BAKTAGenome Explorer: Olsenella uli (GCA_001437585.1)
Select a Genome:
|
BAKTA Annotations for GCA_001437585.1
|
Search & Sort all 3670 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JQCO01000001.1 | GCA001437585_00429 | gene | open | 499232-499600 | RNaseP_bact_a | ||
| 2 | JQCO01000001.1 | GCA001437585_00429 | ncRNA | open | 499232-499600 | Bacterial RNase P class A | ||
| 3 | JQCO01000001.1 | regulatory_region | open | 92594-92842 | raiA RNA | |||
| 4 | JQCO01000001.1 | regulatory_region | open | 157949-158027 | aspS RNA | |||
| 5 | JQCO01000001.1 | regulatory_region | open | 518579-518687 | SAM riboswitch aptamer (S box leader) | |||
| 6 | JQCO01000001.1 | regulatory_region | open | 949190-949263 | c-di-GMP-I riboswitch aptamer | |||
| 7 | JQCO01000001.1 | regulatory_region | open | 989490-989601 | TPP riboswitch aptamer (THI element) | |||
| 8 | JQCO01000001.1 | regulatory_region | open | 1134561-1134638 | c-di-GMP-I riboswitch aptamer | |||
| 9 | JQCO01000001.1 | repeat_region | open | 331239-332271 | CRISPR array with 16 repeats of length 36%2C consensus sequence GTTTTGGGGCAGTGTCGTTTTGACTGGTAATCAAAC and spacer length 29 | |||
| 10 | JQCO01000001.1 | repeat_region | open | 332826-333072 | CRISPR array with 4 repeats of length 38%2C consensus sequence GGGTTTTGGGGCAGTGTCGTTTTGACTGGTAATCAAAC and spacer length 28 | |||
| 11 | JQCO01000001.1 | repeat_region | open | 333155-333336 | CRISPR array with 3 repeats of length 40%2C consensus sequence GGGGTTTTGGGGCAGTGTCGTTTTGACTGGTAATCAAACT and spacer length 26 | |||
| 12 | JQCO01000001.1 | GCA001437585_00001 | CDS | open | 484-2241 | _na 585_aa | mdlB | ABC transporter related protein |
| 13 | JQCO01000001.1 | GCA001437585_00002 | CDS | open | 2241-4037 | _na 598_aa | mdlB | ABC transporter related protein |
| 14 | JQCO01000001.1 | GCA001437585_00003 | CDS | open | 4034-5575 | _na 513_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 15 | JQCO01000001.1 | GCA001437585_00004 | CDS | open | 5575-6273 | _na 232_aa | ecfT | Cobalt transport protein |
| 16 | JQCO01000001.1 | GCA001437585_00005 | CDS | open | 6274-6876 | _na 200_aa | TIGR02185 family protein | |
| 17 | JQCO01000001.1 | GCA001437585_00006 | CDS | open | 7030-7644 | _na 204_aa | acrR | Transcriptional regulator%2C TetR family |
| 18 | JQCO01000001.1 | GCA001437585_00007 | CDS | open | 8416-8697 | _na 93_aa | hypothetical protein | |
| 19 | JQCO01000001.1 | GCA001437585_00008 | CDS | open | 8705-9934 | _na 409_aa | fHA | FHA domain containing protein |
| 20 | JQCO01000001.1 | GCA001437585_00009 | CDS | open | 9972-10655 | _na 227_aa | nfnB | Nitroreductase |
| 21 | JQCO01000001.1 | GCA001437585_00010 | CDS | open | 10687-12378 | _na 563_aa | oPT | Oligopeptide transporter%2C OPT superfamily |
| 22 | JQCO01000001.1 | GCA001437585_00011 | CDS | open | 12518-13417 | _na 299_aa | coaX | Type III pantothenate kinase |
| 23 | JQCO01000001.1 | GCA001437585_00012 | CDS | open | 13503-14051 | _na 182_aa | UBA/Ts-N domain-containing protein | |
| 24 | JQCO01000001.1 | GCA001437585_00013 | CDS | open | 14044-14730 | _na 228_aa | ompR | Two component transcriptional regulator%2C winged helix family |
| 25 | JQCO01000001.1 | GCA001437585_00014 | CDS | open | 14711-16141 | _na 476_aa | baeS | histidine kinase |
| 26 | JQCO01000001.1 | GCA001437585_00015 | CDS | open | 16251-16796 | _na 181_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 27 | JQCO01000001.1 | GCA001437585_00016 | CDS | open | 16818-19040 | _na 740_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 28 | JQCO01000001.1 | GCA001437585_00017 | CDS | open | 19481-20272 | _na 263_aa | cof | Cof-like hydrolase |
| 29 | JQCO01000001.1 | GCA001437585_00018 | CDS | open | 20269-23235 | _na 988_aa | cym1 | Peptidase M16C associated domain protein |
| 30 | JQCO01000001.1 | GCA001437585_00019 | CDS | open | 23395-24414 | _na 339_aa | rhaT | EamA domain-containing protein |
| 31 | JQCO01000001.1 | GCA001437585_00020 | CDS | open | 24512-24961 | _na 149_aa | uspA | UspA domain protein |
| 32 | JQCO01000001.1 | GCA001437585_00021 | CDS | open | 25178-26131 | _na 317_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 33 | JQCO01000001.1 | GCA001437585_00022 | CDS | open | 26501-27472 | _na 323_aa | hisJ | Amino acid ABC transporter substrate-binding protein%2C PAAT family |
| 34 | JQCO01000001.1 | GCA001437585_00023 | CDS | open | 27554-28213 | _na 219_aa | hisM | Amino acid ABC transporter membrane protein 1%2C PAAT family |
| 35 | JQCO01000001.1 | GCA001437585_00024 | CDS | open | 28210-29052 | _na 280_aa | hisM | Amino acid ABC transporter membrane protein 2%2C PAAT family |
| 36 | JQCO01000001.1 | GCA001437585_00025 | CDS | open | 29072-29851 | _na 259_aa | glnQ | Amino acid ABC transporter ATP-binding protein%2C PAAT family |
| 37 | JQCO01000001.1 | GCA001437585_00026 | CDS | open | 30467-32080 | _na 537_aa | hcp | hydroxylamine reductase |
| 38 | JQCO01000001.1 | GCA001437585_00027 | CDS | open | 32273-33550 | _na 425_aa | amyA | Alpha amylase catalytic region |
| 39 | JQCO01000001.1 | GCA001437585_00028 | CDS | open | 33818-34831 | _na 337_aa | purR | Transcriptional regulator%2C LacI family |
| 40 | JQCO01000001.1 | GCA001437585_00029 | CDS | open | 34881-36206 | _na 441_aa | ugpB | Extracellular solute-binding protein family 1 |
| 41 | JQCO01000001.1 | GCA001437585_00030 | CDS | open | 36295-37200 | _na 301_aa | ugpA | Carbohydrate ABC transporter membrane protein 1%2C CUT1 family |
| 42 | JQCO01000001.1 | GCA001437585_00031 | CDS | open | 37200-38063 | _na 287_aa | ugpE | Carbohydrate ABC transporter membrane protein 2%2C CUT1 family |
| 43 | JQCO01000001.1 | GCA001437585_00032 | CDS | open | 38067-39554 | _na 495_aa | malQ | 4-alpha-glucanotransferase |
| 44 | JQCO01000001.1 | GCA001437585_00033 | CDS | open | 39557-40744 | _na 395_aa | malK | Carbohydrate ABC transporter ATP-binding protein%2C CUT1 family |
| 45 | JQCO01000001.1 | GCA001437585_00034 | CDS | open | 41067-41774 | _na 235_aa | yebA | Transglutaminase domain protein |
| 46 | JQCO01000001.1 | GCA001437585_00035 | CDS | open | 41918-43672 | _na 584_aa | mdlB | ATP-binding cassette%2C subfamily B%2C bacterial |
| 47 | JQCO01000001.1 | GCA001437585_00036 | CDS | open | 43660-45360 | _na 566_aa | mdlB | ATP-binding cassette%2C subfamily B%2C bacterial |
| 48 | JQCO01000001.1 | GCA001437585_00037 | CDS | open | 45455-46936 | _na 493_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 49 | JQCO01000001.1 | GCA001437585_00038 | CDS | open | 46933-47544 | _na 203_aa | ecfT | Cobalt transport protein |
| 50 | JQCO01000001.1 | GCA001437585_00039 | CDS | open | 47637-48260 | _na 207_aa | mptD | MptD family ECF transporter S component |
| 51 | JQCO01000001.1 | GCA001437585_00040 | CDS | open | 48473-49522 | _na 349_aa | araC | Transcriptional regulator%2C AraC family |
| 52 | JQCO01000001.1 | GCA001437585_00041 | CDS | open | 50127-50561 | _na 144_aa | hypothetical protein | |
| 53 | JQCO01000001.1 | GCA001437585_00042 | CDS | open | 50606-51052 | _na 148_aa | araC | AraC family transcriptional regulator |
| 54 | JQCO01000001.1 | GCA001437585_00043 | CDS | open | 51001-51210 | _na 69_aa | araC | helix-turn-helix transcriptional regulator |
| 55 | JQCO01000001.1 | GCA001437585_00044 | CDS | open | 51286-51933 | _na 215_aa | hypothetical protein | |
| 56 | JQCO01000001.1 | GCA001437585_00045 | CDS | open | 51930-53105 | _na 391_aa | fieF | Cation diffusion facilitator family transporter |
| 57 | JQCO01000001.1 | GCA001437585_00046 | CDS | open | 53237-55876 | _na 879_aa | uvrD | DNA 3'-5' helicase |
| 58 | JQCO01000001.1 | GCA001437585_00047 | CDS | open | 56327-57163 | _na 278_aa | mscS | MscS Mechanosensitive ion channel |
| 59 | JQCO01000001.1 | GCA001437585_00048 | CDS | open | 57544-58998 | _na 484_aa | ubiD | non-oxidative hydroxyarylic acid decarboxylases subunit C |
| 60 | JQCO01000001.1 | GCA001437585_00049 | CDS | open | 59026-59232 | _na 68_aa | non-oxidative hydroxyarylic acid decarboxylases subunit D | |
| 61 | JQCO01000001.1 | GCA001437585_00050 | CDS | open | 59360-60865 | _na 501_aa | citT | Sodium/sulphate symporter |
