517 argJ
3255 JUTK01000100.1 GCA001067255_01616 gene open 21595-22965 clcA
3256 JUTK01000100.1 GCA001067255_01617 gene open 23041-24552 ubiB
3257 JUTK01000100.1 GCA001067255_01618 gene open 25065-26165 gcvT
3258 JUTK01000100.1 GCA001067255_01619 gene open 26313-26852
3259 JUTK01000100.1 GCA001067255_01620 gene open 26904-27287 gcvH
3260 JUTK01000100.1 GCA001067255_01621 gene open 27395-27946
3261 JUTK01000100.1 GCA001067255_01622 gene open 28082-30934 gcvP
3262 JUTK01000100.1 GCA001067255_01623 gene open 31159-31968
3263 JUTK01000100.1 GCA001067255_01624 gene open 32110-32499 osmC
3264 JUTK01000100.1 GCA001067255_01625 gene open 32762-33475 gntR
3265 JUTK01000100.1 GCA001067255_01626 gene open 33548-34327
3266 JUTK01000100.1 GCA001067255_01627 gene open 34433-36121
3267 JUTK01000100.1 GCA001067255_01628 gene open 36449-36667
3268 JUTK01000100.1 GCA001067255_01629 gene open 36713-36892
3269 JUTK01000101.1 GCA001067255_01632 gene open 884-997 rrf
3270 JUTK01000101.1 GCA001067255_01633 gene open 1093-3984 rrl
3271 JUTK01000101.1 GCA001067255_01636 gene open 4596-6136 rrs
3272 JUTK01000101.1 GCA001067255_01632 rRNA open 884-997 rrf 5S ribosomal RNA
3273 JUTK01000101.1 GCA001067255_01633 rRNA open 1093-3984 rrl 23S ribosomal RNA
3274 JUTK01000101.1 GCA001067255_01636 rRNA open 4596-6136 rrs 16S ribosomal RNA
3275 JUTK01000101.1 GCA001067255_01630 CDS open 288-575 _na     95_aa comE ComE operon protein 1
3276 JUTK01000101.1 GCA001067255_01631 CDS open 627-782 _na     51_aa TonB-dependent receptor
3277 JUTK01000101.1 GCA001067255_01630 gene open 288-575 comE
3278 JUTK01000101.1 GCA001067255_01631 gene open 627-782
3279 JUTK01000101.1 GCA001067255_01634 gene open 4333-4408 trnA
3280 JUTK01000101.1 GCA001067255_01635 gene open 4414-4490 trnI
3281 JUTK01000101.1 GCA001067255_01634 tRNA open 4333-4408 trnA tRNA-Ala(tgc)
3282 JUTK01000101.1 GCA001067255_01635 tRNA open 4414-4490 trnI tRNA-Ile(gat)
3283 JUTK01000102.1 GCA001067255_01637 CDS open 80-802 _na     240_aa type IV secretory system conjugative DNA transfer family protein
3284 JUTK01000102.1 GCA001067255_01638 CDS open 958-1440 _na     160_aa DUF6636 domain-containing protein
3285 JUTK01000102.1 GCA001067255_01639 CDS open 1507-2331 _na     274_aa Peptidase C51 domain-containing protein
3286 JUTK01000102.1 GCA001067255_01640 CDS open 2411-2626 _na     71_aa hypothetical protein
3287 JUTK01000102.1 GCA001067255_01641 CDS open 2602-3267 _na     221_aa IS110 family transposase
3288 JUTK01000102.1 GCA001067255_01642 CDS open 3604-3933 _na     109_aa Transposase
3289 JUTK01000102.1 GCA001067255_01637 gene open 80-802
3290 JUTK01000102.1 GCA001067255_01638 gene open 958-1440
3291 JUTK01000102.1 GCA001067255_01639 gene open 1507-2331
3292 JUTK01000102.1 GCA001067255_01640 gene open 2411-2626
3293 JUTK01000102.1 GCA001067255_01641 gene open 2602-3267
3294 JUTK01000102.1 GCA001067255_01642 gene open 3604-3933
3295 JUTK01000103.1 GCA001067255_01643 CDS open 225-746 _na     173_aa DUF4189 domain-containing protein
