BAKTAGenome Explorer: Limosilactobacillus panis (GCA_001435935.1)
Select a Genome:
|
BAKTA Annotations for GCA_001435935.1
|
Search & Sort all 3967 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | AZGM01000032.1 | GCA001435935_01643 | CDS | open | 27003-27191 | _na 62_aa | rpmD | 50S ribosomal protein L30 |
| 1002 | AZGM01000032.1 | GCA001435935_01644 | CDS | open | 27199-27708 | _na 169_aa | rpsE | 30S ribosomal protein S5 |
| 1003 | AZGM01000032.1 | GCA001435935_01645 | CDS | open | 27731-28087 | _na 118_aa | rplR | 50S ribosomal protein L18 |
| 1004 | AZGM01000032.1 | GCA001435935_01646 | CDS | open | 28153-28689 | _na 178_aa | rplF | 50S ribosomal protein L6 |
| 1005 | AZGM01000032.1 | GCA001435935_01647 | CDS | open | 28719-29117 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 1006 | AZGM01000032.1 | GCA001435935_01648 | CDS | open | 29350-29892 | _na 180_aa | rplE | 50S ribosomal protein L5 |
| 1007 | AZGM01000032.1 | GCA001435935_01649 | CDS | open | 29918-30226 | _na 102_aa | rplX | 50S ribosomal protein L24 |
| 1008 | AZGM01000032.1 | GCA001435935_01650 | CDS | open | 30261-30629 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 1009 | AZGM01000032.1 | GCA001435935_01651 | CDS | open | 30694-30960 | _na 88_aa | rpsQ | 30S ribosomal protein S17 |
| 1010 | AZGM01000032.1 | GCA001435935_01652 | CDS | open | 30985-31191 | _na 68_aa | rpmC | 50S ribosomal protein L29 |
| 1011 | AZGM01000032.1 | GCA001435935_01653 | CDS | open | 31181-31615 | _na 144_aa | rplP | 50S ribosomal protein L16 |
| 1012 | AZGM01000032.1 | GCA001435935_01654 | CDS | open | 31619-32284 | _na 221_aa | rpsC | 30S ribosomal protein S3 |
| 1013 | AZGM01000032.1 | GCA001435935_01655 | CDS | open | 32297-32644 | _na 115_aa | rplV | 50S ribosomal protein L22 |
| 1014 | AZGM01000032.1 | GCA001435935_01656 | CDS | open | 32662-32949 | _na 95_aa | rpsS | 30S ribosomal protein S19 |
| 1015 | AZGM01000032.1 | GCA001435935_01657 | CDS | open | 32986-33831 | _na 281_aa | rplB | 50S ribosomal protein L2 |
| 1016 | AZGM01000032.1 | GCA001435935_01658 | CDS | open | 33857-34153 | _na 98_aa | rplW | 50S ribosomal protein L23 |
| 1017 | AZGM01000032.1 | GCA001435935_01659 | CDS | open | 34153-34776 | _na 207_aa | rplD | 50S ribosomal protein L4 |
| 1018 | AZGM01000032.1 | GCA001435935_01660 | CDS | open | 34798-35460 | _na 220_aa | rplC | 50S ribosomal protein L3 |
| 1019 | AZGM01000032.1 | GCA001435935_01661 | CDS | open | 35516-35824 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 1020 | AZGM01000032.1 | GCA001435935_01662 | CDS | open | 36281-36985 | _na 234_aa | Beta-lactamase class A catalytic domain-containing protein | |
| 1021 | AZGM01000032.1 | GCA001435935_01663 | CDS | open | 37004-38497 | _na 497_aa | Di-tripeptide transporter | |
| 1022 | AZGM01000032.1 | GCA001435935_01617 | gene | open | 139-1143 | |||
| 1023 | AZGM01000032.1 | GCA001435935_01618 | gene | open | 1154-2578 | gatB | ||
| 1024 | AZGM01000032.1 | GCA001435935_01619 | gene | open | 2580-4052 | gatA | ||
| 1025 | AZGM01000032.1 | GCA001435935_01620 | gene | open | 4052-4372 | gatC | ||
| 1026 | AZGM01000032.1 | GCA001435935_01621 | gene | open | 4515-5630 | |||
| 1027 | AZGM01000032.1 | GCA001435935_01622 | gene | open | 5633-7672 | ligA | ||
| 1028 | AZGM01000032.1 | GCA001435935_01623 | gene | open | 7689-9968 | pcrA | ||
| 1029 | AZGM01000032.1 | GCA001435935_01624 | gene | open | 10225-11400 | |||
| 1030 | AZGM01000032.1 | GCA001435935_01625 | gene | open | 11411-11986 | |||
| 1031 | AZGM01000032.1 | GCA001435935_01626 | gene | open | 12008-12631 | |||
| 1032 | AZGM01000032.1 | GCA001435935_01627 | gene | open | 12770-13165 | rpsI | ||
| 1033 | AZGM01000032.1 | GCA001435935_01628 | gene | open | 13179-13622 | rplM | ||
| 1034 | AZGM01000032.1 | GCA001435935_01629 | gene | open | 13727-14497 | truA | ||
| 1035 | AZGM01000032.1 | GCA001435935_01630 | gene | open | 14605-18999 | |||
| 1036 | AZGM01000032.1 | GCA001435935_01631 | gene | open | 19107-19910 | |||
| 1037 | AZGM01000032.1 | GCA001435935_01632 | gene | open | 19903-20772 | |||
| 1038 | AZGM01000032.1 | GCA001435935_01633 | gene | open | 20748-21575 | |||
| 1039 | AZGM01000032.1 | GCA001435935_01634 | gene | open | 21789-22172 | rplQ | ||
| 1040 | AZGM01000032.1 | GCA001435935_01635 | gene | open | 22205-23149 | rpoA | ||
| 1041 | AZGM01000032.1 | GCA001435935_01636 | gene | open | 23233-23622 | rpsK | ||
| 1042 | AZGM01000032.1 | GCA001435935_01637 | gene | open | 23657-24022 | rpsM | ||
| 1043 | AZGM01000032.1 | GCA001435935_01638 | gene | open | 24052-24171 | rpmJ | ||
| 1044 | AZGM01000032.1 | GCA001435935_01639 | gene | open | 24211-24429 | infA | ||
| 1045 | AZGM01000032.1 | GCA001435935_01640 | gene | open | 24562-25218 | |||
| 1046 | AZGM01000032.1 | GCA001435935_01641 | gene | open | 25215-26534 | secY | ||
| 1047 | AZGM01000032.1 | GCA001435935_01642 | gene | open | 26536-26970 | rplO | ||
| 1048 | AZGM01000032.1 | GCA001435935_01643 | gene | open | 27003-27191 | rpmD | ||
| 1049 | AZGM01000032.1 | GCA001435935_01644 | gene | open | 27199-27708 | rpsE | ||
| 1050 | AZGM01000032.1 | GCA001435935_01645 | gene | open | 27731-28087 | rplR | ||
| 1051 | AZGM01000032.1 | GCA001435935_01646 | gene | open | 28153-28689 | rplF | ||
| 1052 | AZGM01000032.1 | GCA001435935_01647 | gene | open | 28719-29117 | rpsH | ||
| 1053 | AZGM01000032.1 | GCA001435935_01648 | gene | open | 29350-29892 | rplE | ||
| 1054 | AZGM01000032.1 | GCA001435935_01649 | gene | open | 29918-30226 | rplX | ||
| 1055 | AZGM01000032.1 | GCA001435935_01650 | gene | open | 30261-30629 | rplN | ||
| 1056 | AZGM01000032.1 | GCA001435935_01651 | gene | open | 30694-30960 | rpsQ | ||
| 1057 | AZGM01000032.1 | GCA001435935_01652 | gene | open | 30985-31191 | rpmC | ||
| 1058 | AZGM01000032.1 | GCA001435935_01653 | gene | open | 31181-31615 | rplP | ||
| 1059 | AZGM01000032.1 | GCA001435935_01654 | gene | open | 31619-32284 | rpsC | ||
| 1060 | AZGM01000032.1 | GCA001435935_01655 | gene | open | 32297-32644 | rplV | ||
| 1061 | AZGM01000032.1 | GCA001435935_01656 | gene | open | 32662-32949 | rpsS | ||
| 1062 | AZGM01000032.1 | GCA001435935_01657 | gene | open | 32986-33831 | rplB | ||
| 1063 | AZGM01000032.1 | GCA001435935_01658 | gene | open | 33857-34153 | rplW | ||
| 1064 | AZGM01000032.1 | GCA001435935_01659 | gene | open | 34153-34776 | rplD | ||