| 62 | JQCO01000001.1 | GCA001437585_00051 | CDS | open | 60956-61540 | _na 194_aa | ubiX | Flavin prenyltransferase UbiX |
| 63 | JQCO01000001.1 | GCA001437585_00052 | CDS | open | 61553-62467 | _na 304_aa | lysR | Transcriptional regulator%2C LysR family |
| 64 | JQCO01000001.1 | GCA001437585_00053 | CDS | open | 62493-63188 | _na 231_aa | mtnN | 5'-methylthioadenosine/adenosylhomocysteine nucleosidase |
| 65 | JQCO01000001.1 | GCA001437585_00054 | CDS | open | 63290-63775 | _na 161_aa | LpdD-like chaperone-like domain-containing protein | |
| 66 | JQCO01000001.1 | GCA001437585_00055 | CDS | open | 63765-64298 | _na 177_aa | idi | isopentenyl-diphosphate Delta-isomerase |
| 67 | JQCO01000001.1 | GCA001437585_00056 | CDS | open | 64670-65398 | _na 242_aa | deoD | purine-nucleoside phosphorylase |
| 68 | JQCO01000001.1 | GCA001437585_00057 | CDS | open | 65467-66597 | _na 376_aa | mtnA | S-methyl-5-thioribose-1-phosphate isomerase |
| 69 | JQCO01000001.1 | GCA001437585_00058 | CDS | open | 66740-67231 | _na 163_aa | luxS | S-ribosylhomocysteine lyase |
| 70 | JQCO01000001.1 | GCA001437585_00059 | CDS | open | 67329-68195 | _na 288_aa | degV | DegV family protein |
| 71 | JQCO01000001.1 | GCA001437585_00060 | CDS | open | 68361-68978 | _na 205_aa | DUF1836 domain-containing protein | |
| 72 | JQCO01000001.1 | GCA001437585_00061 | CDS | open | 69077-70021 | _na 314_aa | pPX1 | Inorganic diphosphatase |
| 73 | JQCO01000001.1 | GCA001437585_00062 | CDS | open | 70135-71652 | _na 505_aa | nhaA | Na+/H+ antiporter NhaA |
| 74 | JQCO01000001.1 | GCA001437585_00063 | CDS | open | 71570-71992 | _na 140_aa | hypothetical protein | |
| 75 | JQCO01000001.1 | GCA001437585_00064 | CDS | open | 72138-73424 | _na 428_aa | aRO8 | Transcriptional regulator |
| 76 | JQCO01000001.1 | GCA001437585_00065 | CDS | open | 73619-74593 | _na 324_aa | Tetratricopeptide TPR_2 repeat protein | |
| 77 | JQCO01000001.1 | GCA001437585_00066 | CDS | open | 74610-74921 | _na 103_aa | spoIIAA | Anti-sigma factor antagonist |
| 78 | JQCO01000001.1 | GCA001437585_00067 | CDS | open | 74963-75655 | _na 230_aa | tatA | Sec-independent translocation protein mttA/Hcf106 |
| 79 | JQCO01000001.1 | GCA001437585_00068 | CDS | open | 75658-76470 | _na 270_aa | tatC | twin-arginine translocase subunit TatC |
| 80 | JQCO01000001.1 | GCA001437585_00069 | CDS | open | 76676-79195 | _na 839_aa | yrdD | DNA topoisomerase I |
| 81 | JQCO01000001.1 | GCA001437585_00070 | CDS | open | 79179-79874 | _na 231_aa | tmk | dTMP kinase |
| 82 | JQCO01000001.1 | GCA001437585_00071 | CDS | open | 79966-81105 | _na 379_aa | dnaX | DNA polymerase III%2C delta prime subunit |
| 83 | JQCO01000001.1 | GCA001437585_00072 | CDS | open | 81084-82646 | _na 520_aa | yaaT | PSP1 domain protein |
| 84 | JQCO01000001.1 | GCA001437585_00073 | CDS | open | 82743-83165 | _na 140_aa | 6-carboxytetrahydropterin synthase | |
| 85 | JQCO01000001.1 | GCA001437585_00074 | CDS | open | 83618-84175 | _na 185_aa | hypothetical protein | |
| 86 | JQCO01000001.1 | GCA001437585_00075 | CDS | open | 84238-85281 | _na 347_aa | bglC | Exo-1%2C3-beta-glucanase D |
| 87 | JQCO01000001.1 | GCA001437585_00076 | CDS | open | 85281-86174 | _na 297_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 88 | JQCO01000001.1 | GCA001437585_00077 | CDS | open | 86291-87070 | _na 259_aa | oca4 | Protein tyrosine/serine phosphatase |
| 89 | JQCO01000001.1 | GCA001437585_00078 | CDS | open | 87905-89509 | _na 534_aa | metG | methionine--tRNA ligase |
| 90 | JQCO01000001.1 | GCA001437585_00079 | CDS | open | 89520-90563 | _na 347_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 91 | JQCO01000001.1 | GCA001437585_00080 | CDS | open | 90574-91608 | _na 344_aa | tatD | TatD-related deoxyribonuclease |
| 92 | JQCO01000001.1 | GCA001437585_00081 | CDS | open | 91704-92504 | _na 266_aa | comFC | Phosphoribosyltransferase |
| 93 | JQCO01000001.1 | GCA001437585_00082 | CDS | open | 92920-93891 | _na 323_aa | hisJ | Extracellular solute-binding protein family 3 |
| 94 | JQCO01000001.1 | GCA001437585_00083 | CDS | open | 94047-94625 | _na 192_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 95 | JQCO01000001.1 | GCA001437585_00084 | CDS | open | 94641-95660 | _na 339_aa | degV | DegV family protein |
| 96 | JQCO01000001.1 | GCA001437585_00085 | CDS | open | 95670-96716 | _na 348_aa | mmsB | 3-hydroxyisobutyrate dehydrogenase |
| 97 | JQCO01000001.1 | GCA001437585_00086 | CDS | open | 96719-97147 | _na 142_aa | DUF554 domain-containing protein | |
| 98 | JQCO01000001.1 | GCA001437585_00087 | CDS | open | 97154-97930 | _na 258_aa | labA | HTH OST-type domain-containing protein |
| 99 | JQCO01000001.1 | GCA001437585_00088 | CDS | open | 97949-98536 | _na 195_aa | HEAT repeat domain-containing protein | |
| 100 | JQCO01000001.1 | GCA001437585_00089 | CDS | open | 98744-99721 | _na 325_aa | surA | SurA N-terminal domain-containing protein |
| 101 | JQCO01000001.1 | GCA001437585_00090 | CDS | open | 100145-100720 | _na 191_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 102 | JQCO01000001.1 | GCA001437585_00091 | CDS | open | 100720-101607 | _na 295_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 103 | JQCO01000001.1 | GCA001437585_00092 | CDS | open | 101615-101920 | _na 101_aa | tfoX | TfoX domain protein |
| 104 | JQCO01000001.1 | GCA001437585_00093 | CDS | open | 102577-103521 | _na 314_aa | Nucleotide modification associated domain-containing protein | |
| 105 | JQCO01000001.1 | GCA001437585_00094 | CDS | open | 104009-105199 | _na 396_aa | ybbK | purine-nucleoside phosphorylase |
| 106 | JQCO01000001.1 | GCA001437585_00095 | CDS | open | 105210-105623 | _na 137_aa | hypothetical protein | |
| 107 | JQCO01000001.1 | GCA001437585_00096 | CDS | open | 105699-105866 | _na 55_aa | Polysaccharide export protein | |
| 108 | JQCO01000001.1 | GCA001437585_00098 | CDS | open | 107184-107285 | _na 33_aa | hypothetical protein | |
| 109 | JQCO01000001.1 | GCA001437585_00099 | CDS | open | 107297-108073 | _na 258_aa | oxdD | glucose-6-phosphate isomerase |
| 110 | JQCO01000001.1 | GCA001437585_00100 | CDS | open | 108089-109831 | _na 580_aa | manA | Mannose-6-phosphate isomerase |
| 111 | JQCO01000001.1 | GCA001437585_00101 | CDS | open | 110009-110782 | _na 257_aa | fabG | Short-chain dehydrogenase/reductase SDR |
| 112 | JQCO01000001.1 | GCA001437585_00102 | CDS | open | 110879-111874 | _na 331_aa | agaS | Sugar isomerase (SIS) |
| 113 | JQCO01000001.1 | GCA001437585_00103 | CDS | open | 111964-112821 | _na 285_aa | ycjR | Xylose isomerase domain protein TIM barrel |
| 114 | JQCO01000001.1 | GCA001437585_00104 | CDS | open | 112948-113736 | _na 262_aa | frmB | Putative esterase |
| 115 | JQCO01000001.1 | GCA001437585_00105 | CDS | open | 114057-115505 | _na 482_aa | potE | Amino acid permease-associated region |
| 116 | JQCO01000001.1 | GCA001437585_00106 | CDS | open | 115618-116511 | _na 297_aa | nagB | Glucosamine/galactosamine-6-phosphate isomerase |
| 117 | JQCO01000001.1 | GCA001437585_00107 | CDS | open | 116514-117452 | _na 312_aa | rbsK | Ribokinase |
| 118 | JQCO01000001.1 | GCA001437585_00108 | CDS | open | 117533-118495 | _na 320_aa | dapA | Dihydrodipicolinate synthetase |
| 119 | JQCO01000001.1 | GCA001437585_00109 | CDS | open | 118650-119615 | _na 321_aa | rbsK | Ribokinase |
| 120 | JQCO01000001.1 | GCA001437585_00110 | CDS | open | 119648-120433 | _na 261_aa | frlD | fructoselysine 6-kinase |
| 121 | JQCO01000001.1 | GCA001437585_00111 | CDS | open | 120704-121504 | _na 266_aa | frlD | fructoselysine 6-kinase |
| 122 | JQCO01000001.1 | GCA001437585_00112 | CDS | open | 121608-122432 | _na 274_aa | frlC | fructoselysine 3-epimerase |
| 123 | JQCO01000001.1 | GCA001437585_00113 | CDS | open | 122451-123305 | _na 284_aa | ligW | Amidohydrolase 2 |
| 124 | JQCO01000001.1 | GCA001437585_00114 | CDS | open | 123312-123740 | _na 142_aa | yjbQ | Secondary thiamine-phosphate synthase enzyme |
| 125 | JQCO01000001.1 | GCA001437585_00115 | CDS | open | 123878-124612 | _na 244_aa | gntR | Transcriptional regulator%2C GntR family |