3296 JUTK01000103.1 GCA001067255_01644 CDS open 806-1087 _na     93_aa hypothetical protein
3297 JUTK01000103.1 GCA001067255_01643 gene open 225-746
3298 JUTK01000103.1 GCA001067255_01644 gene open 806-1087
3299 JUTK01000104.1 GCA001067255_01645 CDS open 48-392 _na     114_aa hypothetical protein
3300 JUTK01000104.1 GCA001067255_01646 CDS open 438-1775 _na     445_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
3301 JUTK01000104.1 GCA001067255_01647 CDS open 2019-3515 _na     498_aa gatA Aspartyl/glutamyl-tRNA amidotransferase subunit A
3302 JUTK01000104.1 GCA001067255_01648 CDS open 3789-5051 _na     420_aa ftsW putative lipid II flippase FtsW
3303 JUTK01000104.1 GCA001067255_01649 CDS open 5056-6123 _na     355_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
3304 JUTK01000104.1 GCA001067255_01650 CDS open 6258-7085 _na     275_aa yktD Tetracenomycin polyketide synthesis O-methyltransferase TcmP
3305 JUTK01000104.1 GCA001067255_01651 CDS open 7351-8760 _na     469_aa murC UDP-N-acetylmuramate--L-alanine ligase
3306 JUTK01000104.1 GCA001067255_01652 CDS open 8848-9762 _na     304_aa ddl D-alanine--D-alanine ligase
3307 JUTK01000104.1 GCA001067255_01653 CDS open 9752-10471 _na     239_aa ftsQ Cell division protein FtsQ
3308 JUTK01000104.1 GCA001067255_01654 CDS open 10546-11799 _na     417_aa ftsA cell division protein FtsA
3309 JUTK01000104.1 GCA001067255_01655 CDS open 12052-13251 _na     399_aa ftsZ cell division protein FtsZ
3310 JUTK01000104.1 GCA001067255_01656 CDS open 13372-14340 _na     322_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
3311 JUTK01000104.1 GCA001067255_01657 CDS open 14354-14860 _na     168_aa lspA signal peptidase II
3312 JUTK01000104.1 GCA001067255_01658 CDS open 15009-15908 _na     299_aa glyQ glycine--tRNA ligase subunit alpha
3313 JUTK01000104.1 GCA001067255_01659 CDS open 15990-16172 _na     60_aa yacG DNA gyrase inhibitor YacG
3314 JUTK01000104.1 GCA001067255_01660 CDS open 16169-16789 _na     206_aa coaE dephospho-CoA kinase
3315 JUTK01000104.1 GCA001067255_01661 CDS open 16789-17676 _na     295_aa Prepilin leader peptidase/N-methyltransferase
3316 JUTK01000104.1 GCA001067255_01662 CDS open 17678-18919 _na     413_aa gspF Type II secretion system protein GspF domain-containing protein
3317 JUTK01000104.1 GCA001067255_01663 CDS open 18999-20678 _na     559_aa pilB type IV-A pilus assembly ATPase PilB
3318 JUTK01000104.1 GCA001067255_01664 CDS open 21084-24299 _na     1071_aa carB carbamoyl-phosphate synthase large subunit
3319 JUTK01000104.1 GCA001067255_01665 CDS open 24328-25233 _na     301_aa hypothetical protein
3320 JUTK01000104.1 GCA001067255_01666 CDS open 26136-26525 _na     129_aa ycjD DNA (Cytosine-5-)-methyltransferase
3321 JUTK01000104.1 GCA001067255_01667 CDS open 26621-26878 _na     85_aa MtN3/saliva family protein
3322 JUTK01000104.1 GCA001067255_01668 CDS open 27026-28153 _na     375_aa carA carbamoyl phosphate synthase small subunit