| 1065 | AZGM01000032.1 | GCA001435935_01660 | gene | open | 34798-35460 | rplC | ||
| 1066 | AZGM01000032.1 | GCA001435935_01661 | gene | open | 35516-35824 | rpsJ | ||
| 1067 | AZGM01000032.1 | GCA001435935_01662 | gene | open | 36281-36985 | |||
| 1068 | AZGM01000032.1 | GCA001435935_01663 | gene | open | 37004-38497 | |||
| 1069 | AZGM01000034.1 | repeat_region | open | 115-1616 | CRISPR array with 23 repeats of length 30%2C consensus sequence GTATTTATCTAATAGAAGTGGAATGTAAAT and spacer length 36 | |||
| 1070 | AZGM01000035.1 | regulatory_region | open | 17837-18099 | T-box leader | |||
| 1071 | AZGM01000035.1 | regulatory_region | open | 18887-18982 | THF (Tetrahydrofolate) riboswitch aptamer | |||
| 1072 | AZGM01000035.1 | GCA001435935_01664 | CDS | open | 328-1878 | _na 516_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 1073 | AZGM01000035.1 | GCA001435935_01665 | CDS | open | 1899-2504 | _na 201_aa | lepB | signal peptidase I |
| 1074 | AZGM01000035.1 | GCA001435935_01666 | CDS | open | 2662-3972 | _na 436_aa | Lactose-specific PTS IIBC | |
| 1075 | AZGM01000035.1 | GCA001435935_01667 | CDS | open | 3959-4840 | _na 293_aa | Alpha beta hydrolase superfamily protein | |
| 1076 | AZGM01000035.1 | GCA001435935_01668 | CDS | open | 4930-6264 | _na 444_aa | D-serine ammonia-lyase | |
| 1077 | AZGM01000035.1 | GCA001435935_01669 | CDS | open | 6261-7253 | _na 330_aa | asparaginase | |
| 1078 | AZGM01000035.1 | GCA001435935_01670 | CDS | open | 7391-8893 | _na 500_aa | Glycosyltransferase | |
| 1079 | AZGM01000035.1 | GCA001435935_01671 | CDS | open | 8945-9739 | _na 264_aa | Cof-like hydrolase | |
| 1080 | AZGM01000035.1 | GCA001435935_01672 | CDS | open | 9879-11093 | _na 404_aa | Oxidoreductase | |
| 1081 | AZGM01000035.1 | GCA001435935_01673 | CDS | open | 11086-12615 | _na 509_aa | GDP dissociation inhibitor | |
| 1082 | AZGM01000035.1 | GCA001435935_01674 | CDS | open | 12772-12900 | _na 42_aa | hypothetical protein | |
| 1083 | AZGM01000035.1 | GCA001435935_01675 | CDS | open | 13027-13488 | _na 153_aa | gntR | GntR C-terminal domain-containing protein |
| 1084 | AZGM01000035.1 | GCA001435935_01676 | CDS | open | 13532-14830 | _na 432_aa | Fic family protein | |
| 1085 | AZGM01000035.1 | GCA001435935_01677 | CDS | open | 15441-16739 | _na 432_aa | asnS | asparagine--tRNA ligase |
| 1086 | AZGM01000035.1 | GCA001435935_01678 | CDS | open | 16764-17774 | _na 336_aa | asnA | aspartate--ammonia ligase |
| 1087 | AZGM01000035.1 | GCA001435935_01679 | CDS | open | 18283-18834 | _na 183_aa | Integral membrane protein | |
| 1088 | AZGM01000035.1 | GCA001435935_01680 | CDS | open | 19174-20277 | _na 367_aa | Orc1-like AAA ATPase domain-containing protein | |
| 1089 | AZGM01000035.1 | GCA001435935_01664 | gene | open | 328-1878 | |||
| 1090 | AZGM01000035.1 | GCA001435935_01665 | gene | open | 1899-2504 | lepB | ||
| 1091 | AZGM01000035.1 | GCA001435935_01666 | gene | open | 2662-3972 | |||
| 1092 | AZGM01000035.1 | GCA001435935_01667 | gene | open | 3959-4840 | |||
| 1093 | AZGM01000035.1 | GCA001435935_01668 | gene | open | 4930-6264 | |||
| 1094 | AZGM01000035.1 | GCA001435935_01669 | gene | open | 6261-7253 | |||
| 1095 | AZGM01000035.1 | GCA001435935_01670 | gene | open | 7391-8893 | |||
| 1096 | AZGM01000035.1 | GCA001435935_01671 | gene | open | 8945-9739 | |||
| 1097 | AZGM01000035.1 | GCA001435935_01672 | gene | open | 9879-11093 | |||
| 1098 | AZGM01000035.1 | GCA001435935_01673 | gene | open | 11086-12615 | |||
| 1099 | AZGM01000035.1 | GCA001435935_01674 | gene | open | 12772-12900 | |||
| 1100 | AZGM01000035.1 | GCA001435935_01675 | gene | open | 13027-13488 | gntR | ||
| 1101 | AZGM01000035.1 | GCA001435935_01676 | gene | open | 13532-14830 | |||
| 1102 | AZGM01000035.1 | GCA001435935_01677 | gene | open | 15441-16739 | asnS | ||
| 1103 | AZGM01000035.1 | GCA001435935_01678 | gene | open | 16764-17774 | asnA | ||
| 1104 | AZGM01000035.1 | GCA001435935_01679 | gene | open | 18283-18834 | |||
| 1105 | AZGM01000035.1 | GCA001435935_01680 | gene | open | 19174-20277 | |||
| 1106 | AZGM01000036.1 | GCA001435935_01681 | CDS | open | 82-1617 | _na 511_aa | tnpC | IS66 family transposase |
| 1107 | AZGM01000036.1 | GCA001435935_01682 | CDS | open | 1687-2043 | _na 118_aa | tnpB | IS66 family insertion sequence element accessory protein TnpB |
| 1108 | AZGM01000036.1 | GCA001435935_01683 | CDS | open | 2033-2227 | _na 64_aa | Transposase | |
| 1109 | AZGM01000036.1 | GCA001435935_01681 | gene | open | 82-1617 | tnpC | ||
| 1110 | AZGM01000036.1 | GCA001435935_01682 | gene | open | 1687-2043 | tnpB | ||
| 1111 | AZGM01000036.1 | GCA001435935_01683 | gene | open | 2033-2227 | |||
| 1112 | AZGM01000037.1 | GCA001435935_01684 | CDS | open | 68-1039 | _na 323_aa | araC | AraC family transcriptional regulator |
| 1113 | AZGM01000037.1 | GCA001435935_01685 | CDS | open | 1104-1958 | _na 284_aa | eutJ | ethanolamine utilization protein EutJ |
| 1114 | AZGM01000037.1 | GCA001435935_01686 | CDS | open | 2043-2750 | _na 235_aa | Major intrinsic protein | |
| 1115 | AZGM01000037.1 | GCA001435935_01687 | CDS | open | 3176-4267 | _na 363_aa | D-lactate dehydrogenase | |
| 1116 | AZGM01000037.1 | GCA001435935_01688 | CDS | open | 4967-5419 | _na 150_aa | flavodoxin | |
| 1117 | AZGM01000037.1 | GCA001435935_01689 | CDS | open | 5687-6016 | _na 109_aa | D-lactate dehydrogenase | |
| 1118 | AZGM01000037.1 | GCA001435935_01690 | CDS | open | 6111-7814 | _na 567_aa | LPXTG-motif cell wall anchor domain protein | |
| 1119 | AZGM01000037.1 | GCA001435935_01691 | CDS | open | 8271-9275 | _na 334_aa | D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding | |
| 1120 | AZGM01000037.1 | GCA001435935_01692 | CDS | open | 9354-11549 | _na 731_aa | ATPase AAA-2 domain protein | |
| 1121 | AZGM01000037.1 | GCA001435935_01693 | CDS | open | 11635-11877 | _na 80_aa | Transcriptional regulator | |
| 1122 | AZGM01000037.1 | GCA001435935_01694 | CDS | open | 12320-13504 | _na 394_aa | Aminotransferase | |
| 1123 | AZGM01000037.1 | GCA001435935_01695 | CDS | open | 13508-14509 | _na 333_aa | D-lactate dehydrogenase | |
| 1124 | AZGM01000037.1 | GCA001435935_01696 | CDS | open | 14512-14949 | _na 145_aa | GNAT family acetyltransferase | |
| 1125 | AZGM01000037.1 | GCA001435935_01697 | CDS | open | 15098-15517 | _na 139_aa | Rrf2 family transcriptional regulator | |