| 126 | JQCO01000001.1 | GCA001437585_00116 | CDS | open | 124605-125330 | _na 241_aa | gntR | Transcriptional regulator%2C GntR family |
| 127 | JQCO01000001.1 | GCA001437585_00117 | CDS | open | 125466-126989 | _na 507_aa | xylB | Carbohydrate kinase%2C FGGY |
| 128 | JQCO01000001.1 | GCA001437585_00118 | CDS | open | 127064-127900 | _na 278_aa | btpA | Photosystem I assembly BtpA |
| 129 | JQCO01000001.1 | GCA001437585_00119 | CDS | open | 128095-129258 | _na 387_aa | fucO | lactaldehyde reductase |
| 130 | JQCO01000001.1 | GCA001437585_00120 | CDS | open | 129300-129413 | _na 37_aa | hypothetical protein | |
| 131 | JQCO01000001.1 | GCA001437585_00121 | CDS | open | 129556-130656 | _na 366_aa | ATPase | |
| 132 | JQCO01000001.1 | GCA001437585_00122 | CDS | open | 130906-131133 | _na 75_aa | bofA | Pro-sigmaK processing inhibitor BofA |
| 133 | JQCO01000001.1 | GCA001437585_00123 | CDS | open | 131312-132850 | _na 512_aa | sacC | beta-fructofuranosidase |
| 134 | JQCO01000001.1 | GCA001437585_00124 | CDS | open | 132912-133877 | _na 321_aa | hIS2 | Histidinol-phosphatase |
| 135 | JQCO01000001.1 | GCA001437585_00125 | CDS | open | 134067-135116 | _na 349_aa | pitA | Phosphate transporter |
| 136 | JQCO01000001.1 | GCA001437585_00126 | CDS | open | 135225-135857 | _na 210_aa | ykaA | Putitive phosphate transport regulator |
| 137 | JQCO01000001.1 | GCA001437585_00127 | CDS | open | 135930-136682 | _na 250_aa | sfp | 4'-phosphopantetheinyl transferase domain-containing protein |
| 138 | JQCO01000001.1 | GCA001437585_00128 | CDS | open | 137186-138205 | _na 339_aa | nadA | quinolinate synthase NadA |
| 139 | JQCO01000001.1 | GCA001437585_00129 | CDS | open | 138218-139591 | _na 457_aa | nadB | L-aspartate oxidase |
| 140 | JQCO01000001.1 | GCA001437585_00130 | CDS | open | 139572-140435 | _na 287_aa | nadC | carboxylating nicotinate-nucleotide diphosphorylase |
| 141 | JQCO01000001.1 | GCA001437585_00131 | CDS | open | 140432-141046 | _na 204_aa | niaR | 3H domain protein |
| 142 | JQCO01000001.1 | GCA001437585_00132 | CDS | open | 141236-142267 | _na 343_aa | ilvE | branched-chain amino acid aminotransferase |
| 143 | JQCO01000001.1 | GCA001437585_00133 | CDS | open | 142754-142858 | _na 34_aa | hypothetical protein | |
| 144 | JQCO01000001.1 | GCA001437585_00134 | CDS | open | 143777-144829 | _na 350_aa | allD | ureidoglycolate dehydrogenase |
| 145 | JQCO01000001.1 | GCA001437585_00135 | CDS | open | 145112-146425 | _na 437_aa | hisS | histidine--tRNA ligase |
| 146 | JQCO01000001.1 | GCA001437585_00136 | CDS | open | 146844-148220 | _na 458_aa | nhaC | Na+/H+ antiporter NhaC |
| 147 | JQCO01000001.1 | GCA001437585_00137 | CDS | open | 148480-149427 | _na 315_aa | lysR | Transcriptional regulator%2C LysR family |
| 148 | JQCO01000001.1 | GCA001437585_00138 | CDS | open | 149430-150497 | _na 355_aa | rluA | Pseudouridine synthase |
| 149 | JQCO01000001.1 | GCA001437585_00139 | CDS | open | 150527-152146 | _na 539_aa | nar1 | Ferredoxin hydrogenase |
| 150 | JQCO01000001.1 | GCA001437585_00140 | CDS | open | 152853-153161 | _na 102_aa | CDP-alcohol phosphatidyltransferase | |
| 151 | JQCO01000001.1 | GCA001437585_00141 | CDS | open | 153373-154023 | _na 216_aa | gph | HAD-superfamily hydrolase%2C subfamily IA%2C variant 3 |
| 152 | JQCO01000001.1 | GCA001437585_00142 | CDS | open | 154178-155404 | _na 408_aa | salY | ABC3 transporter permease protein domain-containing protein |
| 153 | JQCO01000001.1 | GCA001437585_00143 | CDS | open | 155401-156132 | _na 243_aa | lolD | ABC transporter related protein |
| 154 | JQCO01000001.1 | GCA001437585_00144 | CDS | open | 156134-157636 | _na 500_aa | acrA | Efflux transporter%2C RND family%2C MFP subunit |
| 155 | JQCO01000001.1 | GCA001437585_00145 | CDS | open | 158033-159802 | _na 589_aa | aspS | aspartate--tRNA ligase |
| 156 | JQCO01000001.1 | GCA001437585_00146 | CDS | open | 160261-162174 | _na 637_aa | rbbA | ABC transporter related protein |
| 157 | JQCO01000001.1 | GCA001437585_00147 | CDS | open | 162542-163516 | _na 324_aa | hipB | Transcriptional regulator%2C XRE family |
| 158 | JQCO01000001.1 | GCA001437585_00148 | CDS | open | 163728-165479 | _na 583_aa | mdlB | ABC transporter related protein |
| 159 | JQCO01000001.1 | GCA001437585_00149 | CDS | open | 165469-167310 | _na 613_aa | mdlB | ABC transporter related protein |
| 160 | JQCO01000001.1 | GCA001437585_00150 | CDS | open | 167448-167768 | _na 106_aa | grxC | Glutaredoxin |
| 161 | JQCO01000001.1 | GCA001437585_00151 | CDS | open | 167765-169048 | _na 427_aa | elsH | Endonuclease/exonuclease/phosphatase |
| 162 | JQCO01000001.1 | GCA001437585_00152 | CDS | open | 169396-170571 | _na 391_aa | glxK | Glycerate kinase |
| 163 | JQCO01000001.1 | GCA001437585_00153 | CDS | open | 171051-172385 | _na 444_aa | rfbX | Polysaccharide biosynthesis protein |
| 164 | JQCO01000001.1 | GCA001437585_00154 | CDS | open | 172735-175509 | _na 924_aa | ppc | Phosphoenolpyruvate carboxylase |
| 165 | JQCO01000001.1 | GCA001437585_00155 | CDS | open | 175677-175955 | _na 92_aa | feoA | FeoA family protein |
| 166 | JQCO01000001.1 | GCA001437585_00156 | CDS | open | 176032-176274 | _na 80_aa | feoA | FeoA family protein |
| 167 | JQCO01000001.1 | GCA001437585_00157 | CDS | open | 176397-179057 | _na 886_aa | feoB | ferrous iron transport protein B |
| 168 | JQCO01000001.1 | GCA001437585_00158 | CDS | open | 179243-179344 | _na 33_aa | hypothetical protein | |
| 169 | JQCO01000001.1 | GCA001437585_00159 | CDS | open | 179345-180256 | _na 303_aa | araC | Transcriptional regulator%2C AraC family |
| 170 | JQCO01000001.1 | GCA001437585_00160 | CDS | open | 180431-180733 | _na 100_aa | DUF1490 domain-containing protein | |
| 171 | JQCO01000001.1 | GCA001437585_00161 | CDS | open | 180738-182846 | _na 702_aa | zntA | Heavy metal translocating P-type ATPase |
| 172 | JQCO01000001.1 | GCA001437585_00162 | CDS | open | 183089-183859 | _na 256_aa | lolD | ABC transporter related protein |
| 173 | JQCO01000001.1 | GCA001437585_00163 | CDS | open | 183868-186318 | _na 816_aa | ybbP | ABC3 transporter permease C-terminal domain-containing protein |
| 174 | JQCO01000001.1 | GCA001437585_00164 | CDS | open | 186493-187629 | _na 378_aa | metE | Methionine synthase vitamin-B12 independent |
| 175 | JQCO01000001.1 | GCA001437585_00165 | CDS | open | 188123-188827 | _na 234_aa | DUF3793 domain-containing protein | |
| 176 | JQCO01000001.1 | GCA001437585_00166 | CDS | open | 188948-189352 | _na 134_aa | fldA | Flavodoxin/nitric oxide synthase |
| 177 | JQCO01000001.1 | GCA001437585_00167 | CDS | open | 189565-189780 | _na 71_aa | FeoB-associated Cys-rich membrane protein | |
| 178 | JQCO01000001.1 | GCA001437585_00168 | CDS | open | 190027-191373 | _na 448_aa | glnA | L-glutamine synthetase |
| 179 | JQCO01000001.1 | GCA001437585_00169 | CDS | open | 191590-193836 | _na 748_aa | hisJ | Polar amino acid ABC transporter%2C inner membrane subunit |
| 180 | JQCO01000001.1 | GCA001437585_00170 | CDS | open | 193840-194700 | _na 286_aa | glnQ | Amino acid ABC transporter ATP-binding protein%2C PAAT family |
| 181 | JQCO01000001.1 | GCA001437585_00171 | CDS | open | 194869-195543 | _na 224_aa | ompR | Putative two component transcriptional regulator%2C winged helix family |
| 182 | JQCO01000001.1 | GCA001437585_00172 | CDS | open | 195780-197348 | _na 522_aa | degQ | Peptidase S1 and S6 chymotrypsin/Hap |
| 183 | JQCO01000001.1 | GCA001437585_00173 | CDS | open | 197672-197992 | _na 106_aa | frmR | Copper-sensing transcriptional repressor CsoR |
| 184 | JQCO01000001.1 | GCA001437585_00174 | CDS | open | 198027-200765 | _na 912_aa | copZ | Heavy metal translocating P-type ATPase |
| 185 | JQCO01000001.1 | GCA001437585_00175 | CDS | open | 201045-201830 | _na 261_aa | ung | uracil-DNA glycosylase |
| 186 | JQCO01000001.1 | GCA001437585_00176 | CDS | open | 202111-204354 | _na 747_aa | ligA | NAD-dependent DNA ligase LigA |
| 187 | JQCO01000001.1 | GCA001437585_00177 | CDS | open | 204509-205852 | _na 447_aa | Putative esterase | |
