HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_001067535.1)

Select a Genome:
BAKTA Annotations for GCA_001067535.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
65 2231564 2118 3 1 43
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4359 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4359 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 JURA01000025.1 GCA001067535_00587 gene open 44133-44468
1502 JURA01000025.1 GCA001067535_00588 gene open 44900-46291 rhlE
1503 JURA01000025.1 GCA001067535_00589 gene open 46463-49048 acnB
1504 JURA01000025.1 GCA001067535_00590 gene open 49249-50286 ypdA
1505 JURA01000025.1 GCA001067535_00591 gene open 50379-51758 argH
1506 JURA01000025.1 GCA001067535_00592 gene open 51927-52451
1507 JURA01000025.1 GCA001067535_00593 gene open 52502-53890 fumC
1508 JURA01000025.1 GCA001067535_00594 gene open 54200-56119
1509 JURA01000025.1 GCA001067535_00595 gene open 56177-57154 tauA
1510 JURA01000025.1 GCA001067535_00596 gene open 57390-58187 tauC
1511 JURA01000025.1 GCA001067535_00597 gene open 58187-58879
1512 JURA01000026.1 GCA001067535_00598 CDS open 340-606 _na     88_aa MtN3/saliva family protein
1513 JURA01000026.1 GCA001067535_00599 CDS open 756-2213 _na     485_aa mgtE magnesium transporter
1514 JURA01000026.1 GCA001067535_00600 CDS open 2459-3352 _na     297_aa HTH lysR-type domain-containing protein
1515 JURA01000026.1 GCA001067535_00601 CDS open 3394-3840 _na     148_aa lrgA LrgA family protein
1516 JURA01000026.1 GCA001067535_00602 CDS open 3856-4551 _na     231_aa lrgB Murein hydrolase effector protein LrgB
1517 JURA01000026.1 GCA001067535_00603 CDS open 4632-5174 _na     180_aa hypothetical protein
1518 JURA01000026.1 GCA001067535_00604 CDS open 5484-5576 _na     30_aa Methionine/alanine import family NSS transporter small subunit
1519 JURA01000026.1 GCA001067535_00605 CDS open 5576-7111 _na     511_aa Transporter
1520 JURA01000026.1 GCA001067535_00606 CDS open 7892-8920 _na     342_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1521 JURA01000026.1 GCA001067535_00607 CDS open 9021-11228 _na     735_aa uvrD DNA helicase II
1522 JURA01000026.1 GCA001067535_00608 CDS open 11484-11708 _na     74_aa hypothetical protein
1523 JURA01000026.1 GCA001067535_00609 CDS open 11757-11960 _na     67_aa Restriction endonuclease
1524 JURA01000026.1 GCA001067535_00610 CDS open 11957-12229 _na     90_aa DNA-binding helix-turn-helix protein
1525 JURA01000026.1 GCA001067535_00611 CDS open 12276-13388 _na     370_aa dndC DNA phosphorothioation system sulfurtransferase DndC
1526 JURA01000026.1 GCA001067535_00612 CDS open 13385-13609 _na     74_aa Glutamyl-tRNA reductase
1527 JURA01000026.1 GCA001067535_00613 CDS open 13611-15665 _na     684_aa dndD DNA sulfur modification protein DndD
1528 JURA01000026.1 GCA001067535_00614 CDS open 15677-17272 _na     531_aa FtsK/SpoIIIE family protein
1529 JURA01000026.1 GCA001067535_00615 CDS open 17359-20646 _na     1095_aa DUF2339 domain-containing protein
1530 JURA01000026.1 GCA001067535_00616 CDS open 20894-21388 _na     164_aa pduO PduO protein
1531 JURA01000026.1 GCA001067535_00617 CDS open 21660-22742 _na     360_aa hypothetical protein
1532 JURA01000026.1 GCA001067535_00618 CDS open 22785-25580 _na     931_aa polA DNA polymerase I
1533 JURA01000026.1 GCA001067535_00619 CDS open 25762-26262 _na     166_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1534 JURA01000026.1 GCA001067535_00620 CDS open 26304-27080 _na     258_aa Molybdenum metabolism regulator
1535 JURA01000026.1 GCA001067535_00621 CDS open 27138-27806 _na     222_aa pspA PspA/IM30 family protein
1536 JURA01000026.1 GCA001067535_00622 CDS open 28021-28686 _na     221_aa yqiJ YqiJ family protein
1537 JURA01000026.1 GCA001067535_00623 CDS open 28898-30610 _na     570_aa yqiK Band 7 domain-containing protein
1538 JURA01000026.1 GCA001067535_00624 CDS open 30981-31406 _na     141_aa F0F1 ATP synthase subunit epsilon
1539 JURA01000026.1 GCA001067535_00625 CDS open 31417-32814 _na     465_aa atpD F0F1 ATP synthase subunit beta
1540 JURA01000026.1 GCA001067535_00626 CDS open 32853-33728 _na     291_aa atpG F0F1 ATP synthase subunit gamma
1541 JURA01000026.1 GCA001067535_00627 CDS open 33753-35300 _na     515_aa atpA F0F1 ATP synthase subunit alpha
1542 JURA01000026.1 GCA001067535_00628 CDS open 35311-35844 _na     177_aa F0F1 ATP synthase subunit delta
1543 JURA01000026.1 GCA001067535_00629 CDS open 35849-36319 _na     156_aa atpF F0F1 ATP synthase subunit B
1544 JURA01000026.1 GCA001067535_00630 CDS open 36393-36629 _na     78_aa atpE F0F1 ATP synthase subunit C
1545 JURA01000026.1 GCA001067535_00631 CDS open 36694-37545 _na     283_aa atpB F0F1 ATP synthase subunit A
1546 JURA01000026.1 GCA001067535_00632 CDS open 37542-38048 _na     168_aa hypothetical protein
1547 JURA01000026.1 GCA001067535_00633 CDS open 38184-39044 _na     286_aa parB Chromosome-partitioning protein ParB
1548 JURA01000026.1 GCA001067535_00634 CDS open 39146-40930 _na     594_aa Aminodeoxychorismate synthase component 1
1549 JURA01000026.1 GCA001067535_00635 CDS open 41097-42026 _na     309_aa ppk2 polyphosphate kinase 2
1550 JURA01000026.1 GCA001067535_00636 CDS open 42078-42512 _na     144_aa Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein
1551 JURA01000026.1 GCA001067535_00637 CDS open 42567-43124 _na     185_aa ubiX Flavin prenyltransferase UbiX