| 1126 | AZGM01000037.1 | GCA001435935_01698 | CDS | open | 15654-16076 | _na 140_aa | osmC | OsmC family protein |
| 1127 | AZGM01000037.1 | GCA001435935_01699 | CDS | open | 16194-16520 | _na 108_aa | Transcriptional regulator%2C PadR-like family | |
| 1128 | AZGM01000037.1 | GCA001435935_01700 | CDS | open | 16517-17092 | _na 191_aa | DUF1700 domain-containing protein | |
| 1129 | AZGM01000037.1 | GCA001435935_01701 | CDS | open | 17092-17958 | _na 288_aa | DUF4097 domain-containing protein | |
| 1130 | AZGM01000037.1 | GCA001435935_01702 | CDS | open | 18021-18536 | _na 171_aa | Membrane protein | |
| 1131 | AZGM01000037.1 | GCA001435935_01703 | CDS | open | 18562-18951 | _na 129_aa | Transcobalamin-like C-terminal domain-containing protein | |
| 1132 | AZGM01000037.1 | GCA001435935_01704 | CDS | open | 19142-20092 | _na 316_aa | Methyltransferase | |
| 1133 | AZGM01000037.1 | GCA001435935_01684 | gene | open | 68-1039 | araC | ||
| 1134 | AZGM01000037.1 | GCA001435935_01685 | gene | open | 1104-1958 | eutJ | ||
| 1135 | AZGM01000037.1 | GCA001435935_01686 | gene | open | 2043-2750 | |||
| 1136 | AZGM01000037.1 | GCA001435935_01687 | gene | open | 3176-4267 | |||
| 1137 | AZGM01000037.1 | GCA001435935_01688 | gene | open | 4967-5419 | |||
| 1138 | AZGM01000037.1 | GCA001435935_01689 | gene | open | 5687-6016 | |||
| 1139 | AZGM01000037.1 | GCA001435935_01690 | gene | open | 6111-7814 | |||
| 1140 | AZGM01000037.1 | GCA001435935_01691 | gene | open | 8271-9275 | |||
| 1141 | AZGM01000037.1 | GCA001435935_01692 | gene | open | 9354-11549 | |||
| 1142 | AZGM01000037.1 | GCA001435935_01693 | gene | open | 11635-11877 | |||
| 1143 | AZGM01000037.1 | GCA001435935_01694 | gene | open | 12320-13504 | |||
| 1144 | AZGM01000037.1 | GCA001435935_01695 | gene | open | 13508-14509 | |||
| 1145 | AZGM01000037.1 | GCA001435935_01696 | gene | open | 14512-14949 | |||
| 1146 | AZGM01000037.1 | GCA001435935_01697 | gene | open | 15098-15517 | |||
| 1147 | AZGM01000037.1 | GCA001435935_01698 | gene | open | 15654-16076 | osmC | ||
| 1148 | AZGM01000037.1 | GCA001435935_01699 | gene | open | 16194-16520 | |||
| 1149 | AZGM01000037.1 | GCA001435935_01700 | gene | open | 16517-17092 | |||
| 1150 | AZGM01000037.1 | GCA001435935_01701 | gene | open | 17092-17958 | |||
| 1151 | AZGM01000037.1 | GCA001435935_01702 | gene | open | 18021-18536 | |||
| 1152 | AZGM01000037.1 | GCA001435935_01703 | gene | open | 18562-18951 | |||
| 1153 | AZGM01000037.1 | GCA001435935_01704 | gene | open | 19142-20092 | |||
| 1154 | AZGM01000038.1 | regulatory_region | open | 16705-16847 | FMN riboswitch aptamer (RFN element) | |||
| 1155 | AZGM01000038.1 | GCA001435935_01705 | CDS | open | 94-1197 | _na 367_aa | Glycerol dehydrogenase | |
| 1156 | AZGM01000038.1 | GCA001435935_01706 | CDS | open | 1292-2233 | _na 313_aa | Catabolite control protein B | |
| 1157 | AZGM01000038.1 | GCA001435935_01707 | CDS | open | 2321-3175 | _na 284_aa | Sugar transport family protein | |
| 1158 | AZGM01000038.1 | GCA001435935_01708 | CDS | open | 3188-3847 | _na 219_aa | Haloacid dehalogenase-like hydrolase | |
| 1159 | AZGM01000038.1 | GCA001435935_01709 | CDS | open | 3844-4824 | _na 326_aa | Dioxygenase | |
| 1160 | AZGM01000038.1 | GCA001435935_01710 | CDS | open | 4913-7441 | _na 842_aa | Aminopeptidase | |
| 1161 | AZGM01000038.1 | GCA001435935_01711 | CDS | open | 7879-8481 | _na 200_aa | Acetyltransferase | |
| 1162 | AZGM01000038.1 | GCA001435935_01712 | CDS | open | 8652-9086 | _na 144_aa | hypothetical protein | |
| 1163 | AZGM01000038.1 | GCA001435935_01713 | CDS | open | 9172-11394 | _na 740_aa | Beta-galactosidase | |
| 1164 | AZGM01000038.1 | GCA001435935_01714 | CDS | open | 11544-12722 | _na 392_aa | HTH araC/xylS-type domain-containing protein | |
| 1165 | AZGM01000038.1 | GCA001435935_01715 | CDS | open | 12783-13883 | _na 366_aa | KAP NTPase domain-containing protein | |
| 1166 | AZGM01000038.1 | GCA001435935_01716 | CDS | open | 14135-15529 | _na 464_aa | L%2CD-TPase catalytic domain-containing protein | |
| 1167 | AZGM01000038.1 | GCA001435935_01717 | CDS | open | 15828-16613 | _na 261_aa | phzF | Phenazine biosynthesis protein PhzF family |
| 1168 | AZGM01000038.1 | GCA001435935_01718 | CDS | open | 16986-18050 | _na 354_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 1169 | AZGM01000038.1 | GCA001435935_01719 | CDS | open | 18043-18645 | _na 200_aa | riboflavin synthase | |
| 1170 | AZGM01000038.1 | GCA001435935_01720 | CDS | open | 18645-19826 | _na 393_aa | GTP cyclohydrolase-2 | |
| 1171 | AZGM01000038.1 | GCA001435935_01721 | CDS | open | 19829-20293 | _na 154_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 1172 | AZGM01000038.1 | GCA001435935_01722 | CDS | open | 20408-21052 | _na 214_aa | NAD dependent epimerase dehydratase family protein | |
| 1173 | AZGM01000038.1 | GCA001435935_01723 | CDS | open | 21086-21736 | _na 216_aa | Nitroreductase domain-containing protein | |
| 1174 | AZGM01000038.1 | GCA001435935_01724 | CDS | open | 21855-22487 | _na 210_aa | Acetyltransferase | |
| 1175 | AZGM01000038.1 | GCA001435935_01725 | CDS | open | 22560-23882 | _na 440_aa | Aminopeptidase | |
| 1176 | AZGM01000038.1 | GCA001435935_01726 | CDS | open | 24002-24133 | _na 43_aa | hypothetical protein | |
| 1177 | AZGM01000038.1 | GCA001435935_01705 | gene | open | 94-1197 | |||
| 1178 | AZGM01000038.1 | GCA001435935_01706 | gene | open | 1292-2233 | |||
| 1179 | AZGM01000038.1 | GCA001435935_01707 | gene | open | 2321-3175 | |||
| 1180 | AZGM01000038.1 | GCA001435935_01708 | gene | open | 3188-3847 | |||
| 1181 | AZGM01000038.1 | GCA001435935_01709 | gene | open | 3844-4824 | |||
| 1182 | AZGM01000038.1 | GCA001435935_01710 | gene | open | 4913-7441 | |||
| 1183 | AZGM01000038.1 | GCA001435935_01711 | gene | open | 7879-8481 | |||
| 1184 | AZGM01000038.1 | GCA001435935_01712 | gene | open | 8652-9086 | |||
| 1185 | AZGM01000038.1 | GCA001435935_01713 | gene | open | 9172-11394 | |||
| 1186 | AZGM01000038.1 | GCA001435935_01714 | gene | open | 11544-12722 | |||
| 1187 | AZGM01000038.1 | GCA001435935_01715 | gene | open | 12783-13883 | |||
| 1188 | AZGM01000038.1 | GCA001435935_01716 | gene | open | 14135-15529 | |||
| 1189 | AZGM01000038.1 | GCA001435935_01717 | gene | open | 15828-16613 | phzF | ||