| 188 | JQCO01000001.1 | GCA001437585_00178 | CDS | open | 205880-206818 | _na 312_aa | pepI | proline iminopeptidase |
| 189 | JQCO01000001.1 | GCA001437585_00179 | CDS | open | 206872-207837 | _na 321_aa | hypothetical protein | |
| 190 | JQCO01000001.1 | GCA001437585_00180 | CDS | open | 207877-208119 | _na 80_aa | hypothetical protein | |
| 191 | JQCO01000001.1 | GCA001437585_00181 | CDS | open | 208142-209071 | _na 309_aa | Phospholipase C/D domain-containing protein | |
| 192 | JQCO01000001.1 | GCA001437585_00182 | CDS | open | 209153-211243 | _na 696_aa | glnA3 | L-glutamine synthetase |
| 193 | JQCO01000001.1 | GCA001437585_00183 | CDS | open | 211827-213335 | _na 502_aa | fadH2 | FAD-dependent pyridine nucleotide-disulfide oxidoreductase |
| 194 | JQCO01000001.1 | GCA001437585_00184 | CDS | open | 213521-216289 | _na 922_aa | polA | DNA polymerase I |
| 195 | JQCO01000001.1 | GCA001437585_00185 | CDS | open | 216289-216903 | _na 204_aa | rnhA | ribonuclease HI |
| 196 | JQCO01000001.1 | GCA001437585_00186 | CDS | open | 216999-217376 | _na 125_aa | copZ | Heavy metal transport/detoxification protein |
| 197 | JQCO01000001.1 | GCA001437585_00187 | CDS | open | 217409-218725 | _na 438_aa | cdsB | UPF0597 protein Olsu_1328 |
| 198 | JQCO01000001.1 | GCA001437585_00188 | CDS | open | 218855-219601 | _na 248_aa | Haloacid dehalogenase domain protein hydrolase | |
| 199 | JQCO01000001.1 | GCA001437585_00189 | CDS | open | 219990-221168 | _na 392_aa | rpsA | 30S ribosomal protein S1 |
| 200 | JQCO01000001.1 | GCA001437585_00190 | CDS | open | 221643-223268 | _na 541_aa | ddpA | Extracellular solute-binding protein family 5 |
| 201 | JQCO01000001.1 | GCA001437585_00191 | CDS | open | 223593-224528 | _na 311_aa | dppB | Binding-protein-dependent transport systems inner membrane component |
| 202 | JQCO01000001.1 | GCA001437585_00192 | CDS | open | 224528-225484 | _na 318_aa | dppC | Binding-protein-dependent transport systems inner membrane component |
| 203 | JQCO01000001.1 | GCA001437585_00193 | CDS | open | 225497-226591 | _na 364_aa | dppD | Oligopeptide/dipeptide ABC transporter%2C ATPase subunit |
| 204 | JQCO01000001.1 | GCA001437585_00194 | CDS | open | 226595-227647 | _na 350_aa | dppD | Oligopeptide/dipeptide ABC transporter%2C ATPase subunit |
| 205 | JQCO01000001.1 | GCA001437585_00195 | CDS | open | 228185-229807 | _na 540_aa | ddpA | Extracellular solute-binding protein family 5 |
| 206 | JQCO01000001.1 | GCA001437585_00196 | CDS | open | 230054-231322 | _na 422_aa | pepT | peptidase T |
| 207 | JQCO01000001.1 | GCA001437585_00197 | CDS | open | 231340-231429 | _na 29_aa | hypothetical protein | |
| 208 | JQCO01000001.1 | GCA001437585_00198 | CDS | open | 231478-232536 | _na 352_aa | frvX | Peptidase M42 family protein |
| 209 | JQCO01000001.1 | GCA001437585_00199 | CDS | open | 232752-233162 | _na 136_aa | Zn-finger containing protein | |
| 210 | JQCO01000001.1 | GCA001437585_00200 | CDS | open | 233215-233853 | _na 212_aa | coaE | dephospho-CoA kinase |
| 211 | JQCO01000001.1 | GCA001437585_00201 | CDS | open | 233846-234433 | _na 195_aa | mltE | Lytic transglycosylase catalytic |
| 212 | JQCO01000001.1 | GCA001437585_00202 | CDS | open | 234518-236833 | _na 771_aa | uvrB | excinuclease ABC subunit UvrB |
| 213 | JQCO01000001.1 | GCA001437585_00203 | CDS | open | 237653-238480 | _na 275_aa | DUF559 domain-containing protein | |
| 214 | JQCO01000001.1 | GCA001437585_00204 | CDS | open | 239153-241318 | _na 721_aa | pepD | Peptidase U34 dipeptidase |
| 215 | JQCO01000001.1 | GCA001437585_00205 | CDS | open | 242002-243672 | _na 556_aa | FAD dependent oxidoreductase | |
| 216 | JQCO01000001.1 | GCA001437585_00206 | CDS | open | 243684-245237 | _na 517_aa | yhiN | HI0933 family protein |
| 217 | JQCO01000001.1 | GCA001437585_00207 | CDS | open | 245243-246106 | _na 287_aa | mrp | Iron-sulfur cluster carrier protein |
| 218 | JQCO01000001.1 | GCA001437585_00208 | CDS | open | 246420-246878 | _na 152_aa | DUF2975 domain-containing protein | |
| 219 | JQCO01000001.1 | GCA001437585_00209 | CDS | open | 246879-247100 | _na 73_aa | yozG | Transcriptional regulator%2C XRE family |
| 220 | JQCO01000001.1 | GCA001437585_00210 | CDS | open | 247301-248806 | _na 501_aa | hypothetical protein | |
| 221 | JQCO01000001.1 | GCA001437585_00211 | CDS | open | 250222-253122 | _na 966_aa | uvrA | excinuclease ABC subunit UvrA |
| 222 | JQCO01000001.1 | GCA001437585_00212 | CDS | open | 253123-253620 | _na 165_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 223 | JQCO01000001.1 | GCA001437585_00213 | CDS | open | 253680-255494 | _na 604_aa | murJ | Virulence factor MVIN family protein |
| 224 | JQCO01000001.1 | GCA001437585_00214 | CDS | open | 255958-257643 | _na 561_aa | hisG | ATP phosphoribosyltransferase |
| 225 | JQCO01000001.1 | GCA001437585_00215 | CDS | open | 257647-259047 | _na 466_aa | hisD | Histidinol dehydrogenase |
| 226 | JQCO01000001.1 | GCA001437585_00216 | CDS | open | 259124-260227 | _na 367_aa | hisC | histidinol-phosphate transaminase |
| 227 | JQCO01000001.1 | GCA001437585_00217 | CDS | open | 260224-260814 | _na 196_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 228 | JQCO01000001.1 | GCA001437585_00218 | CDS | open | 260814-261470 | _na 218_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 229 | JQCO01000001.1 | GCA001437585_00219 | CDS | open | 261474-262217 | _na 247_aa | hisA | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase |
| 230 | JQCO01000001.1 | GCA001437585_00220 | CDS | open | 262281-263051 | _na 256_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 231 | JQCO01000001.1 | GCA001437585_00221 | CDS | open | 263715-264689 | _na 324_aa | DUF559 domain-containing protein | |
| 232 | JQCO01000001.1 | GCA001437585_00222 | CDS | open | 264686-266431 | _na 581_aa | sdhA | Fumarate reductase/succinate dehydrogenase flavoprotein domain protein |
| 233 | JQCO01000001.1 | GCA001437585_00223 | CDS | open | 266679-267074 | _na 131_aa | hisI | phosphoribosyl-AMP cyclohydrolase |
| 234 | JQCO01000001.1 | GCA001437585_00224 | CDS | open | 267112-267855 | _na 247_aa | racX | Aspartate racemase |
| 235 | JQCO01000001.1 | GCA001437585_00225 | CDS | open | 268076-269344 | _na 422_aa | ATP-grasp protein-like protein | |
| 236 | JQCO01000001.1 | GCA001437585_00226 | CDS | open | 269348-271384 | _na 678_aa | uvrC | excinuclease ABC subunit UvrC |
| 237 | JQCO01000001.1 | GCA001437585_00227 | CDS | open | 271606-273213 | _na 535_aa | ddpA | Extracellular solute-binding protein family 5 |
| 238 | JQCO01000001.1 | GCA001437585_00228 | CDS | open | 273383-274339 | _na 318_aa | dppB | Binding-protein-dependent transport systems inner membrane component |
| 239 | JQCO01000001.1 | GCA001437585_00229 | CDS | open | 274342-276381 | _na 679_aa | dppC | ABC transporter related protein |
| 240 | JQCO01000001.1 | GCA001437585_00230 | CDS | open | 276382-277209 | _na 275_aa | dppD | ABC transporter related protein |
| 241 | JQCO01000001.1 | GCA001437585_00231 | CDS | open | 277278-278246 | _na 322_aa | axe1 | Acetyl xylan esterase |
| 242 | JQCO01000001.1 | GCA001437585_00232 | CDS | open | 278249-279172 | _na 307_aa | axe1 | Acetyl xylan esterase |
| 243 | JQCO01000001.1 | GCA001437585_00233 | CDS | open | 279262-280188 | _na 308_aa | dapA | N-acetylneuraminate lyase |
| 244 | JQCO01000001.1 | GCA001437585_00234 | CDS | open | 280214-281182 | _na 322_aa | nagC | ROK family protein |
| 245 | JQCO01000001.1 | GCA001437585_00235 | CDS | open | 281258-281950 | _na 230_aa | nanE | N-acylglucosamine-6-phosphate 2-epimerase |
| 246 | JQCO01000001.1 | GCA001437585_00236 | CDS | open | 282210-283013 | _na 267_aa | glpR | Transcriptional regulator%2C DeoR family |
| 247 | JQCO01000001.1 | GCA001437585_00237 | CDS | open | 283189-284157 | _na 322_aa | agaB | PTS system mannose-specific EIIAB component |
| 248 | JQCO01000001.1 | GCA001437585_00238 | CDS | open | 284218-285057 | _na 279_aa | manY | Phosphotransferase system PTS sorbose-specific IIC subunit |
| 249 | JQCO01000001.1 | GCA001437585_00239 | CDS | open | 285071-285970 | _na 299_aa | manZ | PTS system IID component%2C Man family (TC 4-A6) |