3323 JUTK01000104.1 GCA001067255_01669 CDS open 28547-31765 _na     1072_aa pilC PilC family type IV pilus tip adhesin
3324 JUTK01000104.1 GCA001067255_01645 gene open 48-392
3325 JUTK01000104.1 GCA001067255_01646 gene open 438-1775 murD
3326 JUTK01000104.1 GCA001067255_01647 gene open 2019-3515 gatA
3327 JUTK01000104.1 GCA001067255_01648 gene open 3789-5051 ftsW
3328 JUTK01000104.1 GCA001067255_01649 gene open 5056-6123 murG
3329 JUTK01000104.1 GCA001067255_01650 gene open 6258-7085 yktD
3330 JUTK01000104.1 GCA001067255_01651 gene open 7351-8760 murC
3331 JUTK01000104.1 GCA001067255_01652 gene open 8848-9762 ddl
3332 JUTK01000104.1 GCA001067255_01653 gene open 9752-10471 ftsQ
3333 JUTK01000104.1 GCA001067255_01654 gene open 10546-11799 ftsA
3334 JUTK01000104.1 GCA001067255_01655 gene open 12052-13251 ftsZ
3335 JUTK01000104.1 GCA001067255_01656 gene open 13372-14340 ispH
3336 JUTK01000104.1 GCA001067255_01657 gene open 14354-14860 lspA
3337 JUTK01000104.1 GCA001067255_01658 gene open 15009-15908 glyQ
3338 JUTK01000104.1 GCA001067255_01659 gene open 15990-16172 yacG
3339 JUTK01000104.1 GCA001067255_01660 gene open 16169-16789 coaE
3340 JUTK01000104.1 GCA001067255_01661 gene open 16789-17676
3341 JUTK01000104.1 GCA001067255_01662 gene open 17678-18919 gspF
3342 JUTK01000104.1 GCA001067255_01663 gene open 18999-20678 pilB
3343 JUTK01000104.1 GCA001067255_01664 gene open 21084-24299 carB
3344 JUTK01000104.1 GCA001067255_01665 gene open 24328-25233
3345 JUTK01000104.1 GCA001067255_01666 gene open 26136-26525 ycjD
3346 JUTK01000104.1 GCA001067255_01667 gene open 26621-26878
3347 JUTK01000104.1 GCA001067255_01668 gene open 27026-28153 carA
3348 JUTK01000104.1 GCA001067255_01669 gene open 28547-31765 pilC
3349 JUTK01000105.1 GCA001067255_01670 CDS open 440-1459 _na     339_aa virB11 P-type DNA transfer ATPase VirB11
3350 JUTK01000105.1 GCA001067255_01671 CDS open 1543-3255 _na     570_aa calcium-binding protein
3351 JUTK01000105.1 GCA001067255_01672 CDS open 3274-3915 _na     213_aa Lipoprotein
3352 JUTK01000105.1 GCA001067255_01673 CDS open 3979-5670 _na     563_aa TRAG family protein
3353 JUTK01000105.1 GCA001067255_01674 CDS open 6002-7150 _na     382_aa TrbI/VirB10 family protein
3354 JUTK01000105.1 GCA001067255_01675 CDS open 7153-7878 _na     241_aa TrbG/VirB9 family P-type conjugative transfer protein
3355 JUTK01000105.1 GCA001067255_01676 CDS open 7881-8774 _na     297_aa virB8 VirB8 protein
3356 JUTK01000105.1 GCA001067255_01677 CDS open 8786-9250 _na     154_aa hypothetical protein
3357 JUTK01000105.1 GCA001067255_01678 CDS open 9418-10056 _na     212_aa lytic transglycosylase domain-containing protein
3358 JUTK01000105.1 GCA001067255_01679 CDS open 10109-10498 _na     129_aa virB2 VirB2 protein
3359 JUTK01000105.1 GCA001067255_01680 CDS open 10607-10813 _na     68_aa hypothetical protein
3360 JUTK01000105.1 GCA001067255_01681 CDS open 10876-13326 _na     816_aa virB4 Type IV secretion system protein virB4
3361 JUTK01000105.1 GCA001067255_01682 CDS open 13553-14230 _na     225_aa hypothetical protein
3362 JUTK01000105.1 GCA001067255_01670 gene open 440-1459 virB11
3363 JUTK01000105.1 GCA001067255_01671 gene open 1543-3255
3364 JUTK01000105.1 GCA001067255_01672 gene open 3274-3915
3365 JUTK01000105.1 GCA001067255_01673 gene open 3979-5670
3366 JUTK01000105.1 GCA001067255_01674 gene open 6002-7150
3367 JUTK01000105.1 GCA001067255_01675 gene open 7153-7878
3368 JUTK01000105.1 GCA001067255_01676 gene open 7881-8774 virB8
3369 JUTK01000105.1 GCA001067255_01677 gene open 8786-9250
3370 JUTK01000105.1 GCA001067255_01678 gene open 9418-10056
3371 JUTK01000105.1 GCA001067255_01679 gene open 10109-10498 virB2
3372 JUTK01000105.1 GCA001067255_01680 gene open 10607-10813
3373 JUTK01000105.1 GCA001067255_01681 gene open 10876-13326 virB4
3374 JUTK01000105.1 GCA001067255_01682 gene open 13553-14230
3375 JUTK01000106.1 GCA001067255_01683 CDS open 51-671 _na     206_aa tsaC L-threonylcarbamoyladenylate synthase
3376 JUTK01000106.1 GCA001067255_01684 CDS open 890-1894 _na     334_aa dusA tRNA dihydrouridine(20/20a) synthase DusA
3377 JUTK01000106.1 GCA001067255_01685 CDS open 2134-2793 _na     219_aa nhhA Autotransporter adhesin NhhA
3378 JUTK01000106.1 GCA001067255_01683 gene open 51-671 tsaC
3379 JUTK01000106.1 GCA001067255_01684 gene open 890-1894 dusA
3380 JUTK01000106.1 GCA001067255_01685 gene open 2134-2793 nhhA
3381 JUTK01000107.1 GCA001067255_01686 CDS open 260-1054 _na     264_aa speE polyamine aminopropyltransferase
3382 JUTK01000107.1 GCA001067255_01687 CDS open 1096-1734 _na     212_aa AB hydrolase-1 domain-containing protein
3383 JUTK01000107.1 GCA001067255_01688 CDS open 1864-2400 _na     178_aa GDP-mannose pyrophosphatase
3384 JUTK01000107.1 GCA001067255_01689 CDS open 2476-2826 _na     116_aa folB dihydroneopterin aldolase
3385 JUTK01000107.1 GCA001067255_01690 CDS open 2884-3495 _na     203_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
3386 JUTK01000107.1 GCA001067255_01691 CDS open 3583-4074 _na     163_aa greB transcription elongation factor GreB
3387 JUTK01000107.1 GCA001067255_01692 CDS open 4149-5696 _na     515_aa purF amidophosphoribosyltransferase
3388 JUTK01000107.1 GCA001067255_01693 CDS open 5849-6382 _na     177_aa cvpA CvpA family protein
3389 JUTK01000107.1 GCA001067255_01694 CDS open 6375-7523 _na     382_aa ftsN Cell division protein FtsN
3390 JUTK01000107.1 GCA001067255_01695 CDS open 7537-8820 _na     427_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
3391 JUTK01000107.1 GCA001067255_01696 CDS open 8859-9311 _na     150_aa ygfX protein YgfX
3392 JUTK01000107.1 GCA001067255_01697 CDS open 9316-9675 _na     119_aa VacJ-like protein
3393 JUTK01000107.1 GCA001067255_01698 CDS open 9740-10468 _na     242_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
3394 JUTK01000107.1 GCA001067255_01699 CDS open 10468-10791 _na     107_aa hypothetical protein
3395 JUTK01000107.1 GCA001067255_01700 CDS open 10799-11578 _na     259_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
3396 JUTK01000107.1 GCA001067255_01701 CDS open 11667-12266 _na     199_aa dTTP/UTP pyrophosphatase
3397 JUTK01000107.1 GCA001067255_01702 CDS open 12281-12820 _na     179_aa Gamma carbonic anhydrase family protein
3398 JUTK01000107.1 GCA001067255_01703 CDS open 12989-13111 _na     40_aa hypothetical protein
3399 JUTK01000107.1 GCA001067255_01686 gene open 260-1054 speE
3400 JUTK01000107.1 GCA001067255_01687 gene open 1096-1734
3401 JUTK01000107.1 GCA001067255_01688 gene open 1864-2400
3402 JUTK01000107.1 GCA001067255_01689 gene open 2476-2826 folB
3403 JUTK01000107.1 GCA001067255_01690 gene open 2884-3495 plsY
3404 JUTK01000107.1 GCA001067255_01691 gene open 3583-4074 greB
3405 JUTK01000107.1 GCA001067255_01692 gene open 4149-5696 purF
3406 JUTK01000107.1 GCA001067255_01693 gene open 5849-6382 cvpA
3407 JUTK01000107.1 GCA001067255_01694 gene open 6375-7523 ftsN
3408 JUTK01000107.1 GCA001067255_01695 gene open 7537-8820 folC
3409 JUTK01000107.1 GCA001067255_01696 gene open 8859-9311 ygfX
3410 JUTK01000107.1 GCA001067255_01697 gene open 9316-9675
3411 JUTK01000107.1 GCA001067255_01698 gene open 9740-10468 glnQ
3412 JUTK01000107.1 GCA001067255_01699 gene open 10468-10791
3413 JUTK01000107.1 GCA001067255_01700 gene open 10799-11578 rsmA
3414 JUTK01000107.1 GCA001067255_01701 gene open 11667-12266
3415 JUTK01000107.1 GCA001067255_01702 gene open 12281-12820
3416 JUTK01000107.1 GCA001067255_01703 gene open 12989-13111
3417 JUTK01000108.1 repeat_region open 1-594 CRISPR array with 9 repeats of length 36%2C consensus sequence ATTGTAGCACTGCGAAATGAGAAAGGGAGCTACAAC and spacer length 30
3418 JUTK01000108.1 GCA001067255_01704 CDS open 677-1051 _na     124_aa rplQ 50S ribosomal protein L17
3419 JUTK01000108.1 GCA001067255_01705 CDS open 1076-2062 _na     328_aa rpoA DNA-directed RNA polymerase subunit alpha
3420 JUTK01000108.1 GCA001067255_01706 CDS open 2088-2708 _na     206_aa rpsD 30S ribosomal protein S4
3421 JUTK01000108.1 GCA001067255_01707 CDS open 2728-3123 _na     131_aa rpsK 30S ribosomal protein S11
3422 JUTK01000108.1 GCA001067255_01708 CDS open 3143-3505 _na     120_aa rpsM 30S ribosomal protein S13
3423 JUTK01000108.1 GCA001067255_01709 CDS open 3705-3923 _na     72_aa infA translation initiation factor IF-1
3424 JUTK01000108.1 GCA001067255_01710 CDS open 3928-5055 _na     375_aa secY preprotein translocase subunit SecY
3425 JUTK01000108.1 GCA001067255_01711 CDS open 5255-5689 _na     144_aa rplO 50S ribosomal protein L15
3426 JUTK01000108.1 GCA001067255_01712 CDS open 5691-5876 _na     61_aa rpmD 50S ribosomal protein L30
3427 JUTK01000108.1 GCA001067255_01713 CDS open 5869-6387 _na     172_aa rpsE 30S ribosomal protein S5
3428 JUTK01000108.1 GCA001067255_01714 CDS open 6405-6758 _na     117_aa rplR 50S ribosomal protein L18
3429 JUTK01000108.1 GCA001067255_01715 CDS open 6772-7305 _na     177_aa rplF 50S ribosomal protein L6
3430 JUTK01000108.1 GCA001067255_01716 CDS open 7319-7711 _na     130_aa rpsH 30S ribosomal protein S8
3431 JUTK01000108.1 GCA001067255_01717 CDS open 7726-8031 _na     101_aa rpsN 30S ribosomal protein S14
3432 JUTK01000108.1 GCA001067255_01718 CDS open 8034-8573 _na     179_aa rplE 50S ribosomal protein L5
3433 JUTK01000108.1 GCA001067255_01719 CDS open 8583-8906 _na     107_aa rplX 50S ribosomal protein L24
3434 JUTK01000108.1 GCA001067255_01720 CDS open 8918-9286 _na     122_aa rplN 50S ribosomal protein L14
3435 JUTK01000108.1 GCA001067255_01721 CDS open 9514-9777 _na     87_aa rpsQ 30S ribosomal protein S17
3436 JUTK01000108.1 GCA001067255_01722 CDS open 9777-9968 _na     63_aa rpmC 50S ribosomal protein L29
3437 JUTK01000108.1 GCA001067255_01723 CDS open 9968-10384 _na     138_aa rplP 50S ribosomal protein L16
3438 JUTK01000108.1 GCA001067255_01724 CDS open 10368-11060 _na     230_aa rpsC 30S ribosomal protein S3
3439 JUTK01000108.1 GCA001067255_01725 CDS open 11070-11399 _na     109_aa rplV 50S ribosomal protein L22
3440 JUTK01000108.1 GCA001067255_01726 CDS open 11408-11686 _na     92_aa rpsS 30S ribosomal protein S19
3441 JUTK01000108.1 GCA001067255_01727 CDS open 11692-12525 _na     277_aa rplB 50S ribosomal protein L2
3442 JUTK01000108.1 GCA001067255_01728 CDS open 12531-12845 _na     104_aa rplW 50S ribosomal protein L23
3443 JUTK01000108.1 GCA001067255_01729 CDS open 12842-13462 _na     206_aa rplD 50S ribosomal protein L4
3444 JUTK01000108.1 GCA001067255_01730 CDS open 13462-14106 _na     214_aa rplC 50S ribosomal protein L3
3445 JUTK01000108.1 GCA001067255_01731 CDS open 14357-14668 _na     103_aa Small ribosomal subunit protein uS10
3446 JUTK01000108.1 GCA001067255_01704 gene open 677-1051 rplQ
3447 JUTK01000108.1 GCA001067255_01705 gene open 1076-2062 rpoA
3448 JUTK01000108.1 GCA001067255_01706 gene open 2088-2708 rpsD
3449 JUTK01000108.1 GCA001067255_01707 gene open 2728-3123 rpsK
3450 JUTK01000108.1 GCA001067255_01708 gene open 3143-3505 rpsM
3451 JUTK01000108.1 GCA001067255_01709 gene open 3705-3923 infA
3452 JUTK01000108.1 GCA001067255_01710 gene open 3928-5055 secY
3453 JUTK01000108.1 GCA001067255_01711 gene open 5255-5689 rplO
3454 JUTK01000108.1 GCA001067255_01712 gene open 5691-5876 rpmD
3455 JUTK01000108.1 GCA001067255_01713 gene open 5869-6387 rpsE
3456 JUTK01000108.1 GCA001067255_01714 gene open 6405-6758 rplR
3457 JUTK01000108.1 GCA001067255_01715 gene open 6772-7305 rplF
3458 JUTK01000108.1 GCA001067255_01716 gene open 7319-7711 rpsH
3459 JUTK01000108.1 GCA001067255_01717 gene open 7726-8031 rpsN
3460 JUTK01000108.1 GCA001067255_01718 gene open 8034-8573 rplE
3461 JUTK01000108.1 GCA001067255_01719 gene open 8583-8906 rplX
3462 JUTK01000108.1 GCA001067255_01720 gene open 8918-9286 rplN
3463 JUTK01000108.1 GCA001067255_01721 gene open 9514-9777 rpsQ
3464 JUTK01000108.1 GCA001067255_01722 gene open 9777-9968 rpmC
3465 JUTK01000108.1 GCA001067255_01723 gene open 9968-10384 rplP
3466 JUTK01000108.1 GCA001067255_01724 gene open 10368-11060 rpsC
3467 JUTK01000108.1 GCA001067255_01725 gene open 11070-11399 rplV
3468 JUTK01000108.1 GCA001067255_01726 gene open 11408-11686 rpsS
3469 JUTK01000108.1 GCA001067255_01727 gene open 11692-12525 rplB
3470 JUTK01000108.1 GCA001067255_01728 gene open 12531-12845 rplW
3471 JUTK01000108.1 GCA001067255_01729 gene open 12842-13462 rplD
3472 JUTK01000108.1 GCA001067255_01730 gene open 13462-14106 rplC
3473 JUTK01000108.1 GCA001067255_01731 gene open 14357-14668
3474 JUTK01000110.1 GCA001067255_01732 CDS open 788-1087 _na     99_aa hypothetical protein
3475 JUTK01000110.1 GCA001067255_01733 CDS open 1108-2160 _na     350_aa hypothetical protein
3476 JUTK01000110.1 GCA001067255_01734 CDS open 2157-4517 _na     786_aa Calcium-binding protein
3477 JUTK01000110.1 GCA001067255_01732 gene open 788-1087
3478 JUTK01000110.1 GCA001067255_01733 gene open 1108-2160
3479 JUTK01000110.1 GCA001067255_01734 gene open 2157-4517
3480 JUTK01000111.1 GCA001067255_01735 CDS open 130-651 _na     173_aa ABC transporter%2C ATP-binding protein
3481 JUTK01000111.1 GCA001067255_01736 CDS open 1098-2144 _na     348_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
3482 JUTK01000111.1 GCA001067255_01737 CDS open 2221-2496 _na     91_aa Secreted protein
3483 JUTK01000111.1 GCA001067255_01738 CDS open 2758-3444 _na     228_aa prtR HTH-type transcriptional regulator PrtR
3484 JUTK01000111.1 GCA001067255_01739 CDS open 3577-3915 _na     112_aa erpA iron-sulfur cluster insertion protein ErpA
3485 JUTK01000111.1 GCA001067255_01740 CDS open 4246-4920 _na     224_aa Zinc ribbon domain-containing protein
3486 JUTK01000111.1 GCA001067255_01741 CDS open 5001-7169 _na     722_aa priA primosomal protein N'
3487 JUTK01000111.1 GCA001067255_01742 CDS open 7272-8096 _na     274_aa Thiol:disulfide interchange protein
3488 JUTK01000111.1 GCA001067255_01743 CDS open 8232-8915 _na     227_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
3489 JUTK01000111.1 GCA001067255_01744 CDS open 9018-9770 _na     250_aa Ribosomal RNA small subunit methyltransferase J
3490 JUTK01000111.1 GCA001067255_01745 CDS open 9819-11447 _na     542_aa Sigma-54 interaction domain protein
3491 JUTK01000111.1 GCA001067255_01746 CDS open 11440-13026 _na     528_aa histidine kinase
3492 JUTK01000111.1 GCA001067255_01747 CDS open 13096-15399 _na     767_aa parC DNA topoisomerase IV subunit A
3493 JUTK01000111.1 GCA001067255_01748 CDS open 15608-16057 _na     149_aa SLC45 family MFS transporter
3494 JUTK01000111.1 GCA001067255_01749 CDS open 16172-16609 _na     145_aa MFS transporter
3495 JUTK01000111.1 GCA001067255_01750 CDS open 16572-16931 _na     119_aa hypothetical protein
3496 JUTK01000111.1 GCA001067255_01751 CDS open 17129-18172 _na     347_aa Ribose operon repressor
3497 JUTK01000111.1 GCA001067255_01752 CDS open 18424-20064 _na     546_aa pgi glucose-6-phosphate isomerase
3498 JUTK01000111.1 GCA001067255_01753 CDS open 20236-20733 _na     165_aa ftnA non-heme ferritin
3499 JUTK01000111.1 GCA001067255_01754 CDS open 20750-21235 _na     161_aa ftnA non-heme ferritin
3500 JUTK01000111.1 GCA001067255_01755 CDS open 22147-22320 _na     57_aa hypothetical protein