| 1190 | AZGM01000038.1 | GCA001435935_01718 | gene | open | 16986-18050 | ribD | ||
| 1191 | AZGM01000038.1 | GCA001435935_01719 | gene | open | 18043-18645 | |||
| 1192 | AZGM01000038.1 | GCA001435935_01720 | gene | open | 18645-19826 | |||
| 1193 | AZGM01000038.1 | GCA001435935_01721 | gene | open | 19829-20293 | ribH | ||
| 1194 | AZGM01000038.1 | GCA001435935_01722 | gene | open | 20408-21052 | |||
| 1195 | AZGM01000038.1 | GCA001435935_01723 | gene | open | 21086-21736 | |||
| 1196 | AZGM01000038.1 | GCA001435935_01724 | gene | open | 21855-22487 | |||
| 1197 | AZGM01000038.1 | GCA001435935_01725 | gene | open | 22560-23882 | |||
| 1198 | AZGM01000038.1 | GCA001435935_01726 | gene | open | 24002-24133 | |||
| 1199 | AZGM01000039.1 | GCA001435935_01727 | CDS | open | 370-2466 | _na 698_aa | Glycerol phosphate lipoteichoic acid synthase 1 | |
| 1200 | AZGM01000039.1 | GCA001435935_01728 | CDS | open | 2668-3567 | _na 299_aa | Membrane protein | |
| 1201 | AZGM01000039.1 | GCA001435935_01729 | CDS | open | 3623-5923 | _na 766_aa | helD | RNA polymerase recycling motor HelD |
| 1202 | AZGM01000039.1 | GCA001435935_01730 | CDS | open | 6125-6775 | _na 216_aa | SNARE-like domain protein | |
| 1203 | AZGM01000039.1 | GCA001435935_01731 | CDS | open | 6862-7512 | _na 216_aa | Phosphoglycerate mutase | |
| 1204 | AZGM01000039.1 | GCA001435935_01732 | CDS | open | 7545-8819 | _na 424_aa | hflX | GTPase HflX |
| 1205 | AZGM01000039.1 | GCA001435935_01733 | CDS | open | 8872-9777 | _na 301_aa | Permease | |
| 1206 | AZGM01000039.1 | GCA001435935_01734 | CDS | open | 9916-12540 | _na 874_aa | YhgE/Pip domain-containing protein | |
| 1207 | AZGM01000039.1 | GCA001435935_01735 | CDS | open | 12570-13118 | _na 182_aa | tetR | Transcriptional regulator%2C TetR family |
| 1208 | AZGM01000039.1 | GCA001435935_01736 | CDS | open | 13390-14442 | _na 350_aa | Maltose epimerase | |
| 1209 | AZGM01000039.1 | GCA001435935_01737 | CDS | open | 14457-14693 | _na 78_aa | pspC | Phage shock protein PspC N-terminal domain-containing protein |
| 1210 | AZGM01000039.1 | GCA001435935_01727 | gene | open | 370-2466 | |||
| 1211 | AZGM01000039.1 | GCA001435935_01728 | gene | open | 2668-3567 | |||
| 1212 | AZGM01000039.1 | GCA001435935_01729 | gene | open | 3623-5923 | helD | ||
| 1213 | AZGM01000039.1 | GCA001435935_01730 | gene | open | 6125-6775 | |||
| 1214 | AZGM01000039.1 | GCA001435935_01731 | gene | open | 6862-7512 | |||
| 1215 | AZGM01000039.1 | GCA001435935_01732 | gene | open | 7545-8819 | hflX | ||
| 1216 | AZGM01000039.1 | GCA001435935_01733 | gene | open | 8872-9777 | |||
| 1217 | AZGM01000039.1 | GCA001435935_01734 | gene | open | 9916-12540 | |||
| 1218 | AZGM01000039.1 | GCA001435935_01735 | gene | open | 12570-13118 | tetR | ||
| 1219 | AZGM01000039.1 | GCA001435935_01736 | gene | open | 13390-14442 | |||
| 1220 | AZGM01000039.1 | GCA001435935_01737 | gene | open | 14457-14693 | pspC | ||
| 1221 | AZGM01000040.1 | GCA001435935_01757 | CDS | open | 395-673 | _na 92_aa | Carbon dioxide concentrating mechanism carboxysome shell protein | |
| 1222 | AZGM01000040.1 | GCA001435935_01758 | CDS | open | 737-1456 | _na 239_aa | pduB | propanediol utilization microcompartment protein PduB |
| 1223 | AZGM01000040.1 | GCA001435935_01759 | CDS | open | 1483-3159 | _na 558_aa | Propanediol dehydratase large subunit | |
| 1224 | AZGM01000040.1 | GCA001435935_01760 | CDS | open | 3183-3881 | _na 232_aa | Propanediol dehydratase medium subunit | |
| 1225 | AZGM01000040.1 | GCA001435935_01761 | CDS | open | 3896-4411 | _na 171_aa | Propanediol dehydratase small subunit | |
| 1226 | AZGM01000040.1 | GCA001435935_01762 | CDS | open | 4440-6290 | _na 616_aa | diol dehydratase reactivase subunit alpha | |
| 1227 | AZGM01000040.1 | GCA001435935_01763 | CDS | open | 6280-6654 | _na 124_aa | Diol dehydratase reactivation protein | |
| 1228 | AZGM01000040.1 | GCA001435935_01764 | CDS | open | 6669-7244 | _na 191_aa | Propanediol utilization protein | |
| 1229 | AZGM01000040.1 | GCA001435935_01765 | CDS | open | 7257-7544 | _na 95_aa | eutM | Ethanolamine utilization polyhedral-body-like protein EutM |
| 1230 | AZGM01000040.1 | GCA001435935_01766 | CDS | open | 7707-8210 | _na 167_aa | pduM | PduM family microcompartment protein |
| 1231 | AZGM01000040.1 | GCA001435935_01767 | CDS | open | 8198-8467 | _na 89_aa | eutN | Ethanolamine utilization protein EutN |
| 1232 | AZGM01000040.1 | GCA001435935_01768 | CDS | open | 8485-9072 | _na 195_aa | Corrinoid adenosyltransferase | |
| 1233 | AZGM01000040.1 | GCA001435935_01769 | CDS | open | 9076-9600 | _na 174_aa | ATP cob(I)alamin adenosyltransferase | |
| 1234 | AZGM01000040.1 | GCA001435935_01770 | CDS | open | 9655-10776 | _na 373_aa | Alcohol dehydrogenase class IV | |
| 1235 | AZGM01000040.1 | GCA001435935_01771 | CDS | open | 10805-11149 | _na 114_aa | eutS | Ethanolamine utilization protein EutS |
| 1236 | AZGM01000040.1 | GCA001435935_01772 | CDS | open | 11286-12068 | _na 260_aa | Protein tyrosine serine phosphatase | |
| 1237 | AZGM01000040.1 | GCA001435935_01773 | CDS | open | 12087-12653 | _na 188_aa | Permease cadmium resistance protein family protein | |
| 1238 | AZGM01000040.1 | GCA001435935_01774 | CDS | open | 12670-13206 | _na 178_aa | NAD(P)H dehydrogenase | |
| 1239 | AZGM01000040.1 | GCA001435935_01775 | CDS | open | 13390-13755 | _na 121_aa | type II toxin-antitoxin system RelE/ParE family toxin | |
| 1240 | AZGM01000040.1 | GCA001435935_01776 | CDS | open | 13752-14030 | _na 92_aa | HTH cro/C1-type domain-containing protein | |
| 1241 | AZGM01000040.1 | GCA001435935_01777 | CDS | open | 14283-14714 | _na 143_aa | eutP | Ethanolamine utilization protein%2C EutP |
| 1242 | AZGM01000040.1 | GCA001435935_01757 | gene | open | 395-673 | |||
| 1243 | AZGM01000040.1 | GCA001435935_01758 | gene | open | 737-1456 | pduB | ||
| 1244 | AZGM01000040.1 | GCA001435935_01759 | gene | open | 1483-3159 | |||
| 1245 | AZGM01000040.1 | GCA001435935_01760 | gene | open | 3183-3881 | |||
| 1246 | AZGM01000040.1 | GCA001435935_01761 | gene | open | 3896-4411 | |||
| 1247 | AZGM01000040.1 | GCA001435935_01762 | gene | open | 4440-6290 | |||
| 1248 | AZGM01000040.1 | GCA001435935_01763 | gene | open | 6280-6654 | |||
| 1249 | AZGM01000040.1 | GCA001435935_01764 | gene | open | 6669-7244 | |||