| 250 | JQCO01000001.1 | GCA001437585_00240 | CDS | open | 286098-287165 | _na 355_aa | tdh | Alcohol dehydrogenase zinc-binding domain protein |
| 251 | JQCO01000001.1 | GCA001437585_00241 | CDS | open | 287250-287771 | _na 173_aa | mug | DNA-deoxyinosine glycosylase |
| 252 | JQCO01000001.1 | GCA001437585_00242 | CDS | open | 288083-289177 | _na 364_aa | mviM | Oxidoreductase domain protein |
| 253 | JQCO01000001.1 | GCA001437585_00243 | CDS | open | 289207-290133 | _na 308_aa | rapZ | RNase adapter RapZ |
| 254 | JQCO01000001.1 | GCA001437585_00244 | CDS | open | 290135-291085 | _na 316_aa | whiA | DNA-binding protein WhiA |
| 255 | JQCO01000001.1 | GCA001437585_00245 | CDS | open | 291285-292310 | _na 341_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 256 | JQCO01000001.1 | GCA001437585_00246 | CDS | open | 292434-293624 | _na 396_aa | pgk | Phosphoglycerate kinase |
| 257 | JQCO01000001.1 | GCA001437585_00247 | CDS | open | 293617-294381 | _na 254_aa | tpiA | triose-phosphate isomerase |
| 258 | JQCO01000001.1 | GCA001437585_00248 | CDS | open | 294478-294726 | _na 82_aa | secG | preprotein translocase subunit SecG |
| 259 | JQCO01000001.1 | GCA001437585_00249 | CDS | open | 295056-296696 | _na 546_aa | ddpA | Extracellular solute-binding protein family 5 |
| 260 | JQCO01000001.1 | GCA001437585_00250 | CDS | open | 296905-297945 | _na 346_aa | dppB | Binding-protein-dependent transport systems inner membrane component |
| 261 | JQCO01000001.1 | GCA001437585_00251 | CDS | open | 297959-298936 | _na 325_aa | dppC | Binding-protein-dependent transport systems inner membrane component |
| 262 | JQCO01000001.1 | GCA001437585_00252 | CDS | open | 298939-300027 | _na 362_aa | dppD | Oligopeptide/dipeptide ABC transporter%2C ATPase subunit |
| 263 | JQCO01000001.1 | GCA001437585_00253 | CDS | open | 300027-301061 | _na 344_aa | dppD | Oligopeptide/dipeptide ABC transporter%2C ATPase subunit |
| 264 | JQCO01000001.1 | GCA001437585_00255 | CDS | open | 301319-303604 | _na 761_aa | rsbU | Protein serine phosphatase with GAF(S) sensor(S) |
| 265 | JQCO01000001.1 | GCA001437585_00256 | CDS | open | 303652-304446 | _na 264_aa | spoIIAA | Anti-sigma-factor antagonist |
| 266 | JQCO01000001.1 | GCA001437585_00259 | CDS | open | 305121-306029 | _na 302_aa | PF06541 family protein | |
| 267 | JQCO01000001.1 | GCA001437585_00260 | CDS | open | 306026-307279 | _na 417_aa | nifS | Cysteine desulfurase |
| 268 | JQCO01000001.1 | GCA001437585_00261 | CDS | open | 307279-308421 | _na 380_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 269 | JQCO01000001.1 | GCA001437585_00262 | CDS | open | 309200-310966 | _na 588_aa | aglD2 | Integral membrane protein |
| 270 | JQCO01000001.1 | GCA001437585_00264 | CDS | open | 311805-312608 | _na 267_aa | mngR | Transcriptional regulator%2C GntR family |
| 271 | JQCO01000001.1 | GCA001437585_00265 | CDS | open | 312650-313852 | _na 400_aa | med | Nucleoside-binding protein |
| 272 | JQCO01000001.1 | GCA001437585_00266 | CDS | open | 313953-315497 | _na 514_aa | nupO | Nucleoside ABC transporter ATP-binding protein |
| 273 | JQCO01000001.1 | GCA001437585_00267 | CDS | open | 315487-316605 | _na 372_aa | nupP | Nucleoside ABC transporter membrane protein |
| 274 | JQCO01000001.1 | GCA001437585_00268 | CDS | open | 316608-317522 | _na 304_aa | nupQ | Nucleoside ABC transporter membrane protein |
| 275 | JQCO01000001.1 | GCA001437585_00269 | CDS | open | 317515-318105 | _na 196_aa | pncA | Isochorismatase hydrolase |
| 276 | JQCO01000001.1 | GCA001437585_00270 | CDS | open | 318102-319088 | _na 328_aa | rbsK | PfkB domain protein |
| 277 | JQCO01000001.1 | GCA001437585_00271 | CDS | open | 319070-319822 | _na 250_aa | udp | Uridine phosphorylase |
| 278 | JQCO01000001.1 | GCA001437585_00272 | CDS | open | 319898-320695 | _na 265_aa | btpA | Photosystem I assembly BtpA |
| 279 | JQCO01000001.1 | GCA001437585_00273 | CDS | open | 320779-321930 | _na 383_aa | eutG | Iron-containing alcohol dehydrogenase |
| 280 | JQCO01000001.1 | GCA001437585_00274 | CDS | open | 322007-322723 | _na 238_aa | tryptophan synthase | |
| 281 | JQCO01000001.1 | GCA001437585_00275 | CDS | open | 322837-323091 | _na 84_aa | hypothetical protein | |
| 282 | JQCO01000001.1 | GCA001437585_00276 | CDS | open | 323242-323601 | _na 119_aa | mmcQ | MmcQ/YjbR family DNA-binding protein |
| 283 | JQCO01000001.1 | GCA001437585_00277 | CDS | open | 323833-324483 | _na 216_aa | tdk | thymidine kinase |
| 284 | JQCO01000001.1 | GCA001437585_00278 | CDS | open | 325042-329241 | _na 1399_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 285 | JQCO01000001.1 | GCA001437585_00279 | CDS | open | 329231-330109 | _na 292_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 286 | JQCO01000001.1 | GCA001437585_00280 | CDS | open | 330106-330441 | _na 111_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 287 | JQCO01000001.1 | GCA001437585_00281 | CDS | open | 330438-331118 | _na 226_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 288 | JQCO01000001.1 | GCA001437585_00282 | CDS | open | 333926-334102 | _na 58_aa | Antitoxin | |
| 289 | JQCO01000001.1 | GCA001437585_00283 | CDS | open | 334099-334314 | _na 71_aa | hypothetical protein | |
| 290 | JQCO01000001.1 | GCA001437585_00284 | CDS | open | 334351-335913 | _na 520_aa | ymfN | Terminase |
| 291 | JQCO01000001.1 | GCA001437585_00285 | CDS | open | 336277-336606 | _na 109_aa | hipB | Transcriptional regulator%2C XRE family |
| 292 | JQCO01000001.1 | GCA001437585_00286 | CDS | open | 336942-337178 | _na 78_aa | Antitoxin | |
| 293 | JQCO01000001.1 | GCA001437585_00287 | CDS | open | 337162-337434 | _na 90_aa | relE | Addiction module toxin%2C RelE/StbE family |
| 294 | JQCO01000001.1 | GCA001437585_00288 | CDS | open | 337603-337926 | _na 107_aa | hypothetical protein | |
| 295 | JQCO01000001.1 | GCA001437585_00289 | CDS | open | 338134-338982 | _na 282_aa | yhhN | YhhN family protein |
| 296 | JQCO01000001.1 | GCA001437585_00290 | CDS | open | 339050-339718 | _na 222_aa | ompR | Two component transcriptional regulator%2C winged helix family |
| 297 | JQCO01000001.1 | GCA001437585_00291 | CDS | open | 339715-340800 | _na 361_aa | baeS | histidine kinase |
| 298 | JQCO01000001.1 | GCA001437585_00292 | CDS | open | 341014-341169 | _na 51_aa | hypothetical protein | |
| 299 | JQCO01000001.1 | GCA001437585_00293 | CDS | open | 341202-341972 | _na 256_aa | lolD | ABC transporter related protein |
| 300 | JQCO01000001.1 | GCA001437585_00294 | CDS | open | 341962-344055 | _na 697_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 301 | JQCO01000001.1 | GCA001437585_00295 | CDS | open | 344068-345456 | _na 462_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 302 | JQCO01000001.1 | GCA001437585_00296 | CDS | open | 345629-346312 | _na 227_aa | ompR | Response regulator receiver protein |
| 303 | JQCO01000001.1 | GCA001437585_00297 | CDS | open | 346290-347543 | _na 417_aa | baeS | histidine kinase |
| 304 | JQCO01000001.1 | GCA001437585_00298 | CDS | open | 347540-348256 | _na 238_aa | yjbM | RelA/SpoT domain protein |
| 305 | JQCO01000001.1 | GCA001437585_00299 | CDS | open | 348648-349277 | _na 209_aa | udg4 | Uracil-DNA glycosylase superfamily |
| 306 | JQCO01000001.1 | GCA001437585_00300 | CDS | open | 349284-349496 | _na 70_aa | hypothetical protein | |
| 307 | JQCO01000001.1 | GCA001437585_00301 | CDS | open | 349493-350770 | _na 425_aa | dltD | D-alanyl-lipoteichoic acid biosynthesis protein DltD |
| 308 | JQCO01000001.1 | GCA001437585_00302 | CDS | open | 350763-351026 | _na 87_aa | dltC | D-alanine--poly(phosphoribitol) ligase subunit DltC |
| 309 | JQCO01000001.1 | GCA001437585_00303 | CDS | open | 351028-352194 | _na 388_aa | dltB | D-alanyl-lipoteichoic acid biosynthesis protein DltB |
| 310 | JQCO01000001.1 | GCA001437585_00304 | CDS | open | 352211-353968 | _na 585_aa | menE | AMP-dependent synthetase and ligase |
| 311 | JQCO01000001.1 | GCA001437585_00305 | CDS | open | 354101-354787 | _na 228_aa | ompR | Two component transcriptional regulator%2C winged helix family |