1552 JURA01000026.1 GCA001067535_00639 CDS open 43316-43675 _na     119_aa secG preprotein translocase subunit SecG
1553 JURA01000026.1 GCA001067535_00640 CDS open 43683-44456 _na     257_aa tpiA triose-phosphate isomerase
1554 JURA01000026.1 GCA001067535_00641 CDS open 44639-45295 _na     218_aa Protein-L-isoaspartate O-methyltransferase
1555 JURA01000026.1 GCA001067535_00642 CDS open 45348-45677 _na     109_aa Rhodanese domain-containing protein
1556 JURA01000026.1 GCA001067535_00643 CDS open 45744-47174 _na     476_aa Transporter%2C basic amino acid/polyamine antiporter (APA) family
1557 JURA01000026.1 GCA001067535_00644 CDS open 47273-48160 _na     295_aa Homocysteine S-methyltransferase
1558 JURA01000026.1 GCA001067535_00645 CDS open 48302-48994 _na     230_aa Tat pathway signal sequence domain protein
1559 JURA01000026.1 GCA001067535_00646 CDS open 49176-50498 _na     440_aa fabF beta-ketoacyl-ACP synthase II
1560 JURA01000026.1 GCA001067535_00647 CDS open 50585-50821 _na     78_aa acpP acyl carrier protein
1561 JURA01000026.1 GCA001067535_00598 gene open 340-606
1562 JURA01000026.1 GCA001067535_00599 gene open 756-2213 mgtE
1563 JURA01000026.1 GCA001067535_00600 gene open 2459-3352
1564 JURA01000026.1 GCA001067535_00601 gene open 3394-3840 lrgA
1565 JURA01000026.1 GCA001067535_00602 gene open 3856-4551 lrgB
1566 JURA01000026.1 GCA001067535_00603 gene open 4632-5174
1567 JURA01000026.1 GCA001067535_00604 gene open 5484-5576
1568 JURA01000026.1 GCA001067535_00605 gene open 5576-7111
1569 JURA01000026.1 GCA001067535_00606 gene open 7892-8920 gap
1570 JURA01000026.1 GCA001067535_00607 gene open 9021-11228 uvrD
1571 JURA01000026.1 GCA001067535_00608 gene open 11484-11708
1572 JURA01000026.1 GCA001067535_00609 gene open 11757-11960
1573 JURA01000026.1 GCA001067535_00610 gene open 11957-12229
1574 JURA01000026.1 GCA001067535_00611 gene open 12276-13388 dndC
1575 JURA01000026.1 GCA001067535_00612 gene open 13385-13609
1576 JURA01000026.1 GCA001067535_00613 gene open 13611-15665 dndD
1577 JURA01000026.1 GCA001067535_00614 gene open 15677-17272
1578 JURA01000026.1 GCA001067535_00615 gene open 17359-20646
1579 JURA01000026.1 GCA001067535_00616 gene open 20894-21388 pduO
1580 JURA01000026.1 GCA001067535_00617 gene open 21660-22742
1581 JURA01000026.1 GCA001067535_00618 gene open 22785-25580 polA
1582 JURA01000026.1 GCA001067535_00619 gene open 25762-26262
1583 JURA01000026.1 GCA001067535_00620 gene open 26304-27080
1584 JURA01000026.1 GCA001067535_00621 gene open 27138-27806 pspA
1585 JURA01000026.1 GCA001067535_00622 gene open 28021-28686 yqiJ
1586 JURA01000026.1 GCA001067535_00623 gene open 28898-30610 yqiK
1587 JURA01000026.1 GCA001067535_00624 gene open 30981-31406
1588 JURA01000026.1 GCA001067535_00625 gene open 31417-32814 atpD
1589 JURA01000026.1 GCA001067535_00626 gene open 32853-33728 atpG
1590 JURA01000026.1 GCA001067535_00627 gene open 33753-35300 atpA
1591 JURA01000026.1 GCA001067535_00628 gene open 35311-35844
1592 JURA01000026.1 GCA001067535_00629 gene open 35849-36319 atpF
1593 JURA01000026.1 GCA001067535_00630 gene open 36393-36629 atpE
1594 JURA01000026.1 GCA001067535_00631 gene open 36694-37545 atpB
1595 JURA01000026.1 GCA001067535_00632 gene open 37542-38048
1596 JURA01000026.1 GCA001067535_00633 gene open 38184-39044 parB
1597 JURA01000026.1 GCA001067535_00634 gene open 39146-40930
1598 JURA01000026.1 GCA001067535_00635 gene open 41097-42026 ppk2
1599 JURA01000026.1 GCA001067535_00636 gene open 42078-42512
1600 JURA01000026.1 GCA001067535_00637 gene open 42567-43124 ubiX
1601 JURA01000026.1 GCA001067535_00639 gene open 43316-43675 secG
1602 JURA01000026.1 GCA001067535_00640 gene open 43683-44456 tpiA
1603 JURA01000026.1 GCA001067535_00641 gene open 44639-45295
1604 JURA01000026.1 GCA001067535_00642 gene open 45348-45677
1605 JURA01000026.1 GCA001067535_00643 gene open 45744-47174
1606 JURA01000026.1 GCA001067535_00644 gene open 47273-48160
1607 JURA01000026.1 GCA001067535_00645 gene open 48302-48994
1608 JURA01000026.1 GCA001067535_00646 gene open 49176-50498 fabF
1609 JURA01000026.1 GCA001067535_00647 gene open 50585-50821 acpP
1610 JURA01000026.1 GCA001067535_00638 gene open 43215-43300 trnL
1611 JURA01000026.1 GCA001067535_00638 tRNA open 43215-43300 trnL tRNA-Leu(gag)
1612 JURA01000027.1 GCA001067535_00648 CDS open 223-2208 _na     661_aa parE DNA topoisomerase IV subunit B
1613 JURA01000027.1 GCA001067535_00649 CDS open 2277-2813 _na     178_aa RNA pyrophosphohydrolase
1614 JURA01000027.1 GCA001067535_00650 CDS open 3142-4287 _na     381_aa Putrescine-binding periplasmic protein
1615 JURA01000027.1 GCA001067535_00651 CDS open 4389-4661 _na     90_aa aCT ACT domain-containing protein
1616 JURA01000027.1 GCA001067535_00652 CDS open 4677-6032 _na     451_aa UPF0210 protein NMA1908
1617 JURA01000027.1 GCA001067535_00653 CDS open 6081-6581 _na     166_aa glycosyltransferase family 9 protein
1618 JURA01000027.1 GCA001067535_00654 CDS open 6790-7278 _na     162_aa Acetyltransferase%2C GNAT family
1619 JURA01000027.1 GCA001067535_00655 CDS open 7409-8938 _na     509_aa cedB AAA+ ATPase domain-containing protein
1620 JURA01000027.1 GCA001067535_00656 CDS open 9180-10409 _na     409_aa Bcr/CflA family efflux transporter
1621 JURA01000027.1 GCA001067535_00657 CDS open 10471-11280 _na     269_aa murI glutamate racemase
1622 JURA01000027.1 GCA001067535_00658 CDS open 11352-11891 _na     179_aa hypothetical protein