| 1250 | AZGM01000040.1 | GCA001435935_01765 | gene | open | 7257-7544 | eutM | ||
| 1251 | AZGM01000040.1 | GCA001435935_01766 | gene | open | 7707-8210 | pduM | ||
| 1252 | AZGM01000040.1 | GCA001435935_01767 | gene | open | 8198-8467 | eutN | ||
| 1253 | AZGM01000040.1 | GCA001435935_01768 | gene | open | 8485-9072 | |||
| 1254 | AZGM01000040.1 | GCA001435935_01769 | gene | open | 9076-9600 | |||
| 1255 | AZGM01000040.1 | GCA001435935_01770 | gene | open | 9655-10776 | |||
| 1256 | AZGM01000040.1 | GCA001435935_01771 | gene | open | 10805-11149 | eutS | ||
| 1257 | AZGM01000040.1 | GCA001435935_01772 | gene | open | 11286-12068 | |||
| 1258 | AZGM01000040.1 | GCA001435935_01773 | gene | open | 12087-12653 | |||
| 1259 | AZGM01000040.1 | GCA001435935_01774 | gene | open | 12670-13206 | |||
| 1260 | AZGM01000040.1 | GCA001435935_01775 | gene | open | 13390-13755 | |||
| 1261 | AZGM01000040.1 | GCA001435935_01776 | gene | open | 13752-14030 | |||
| 1262 | AZGM01000040.1 | GCA001435935_01777 | gene | open | 14283-14714 | eutP | ||
| 1263 | AZGM01000042.1 | GCA001435935_01778 | CDS | open | 177-752 | _na 191_aa | Flavin reductase | |
| 1264 | AZGM01000042.1 | GCA001435935_01779 | CDS | open | 752-1987 | _na 411_aa | NADPH-dependent FMN reductase-like domain-containing protein | |
| 1265 | AZGM01000042.1 | GCA001435935_01780 | CDS | open | 1997-2920 | _na 307_aa | FAD:protein FMN transferase | |
| 1266 | AZGM01000042.1 | GCA001435935_01781 | CDS | open | 3282-4580 | _na 432_aa | serS | serine--tRNA ligase |
| 1267 | AZGM01000042.1 | GCA001435935_01782 | CDS | open | 4857-6320 | _na 487_aa | ABC transporter%2C permease protein | |
| 1268 | AZGM01000042.1 | GCA001435935_01783 | CDS | open | 6322-7065 | _na 247_aa | ABC transporter%2C ATP-binding protein | |
| 1269 | AZGM01000042.1 | GCA001435935_01784 | CDS | open | 7488-8846 | _na 452_aa | D-serine D-alanine glycine transporter | |
| 1270 | AZGM01000042.1 | GCA001435935_01778 | gene | open | 177-752 | |||
| 1271 | AZGM01000042.1 | GCA001435935_01779 | gene | open | 752-1987 | |||
| 1272 | AZGM01000042.1 | GCA001435935_01780 | gene | open | 1997-2920 | |||
| 1273 | AZGM01000042.1 | GCA001435935_01781 | gene | open | 3282-4580 | serS | ||
| 1274 | AZGM01000042.1 | GCA001435935_01782 | gene | open | 4857-6320 | |||
| 1275 | AZGM01000042.1 | GCA001435935_01783 | gene | open | 6322-7065 | |||
| 1276 | AZGM01000042.1 | GCA001435935_01784 | gene | open | 7488-8846 | |||
| 1277 | AZGM01000043.1 | GCA001435935_01785 | CDS | open | 73-1992 | _na 639_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 1278 | AZGM01000043.1 | GCA001435935_01786 | CDS | open | 2197-4143 | _na 648_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 1279 | AZGM01000043.1 | GCA001435935_01787 | CDS | open | 4152-5540 | _na 462_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 1280 | AZGM01000043.1 | GCA001435935_01788 | CDS | open | 5684-6484 | _na 266_aa | jag | RNA-binding cell elongation regulator Jag/EloR |
| 1281 | AZGM01000043.1 | GCA001435935_01789 | CDS | open | 6630-7355 | _na 241_aa | Peptidase c26 | |
| 1282 | AZGM01000043.1 | GCA001435935_01790 | CDS | open | 7437-8018 | _na 193_aa | Glutamate--cysteine ligase | |
| 1283 | AZGM01000043.1 | GCA001435935_01791 | CDS | open | 8029-8778 | _na 249_aa | Glutamate--cysteine ligase | |
| 1284 | AZGM01000043.1 | GCA001435935_01785 | gene | open | 73-1992 | asnB | ||
| 1285 | AZGM01000043.1 | GCA001435935_01786 | gene | open | 2197-4143 | mnmG | ||
| 1286 | AZGM01000043.1 | GCA001435935_01787 | gene | open | 4152-5540 | mnmE | ||
| 1287 | AZGM01000043.1 | GCA001435935_01788 | gene | open | 5684-6484 | jag | ||
| 1288 | AZGM01000043.1 | GCA001435935_01789 | gene | open | 6630-7355 | |||
| 1289 | AZGM01000043.1 | GCA001435935_01790 | gene | open | 7437-8018 | |||
| 1290 | AZGM01000043.1 | GCA001435935_01791 | gene | open | 8029-8778 | |||
| 1291 | AZGM01000044.1 | regulatory_region | open | 10066-10309 | T-box leader | |||
| 1292 | AZGM01000044.1 | GCA001435935_01792 | CDS | open | 183-1178 | _na 331_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 1293 | AZGM01000044.1 | GCA001435935_01793 | CDS | open | 1458-2960 | _na 500_aa | Glycosyl transferase family 1 domain-containing protein | |
| 1294 | AZGM01000044.1 | GCA001435935_01794 | CDS | open | 2963-4504 | _na 513_aa | Glycosyltransferase | |
| 1295 | AZGM01000044.1 | GCA001435935_01795 | CDS | open | 4632-5153 | _na 173_aa | hypothetical protein | |
| 1296 | AZGM01000044.1 | GCA001435935_01796 | CDS | open | 5267-5695 | _na 142_aa | msrB | Peptide methionine sulfoxide reductase MsrB |
| 1297 | AZGM01000044.1 | GCA001435935_01797 | CDS | open | 5767-5865 | _na 32_aa | hypothetical protein | |
| 1298 | AZGM01000044.1 | GCA001435935_01798 | CDS | open | 6216-7358 | _na 380_aa | putative succinyl-diaminopimelate desuccinylase | |
| 1299 | AZGM01000044.1 | GCA001435935_01799 | CDS | open | 7377-8066 | _na 229_aa | ABC transporter%2C permease protein | |
| 1300 | AZGM01000044.1 | GCA001435935_01800 | CDS | open | 8059-9123 | _na 354_aa | D-methionine ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 1301 | AZGM01000044.1 | GCA001435935_01801 | CDS | open | 9135-9986 | _na 283_aa | Lipoprotein | |
| 1302 | AZGM01000044.1 | GCA001435935_01802 | CDS | open | 10439-11425 | _na 328_aa | Sugar-binding domain protein | |
| 1303 | AZGM01000044.1 | GCA001435935_01803 | CDS | open | 11703-12113 | _na 136_aa | Glyoxalase/bleomycin resistance/extradiol dioxygenase family protein | |
| 1304 | AZGM01000044.1 | GCA001435935_01804 | CDS | open | 12145-13164 | _na 339_aa | L-threonine 3-dehydrogenase | |
| 1305 | AZGM01000044.1 | GCA001435935_01805 | CDS | open | 13326-14264 | _na 312_aa | L-lactate dehydrogenase | |
| 1306 | AZGM01000044.1 | GCA001435935_01806 | CDS | open | 14381-15571 | _na 396_aa | Transporter%2C major facilitator family protein | |
| 1307 | AZGM01000044.1 | GCA001435935_01807 | CDS | open | 15587-16342 | _na 251_aa | putative membrane transporter protein | |
| 1308 | AZGM01000044.1 | GCA001435935_01808 | CDS | open | 16398-17357 | _na 319_aa | Glyoxylate reductase | |
| 1309 | AZGM01000044.1 | GCA001435935_01809 | CDS | open | 17455-18096 | _na 213_aa | nth | endonuclease III |
| 1310 | AZGM01000044.1 | GCA001435935_01810 | CDS | open | 18366-19799 | _na 477_aa | Amino acid permease | |