| 312 | JQCO01000001.1 | GCA001437585_00306 | CDS | open | 354780-356168 | _na 462_aa | baeS | histidine kinase |
| 313 | JQCO01000001.1 | GCA001437585_00307 | CDS | open | 356179-356898 | _na 239_aa | mngR | Transcriptional regulator%2C GntR family |
| 314 | JQCO01000001.1 | GCA001437585_00308 | CDS | open | 357216-358826 | _na 536_aa | ptsG2 | PTS system maltose-specific IIB/IIC components |
| 315 | JQCO01000001.1 | GCA001437585_00309 | CDS | open | 358971-359789 | _na 272_aa | cof | Haloacid dehalogenase domain protein hydrolase type 3 |
| 316 | JQCO01000001.1 | GCA001437585_00310 | CDS | open | 360009-361361 | _na 450_aa | hypothetical protein | |
| 317 | JQCO01000001.1 | GCA001437585_00311 | CDS | open | 361554-363218 | _na 554_aa | yqiK | Band 7 protein |
| 318 | JQCO01000001.1 | GCA001437585_00312 | CDS | open | 363380-363694 | _na 104_aa | hypothetical protein | |
| 319 | JQCO01000001.1 | GCA001437585_00313 | CDS | open | 363756-364133 | _na 125_aa | hypothetical protein | |
| 320 | JQCO01000001.1 | GCA001437585_00314 | CDS | open | 364599-365471 | _na 290_aa | map | type I methionyl aminopeptidase |
| 321 | JQCO01000001.1 | GCA001437585_00315 | CDS | open | 365604-366350 | _na 248_aa | glpR | Transcriptional regulator%2C DeoR family |
| 322 | JQCO01000001.1 | GCA001437585_00316 | CDS | open | 366392-367300 | _na 302_aa | pflA | Glycyl-radical enzyme activating protein family |
| 323 | JQCO01000001.1 | GCA001437585_00317 | CDS | open | 367559-369973 | _na 804_aa | pflD | Pyruvate formate-lyase |
| 324 | JQCO01000001.1 | GCA001437585_00318 | CDS | open | 369970-371049 | _na 359_aa | ddlA | D-alanine--D-alanine ligase |
| 325 | JQCO01000001.1 | GCA001437585_00319 | CDS | open | 371399-372364 | _na 321_aa | yfdV | Auxin Efflux Carrier |
| 326 | JQCO01000001.1 | GCA001437585_00320 | CDS | open | 372492-373331 | _na 279_aa | yncE | YncE family protein |
| 327 | JQCO01000001.1 | GCA001437585_00321 | CDS | open | 373714-374268 | _na 184_aa | ssuE | NADPH-dependent FMN reductase |
| 328 | JQCO01000001.1 | GCA001437585_00322 | CDS | open | 374673-376286 | _na 537_aa | hipB | alanine transaminase |
| 329 | JQCO01000001.1 | GCA001437585_00323 | CDS | open | 376566-377081 | _na 171_aa | hypothetical protein | |
| 330 | JQCO01000001.1 | GCA001437585_00324 | CDS | open | 377078-377302 | _na 74_aa | hypothetical protein | |
| 331 | JQCO01000001.1 | GCA001437585_00325 | CDS | open | 377462-377701 | _na 79_aa | abrB | Toxin-antitoxin system%2C antitoxin component%2C AbrB domain protein |
| 332 | JQCO01000001.1 | GCA001437585_00326 | CDS | open | 377711-378133 | _na 140_aa | hypothetical protein | |
| 333 | JQCO01000001.1 | GCA001437585_00327 | CDS | open | 379036-379983 | _na 315_aa | notI | Restriction endonuclease type II NotI domain-containing protein |
| 334 | JQCO01000001.1 | GCA001437585_00328 | CDS | open | 379987-380940 | _na 317_aa | Cytosine-specific methyltransferase | |
| 335 | JQCO01000001.1 | GCA001437585_00329 | CDS | open | 381505-382002 | _na 165_aa | alkA | HhH-GPD family protein |
| 336 | JQCO01000001.1 | GCA001437585_00330 | CDS | open | 382203-382877 | _na 224_aa | AbiTii domain-containing protein | |
| 337 | JQCO01000001.1 | GCA001437585_00331 | CDS | open | 384840-385544 | _na 234_aa | puuD | Peptidase C26 |
| 338 | JQCO01000001.1 | GCA001437585_00332 | CDS | open | 385771-386253 | _na 160_aa | comEB | dCMP deaminase |
| 339 | JQCO01000001.1 | GCA001437585_00333 | CDS | open | 386436-386630 | _na 64_aa | relB | type II toxin-antitoxin system RelB/DinJ family antitoxin |
| 340 | JQCO01000001.1 | GCA001437585_00334 | CDS | open | 386599-386736 | _na 45_aa | hypothetical protein | |
| 341 | JQCO01000001.1 | GCA001437585_00335 | CDS | open | 387558-389528 | _na 656_aa | htpG | molecular chaperone HtpG |
| 342 | JQCO01000001.1 | GCA001437585_00336 | CDS | open | 389695-389940 | _na 81_aa | hypothetical protein | |
| 343 | JQCO01000001.1 | GCA001437585_00337 | CDS | open | 390100-391071 | _na 323_aa | dnaQ | Exonuclease RNase T and DNA polymerase III |
| 344 | JQCO01000001.1 | GCA001437585_00338 | CDS | open | 391185-391553 | _na 122_aa | vOC | Glyoxalase/bleomycin resistance protein/dioxygenase |
| 345 | JQCO01000001.1 | GCA001437585_00339 | CDS | open | 391865-392944 | _na 359_aa | pfkA | 6-phosphofructokinase |
| 346 | JQCO01000001.1 | GCA001437585_00340 | CDS | open | 393485-394396 | _na 303_aa | cysK | cysteine synthase A |
| 347 | JQCO01000001.1 | GCA001437585_00341 | CDS | open | 394484-395155 | _na 223_aa | cysE | serine O-acetyltransferase |
| 348 | JQCO01000001.1 | GCA001437585_00342 | CDS | open | 395404-396297 | _na 297_aa | Abortive infection protein | |
| 349 | JQCO01000001.1 | GCA001437585_00343 | CDS | open | 396406-397032 | _na 208_aa | ykaA | Putitive phosphate transport regulator |
| 350 | JQCO01000001.1 | GCA001437585_00344 | CDS | open | 397036-398031 | _na 331_aa | pitA | Phosphate transporter |
| 351 | JQCO01000001.1 | GCA001437585_00345 | CDS | open | 398094-399488 | _na 464_aa | erfK | ErfK/YbiS/YcfS/YnhG family protein |
| 352 | JQCO01000001.1 | GCA001437585_00346 | CDS | open | 399812-400261 | _na 149_aa | marR | Transcriptional regulator%2C MarR family |
| 353 | JQCO01000001.1 | GCA001437585_00347 | CDS | open | 400314-401159 | _na 281_aa | degV | DegV family protein |
| 354 | JQCO01000001.1 | GCA001437585_00348 | CDS | open | 401425-404811 | _na 1128_aa | Peptidase M14 carboxypeptidase A | |
| 355 | JQCO01000001.1 | GCA001437585_00349 | CDS | open | 404934-406088 | _na 384_aa | afuA | Extracellular solute-binding protein family 1 |
| 356 | JQCO01000001.1 | GCA001437585_00350 | CDS | open | 406208-407926 | _na 572_aa | fbpB | ABC transmembrane type-1 domain-containing protein |
| 357 | JQCO01000001.1 | GCA001437585_00351 | CDS | open | 407930-409006 | _na 358_aa | potA | ABC transporter related protein |
| 358 | JQCO01000001.1 | GCA001437585_00352 | CDS | open | 409357-409674 | _na 105_aa | hypothetical protein | |
| 359 | JQCO01000001.1 | GCA001437585_00353 | CDS | open | 411103-412584 | _na 493_aa | ATP-dependent Zn protease | |
| 360 | JQCO01000001.1 | GCA001437585_00354 | CDS | open | 412765-413409 | _na 214_aa | GCN5-related N-acetyltransferase | |
| 361 | JQCO01000001.1 | GCA001437585_00355 | CDS | open | 413635-414207 | _na 190_aa | nagE | PTS system IIA component%2C Glc family (TC 4-A1) |
| 362 | JQCO01000001.1 | GCA001437585_00356 | CDS | open | 414331-414657 | _na 108_aa | hypothetical protein | |
| 363 | JQCO01000001.1 | GCA001437585_00357 | CDS | open | 415043-416140 | _na 365_aa | Nucleoid-associated protein | |
| 364 | JQCO01000001.1 | GCA001437585_00358 | CDS | open | 416109-416957 | _na 282_aa | yaaA | UPF0246 protein Olsu_1159 |
| 365 | JQCO01000001.1 | GCA001437585_00359 | CDS | open | 416958-417953 | _na 331_aa | lysR | Transcriptional regulator%2C LysR family |
| 366 | JQCO01000001.1 | GCA001437585_00360 | CDS | open | 418114-418959 | _na 281_aa | azlC | AzlC family protein |
| 367 | JQCO01000001.1 | GCA001437585_00361 | CDS | open | 418949-419257 | _na 102_aa | Branched-chain amino acid transport | |
| 368 | JQCO01000001.1 | GCA001437585_00362 | CDS | open | 419477-420259 | _na 260_aa | Peptidase A24A prepilin type IV | |
| 369 | JQCO01000001.1 | GCA001437585_00363 | CDS | open | 420578-421750 | _na 390_aa | cwlO1 | NLP/P60 protein |
| 370 | JQCO01000001.1 | GCA001437585_00364 | CDS | open | 421804-422475 | _na 223_aa | yqfA | Channel protein%2C hemolysin III family |
| 371 | JQCO01000001.1 | GCA001437585_00365 | CDS | open | 422527-424074 | _na 515_aa | pepD | C69 family dipeptidase |
| 372 | JQCO01000001.1 | GCA001437585_00366 | CDS | open | 424251-425279 | _na 342_aa | aroG1 | 3-deoxy-7-phosphoheptulonate synthase |
| 373 | JQCO01000001.1 | GCA001437585_00367 | CDS | open | 425284-426867 | _na 527_aa | lldP | L-lactate permease |
| 374 | JQCO01000001.1 | GCA001437585_00368 | CDS | open | 427187-427768 | _na 193_aa | yajL | DJ-1 family glyoxalase III |
| 375 | JQCO01000001.1 | GCA001437585_00369 | CDS | open | 427778-429160 | _na 460_aa | dinP | DNA-directed DNA polymerase |
| 376 | JQCO01000001.1 | GCA001437585_00370 | CDS | open | 429235-429549 | _na 104_aa | YolD-like protein | |
| 377 | JQCO01000001.1 | GCA001437585_00371 | CDS | open | 429726-429977 | _na 83_aa | hypothetical protein | |
| 378 | JQCO01000001.1 | GCA001437585_00372 | CDS | open | 430482-431213 | _na 243_aa | mngR | Transcriptional regulator%2C GntR family |
| 379 | JQCO01000001.1 | GCA001437585_00373 | CDS | open | 431373-432074 | _na 233_aa | lolD | ABC transporter related protein |
| 380 | JQCO01000001.1 | GCA001437585_00374 | CDS | open | 432078-435491 | _na 1137_aa | lolE | ABC3 transporter permease C-terminal domain-containing protein |
| 381 | JQCO01000001.1 | GCA001437585_00375 | CDS | open | 435635-437431 | _na 598_aa | PAS/PAC sensor protein | |
| 382 | JQCO01000001.1 | GCA001437585_00376 | CDS | open | 437686-439260 | _na 524_aa | mMP0363 | ATPase associated with various cellular activities AAA_5 |
| 383 | JQCO01000001.1 | GCA001437585_00377 | CDS | open | 439376-442225 | _na 949_aa | VWA-like domain-containing protein | |
| 384 | JQCO01000001.1 | GCA001437585_00378 | CDS | open | 442549-443415 | _na 288_aa | cof | HAD-superfamily hydrolase%2C subfamily IIB |
| 385 | JQCO01000001.1 | GCA001437585_00379 | CDS | open | 443473-444723 | _na 416_aa | btlA | Major facilitator superfamily MFS_1 |
| 386 | JQCO01000001.1 | GCA001437585_00380 | CDS | open | 444945-445931 | _na 328_aa | Phospholipase C/D domain-containing protein | |
| 387 | JQCO01000001.1 | GCA001437585_00381 | CDS | open | 445921-446481 | _na 186_aa | vsr | DNA mismatch endonuclease Vsr |
| 388 | JQCO01000001.1 | GCA001437585_00382 | CDS | open | 446539-447339 | _na 266_aa | Metallophosphoesterase | |
| 389 | JQCO01000001.1 | GCA001437585_00383 | CDS | open | 447405-449303 | _na 632_aa | tesA | GCN5-related N-acetyltransferase |
| 390 | JQCO01000001.1 | GCA001437585_00384 | CDS | open | 449388-450659 | _na 423_aa | dgt | Metal-dependent phosphohydrolase HD sub domain protein |
| 391 | JQCO01000001.1 | GCA001437585_00385 | CDS | open | 450659-452047 | _na 462_aa | rarA | Recombination protein MgsA |
| 392 | JQCO01000001.1 | GCA001437585_00386 | CDS | open | 452123-452704 | _na 193_aa | DUF948 domain-containing protein | |
| 393 | JQCO01000001.1 | GCA001437585_00387 | CDS | open | 452743-453120 | _na 125_aa | Putative anti-sigma regulatory factor%2C serine/threonine protein kinase | |
| 394 | JQCO01000001.1 | GCA001437585_00388 | CDS | open | 453110-453940 | _na 276_aa | RNA polymerase%2C sigma 37 subunit%2C RpsB/SigB | |
| 395 | JQCO01000001.1 | GCA001437585_00389 | CDS | open | 453965-455395 | _na 476_aa | perM | AI-2E family transporter |
| 396 | JQCO01000001.1 | GCA001437585_00390 | CDS | open | 455484-458126 | _na 880_aa | alaS | alanine--tRNA ligase |
| 397 | JQCO01000001.1 | GCA001437585_00391 | CDS | open | 458135-458548 | _na 137_aa | ruvX | Holliday junction resolvase RuvX |
| 398 | JQCO01000001.1 | GCA001437585_00392 | CDS | open | 458551-459789 | _na 412_aa | mltG | Endolytic murein transglycosylase |
| 399 | JQCO01000001.1 | GCA001437585_00393 | CDS | open | 459794-460297 | _na 167_aa | yqeG | HAD superfamily (Subfamily IIIA) phosphatase%2C TIGR01668 |
| 400 | JQCO01000001.1 | GCA001437585_00394 | CDS | open | 460350-460898 | _na 182_aa | aroK | Shikimate kinase |
| 401 | JQCO01000001.1 | GCA001437585_00395 | CDS | open | 460895-462034 | _na 379_aa | aroB | 3-dehydroquinate synthase |
| 402 | JQCO01000001.1 | GCA001437585_00396 | CDS | open | 462066-463190 | _na 374_aa | pepP | Peptidase M24 |
| 403 | JQCO01000001.1 | GCA001437585_00397 | CDS | open | 463661-466705 | _na 1014_aa | LPXTG-motif cell wall anchor domain protein | |
| 404 | JQCO01000001.1 | GCA001437585_00398 | CDS | open | 467002-467997 | _na 331_aa | agaB | PTS system mannose-specific EIIAB component |
| 405 | JQCO01000001.1 | GCA001437585_00399 | CDS | open | 468024-468833 | _na 269_aa | manY | Phosphotransferase system PTS sorbose-specific IIC subunit |
| 406 | JQCO01000001.1 | GCA001437585_00400 | CDS | open | 468856-469773 | _na 305_aa | manZ | PTS system IID component%2C Man family (TC 4-A6) |
| 407 | JQCO01000001.1 | GCA001437585_00401 | CDS | open | 469873-470262 | _na 129_aa | manO | Regulator of the mannose operon%2C ManO |
| 408 | JQCO01000001.1 | GCA001437585_00402 | CDS | open | 470797-471360 | _na 187_aa | efp | elongation factor P |
| 409 | JQCO01000001.1 | GCA001437585_00403 | CDS | open | 471527-471889 | _na 120_aa | Asp23/Gls24 family envelope stress response protein | |
| 410 | JQCO01000001.1 | GCA001437585_00404 | CDS | open | 471895-472392 | _na 165_aa | nusB | transcription antitermination factor NusB |
| 411 | JQCO01000001.1 | GCA001437585_00405 | CDS | open | 472396-472689 | _na 97_aa | hypothetical protein | |
| 412 | JQCO01000001.1 | GCA001437585_00406 | CDS | open | 472691-473473 | _na 260_aa | yqxC | Hemolysin A |
| 413 | JQCO01000001.1 | GCA001437585_00407 | CDS | open | 473514-474365 | _na 283_aa | nadK | NAD kinase |
| 414 | JQCO01000001.1 | GCA001437585_00408 | CDS | open | 474368-476008 | _na 546_aa | recN | DNA repair protein RecN |
| 415 | JQCO01000001.1 | GCA001437585_00409 | CDS | open | 476091-477743 | _na 550_aa | pyrG | CTP synthase |
| 416 | JQCO01000001.1 | GCA001437585_00410 | CDS | open | 477768-478733 | _na 321_aa | xerC | Tyrosine recombinase XerC |
| 417 | JQCO01000001.1 | GCA001437585_00411 | CDS | open | 478999-479424 | _na 141_aa | mraZ | Transcriptional regulator MraZ |
| 418 | JQCO01000001.1 | GCA001437585_00412 | CDS | open | 479443-480414 | _na 323_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 419 | JQCO01000001.1 | GCA001437585_00413 | CDS | open | 480558-481127 | _na 189_aa | ftsL | Cell division protein FtsL |
| 420 | JQCO01000001.1 | GCA001437585_00414 | CDS | open | 481241-482917 | _na 558_aa | ftsI | Peptidoglycan glycosyltransferase |
| 421 | JQCO01000001.1 | GCA001437585_00415 | CDS | open | 482944-484389 | _na 481_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 422 | JQCO01000001.1 | GCA001437585_00416 | CDS | open | 484389-485420 | _na 343_aa | mraY | phospho-N-acetylmuramoyl-pentapeptide-transferase |
| 423 | JQCO01000001.1 | GCA001437585_00417 | CDS | open | 485429-486844 | _na 471_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 424 | JQCO01000001.1 | GCA001437585_00418 | CDS | open | 488734-489720 | _na 328_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 425 | JQCO01000001.1 | GCA001437585_00419 | CDS | open | 489801-491222 | _na 473_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 426 | JQCO01000001.1 | GCA001437585_00420 | CDS | open | 491224-492138 | _na 304_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 427 | JQCO01000001.1 | GCA001437585_00421 | CDS | open | 492251-493216 | _na 321_aa | ftsQ | Polypeptide-transport-associated domain protein FtsQ-type |
| 428 | JQCO01000001.1 | GCA001437585_00422 | CDS | open | 493441-494700 | _na 419_aa | ftsZ | cell division protein FtsZ |
| 429 | JQCO01000001.1 | GCA001437585_00423 | CDS | open | 494717-495523 | _na 268_aa | yfiH | Laccase domain-containing protein |
| 430 | JQCO01000001.1 | GCA001437585_00424 | CDS | open | 495566-496297 | _na 243_aa | yggS | Pyridoxal phosphate homeostasis protein |
| 431 | JQCO01000001.1 | GCA001437585_00425 | CDS | open | 496365-497135 | _na 256_aa | sepF | Cell division protein SepF |
| 432 | JQCO01000001.1 | GCA001437585_00426 | CDS | open | 497141-497953 | _na 270_aa | proC | pyrroline-5-carboxylate reductase |
| 433 | JQCO01000001.1 | GCA001437585_00427 | CDS | open | 497957-498208 | _na 83_aa | yggT | YggT family protein |
| 434 | JQCO01000001.1 | GCA001437585_00428 | CDS | open | 498283-498972 | _na 229_aa | Cell wall synthesis protein Wag31 | |
| 435 | JQCO01000001.1 | GCA001437585_00430 | CDS | open | 499672-500325 | _na 217_aa | yIH1 | Impact N-terminal domain-containing protein |
| 436 | JQCO01000001.1 | GCA001437585_00431 | CDS | open | 500374-500982 | _na 202_aa | yigB | HAD-superfamily hydrolase%2C subfamily IA%2C variant 3 |
| 437 | JQCO01000001.1 | GCA001437585_00432 | CDS | open | 501123-502586 | _na 487_aa | pepC | Aminopeptidase |
| 438 | JQCO01000001.1 | GCA001437585_00433 | CDS | open | 502686-504035 | _na 449_aa | pepC | Aminopeptidase |
| 439 | JQCO01000001.1 | GCA001437585_00434 | CDS | open | 504386-504904 | _na 172_aa | hypothetical protein | |
| 440 | JQCO01000001.1 | GCA001437585_00440 | CDS | open | 506640-507944 | _na 434_aa | Integral membrane protein | |
| 441 | JQCO01000001.1 | GCA001437585_00441 | CDS | open | 507962-509551 | _na 529_aa | sdaAA | L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha |
| 442 | JQCO01000001.1 | GCA001437585_00442 | CDS | open | 510125-510439 | _na 104_aa | relB | Addiction module antitoxin%2C RelB/DinJ family |
| 443 | JQCO01000001.1 | GCA001437585_00443 | CDS | open | 510436-510750 | _na 104_aa | Addiction module toxin%2C RelE/StbE family | |
| 444 | JQCO01000001.1 | GCA001437585_00444 | CDS | open | 510961-512454 | _na 497_aa | gltX | glutamate--tRNA ligase |
| 445 | JQCO01000001.1 | GCA001437585_00445 | CDS | open | 512586-514817 | _na 743_aa | yhgE | YhgE/Pip C-terminal domain protein |
| 446 | JQCO01000001.1 | GCA001437585_00446 | CDS | open | 514810-517503 | _na 897_aa | yhgE | YhgE/Pip C-terminal domain protein |
| 447 | JQCO01000001.1 | GCA001437585_00447 | CDS | open | 517715-518506 | _na 263_aa | acrR | Transcriptional regulator%2C TetR family |
| 448 | JQCO01000001.1 | GCA001437585_00448 | CDS | open | 518783-520036 | _na 417_aa | metK | methionine adenosyltransferase |
| 449 | JQCO01000001.1 | GCA001437585_00449 | CDS | open | 520048-522357 | _na 769_aa | priA | primosomal protein N' |
| 450 | JQCO01000001.1 | GCA001437585_00450 | CDS | open | 522566-523108 | _na 180_aa | def | peptide deformylase |
| 451 | JQCO01000001.1 | GCA001437585_00451 | CDS | open | 523118-524047 | _na 309_aa | fmt | methionyl-tRNA formyltransferase |
| 452 | JQCO01000001.1 | GCA001437585_00452 | CDS | open | 524019-525473 | _na 484_aa | nusB | NusB/RsmB/TIM44 |
| 453 | JQCO01000001.1 | GCA001437585_00453 | CDS | open | 525525-525713 | _na 62_aa | fmdB | Regulatory protein%2C FmdB family |
| 454 | JQCO01000001.1 | GCA001437585_00454 | CDS | open | 525868-527247 | _na 459_aa | thiN | thiamine diphosphokinase |
| 455 | JQCO01000001.1 | GCA001437585_00455 | CDS | open | 527368-527568 | _na 66_aa | rpmB | 50S ribosomal protein L28 |
| 456 | JQCO01000001.1 | GCA001437585_00456 | CDS | open | 527790-528134 | _na 114_aa | yloU | Asp23/Gls24 family envelope stress response protein |
| 457 | JQCO01000001.1 | GCA001437585_00457 | CDS | open | 528191-529855 | _na 554_aa | yloV | DAK2 domain fusion protein YloV |
| 458 | JQCO01000001.1 | GCA001437585_00458 | CDS | open | 529875-532037 | _na 720_aa | recG | putative DNA 3'-5' helicase RecG |
| 459 | JQCO01000001.1 | GCA001437585_00459 | CDS | open | 532034-532618 | _na 194_aa | rsmD | Methyltransferase |
| 460 | JQCO01000001.1 | GCA001437585_00460 | CDS | open | 532611-533123 | _na 170_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 461 | JQCO01000001.1 | GCA001437585_00461 | CDS | open | 533215-533712 | _na 165_aa | ATPase | |
| 462 | JQCO01000001.1 | GCA001437585_00462 | CDS | open | 533727-534353 | _na 208_aa | DUF177 domain-containing protein | |
| 463 | JQCO01000001.1 | GCA001437585_00463 | CDS | open | 534603-535145 | _na 180_aa | EF-hand domain-containing protein | |
| 464 | JQCO01000001.1 | GCA001437585_00464 | CDS | open | 535281-539576 | _na 1431_aa | yhbB | YD repeat protein |
| 465 | JQCO01000001.1 | GCA001437585_00465 | CDS | open | 539591-540061 | _na 156_aa | hypothetical protein | |
| 466 | JQCO01000001.1 | GCA001437585_00466 | CDS | open | 540269-540745 | _na 158_aa | Secreted protein | |
| 467 | JQCO01000001.1 | GCA001437585_00467 | CDS | open | 540785-541069 | _na 94_aa | hypothetical protein | |
| 468 | JQCO01000001.1 | GCA001437585_00468 | CDS | open | 541075-541374 | _na 99_aa | hypothetical protein | |
| 469 | JQCO01000001.1 | GCA001437585_00469 | CDS | open | 541371-541625 | _na 84_aa | hypothetical protein | |
| 470 | JQCO01000001.1 | GCA001437585_00470 | CDS | open | 541711-541890 | _na 59_aa | rpmF | 50S ribosomal protein L32 |
| 471 | JQCO01000001.1 | GCA001437585_00471 | CDS | open | 541984-542973 | _na 329_aa | plsX | phosphate acyltransferase PlsX |
| 472 | JQCO01000001.1 | GCA001437585_00472 | CDS | open | 543090-543326 | _na 78_aa | acpP | Acyl carrier protein |
| 473 | JQCO01000001.1 | GCA001437585_00473 | CDS | open | 543340-544068 | _na 242_aa | rnc | ribonuclease III |
| 474 | JQCO01000001.1 | GCA001437585_00474 | CDS | open | 544095-547628 | _na 1177_aa | smc | chromosome segregation protein SMC |
| 475 | JQCO01000001.1 | GCA001437585_00475 | CDS | open | 547628-548533 | _na 301_aa | ftsY | signal recognition particle-docking protein FtsY |
| 476 | JQCO01000001.1 | GCA001437585_00476 | CDS | open | 548537-549934 | _na 465_aa | ffh | signal recognition particle protein |
| 477 | JQCO01000001.1 | GCA001437585_00477 | CDS | open | 550011-551591 | _na 526_aa | erfK | ErfK/YbiS/YcfS/YnhG family protein |
| 478 | JQCO01000001.1 | GCA001437585_00478 | CDS | open | 551798-552631 | _na 277_aa | spoU | tRNA/rRNA methyltransferase (SpoU) |
| 479 | JQCO01000001.1 | GCA001437585_00479 | CDS | open | 552645-554546 | _na 633_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 480 | JQCO01000001.1 | GCA001437585_00480 | CDS | open | 554739-556736 | _na 665_aa | fbpC | Fructose-16-bisphosphatase |
| 481 | JQCO01000001.1 | GCA001437585_00481 | CDS | open | 557677-560487 | _na 936_aa | ileS | isoleucine--tRNA ligase |
| 482 | JQCO01000001.1 | GCA001437585_00482 | CDS | open | 560497-561027 | _na 176_aa | lspA | signal peptidase II |
| 483 | JQCO01000001.1 | GCA001437585_00483 | CDS | open | 561031-562059 | _na 342_aa | rluA | Pseudouridine synthase |
| 484 | JQCO01000001.1 | GCA001437585_00484 | CDS | open | 562090-563382 | _na 430_aa | Glycosyl transferase family 2 | |
| 485 | JQCO01000001.1 | GCA001437585_00485 | CDS | open | 563550-565067 | _na 505_aa | guaB | IMP dehydrogenase |
| 486 | JQCO01000001.1 | GCA001437585_00486 | CDS | open | 565115-566203 | _na 362_aa | 5-bromo-4-chloroindolyl phosphate hydrolysis protein | |
| 487 | JQCO01000001.1 | GCA001437585_00487 | CDS | open | 566245-567396 | _na 383_aa | yaaN | Toxic anion resistance family protein |
| 488 | JQCO01000001.1 | GCA001437585_00488 | CDS | open | 567574-568185 | _na 203_aa | tig | FKBP-type peptidyl-prolyl cis-trans isomerase (trigger factor) |
| 489 | JQCO01000001.1 | GCA001437585_00489 | CDS | open | 568291-568956 | _na 221_aa | crp | Putative transcriptional regulator%2C Crp/Fnr family |
| 490 | JQCO01000001.1 | GCA001437585_00490 | CDS | open | 569154-571439 | _na 761_aa | clpA | ATPase AAA-2 domain protein |
| 491 | JQCO01000001.1 | GCA001437585_00491 | CDS | open | 571502-572407 | _na 301_aa | TPR repeat-containing protein | |
| 492 | JQCO01000001.1 | GCA001437585_00492 | CDS | open | 572969-575677 | _na 902_aa | hpdB | 4-hydroxyphenylacetate decarboxylase large subunit |
| 493 | JQCO01000001.1 | GCA001437585_00493 | CDS | open | 575726-575986 | _na 86_aa | hpdC | 4-hydroxyphenylacetate decarboxylase small subunit |
| 494 | JQCO01000001.1 | GCA001437585_00494 | CDS | open | 576088-577032 | _na 314_aa | hpdA | 4-hydroxyphenylacetate decarboxylase activase |
| 495 | JQCO01000001.1 | GCA001437585_00495 | CDS | open | 577099-578049 | _na 316_aa | hypothetical protein | |
| 496 | JQCO01000001.1 | GCA001437585_00496 | CDS | open | 578095-579432 | _na 445_aa | uhpC | Major facilitator superfamily MFS_1 |
| 497 | JQCO01000001.1 | GCA001437585_00497 | CDS | open | 579605-580849 | _na 414_aa | kdpD | histidine kinase |
| 498 | JQCO01000001.1 | GCA001437585_00498 | CDS | open | 580846-581541 | _na 231_aa | ompR | Two component transcriptional regulator%2C winged helix family |
| 499 | JQCO01000001.1 | GCA001437585_00499 | CDS | open | 581756-582673 | _na 305_aa | dacC | Peptidase S11 D-alanyl-D-alanine carboxypeptidase 1 |
| 500 | JQCO01000001.1 | GCA001437585_00500 | CDS | open | 583206-585770 | _na 854_aa | leuS | leucine--tRNA ligase |