1623 JURA01000027.1 GCA001067535_00659 CDS open 12041-12811 _na     256_aa xth exodeoxyribonuclease III
1624 JURA01000027.1 GCA001067535_00660 CDS open 12979-13257 _na     92_aa arsR Transcriptional regulator%2C ArsR family
1625 JURA01000027.1 GCA001067535_00661 CDS open 13674-15455 _na     593_aa ABC transporter%2C substrate-binding protein%2C family 5
1626 JURA01000027.1 GCA001067535_00662 CDS open 15555-16757 _na     400_aa UPF0761 membrane protein HMPREF2560_01870
1627 JURA01000027.1 GCA001067535_00663 CDS open 16856-17461 _na     201_aa wrbA NAD(P)H:quinone oxidoreductase
1628 JURA01000027.1 GCA001067535_00648 gene open 223-2208 parE
1629 JURA01000027.1 GCA001067535_00649 gene open 2277-2813
1630 JURA01000027.1 GCA001067535_00650 gene open 3142-4287
1631 JURA01000027.1 GCA001067535_00651 gene open 4389-4661 aCT
1632 JURA01000027.1 GCA001067535_00652 gene open 4677-6032
1633 JURA01000027.1 GCA001067535_00653 gene open 6081-6581
1634 JURA01000027.1 GCA001067535_00654 gene open 6790-7278
1635 JURA01000027.1 GCA001067535_00655 gene open 7409-8938 cedB
1636 JURA01000027.1 GCA001067535_00656 gene open 9180-10409
1637 JURA01000027.1 GCA001067535_00657 gene open 10471-11280 murI
1638 JURA01000027.1 GCA001067535_00658 gene open 11352-11891
1639 JURA01000027.1 GCA001067535_00659 gene open 12041-12811 xth
1640 JURA01000027.1 GCA001067535_00660 gene open 12979-13257 arsR
1641 JURA01000027.1 GCA001067535_00661 gene open 13674-15455
1642 JURA01000027.1 GCA001067535_00662 gene open 15555-16757
1643 JURA01000027.1 GCA001067535_00663 gene open 16856-17461 wrbA
1644 JURA01000028.1 GCA001067535_00664 CDS open 311-511 _na     66_aa hypothetical protein
1645 JURA01000028.1 GCA001067535_00664 gene open 311-511
1646 JURA01000029.1 GCA001067535_00665 CDS open 570-1616 _na     348_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
1647 JURA01000029.1 GCA001067535_00666 CDS open 1697-1972 _na     91_aa Secreted protein
1648 JURA01000029.1 GCA001067535_00667 CDS open 2234-2920 _na     228_aa prtR HTH-type transcriptional regulator PrtR
1649 JURA01000029.1 GCA001067535_00668 CDS open 3053-3391 _na     112_aa erpA iron-sulfur cluster insertion protein ErpA
1650 JURA01000029.1 GCA001067535_00669 CDS open 3726-4400 _na     224_aa Zinc ribbon domain-containing protein
1651 JURA01000029.1 GCA001067535_00670 CDS open 4481-6670 _na     729_aa priA primosomal protein N'
1652 JURA01000029.1 GCA001067535_00671 CDS open 6773-7597 _na     274_aa Thiol:disulfide interchange protein
1653 JURA01000029.1 GCA001067535_00672 CDS open 7735-8418 _na     227_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
1654 JURA01000029.1 GCA001067535_00673 CDS open 8521-9273 _na     250_aa Ribosomal RNA small subunit methyltransferase J
1655 JURA01000029.1 GCA001067535_00674 CDS open 9322-10947 _na     541_aa Sigma-54 interaction domain protein
1656 JURA01000029.1 GCA001067535_00675 CDS open 10940-12526 _na     528_aa histidine kinase
1657 JURA01000029.1 GCA001067535_00676 CDS open 12597-14900 _na     767_aa parC DNA topoisomerase IV subunit A
1658 JURA01000029.1 GCA001067535_00677 CDS open 15110-16432 _na     440_aa Transporter%2C major facilitator family protein
1659 JURA01000029.1 GCA001067535_00678 CDS open 16629-17672 _na     347_aa Ribose operon repressor
1660 JURA01000029.1 GCA001067535_00679 CDS open 17930-19570 _na     546_aa pgi glucose-6-phosphate isomerase
1661 JURA01000029.1 GCA001067535_00680 CDS open 19776-21065 _na     429_aa ampG AmpG family muropeptide MFS transporter
1662 JURA01000029.1 GCA001067535_00681 CDS open 21127-21441 _na     104_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1663 JURA01000029.1 GCA001067535_00682 CDS open 21491-22846 _na     451_aa rpoN RNA polymerase factor sigma-54
1664 JURA01000029.1 GCA001067535_00683 CDS open 23012-23746 _na     244_aa lptB LPS export ABC transporter ATP-binding protein
1665 JURA01000029.1 GCA001067535_00684 CDS open 23817-24347 _na     176_aa lptA lipopolysaccharide transport periplasmic protein LptA
1666 JURA01000029.1 GCA001067535_00685 CDS open 24328-24909 _na     193_aa lptC LPS export ABC transporter periplasmic protein LptC
1667 JURA01000029.1 GCA001067535_00686 CDS open 24906-25442 _na     178_aa 3-deoxy-manno-octulosonate-8-phosphatase
1668 JURA01000029.1 GCA001067535_00687 CDS open 25509-26483 _na     324_aa Arabinose 5-phosphate isomerase
1669 JURA01000029.1 GCA001067535_00688 CDS open 26618-27673 _na     351_aa tal transaldolase
1670 JURA01000029.1 GCA001067535_00689 CDS open 27828-28715 _na     295_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
1671 JURA01000029.1 GCA001067535_00690 CDS open 28640-28822 _na     60_aa hypothetical protein
1672 JURA01000029.1 GCA001067535_00691 CDS open 28954-29688 _na     244_aa Response regulator receiver domain protein
1673 JURA01000029.1 GCA001067535_00692 CDS open 29960-33430 _na     1156_aa pilC PilC family type IV pilus tip adhesin
1674 JURA01000029.1 GCA001067535_00693 CDS open 33647-34054 _na     135_aa cadR Cd(II)/Pb(II)-responsive transcriptional regulator
1675 JURA01000029.1 GCA001067535_00694 CDS open 34150-35046 _na     298_aa Cation transporter
1676 JURA01000029.1 GCA001067535_00695 CDS open 35050-35562 _na     170_aa lspA signal peptidase II
1677 JURA01000029.1 GCA001067535_00696 CDS open 35584-36873 _na     429_aa ISL3-like element ISPpu12 family transposase