| 1311 | AZGM01000044.1 | GCA001435935_01812 | CDS | open | 21302-22603 | _na 433_aa | Transporter%2C major facilitator family protein | |
| 1312 | AZGM01000044.1 | GCA001435935_01813 | CDS | open | 22812-24191 | _na 459_aa | 6-phospho-beta-glucosidase | |
| 1313 | AZGM01000044.1 | GCA001435935_01814 | CDS | open | 24220-25089 | _na 289_aa | ROK family sugar kinase | |
| 1314 | AZGM01000044.1 | GCA001435935_01815 | CDS | open | 25105-25818 | _na 237_aa | gmuR | HTH-type transcriptional regulator GmuR |
| 1315 | AZGM01000044.1 | GCA001435935_01816 | CDS | open | 25950-26915 | _na 321_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 1316 | AZGM01000044.1 | GCA001435935_01817 | CDS | open | 27318-28466 | _na 382_aa | cysteine-S-conjugate beta-lyase | |
| 1317 | AZGM01000044.1 | GCA001435935_01818 | CDS | open | 28479-29597 | _na 372_aa | Cystathionine gamma-synthase | |
| 1318 | AZGM01000044.1 | GCA001435935_01819 | CDS | open | 29637-30188 | _na 183_aa | Hydrophobic protein | |
| 1319 | AZGM01000044.1 | GCA001435935_01820 | CDS | open | 30302-30823 | _na 173_aa | Acetyltransferase | |
| 1320 | AZGM01000044.1 | GCA001435935_01821 | CDS | open | 30873-31673 | _na 266_aa | Oxidoreductase%2C short chain dehydrogenase reductase family protein | |
| 1321 | AZGM01000044.1 | GCA001435935_01822 | CDS | open | 31814-33154 | _na 446_aa | Chloride transporter%2C ClC family | |
| 1322 | AZGM01000044.1 | GCA001435935_01823 | CDS | open | 33268-34428 | _na 386_aa | Transporter%2C CPA2 family | |
| 1323 | AZGM01000044.1 | GCA001435935_01824 | CDS | open | 34640-36955 | _na 771_aa | helD | RNA polymerase recycling motor HelD |
| 1324 | AZGM01000044.1 | GCA001435935_01825 | CDS | open | 37022-37486 | _na 154_aa | ndk | nucleoside-diphosphate kinase |
| 1325 | AZGM01000044.1 | GCA001435935_01792 | gene | open | 183-1178 | |||
| 1326 | AZGM01000044.1 | GCA001435935_01793 | gene | open | 1458-2960 | |||
| 1327 | AZGM01000044.1 | GCA001435935_01794 | gene | open | 2963-4504 | |||
| 1328 | AZGM01000044.1 | GCA001435935_01795 | gene | open | 4632-5153 | |||
| 1329 | AZGM01000044.1 | GCA001435935_01796 | gene | open | 5267-5695 | msrB | ||
| 1330 | AZGM01000044.1 | GCA001435935_01797 | gene | open | 5767-5865 | |||
| 1331 | AZGM01000044.1 | GCA001435935_01798 | gene | open | 6216-7358 | |||
| 1332 | AZGM01000044.1 | GCA001435935_01799 | gene | open | 7377-8066 | |||
| 1333 | AZGM01000044.1 | GCA001435935_01800 | gene | open | 8059-9123 | |||
| 1334 | AZGM01000044.1 | GCA001435935_01801 | gene | open | 9135-9986 | |||
| 1335 | AZGM01000044.1 | GCA001435935_01802 | gene | open | 10439-11425 | |||
| 1336 | AZGM01000044.1 | GCA001435935_01803 | gene | open | 11703-12113 | |||
| 1337 | AZGM01000044.1 | GCA001435935_01804 | gene | open | 12145-13164 | |||
| 1338 | AZGM01000044.1 | GCA001435935_01805 | gene | open | 13326-14264 | |||
| 1339 | AZGM01000044.1 | GCA001435935_01806 | gene | open | 14381-15571 | |||
| 1340 | AZGM01000044.1 | GCA001435935_01807 | gene | open | 15587-16342 | |||
| 1341 | AZGM01000044.1 | GCA001435935_01808 | gene | open | 16398-17357 | |||
| 1342 | AZGM01000044.1 | GCA001435935_01809 | gene | open | 17455-18096 | nth | ||
| 1343 | AZGM01000044.1 | GCA001435935_01810 | gene | open | 18366-19799 | |||
| 1344 | AZGM01000044.1 | GCA001435935_01812 | gene | open | 21302-22603 | |||
| 1345 | AZGM01000044.1 | GCA001435935_01813 | gene | open | 22812-24191 | |||
| 1346 | AZGM01000044.1 | GCA001435935_01814 | gene | open | 24220-25089 | |||
| 1347 | AZGM01000044.1 | GCA001435935_01815 | gene | open | 25105-25818 | gmuR | ||
| 1348 | AZGM01000044.1 | GCA001435935_01816 | gene | open | 25950-26915 | manA | ||
| 1349 | AZGM01000044.1 | GCA001435935_01817 | gene | open | 27318-28466 | |||
| 1350 | AZGM01000044.1 | GCA001435935_01818 | gene | open | 28479-29597 | |||
| 1351 | AZGM01000044.1 | GCA001435935_01819 | gene | open | 29637-30188 | |||
| 1352 | AZGM01000044.1 | GCA001435935_01820 | gene | open | 30302-30823 | |||
| 1353 | AZGM01000044.1 | GCA001435935_01821 | gene | open | 30873-31673 | |||
| 1354 | AZGM01000044.1 | GCA001435935_01822 | gene | open | 31814-33154 | |||
| 1355 | AZGM01000044.1 | GCA001435935_01823 | gene | open | 33268-34428 | |||
| 1356 | AZGM01000044.1 | GCA001435935_01824 | gene | open | 34640-36955 | helD | ||
| 1357 | AZGM01000044.1 | GCA001435935_01825 | gene | open | 37022-37486 | ndk | ||
| 1358 | AZGM01000044.1 | GCA001435935_01811 | gene | open | 19900-19972 | trnT | ||
| 1359 | AZGM01000044.1 | GCA001435935_01811 | tRNA | open | 19900-19972 | trnT | tRNA-Thr(ggt) | |
| 1360 | AZGM01000045.1 | GCA001435935_01826 | CDS | open | 464-850 | _na 128_aa | Transaminase | |
| 1361 | AZGM01000045.1 | GCA001435935_01827 | CDS | open | 789-1586 | _na 265_aa | Aminotransferase | |
| 1362 | AZGM01000045.1 | GCA001435935_01828 | CDS | open | 1632-2171 | _na 179_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 1363 | AZGM01000045.1 | GCA001435935_01829 | CDS | open | 2352-2645 | _na 97_aa | dinJ | Addiction module antitoxin%2C RelB DinJ family |
| 1364 | AZGM01000045.1 | GCA001435935_01830 | CDS | open | 2815-5043 | _na 742_aa | Alpha-galactosidase | |
| 1365 | AZGM01000045.1 | GCA001435935_01831 | CDS | open | 5140-6075 | _na 311_aa | Transcriptional regulator | |
| 1366 | AZGM01000045.1 | GCA001435935_01826 | gene | open | 464-850 | |||
| 1367 | AZGM01000045.1 | GCA001435935_01827 | gene | open | 789-1586 | |||
| 1368 | AZGM01000045.1 | GCA001435935_01828 | gene | open | 1632-2171 | hpt | ||
| 1369 | AZGM01000045.1 | GCA001435935_01829 | gene | open | 2352-2645 | dinJ | ||
| 1370 | AZGM01000045.1 | GCA001435935_01830 | gene | open | 2815-5043 | |||
| 1371 | AZGM01000045.1 | GCA001435935_01831 | gene | open | 5140-6075 | |||
| 1372 | AZGM01000046.1 | GCA001435935_01832 | CDS | open | 174-1565 | _na 463_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 1373 | AZGM01000046.1 | GCA001435935_01833 | CDS | open | 1629-2033 | _na 134_aa | DUF2628 domain-containing protein | |
| 1374 | AZGM01000046.1 | GCA001435935_01834 | CDS | open | 2102-2833 | _na 243_aa | B3 4 domain-containing protein | |
| 1375 | AZGM01000046.1 | GCA001435935_01835 | CDS | open | 2854-3306 | _na 150_aa | marR | Transcriptional regulator%2C MarR family |
| 1376 | AZGM01000046.1 | GCA001435935_01836 | CDS | open | 3361-3987 | _na 208_aa | GyrI-like small molecule binding domain-containing protein | |
| 1377 | AZGM01000046.1 | GCA001435935_01837 | CDS | open | 4247-4783 | _na 178_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 1378 | AZGM01000046.1 | GCA001435935_01838 | CDS | open | 4954-5745 | _na 263_aa | DUF5011 domain-containing protein | |
| 1379 | AZGM01000046.1 | GCA001435935_01839 | CDS | open | 6042-7340 | _na 432_aa | purA | adenylosuccinate synthase |
| 1380 | AZGM01000046.1 | GCA001435935_01840 | CDS | open | 7537-8511 | _na 324_aa | GMP reductase | |
| 1381 | AZGM01000046.1 | GCA001435935_01841 | CDS | open | 8572-9834 | _na 420_aa | histidine kinase | |
| 1382 | AZGM01000046.1 | GCA001435935_01842 | CDS | open | 9841-10500 | _na 219_aa | DNA-binding response regulator | |
| 1383 | AZGM01000046.1 | GCA001435935_01843 | CDS | open | 10509-11117 | _na 202_aa | spoT | RelA SpoT domain protein |
| 1384 | AZGM01000046.1 | GCA001435935_01844 | CDS | open | 11199-12980 | _na 593_aa | Glycerophosphodiesterase | |
| 1385 | AZGM01000046.1 | GCA001435935_01845 | CDS | open | 12990-14186 | _na 398_aa | Major facilitator superfamily MFS 1 transporter | |
| 1386 | AZGM01000046.1 | GCA001435935_01846 | CDS | open | 14448-14744 | _na 98_aa | Cupin 2 conserved barrel domain-containing protein | |
| 1387 | AZGM01000046.1 | GCA001435935_01847 | CDS | open | 14756-15622 | _na 288_aa | Glyoxal reductase | |
| 1388 | AZGM01000046.1 | GCA001435935_01848 | CDS | open | 15953-16615 | _na 220_aa | pgmB | beta-phosphoglucomutase |
| 1389 | AZGM01000046.1 | GCA001435935_01849 | CDS | open | 16635-18887 | _na 750_aa | aTH1 | Maltose phosphorylase / Trehalose phosphorylase |
| 1390 | AZGM01000046.1 | GCA001435935_01850 | CDS | open | 18976-20322 | _na 448_aa | melB | Major facilitator transporter |
| 1391 | AZGM01000046.1 | GCA001435935_01851 | CDS | open | 20512-21687 | _na 391_aa | acetyl-CoA C-acetyltransferase | |
| 1392 | AZGM01000046.1 | GCA001435935_01852 | CDS | open | 21995-22933 | _na 312_aa | lacI | Transcriptional regulator%2C LacI family |
| 1393 | AZGM01000046.1 | GCA001435935_01853 | CDS | open | 22956-27095 | _na 1379_aa | addA | helicase-exonuclease AddAB subunit AddA |
| 1394 | AZGM01000046.1 | GCA001435935_01854 | CDS | open | 27097-30855 | _na 1252_aa | ATP-dependent helicase/deoxyribonuclease subunit B | |
| 1395 | AZGM01000046.1 | GCA001435935_01855 | CDS | open | 30997-32463 | _na 488_aa | cls | cardiolipin synthase |
| 1396 | AZGM01000046.1 | GCA001435935_01856 | CDS | open | 32593-33177 | _na 194_aa | Acetyltransferase%2C GNAT family | |
| 1397 | AZGM01000046.1 | GCA001435935_01857 | CDS | open | 33193-33702 | _na 169_aa | hypothetical protein | |
| 1398 | AZGM01000046.1 | GCA001435935_01858 | CDS | open | 33955-34953 | _na 332_aa | D-lactate dehydrogenase | |
| 1399 | AZGM01000046.1 | GCA001435935_01859 | CDS | open | 35169-36164 | _na 331_aa | D-lactate dehydrogenase | |
| 1400 | AZGM01000046.1 | GCA001435935_01832 | gene | open | 174-1565 | rlmD | ||
| 1401 | AZGM01000046.1 | GCA001435935_01833 | gene | open | 1629-2033 | |||
| 1402 | AZGM01000046.1 | GCA001435935_01834 | gene | open | 2102-2833 | |||
| 1403 | AZGM01000046.1 | GCA001435935_01835 | gene | open | 2854-3306 | marR | ||
| 1404 | AZGM01000046.1 | GCA001435935_01836 | gene | open | 3361-3987 | |||
| 1405 | AZGM01000046.1 | GCA001435935_01837 | gene | open | 4247-4783 | pyrR | ||
| 1406 | AZGM01000046.1 | GCA001435935_01838 | gene | open | 4954-5745 | |||
| 1407 | AZGM01000046.1 | GCA001435935_01839 | gene | open | 6042-7340 | purA | ||
| 1408 | AZGM01000046.1 | GCA001435935_01840 | gene | open | 7537-8511 | |||
| 1409 | AZGM01000046.1 | GCA001435935_01841 | gene | open | 8572-9834 | |||
| 1410 | AZGM01000046.1 | GCA001435935_01842 | gene | open | 9841-10500 | |||
| 1411 | AZGM01000046.1 | GCA001435935_01843 | gene | open | 10509-11117 | spoT | ||
| 1412 | AZGM01000046.1 | GCA001435935_01844 | gene | open | 11199-12980 | |||
| 1413 | AZGM01000046.1 | GCA001435935_01845 | gene | open | 12990-14186 | |||
| 1414 | AZGM01000046.1 | GCA001435935_01846 | gene | open | 14448-14744 | |||
| 1415 | AZGM01000046.1 | GCA001435935_01847 | gene | open | 14756-15622 | |||
| 1416 | AZGM01000046.1 | GCA001435935_01848 | gene | open | 15953-16615 | pgmB | ||
| 1417 | AZGM01000046.1 | GCA001435935_01849 | gene | open | 16635-18887 | aTH1 | ||
| 1418 | AZGM01000046.1 | GCA001435935_01850 | gene | open | 18976-20322 | melB | ||
| 1419 | AZGM01000046.1 | GCA001435935_01851 | gene | open | 20512-21687 | |||
| 1420 | AZGM01000046.1 | GCA001435935_01852 | gene | open | 21995-22933 | lacI | ||
| 1421 | AZGM01000046.1 | GCA001435935_01853 | gene | open | 22956-27095 | addA | ||
| 1422 | AZGM01000046.1 | GCA001435935_01854 | gene | open | 27097-30855 | |||
| 1423 | AZGM01000046.1 | GCA001435935_01855 | gene | open | 30997-32463 | cls | ||
| 1424 | AZGM01000046.1 | GCA001435935_01856 | gene | open | 32593-33177 | |||
| 1425 | AZGM01000046.1 | GCA001435935_01857 | gene | open | 33193-33702 | |||
| 1426 | AZGM01000046.1 | GCA001435935_01858 | gene | open | 33955-34953 | |||
| 1427 | AZGM01000046.1 | GCA001435935_01859 | gene | open | 35169-36164 | |||
| 1428 | AZGM01000047.1 | GCA001435935_01860 | CDS | open | 186-1133 | _na 315_aa | Lipoprotein | |
| 1429 | AZGM01000047.1 | GCA001435935_01861 | CDS | open | 1281-1958 | _na 225_aa | Putative extracellular protein | |
| 1430 | AZGM01000047.1 | GCA001435935_01862 | CDS | open | 2374-3354 | _na 326_aa | cotH | CotH kinase protein |
| 1431 | AZGM01000047.1 | GCA001435935_01863 | CDS | open | 3472-3681 | _na 69_aa | hypothetical protein | |
| 1432 | AZGM01000047.1 | GCA001435935_01864 | CDS | open | 3776-5281 | _na 501_aa | Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 1433 | AZGM01000047.1 | GCA001435935_01865 | CDS | open | 5450-5689 | _na 79_aa | DUF5659 domain-containing protein | |
| 1434 | AZGM01000047.1 | GCA001435935_01866 | CDS | open | 5778-6050 | _na 90_aa | DUF771 domain-containing protein | |
| 1435 | AZGM01000047.1 | GCA001435935_01867 | CDS | open | 6149-6424 | _na 91_aa | hypothetical protein | |
| 1436 | AZGM01000047.1 | GCA001435935_01860 | gene | open | 186-1133 | |||
| 1437 | AZGM01000047.1 | GCA001435935_01861 | gene | open | 1281-1958 | |||
| 1438 | AZGM01000047.1 | GCA001435935_01862 | gene | open | 2374-3354 | cotH | ||