1678 JURA01000029.1 GCA001067535_00697 CDS open 37295-38425 _na     376_aa carA carbamoyl phosphate synthase small subunit
1679 JURA01000029.1 GCA001067535_00698 CDS open 38566-38823 _na     85_aa MtN3/saliva family protein
1680 JURA01000029.1 GCA001067535_00699 CDS open 39111-39683 _na     190_aa DUF1643 domain-containing protein
1681 JURA01000029.1 GCA001067535_00700 CDS open 39725-40435 _na     236_aa hypothetical protein
1682 JURA01000029.1 GCA001067535_00701 CDS open 40550-40894 _na     114_aa hypothetical protein
1683 JURA01000029.1 GCA001067535_00665 gene open 570-1616 argC
1684 JURA01000029.1 GCA001067535_00666 gene open 1697-1972
1685 JURA01000029.1 GCA001067535_00667 gene open 2234-2920 prtR
1686 JURA01000029.1 GCA001067535_00668 gene open 3053-3391 erpA
1687 JURA01000029.1 GCA001067535_00669 gene open 3726-4400
1688 JURA01000029.1 GCA001067535_00670 gene open 4481-6670 priA
1689 JURA01000029.1 GCA001067535_00671 gene open 6773-7597
1690 JURA01000029.1 GCA001067535_00672 gene open 7735-8418 gpmA
1691 JURA01000029.1 GCA001067535_00673 gene open 8521-9273
1692 JURA01000029.1 GCA001067535_00674 gene open 9322-10947
1693 JURA01000029.1 GCA001067535_00675 gene open 10940-12526
1694 JURA01000029.1 GCA001067535_00676 gene open 12597-14900 parC
1695 JURA01000029.1 GCA001067535_00677 gene open 15110-16432
1696 JURA01000029.1 GCA001067535_00678 gene open 16629-17672
1697 JURA01000029.1 GCA001067535_00679 gene open 17930-19570 pgi
1698 JURA01000029.1 GCA001067535_00680 gene open 19776-21065 ampG
1699 JURA01000029.1 GCA001067535_00681 gene open 21127-21441 hpf
1700 JURA01000029.1 GCA001067535_00682 gene open 21491-22846 rpoN
1701 JURA01000029.1 GCA001067535_00683 gene open 23012-23746 lptB
1702 JURA01000029.1 GCA001067535_00684 gene open 23817-24347 lptA
1703 JURA01000029.1 GCA001067535_00685 gene open 24328-24909 lptC
1704 JURA01000029.1 GCA001067535_00686 gene open 24906-25442
1705 JURA01000029.1 GCA001067535_00687 gene open 25509-26483
1706 JURA01000029.1 GCA001067535_00688 gene open 26618-27673 tal
1707 JURA01000029.1 GCA001067535_00689 gene open 27828-28715 gluQRS
1708 JURA01000029.1 GCA001067535_00690 gene open 28640-28822
1709 JURA01000029.1 GCA001067535_00691 gene open 28954-29688
1710 JURA01000029.1 GCA001067535_00692 gene open 29960-33430 pilC
1711 JURA01000029.1 GCA001067535_00693 gene open 33647-34054 cadR
1712 JURA01000029.1 GCA001067535_00694 gene open 34150-35046
1713 JURA01000029.1 GCA001067535_00695 gene open 35050-35562 lspA
1714 JURA01000029.1 GCA001067535_00696 gene open 35584-36873
1715 JURA01000029.1 GCA001067535_00697 gene open 37295-38425 carA
1716 JURA01000029.1 GCA001067535_00698 gene open 38566-38823
1717 JURA01000029.1 GCA001067535_00699 gene open 39111-39683
1718 JURA01000029.1 GCA001067535_00700 gene open 39725-40435
1719 JURA01000029.1 GCA001067535_00701 gene open 40550-40894
1720 JURA01000030.1 GCA001067535_00702 CDS open 34-4908 _na     1624_aa DUF2345 domain-containing protein
1721 JURA01000030.1 GCA001067535_00703 CDS open 4925-6034 _na     369_aa SEL1-like repeat protein
1722 JURA01000030.1 GCA001067535_00704 CDS open 6598-6882 _na     94_aa IS1595 family transposase
1723 JURA01000030.1 GCA001067535_00702 gene open 34-4908
1724 JURA01000030.1 GCA001067535_00703 gene open 4925-6034
1725 JURA01000030.1 GCA001067535_00704 gene open 6598-6882
1726 JURA01000031.1 repeat_region open 14192-14962 CRISPR array with 12 repeats of length 36%2C consensus sequence GTTGTAGCTCCCTTTCTCATTTCGCAGTGCTACAAT and spacer length 30
1727 JURA01000031.1 GCA001067535_00705 CDS open 105-416 _na     103_aa Small ribosomal subunit protein uS10
1728 JURA01000031.1 GCA001067535_00706 CDS open 668-1312 _na     214_aa rplC 50S ribosomal protein L3
1729 JURA01000031.1 GCA001067535_00707 CDS open 1312-1932 _na     206_aa rplD 50S ribosomal protein L4
1730 JURA01000031.1 GCA001067535_00708 CDS open 1929-2243 _na     104_aa rplW 50S ribosomal protein L23
1731 JURA01000031.1 GCA001067535_00709 CDS open 2249-3082 _na     277_aa rplB 50S ribosomal protein L2
1732 JURA01000031.1 GCA001067535_00710 CDS open 3088-3366 _na     92_aa rpsS 30S ribosomal protein S19
1733 JURA01000031.1 GCA001067535_00711 CDS open 3375-3704 _na     109_aa rplV 50S ribosomal protein L22
1734 JURA01000031.1 GCA001067535_00712 CDS open 3714-4406 _na     230_aa rpsC 30S ribosomal protein S3
1735 JURA01000031.1 GCA001067535_00713 CDS open 4390-4806 _na     138_aa rplP 50S ribosomal protein L16
1736 JURA01000031.1 GCA001067535_00714 CDS open 4806-4997 _na     63_aa rpmC 50S ribosomal protein L29
1737 JURA01000031.1 GCA001067535_00715 CDS open 4997-5260 _na     87_aa rpsQ 30S ribosomal protein S17
1738 JURA01000031.1 GCA001067535_00716 CDS open 5488-5856 _na     122_aa rplN 50S ribosomal protein L14
1739 JURA01000031.1 GCA001067535_00717 CDS open 5868-6191 _na     107_aa rplX 50S ribosomal protein L24
1740 JURA01000031.1 GCA001067535_00718 CDS open 6201-6740 _na     179_aa rplE 50S ribosomal protein L5
1741 JURA01000031.1 GCA001067535_00719 CDS open 6743-7048 _na     101_aa rpsN 30S ribosomal protein S14
1742 JURA01000031.1 GCA001067535_00720 CDS open 7063-7455 _na     130_aa rpsH 30S ribosomal protein S8
1743 JURA01000031.1 GCA001067535_00721 CDS open 7469-8002 _na     177_aa rplF 50S ribosomal protein L6
1744 JURA01000031.1 GCA001067535_00722 CDS open 8016-8369 _na     117_aa rplR 50S ribosomal protein L18
1745 JURA01000031.1 GCA001067535_00723 CDS open 8387-8905 _na     172_aa rpsE 30S ribosomal protein S5
1746 JURA01000031.1 GCA001067535_00724 CDS open 8898-9083 _na     61_aa rpmD 50S ribosomal protein L30
1747 JURA01000031.1 GCA001067535_00725 CDS open 9085-9519 _na     144_aa rplO 50S ribosomal protein L15
1748 JURA01000031.1 GCA001067535_00726 CDS open 9719-10837 _na     372_aa secY preprotein translocase subunit SecY
1749 JURA01000031.1 GCA001067535_00727 CDS open 10842-11060 _na     72_aa infA translation initiation factor IF-1
1750 JURA01000031.1 GCA001067535_00728 CDS open 11260-11622 _na     120_aa rpsM 30S ribosomal protein S13
1751 JURA01000031.1 GCA001067535_00729 CDS open 11642-12037 _na     131_aa rpsK 30S ribosomal protein S11
1752 JURA01000031.1 GCA001067535_00730 CDS open 12057-12677 _na     206_aa rpsD 30S ribosomal protein S4
1753 JURA01000031.1 GCA001067535_00731 CDS open 12703-13689 _na     328_aa rpoA DNA-directed RNA polymerase subunit alpha
1754 JURA01000031.1 GCA001067535_00732 CDS open 13714-14088 _na     124_aa rplQ 50S ribosomal protein L17
1755 JURA01000031.1 GCA001067535_00733 CDS open 15016-15324 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
1756 JURA01000031.1 GCA001067535_00734 CDS open 15335-16249 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
1757 JURA01000031.1 GCA001067535_00735 CDS open 16316-19561 _na     1081_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1758 JURA01000031.1 GCA001067535_00736 CDS open 19831-21255 _na     474_aa alsT Amino acid carrier protein
1759 JURA01000031.1 GCA001067535_00737 CDS open 21518-23029 _na     503_aa lysS lysine--tRNA ligase
1760 JURA01000031.1 GCA001067535_00738 CDS open 23430-24005 _na     191_aa hypothetical protein
1761 JURA01000031.1 GCA001067535_00739 CDS open 24144-25586 _na     480_aa aldA aldehyde dehydrogenase
1762 JURA01000031.1 GCA001067535_00705 gene open 105-416
1763 JURA01000031.1 GCA001067535_00706 gene open 668-1312 rplC
1764 JURA01000031.1 GCA001067535_00707 gene open 1312-1932 rplD
1765 JURA01000031.1 GCA001067535_00708 gene open 1929-2243 rplW
1766 JURA01000031.1 GCA001067535_00709 gene open 2249-3082 rplB
1767 JURA01000031.1 GCA001067535_00710 gene open 3088-3366 rpsS
1768 JURA01000031.1 GCA001067535_00711 gene open 3375-3704 rplV
1769 JURA01000031.1 GCA001067535_00712 gene open 3714-4406 rpsC
1770 JURA01000031.1 GCA001067535_00713 gene open 4390-4806 rplP
1771 JURA01000031.1 GCA001067535_00714 gene open 4806-4997 rpmC
1772 JURA01000031.1 GCA001067535_00715 gene open 4997-5260 rpsQ
1773 JURA01000031.1 GCA001067535_00716 gene open 5488-5856 rplN
1774 JURA01000031.1 GCA001067535_00717 gene open 5868-6191 rplX
1775 JURA01000031.1 GCA001067535_00718 gene open 6201-6740 rplE
1776 JURA01000031.1 GCA001067535_00719 gene open 6743-7048 rpsN
1777 JURA01000031.1 GCA001067535_00720 gene open 7063-7455 rpsH
1778 JURA01000031.1 GCA001067535_00721 gene open 7469-8002 rplF
1779 JURA01000031.1 GCA001067535_00722 gene open 8016-8369 rplR
1780 JURA01000031.1 GCA001067535_00723 gene open 8387-8905 rpsE
1781 JURA01000031.1 GCA001067535_00724 gene open 8898-9083 rpmD
1782 JURA01000031.1 GCA001067535_00725 gene open 9085-9519 rplO
1783 JURA01000031.1 GCA001067535_00726 gene open 9719-10837 secY
1784 JURA01000031.1 GCA001067535_00727 gene open 10842-11060 infA
1785 JURA01000031.1 GCA001067535_00728 gene open 11260-11622 rpsM
1786 JURA01000031.1 GCA001067535_00729 gene open 11642-12037 rpsK
1787 JURA01000031.1 GCA001067535_00730 gene open 12057-12677 rpsD
1788 JURA01000031.1 GCA001067535_00731 gene open 12703-13689 rpoA
1789 JURA01000031.1 GCA001067535_00732 gene open 13714-14088 rplQ
1790 JURA01000031.1 GCA001067535_00733 gene open 15016-15324 cas2
1791 JURA01000031.1 GCA001067535_00734 gene open 15335-16249 cas1
1792 JURA01000031.1 GCA001067535_00735 gene open 16316-19561 cas9
1793 JURA01000031.1 GCA001067535_00736 gene open 19831-21255 alsT
1794 JURA01000031.1 GCA001067535_00737 gene open 21518-23029 lysS
1795 JURA01000031.1 GCA001067535_00738 gene open 23430-24005
1796 JURA01000031.1 GCA001067535_00739 gene open 24144-25586 aldA
1797 JURA01000031.1 GCA001067535_00740 gene open 25898-25973 trnK
1798 JURA01000031.1 GCA001067535_00740 tRNA open 25898-25973 trnK tRNA-Lys(ttt)
1799 JURA01000032.1 GCA001067535_00808 gene open 66602-66795 IR_84
1800 JURA01000032.1 GCA001067535_00808 ncRNA open 66602-66795 Neisseria sRNA 84
1801 JURA01000032.1 GCA001067535_00741 CDS open 19-2019 _na     666_aa carB carbamoyl-phosphate synthase large subunit
1802 JURA01000032.1 GCA001067535_00742 CDS open 2423-4102 _na     559_aa pilB type IV-A pilus assembly ATPase PilB
1803 JURA01000032.1 GCA001067535_00743 CDS open 4181-5422 _na     413_aa gspF Type II secretion system protein GspF domain-containing protein
1804 JURA01000032.1 GCA001067535_00744 CDS open 5424-6311 _na     295_aa Prepilin leader peptidase/N-methyltransferase
1805 JURA01000032.1 GCA001067535_00745 CDS open 6311-6931 _na     206_aa coaE dephospho-CoA kinase
1806 JURA01000032.1 GCA001067535_00746 CDS open 6928-7110 _na     60_aa yacG DNA gyrase inhibitor YacG
1807 JURA01000032.1 GCA001067535_00747 CDS open 7192-8091 _na     299_aa glyQ glycine--tRNA ligase subunit alpha
1808 JURA01000032.1 GCA001067535_00748 CDS open 8240-8746 _na     168_aa lspA signal peptidase II
1809 JURA01000032.1 GCA001067535_00749 CDS open 8760-9728 _na     322_aa ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
1810 JURA01000032.1 GCA001067535_00750 CDS open 9850-11049 _na     399_aa ftsZ cell division protein FtsZ
1811 JURA01000032.1 GCA001067535_00751 CDS open 11302-12552 _na     416_aa ftsA cell division protein FtsA
1812 JURA01000032.1 GCA001067535_00752 CDS open 12627-13346 _na     239_aa ftsQ Cell division protein FtsQ
1813 JURA01000032.1 GCA001067535_00753 CDS open 13336-14250 _na     304_aa ddl D-alanine--D-alanine ligase
1814 JURA01000032.1 GCA001067535_00754 CDS open 14339-15748 _na     469_aa murC UDP-N-acetylmuramate--L-alanine ligase
1815 JURA01000032.1 GCA001067535_00755 CDS open 15915-16982 _na     355_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
1816 JURA01000032.1 GCA001067535_00756 CDS open 16987-18249 _na     420_aa ftsW putative lipid II flippase FtsW
1817 JURA01000032.1 GCA001067535_00757 CDS open 18536-18676 _na     46_aa hypothetical protein
1818 JURA01000032.1 GCA001067535_00758 CDS open 18918-19253 _na     111_aa hypothetical protein
1819 JURA01000032.1 GCA001067535_00759 CDS open 19110-20447 _na     445_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1820 JURA01000032.1 GCA001067535_00760 CDS open 20535-22538 _na     667_aa hypothetical protein
1821 JURA01000032.1 GCA001067535_00761 CDS open 22610-23527 _na     305_aa SEL1-like repeat protein
1822 JURA01000032.1 GCA001067535_00762 CDS open 23580-24068 _na     162_aa yjbI Group 2 truncated hemoglobin YjbI
1823 JURA01000032.1 GCA001067535_00763 CDS open 24185-25267 _na     360_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1824 JURA01000032.1 GCA001067535_00764 CDS open 25369-25518 _na     49_aa Periplasmic protein
1825 JURA01000032.1 GCA001067535_00765 CDS open 25535-25966 _na     143_aa DUF2569 domain-containing protein
1826 JURA01000032.1 GCA001067535_00766 CDS open 25969-27336 _na     455_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1827 JURA01000032.1 GCA001067535_00767 CDS open 27333-27845 _na     170_aa GtrA-like protein domain-containing protein
1828 JURA01000032.1 GCA001067535_00768 CDS open 27867-28721 _na     284_aa Peptidase
1829 JURA01000032.1 GCA001067535_00769 CDS open 28746-29267 _na     173_aa L-Ala--D-Glu endopeptidase
1830 JURA01000032.1 GCA001067535_00770 CDS open 29448-30926 _na     492_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1831 JURA01000032.1 GCA001067535_00771 CDS open 30953-32701 _na     582_aa penA putative peptidoglycan D%2CD-transpeptidase PenA
1832 JURA01000032.1 GCA001067535_00772 CDS open 32776-33039 _na     87_aa ftsL cell division protein FtsL
1833 JURA01000032.1 GCA001067535_00773 CDS open 33102-34064 _na     320_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1834 JURA01000032.1 GCA001067535_00774 CDS open 34061-34516 _na     151_aa mraZ division/cell wall cluster transcriptional repressor MraZ
1835 JURA01000032.1 GCA001067535_00775 CDS open 34919-36070 _na     383_aa S-adenosyl-L-methionine-dependent methyltransferase
1836 JURA01000032.1 GCA001067535_00778 CDS open 36476-36880 _na     134_aa ClpXP protease specificity-enhancing factor
1837 JURA01000032.1 GCA001067535_00779 CDS open 36892-37497 _na     201_aa gstA Stringent starvation protein A
1838 JURA01000032.1 GCA001067535_00780 CDS open 37712-38500 _na     262_aa Cytochrome C1 family
1839 JURA01000032.1 GCA001067535_00781 CDS open 38515-39864 _na     449_aa petB Cytochrome b
1840 JURA01000032.1 GCA001067535_00782 CDS open 39883-40464 _na     193_aa petA ubiquinol-cytochrome c reductase iron-sulfur subunit
1841 JURA01000032.1 GCA001067535_00783 CDS open 40588-41337 _na     249_aa Nif3-like dinuclear metal center hexameric protein
1842 JURA01000032.1 GCA001067535_00784 CDS open 41513-42439 _na     308_aa lysR HTH-type transcriptional regulator MetR
1843 JURA01000032.1 GCA001067535_00785 CDS open 42515-43165 _na     216_aa Ribosomal large subunit pseudouridine synthase C
1844 JURA01000032.1 GCA001067535_00786 CDS open 43167-43745 _na     192_aa GDT1 family protein
1845 JURA01000032.1 GCA001067535_00787 CDS open 44036-44506 _na     156_aa Antibiotic biosynthesis monooxygenase
1846 JURA01000032.1 GCA001067535_00788 CDS open 44546-44983 _na     145_aa Nickel-dependent hydrogenases B-type cytochrome subunit
1847 JURA01000032.1 GCA001067535_00789 CDS open 45007-45462 _na     151_aa Transmembrane protein
1848 JURA01000032.1 GCA001067535_00790 CDS open 45609-46052 _na     147_aa marR Transcriptional regulator%2C MarR family
1849 JURA01000032.1 GCA001067535_00791 CDS open 46118-47269 _na     383_aa dnaJ molecular chaperone DnaJ
1850 JURA01000032.1 GCA001067535_00792 CDS open 47474-50119 _na     881_aa leuS leucine--tRNA ligase
1851 JURA01000032.1 GCA001067535_00793 CDS open 50396-51685 _na     429_aa FAD-binding domain protein
1852 JURA01000032.1 GCA001067535_00794 CDS open 52207-54822 _na     871_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
1853 JURA01000032.1 GCA001067535_00795 CDS open 55141-56460 _na     439_aa naiP Niacin/nicotinamide transporter NaiP
1854 JURA01000032.1 GCA001067535_00796 CDS open 56811-58184 _na     457_aa Sodium:proton antiporter
1855 JURA01000032.1 GCA001067535_00797 CDS open 58186-58413 _na     75_aa Protein SlyX-like protein
1856 JURA01000032.1 GCA001067535_00798 CDS open 58516-59736 _na     406_aa lysA diaminopimelate decarboxylase
1857 JURA01000032.1 GCA001067535_00799 CDS open 59754-59945 _na     63_aa lptM LPS translocon maturation chaperone LptM
1858 JURA01000032.1 GCA001067535_00800 CDS open 59996-60319 _na     107_aa cyaY iron donor protein CyaY
1859 JURA01000032.1 GCA001067535_00801 CDS open 60374-60880 _na     168_aa luxS S-ribosylhomocysteine lyase
1860 JURA01000032.1 GCA001067535_00802 CDS open 61066-62667 _na     533_aa fimV FimV domain protein
1861 JURA01000032.1 GCA001067535_00803 CDS open 62777-63460 _na     227_aa Beta-ketoacyl synthase N-terminal domain-containing protein
1862 JURA01000032.1 GCA001067535_00804 CDS open 63448-64506 _na     352_aa 3-oxoacyl-[acyl-carrier-protein] synthase 2
1863 JURA01000032.1 GCA001067535_00805 CDS open 64503-64793 _na     96_aa Carrier domain-containing protein
1864 JURA01000032.1 GCA001067535_00806 CDS open 64877-65602 _na     241_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
1865 JURA01000032.1 GCA001067535_00807 CDS open 65782-66570 _na     262_aa Inositol monophosphatase
1866 JURA01000032.1 GCA001067535_00809 CDS open 66835-67302 _na     155_aa ychJ YchJ family protein
1867 JURA01000032.1 GCA001067535_00810 CDS open 67466-68314 _na     282_aa Electron transport complex%2C RnfABCDGE type%2C B subunit
1868 JURA01000032.1 GCA001067535_00811 CDS open 68367-69383 _na     338_aa Butirosin biosynthesis protein H N-terminal domain-containing protein
1869 JURA01000032.1 GCA001067535_00812 CDS open 69465-70208 _na     247_aa SH3 domain-containing protein
1870 JURA01000032.1 GCA001067535_00813 CDS open 70237-71151 _na     304_aa ybhF ABC transporter ATP-binding protein YbhF
1871 JURA01000032.1 GCA001067535_00814 CDS open 71148-72401 _na     417_aa ybhR Inner membrane transport permease YbhR
1872 JURA01000032.1 GCA001067535_00741 gene open 19-2019 carB
1873 JURA01000032.1 GCA001067535_00742 gene open 2423-4102 pilB
1874 JURA01000032.1 GCA001067535_00743 gene open 4181-5422 gspF
1875 JURA01000032.1 GCA001067535_00744 gene open 5424-6311
1876 JURA01000032.1 GCA001067535_00745 gene open 6311-6931 coaE
1877 JURA01000032.1 GCA001067535_00746 gene open 6928-7110 yacG
1878 JURA01000032.1 GCA001067535_00747 gene open 7192-8091 glyQ
1879 JURA01000032.1 GCA001067535_00748 gene open 8240-8746 lspA
1880 JURA01000032.1 GCA001067535_00749 gene open 8760-9728 ispH
1881 JURA01000032.1 GCA001067535_00750 gene open 9850-11049 ftsZ
1882 JURA01000032.1 GCA001067535_00751 gene open 11302-12552 ftsA
1883 JURA01000032.1 GCA001067535_00752 gene open 12627-13346 ftsQ
1884 JURA01000032.1 GCA001067535_00753 gene open 13336-14250 ddl
1885 JURA01000032.1 GCA001067535_00754 gene open 14339-15748 murC
1886 JURA01000032.1 GCA001067535_00755 gene open 15915-16982 murG
1887 JURA01000032.1 GCA001067535_00756 gene open 16987-18249 ftsW
1888 JURA01000032.1 GCA001067535_00757 gene open 18536-18676
1889 JURA01000032.1 GCA001067535_00758 gene open 18918-19253
1890 JURA01000032.1 GCA001067535_00759 gene open 19110-20447 murD
1891 JURA01000032.1 GCA001067535_00760 gene open 20535-22538
1892 JURA01000032.1 GCA001067535_00761 gene open 22610-23527
1893 JURA01000032.1 GCA001067535_00762 gene open 23580-24068 yjbI
1894 JURA01000032.1 GCA001067535_00763 gene open 24185-25267 mraY
1895 JURA01000032.1 GCA001067535_00764 gene open 25369-25518
1896 JURA01000032.1 GCA001067535_00765 gene open 25535-25966
1897 JURA01000032.1 GCA001067535_00766 gene open 25969-27336
1898 JURA01000032.1 GCA001067535_00767 gene open 27333-27845
1899 JURA01000032.1 GCA001067535_00768 gene open 27867-28721
1900 JURA01000032.1 GCA001067535_00769 gene open 28746-29267
1901 JURA01000032.1 GCA001067535_00770 gene open 29448-30926
1902 JURA01000032.1 GCA001067535_00771 gene open 30953-32701 penA
1903 JURA01000032.1 GCA001067535_00772 gene open 32776-33039 ftsL
1904 JURA01000032.1 GCA001067535_00773 gene open 33102-34064 rsmH
1905 JURA01000032.1 GCA001067535_00774 gene open 34061-34516 mraZ
1906 JURA01000032.1 GCA001067535_00775 gene open 34919-36070
1907 JURA01000032.1 GCA001067535_00778 gene open 36476-36880
1908 JURA01000032.1 GCA001067535_00779 gene open 36892-37497 gstA
1909 JURA01000032.1 GCA001067535_00780 gene open 37712-38500
1910 JURA01000032.1 GCA001067535_00781 gene open 38515-39864 petB
1911 JURA01000032.1 GCA001067535_00782 gene open 39883-40464 petA
1912 JURA01000032.1 GCA001067535_00783 gene open 40588-41337
1913 JURA01000032.1 GCA001067535_00784 gene open 41513-42439 lysR
1914 JURA01000032.1 GCA001067535_00785 gene open 42515-43165
1915 JURA01000032.1 GCA001067535_00786 gene open 43167-43745
1916 JURA01000032.1 GCA001067535_00787 gene open 44036-44506
1917 JURA01000032.1 GCA001067535_00788 gene open 44546-44983
1918 JURA01000032.1 GCA001067535_00789 gene open 45007-45462
1919 JURA01000032.1 GCA001067535_00790 gene open 45609-46052 marR
1920 JURA01000032.1 GCA001067535_00791 gene open 46118-47269 dnaJ
1921 JURA01000032.1 GCA001067535_00792 gene open 47474-50119 leuS
1922 JURA01000032.1 GCA001067535_00793 gene open 50396-51685
1923 JURA01000032.1 GCA001067535_00794 gene open 52207-54822 adhE
1924 JURA01000032.1 GCA001067535_00795 gene open 55141-56460 naiP
1925 JURA01000032.1 GCA001067535_00796 gene open 56811-58184
1926 JURA01000032.1 GCA001067535_00797 gene open 58186-58413
1927 JURA01000032.1 GCA001067535_00798 gene open 58516-59736 lysA
1928 JURA01000032.1 GCA001067535_00799 gene open 59754-59945 lptM
1929 JURA01000032.1 GCA001067535_00800 gene open 59996-60319 cyaY
1930 JURA01000032.1 GCA001067535_00801 gene open 60374-60880 luxS
1931 JURA01000032.1 GCA001067535_00802 gene open 61066-62667 fimV
1932 JURA01000032.1 GCA001067535_00803 gene open 62777-63460
1933 JURA01000032.1 GCA001067535_00804 gene open 63448-64506
1934 JURA01000032.1 GCA001067535_00805 gene open 64503-64793
1935 JURA01000032.1 GCA001067535_00806 gene open 64877-65602
1936 JURA01000032.1 GCA001067535_00807 gene open 65782-66570
1937 JURA01000032.1 GCA001067535_00809 gene open 66835-67302 ychJ
1938 JURA01000032.1 GCA001067535_00810 gene open 67466-68314
1939 JURA01000032.1 GCA001067535_00811 gene open 68367-69383
1940 JURA01000032.1 GCA001067535_00812 gene open 69465-70208
1941 JURA01000032.1 GCA001067535_00813 gene open 70237-71151 ybhF
1942 JURA01000032.1 GCA001067535_00814 gene open 71148-72401 ybhR
1943 JURA01000032.1 GCA001067535_00776 gene open 36177-36253 trnM
1944 JURA01000032.1 GCA001067535_00777 gene open 36260-36335 trnA
1945 JURA01000032.1 GCA001067535_00815 gene open 72595-72670 trnK
1946 JURA01000032.1 GCA001067535_00776 tRNA open 36177-36253 trnM tRNA-Met(cat)
1947 JURA01000032.1 GCA001067535_00777 tRNA open 36260-36335 trnA tRNA-Ala(ggc)
1948 JURA01000032.1 GCA001067535_00815 tRNA open 72595-72670 trnK tRNA-Lys(ttt)
1949 JURA01000033.1 GCA001067535_00817 CDS open 389-949 _na     186_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1950 JURA01000033.1 GCA001067535_00818 CDS open 1007-1552 _na     181_aa Type IV secretion protein Rhs
1951 JURA01000033.1 GCA001067535_00819 CDS open 1625-2191 _na     188_aa Inner membrane protein
1952 JURA01000033.1 GCA001067535_00820 CDS open 2195-3679 _na     494_aa ccoG cytochrome c oxidase accessory protein CcoG
1953 JURA01000033.1 GCA001067535_00821 CDS open 4124-6103 _na     659_aa tkt transketolase
1954 JURA01000033.1 GCA001067535_00822 CDS open 6367-7779 _na     470_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
1955 JURA01000033.1 GCA001067535_00823 CDS open 7885-8709 _na     274_aa hypothetical protein
1956 JURA01000033.1 GCA001067535_00817 gene open 389-949 pgsA
1957 JURA01000033.1 GCA001067535_00818 gene open 1007-1552
1958 JURA01000033.1 GCA001067535_00819 gene open 1625-2191
1959 JURA01000033.1 GCA001067535_00820 gene open 2195-3679 ccoG
1960 JURA01000033.1 GCA001067535_00821 gene open 4124-6103 tkt
1961 JURA01000033.1 GCA001067535_00822 gene open 6367-7779
1962 JURA01000033.1 GCA001067535_00823 gene open 7885-8709
1963 JURA01000033.1 GCA001067535_00816 gene open 220-295 trnG
1964 JURA01000033.1 GCA001067535_00816 tRNA open 220-295 trnG tRNA-Gly(gcc)
1965 JURA01000034.1 GCA001067535_00824 CDS open 277-945 _na     222_aa nhhA Autotransporter adhesin NhhA
1966 JURA01000034.1 GCA001067535_00824 gene open 277-945 nhhA
1967 JURA01000035.1 GCA001067535_00827 gene open 1337-1450 rrf
1968 JURA01000035.1 GCA001067535_00828 gene open 1546-4434 rrl
1969 JURA01000035.1 GCA001067535_00831 gene open 5046-6586 rrs
1970 JURA01000035.1 GCA001067535_00827 rRNA open 1337-1450 rrf 5S ribosomal RNA
1971 JURA01000035.1 GCA001067535_00828 rRNA open 1546-4434 rrl 23S ribosomal RNA
1972 JURA01000035.1 GCA001067535_00831 rRNA open 5046-6586 rrs 16S ribosomal RNA
1973 JURA01000035.1 GCA001067535_00825 CDS open 30-290 _na     86_aa hypothetical protein
1974 JURA01000035.1 GCA001067535_00826 CDS open 674-961 _na     95_aa Helix-hairpin-helix domain-containing protein
1975 JURA01000035.1 GCA001067535_00825 gene open 30-290
1976 JURA01000035.1 GCA001067535_00826 gene open 674-961
1977 JURA01000035.1 GCA001067535_00829 gene open 4783-4858 trnA
1978 JURA01000035.1 GCA001067535_00830 gene open 4864-4940 trnI
1979 JURA01000035.1 GCA001067535_00829 tRNA open 4783-4858 trnA tRNA-Ala(tgc)
1980 JURA01000035.1 GCA001067535_00830 tRNA open 4864-4940 trnI tRNA-Ile(gat)
1981 JURA01000036.1 GCA001067535_00832 CDS open 18-431 _na     137_aa Type IV pilin protein
1982 JURA01000036.1 GCA001067535_00833 CDS open 504-1328 _na     274_aa undecaprenyl-diphosphate phosphatase
1983 JURA01000036.1 GCA001067535_00834 CDS open 1373-2014 _na     213_aa Thiol:disulfide interchange protein
1984 JURA01000036.1 GCA001067535_00835 CDS open 2026-3108 _na     360_aa ftsN Cell division protein FtsN
1985 JURA01000036.1 GCA001067535_00836 CDS open 3259-4755 _na     498_aa yifB YifB family Mg chelatase-like AAA ATPase
1986 JURA01000036.1 GCA001067535_00837 CDS open 4769-5089 _na     106_aa ubiK Ubiquinone biosynthesis accessory factor UbiK
1987 JURA01000036.1 GCA001067535_00838 CDS open 5214-6281 _na     355_aa DUF1176 domain-containing protein
1988 JURA01000036.1 GCA001067535_00839 CDS open 6453-7181 _na     242_aa metK methionine adenosyltransferase
1989 JURA01000036.1 GCA001067535_00832 gene open 18-431
1990 JURA01000036.1 GCA001067535_00833 gene open 504-1328
1991 JURA01000036.1 GCA001067535_00834 gene open 1373-2014
1992 JURA01000036.1 GCA001067535_00835 gene open 2026-3108 ftsN
1993 JURA01000036.1 GCA001067535_00836 gene open 3259-4755 yifB
1994 JURA01000036.1 GCA001067535_00837 gene open 4769-5089 ubiK
1995 JURA01000036.1 GCA001067535_00838 gene open 5214-6281
1996 JURA01000036.1 GCA001067535_00839 gene open 6453-7181 metK
1997 JURA01000037.1 GCA001067535_00868 gene open 24163-24253 NmsRb
1998 JURA01000037.1 GCA001067535_00869 gene open 24361-24447 NmsRb
1999 JURA01000037.1 GCA001067535_00868 ncRNA open 24163-24253 Neisseria metabolic switch regulator b (RcoF1/NgncR163)
2000 JURA01000037.1 GCA001067535_00869 ncRNA open 24361-24447 Neisseria metabolic switch regulator b (RcoF1/NgncR163)