| 1439 | AZGM01000047.1 | GCA001435935_01863 | gene | open | 3472-3681 | |||
| 1440 | AZGM01000047.1 | GCA001435935_01864 | gene | open | 3776-5281 | |||
| 1441 | AZGM01000047.1 | GCA001435935_01865 | gene | open | 5450-5689 | |||
| 1442 | AZGM01000047.1 | GCA001435935_01866 | gene | open | 5778-6050 | |||
| 1443 | AZGM01000047.1 | GCA001435935_01867 | gene | open | 6149-6424 | |||
| 1444 | AZGM01000049.1 | GCA001435935_01868 | CDS | open | 310-786 | _na 158_aa | Sensory protein | |
| 1445 | AZGM01000049.1 | GCA001435935_01868 | gene | open | 310-786 | |||
| 1446 | AZGM01000050.1 | GCA001435935_01870 | CDS | open | 209-664 | _na 151_aa | UPF0756 membrane protein HMPREF0494_1717 | |
| 1447 | AZGM01000050.1 | GCA001435935_01871 | CDS | open | 726-1349 | _na 207_aa | Integral membrane protein | |
| 1448 | AZGM01000050.1 | GCA001435935_01872 | CDS | open | 1349-2224 | _na 291_aa | degV | DegV family protein |
| 1449 | AZGM01000050.1 | GCA001435935_01873 | CDS | open | 2435-4111 | _na 558_aa | rqcH | Rqc2-like protein RqcH |
| 1450 | AZGM01000050.1 | GCA001435935_01870 | gene | open | 209-664 | |||
| 1451 | AZGM01000050.1 | GCA001435935_01871 | gene | open | 726-1349 | |||
| 1452 | AZGM01000050.1 | GCA001435935_01872 | gene | open | 1349-2224 | degV | ||
| 1453 | AZGM01000050.1 | GCA001435935_01873 | gene | open | 2435-4111 | rqcH | ||
| 1454 | AZGM01000051.1 | rep_origin | open | 1536-2013 | ||||
| 1455 | AZGM01000051.1 | GCA001435935_01874 | CDS | open | 78-908 | _na 276_aa | yidC | Membrane protein insertase YidC |
| 1456 | AZGM01000051.1 | GCA001435935_01875 | CDS | open | 920-1264 | _na 114_aa | rnpA | ribonuclease P protein component |
| 1457 | AZGM01000051.1 | GCA001435935_01876 | CDS | open | 1401-1535 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 1458 | AZGM01000051.1 | GCA001435935_01877 | CDS | open | 2014-3324 | _na 436_aa | dnaA | chromosomal replication initiator protein DnaA |
| 1459 | AZGM01000051.1 | GCA001435935_01878 | CDS | open | 3501-4643 | _na 380_aa | dnaN | DNA polymerase III subunit beta |
| 1460 | AZGM01000051.1 | GCA001435935_01879 | CDS | open | 4871-5092 | _na 73_aa | yaaA | S4 domain-containing protein YaaA |
| 1461 | AZGM01000051.1 | GCA001435935_01880 | CDS | open | 5103-6224 | _na 373_aa | recF | DNA replication/repair protein RecF |
| 1462 | AZGM01000051.1 | GCA001435935_01881 | CDS | open | 6224-8170 | _na 648_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 1463 | AZGM01000051.1 | GCA001435935_01882 | CDS | open | 8202-10715 | _na 837_aa | gyrA | DNA gyrase subunit A |
| 1464 | AZGM01000051.1 | GCA001435935_01883 | CDS | open | 10906-11202 | _na 98_aa | rpsF | 30S ribosomal protein S6 |
| 1465 | AZGM01000051.1 | GCA001435935_01884 | CDS | open | 11238-11813 | _na 191_aa | Single-stranded DNA-binding protein | |
| 1466 | AZGM01000051.1 | GCA001435935_01885 | CDS | open | 11846-12082 | _na 78_aa | rpsR | 30S ribosomal protein S18 |
| 1467 | AZGM01000051.1 | GCA001435935_01886 | CDS | open | 12420-13601 | _na 393_aa | MFS family major facilitator transporter | |
| 1468 | AZGM01000051.1 | GCA001435935_01887 | CDS | open | 13776-15797 | _na 673_aa | Cyclic-di-AMP phosphodiesterase | |
| 1469 | AZGM01000051.1 | GCA001435935_01888 | CDS | open | 15803-16255 | _na 150_aa | rplI | 50S ribosomal protein L9 |
| 1470 | AZGM01000051.1 | GCA001435935_01889 | CDS | open | 16289-17701 | _na 470_aa | dnaB | replicative DNA helicase |
| 1471 | AZGM01000051.1 | GCA001435935_01890 | CDS | open | 17798-19000 | _na 400_aa | Transporter%2C major facilitator family protein | |
| 1472 | AZGM01000051.1 | GCA001435935_01891 | CDS | open | 19010-19321 | _na 103_aa | RNHCP domain-containing protein | |
| 1473 | AZGM01000051.1 | GCA001435935_01874 | gene | open | 78-908 | yidC | ||
| 1474 | AZGM01000051.1 | GCA001435935_01875 | gene | open | 920-1264 | rnpA | ||
| 1475 | AZGM01000051.1 | GCA001435935_01876 | gene | open | 1401-1535 | rpmH | ||
| 1476 | AZGM01000051.1 | GCA001435935_01877 | gene | open | 2014-3324 | dnaA | ||
| 1477 | AZGM01000051.1 | GCA001435935_01878 | gene | open | 3501-4643 | dnaN | ||
| 1478 | AZGM01000051.1 | GCA001435935_01879 | gene | open | 4871-5092 | yaaA | ||
| 1479 | AZGM01000051.1 | GCA001435935_01880 | gene | open | 5103-6224 | recF | ||
| 1480 | AZGM01000051.1 | GCA001435935_01881 | gene | open | 6224-8170 | gyrB | ||
| 1481 | AZGM01000051.1 | GCA001435935_01882 | gene | open | 8202-10715 | gyrA | ||
| 1482 | AZGM01000051.1 | GCA001435935_01883 | gene | open | 10906-11202 | rpsF | ||
| 1483 | AZGM01000051.1 | GCA001435935_01884 | gene | open | 11238-11813 | |||
| 1484 | AZGM01000051.1 | GCA001435935_01885 | gene | open | 11846-12082 | rpsR | ||
| 1485 | AZGM01000051.1 | GCA001435935_01886 | gene | open | 12420-13601 | |||
| 1486 | AZGM01000051.1 | GCA001435935_01887 | gene | open | 13776-15797 | |||
| 1487 | AZGM01000051.1 | GCA001435935_01888 | gene | open | 15803-16255 | rplI | ||
| 1488 | AZGM01000051.1 | GCA001435935_01889 | gene | open | 16289-17701 | dnaB | ||
| 1489 | AZGM01000051.1 | GCA001435935_01890 | gene | open | 17798-19000 | |||
| 1490 | AZGM01000051.1 | GCA001435935_01891 | gene | open | 19010-19321 | |||
| 1491 | AZGM01000052.1 | regulatory_region | open | 14545-14678 | Ribosomal protein L20 leader | |||
| 1492 | AZGM01000052.1 | GCA001435935_01892 | CDS | open | 225-443 | _na 72_aa | hypothetical protein | |
| 1493 | AZGM01000052.1 | GCA001435935_01893 | CDS | open | 443-877 | _na 144_aa | HIT family protein | |
| 1494 | AZGM01000052.1 | GCA001435935_01894 | CDS | open | 999-1736 | _na 245_aa | ecsA | ABC transporter%2C ATP-binding protein EcsA |
| 1495 | AZGM01000052.1 | GCA001435935_01895 | CDS | open | 1729-2937 | _na 402_aa | ABC superfamily ATP binding cassette transporter | |
| 1496 | AZGM01000052.1 | GCA001435935_01896 | CDS | open | 2939-3580 | _na 213_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 1497 | AZGM01000052.1 | GCA001435935_01897 | CDS | open | 3710-3964 | _na 84_aa | PepSY domain-containing protein | |
| 1498 | AZGM01000052.1 | GCA001435935_01898 | CDS | open | 4113-4433 | _na 106_aa | Thioredoxin | |
| 1499 | AZGM01000052.1 | GCA001435935_01899 | CDS | open | 4547-5194 | _na 215_aa | ytpR | YtpR family tRNA-binding protein |
| 1500 | AZGM01000052.1 | GCA001435935_01900 | CDS | open | 5326-6636 | _na 436_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |

