BAKTAGenome Explorer: Prevotella intermedia (GCA_001548195.1)
Select a Genome:
|
BAKTA Annotations for GCA_001548195.1
|
Search & Sort all 4846 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | AP014925.1 | GCA001548195_02186 | gene | open | 1893036-1893302 | rpsS | ||
| 3502 | AP014925.1 | GCA001548195_02187 | gene | open | 1893325-1894152 | rplB | ||
| 3503 | AP014925.1 | GCA001548195_02188 | gene | open | 1894160-1894603 | rplW | ||
| 3504 | AP014925.1 | GCA001548195_02189 | gene | open | 1894626-1895255 | rplD | ||
| 3505 | AP014925.1 | GCA001548195_02190 | gene | open | 1895255-1895869 | rplC | ||
| 3506 | AP014925.1 | GCA001548195_02191 | gene | open | 1895920-1896225 | rpsJ | ||
| 3507 | AP014925.1 | GCA001548195_02192 | gene | open | 1896316-1898433 | fusA | ||
| 3508 | AP014925.1 | GCA001548195_02193 | gene | open | 1898463-1898939 | rpsG | ||
| 3509 | AP014925.1 | GCA001548195_02194 | gene | open | 1899168-1899551 | rpsL | ||
| 3510 | AP014925.1 | GCA001548195_02195 | gene | open | 1899752-1899862 | |||
| 3511 | AP014925.1 | GCA001548195_02196 | gene | open | 1899885-1900949 | |||
| 3512 | AP014925.1 | GCA001548195_02197 | gene | open | 1901193-1901513 | |||
| 3513 | AP014925.1 | GCA001548195_02198 | gene | open | 1901596-1903017 | |||
| 3514 | AP014925.1 | GCA001548195_02199 | gene | open | 1903260-1903997 | |||
| 3515 | AP014925.1 | GCA001548195_02200 | gene | open | 1904119-1904274 | |||
| 3516 | AP014925.1 | GCA001548195_02201 | gene | open | 1904341-1904649 | |||
| 3517 | AP014925.1 | GCA001548195_02202 | gene | open | 1904660-1905358 | |||
| 3518 | AP014925.1 | GCA001548195_02203 | gene | open | 1905363-1906466 | |||
| 3519 | AP014925.1 | GCA001548195_02204 | gene | open | 1906486-1906626 | |||
| 3520 | AP014925.1 | GCA001548195_02205 | gene | open | 1906632-1910996 | rpoC | ||
| 3521 | AP014925.1 | GCA001548195_02206 | gene | open | 1911023-1914832 | rpoB | ||
| 3522 | AP014925.1 | GCA001548195_02207 | gene | open | 1914997-1915377 | rplL | ||
| 3523 | AP014925.1 | GCA001548195_02208 | gene | open | 1915437-1915955 | rplJ | ||
| 3524 | AP014925.1 | GCA001548195_02209 | gene | open | 1915974-1916666 | rplA | ||
| 3525 | AP014925.1 | GCA001548195_02210 | gene | open | 1916688-1917128 | rplK | ||
| 3526 | AP014925.1 | GCA001548195_02211 | gene | open | 1917183-1917728 | nusG | ||
| 3527 | AP014925.1 | GCA001548195_02212 | gene | open | 1917743-1917946 | secE | ||
| 3528 | AP014925.1 | GCA001548195_02214 | gene | open | 1918083-1919273 | tuf | ||
| 3529 | AP014925.1 | GCA001548195_02219 | gene | open | 1919844-1920140 | hpf | ||
| 3530 | AP014925.1 | GCA001548195_02220 | gene | open | 1920166-1921047 | xerC | ||
| 3531 | AP014925.1 | GCA001548195_02221 | gene | open | 1921122-1921313 | rpsU | ||
| 3532 | AP014925.1 | GCA001548195_02222 | gene | open | 1921497-1922657 | |||
| 3533 | AP014925.1 | GCA001548195_02223 | gene | open | 1923456-1925249 | |||
| 3534 | AP014925.1 | GCA001548195_02224 | gene | open | 1925289-1928483 | |||
| 3535 | AP014925.1 | GCA001548195_02225 | gene | open | 1928788-1931895 | |||
| 3536 | AP014925.1 | GCA001548195_02226 | gene | open | 1931946-1935233 | |||
| 3537 | AP014925.1 | GCA001548195_02227 | gene | open | 1935236-1937173 | |||
| 3538 | AP014925.1 | GCA001548195_02228 | gene | open | 1937184-1938968 | |||
| 3539 | AP014925.1 | GCA001548195_02229 | gene | open | 1939411-1939911 | |||
| 3540 | AP014925.1 | GCA001548195_02230 | gene | open | 1939958-1940212 | |||
| 3541 | AP014925.1 | GCA001548195_02231 | gene | open | 1940215-1940907 | |||
| 3542 | AP014925.1 | GCA001548195_02232 | gene | open | 1940926-1941549 | |||
| 3543 | AP014925.1 | GCA001548195_02233 | gene | open | 1941963-1942955 | |||
| 3544 | AP014925.1 | GCA001548195_02234 | gene | open | 1943177-1944130 | |||
| 3545 | AP014925.1 | GCA001548195_02235 | gene | open | 1944371-1945900 | |||
| 3546 | AP014925.1 | GCA001548195_02236 | gene | open | 1946235-1948559 | priA | ||
| 3547 | AP014925.1 | GCA001548195_02237 | gene | open | 1948559-1950610 | |||
| 3548 | AP014925.1 | GCA001548195_02238 | gene | open | 1950849-1952366 | gltX | ||
| 3549 | AP014925.1 | GCA001548195_02239 | gene | open | 1952403-1953665 | |||
| 3550 | AP014925.1 | GCA001548195_02240 | gene | open | 1953662-1954159 | |||
| 3551 | AP014925.1 | GCA001548195_02241 | gene | open | 1954243-1955340 | trpS | ||
| 3552 | AP014925.1 | GCA001548195_02242 | gene | open | 1955789-1957018 | xerD | ||
| 3553 | AP014925.1 | GCA001548195_02243 | gene | open | 1957031-1958224 | |||
| 3554 | AP014925.1 | GCA001548195_02244 | gene | open | 1958346-1960421 | |||
| 3555 | AP014925.1 | GCA001548195_02245 | gene | open | 1961280-1963355 | |||
| 3556 | AP014925.1 | GCA001548195_02246 | gene | open | 1963345-1963881 | |||
| 3557 | AP014925.1 | GCA001548195_02247 | gene | open | 1964297-1964725 | |||
| 3558 | AP014925.1 | GCA001548195_02248 | gene | open | 1964816-1965124 | |||
| 3559 | AP014925.1 | GCA001548195_02249 | gene | open | 1965491-1965907 | mobA | ||
| 3560 | AP014925.1 | GCA001548195_02250 | gene | open | 1965991-1966311 | rteC | ||
| 3561 | AP014925.1 | GCA001548195_02251 | gene | open | 1966340-1966585 | |||
| 3562 | AP014925.1 | GCA001548195_02252 | gene | open | 1966603-1967961 | norM | ||
| 3563 | AP014925.1 | GCA001548195_02253 | gene | open | 1968058-1968906 | araC | ||
| 3564 | AP014925.1 | GCA001548195_02254 | gene | open | 1968934-1969563 | |||
| 3565 | AP014925.1 | GCA001548195_02255 | gene | open | 1969652-1969966 | hxlR | ||
| 3566 | AP014925.1 | GCA001548195_02256 | gene | open | 1970099-1970506 | yesE | ||
| 3567 | AP014925.1 | GCA001548195_02257 | gene | open | 1970632-1970994 | |||
| 3568 | AP014925.1 | GCA001548195_02258 | gene | open | 1971001-1972203 | xerD | ||
| 3569 | AP014925.1 | GCA001548195_02259 | gene | open | 1972229-1973458 | xerD | ||
| 3570 | AP014925.1 | GCA001548195_02260 | gene | open | 1973941-1974345 | |||
| 3571 | AP014925.1 | GCA001548195_02261 | gene | open | 1974566-1975468 | |||
| 3572 | AP014925.1 | GCA001548195_02262 | gene | open | 1975486-1976250 | |||
| 3573 | AP014925.1 | GCA001548195_02263 | gene | open | 1976264-1976800 | |||
| 3574 | AP014925.1 | GCA001548195_02264 | gene | open | 1976836-1977741 | |||
| 3575 | AP014925.1 | GCA001548195_02265 | gene | open | 1977846-1978148 | |||
| 3576 | AP014925.1 | GCA001548195_02266 | gene | open | 1978148-1978438 | |||
| 3577 | AP014925.1 | GCA001548195_02267 | gene | open | 1978851-1980287 | |||
| 3578 | AP014925.1 | GCA001548195_02268 | gene | open | 1980468-1981430 | |||
| 3579 | AP014925.1 | GCA001548195_02269 | gene | open | 1981435-1981896 | |||
| 3580 | AP014925.1 | GCA001548195_02270 | gene | open | 1982248-1982679 | |||
| 3581 | AP014925.1 | GCA001548195_02271 | gene | open | 1982663-1983742 | bmgA | ||
| 3582 | AP014925.1 | GCA001548195_02272 | gene | open | 1983787-1984017 | |||
| 3583 | AP014925.1 | GCA001548195_02273 | gene | open | 1984023-1986299 | |||
| 3584 | AP014925.1 | GCA001548195_02274 | gene | open | 1986414-1987052 | |||
| 3585 | AP014925.1 | GCA001548195_02275 | gene | open | 1987078-1987908 | |||
| 3586 | AP014925.1 | GCA001548195_02276 | gene | open | 1987978-1988220 | |||
| 3587 | AP014925.1 | GCA001548195_02277 | gene | open | 1988402-1988728 | |||
| 3588 | AP014925.1 | GCA001548195_02278 | gene | open | 1988747-1990426 | bppU | ||
| 3589 | AP014925.1 | GCA001548195_02279 | gene | open | 1990493-1991545 | |||
| 3590 | AP014925.1 | GCA001548195_02280 | gene | open | 1991558-1994425 | |||
| 3591 | AP014925.1 | GCA001548195_02281 | gene | open | 1994449-1994913 | |||
| 3592 | AP014925.1 | GCA001548195_02282 | gene | open | 1994915-1999552 | |||
| 3593 | AP014925.1 | GCA001548195_02283 | gene | open | 1999788-2000282 | |||
| 3594 | AP014925.1 | GCA001548195_02284 | gene | open | 2000282-2000788 | |||
| 3595 | AP014925.1 | GCA001548195_02285 | gene | open | 2001099-2001668 | |||
| 3596 | AP014925.1 | GCA001548195_02286 | gene | open | 2001689-2002192 | |||
| 3597 | AP014925.1 | GCA001548195_02287 | gene | open | 2002146-2002424 | |||
| 3598 | AP014925.1 | GCA001548195_02288 | gene | open | 2002453-2003523 | |||
| 3599 | AP014925.1 | GCA001548195_02289 | gene | open | 2003552-2004499 | |||
| 3600 | AP014925.1 | GCA001548195_02290 | gene | open | 2004588-2005169 | |||
| 3601 | AP014925.1 | GCA001548195_02291 | gene | open | 2005179-2006741 | |||
| 3602 | AP014925.1 | GCA001548195_02292 | gene | open | 2006816-2007046 | |||
| 3603 | AP014925.1 | GCA001548195_02293 | gene | open | 2007060-2007479 | |||
| 3604 | AP014925.1 | GCA001548195_02294 | gene | open | 2007485-2008828 | |||
| 3605 | AP014925.1 | GCA001548195_02295 | gene | open | 2008951-2010135 | |||
| 3606 | AP014925.1 | GCA001548195_02296 | gene | open | 2010125-2010463 | |||
| 3607 | AP014925.1 | GCA001548195_02297 | gene | open | 2010338-2010775 | |||
| 3608 | AP014925.1 | GCA001548195_02298 | gene | open | 2010772-2011329 | |||
| 3609 | AP014925.1 | GCA001548195_02299 | gene | open | 2011326-2011577 | |||
| 3610 | AP014925.1 | GCA001548195_02300 | gene | open | 2011652-2012215 | |||
| 3611 | AP014925.1 | GCA001548195_02301 | gene | open | 2012249-2012716 | |||
| 3612 | AP014925.1 | GCA001548195_02302 | gene | open | 2012674-2012973 | |||
| 3613 | AP014925.1 | GCA001548195_02303 | gene | open | 2012985-2013641 | rpiR | ||
| 3614 | AP014925.1 | GCA001548195_02304 | gene | open | 2013581-2013811 | dnaJ | ||
| 3615 | AP014925.1 | GCA001548195_02305 | gene | open | 2013786-2013965 | |||
| 3616 | AP014925.1 | GCA001548195_02306 | gene | open | 2013967-2014602 | |||
| 3617 | AP014925.1 | GCA001548195_02307 | gene | open | 2014599-2014814 | |||
| 3618 | AP014925.1 | GCA001548195_02308 | gene | open | 2014835-2015710 | |||
| 3619 | AP014925.1 | GCA001548195_02309 | gene | open | 2015842-2017863 | |||
| 3620 | AP014925.1 | GCA001548195_02310 | gene | open | 2017873-2018244 | |||
| 3621 | AP014925.1 | GCA001548195_02311 | gene | open | 2018397-2018837 | |||
| 3622 | AP014925.1 | GCA001548195_02312 | gene | open | 2019280-2019519 | |||
| 3623 | AP014925.1 | GCA001548195_02313 | gene | open | 2019815-2019991 | |||
| 3624 | AP014925.1 | GCA001548195_02314 | gene | open | 2020619-2021518 | |||
| 3625 | AP014925.1 | GCA001548195_02315 | gene | open | 2022545-2024578 | |||
| 3626 | AP014925.1 | GCA001548195_02316 | gene | open | 2025104-2025715 | |||
| 3627 | AP014925.1 | GCA001548195_02317 | gene | open | 2025729-2026286 | |||
| 3628 | AP014925.1 | GCA001548195_02318 | gene | open | 2026342-2026563 | |||
| 3629 | AP014925.1 | GCA001548195_02319 | gene | open | 2026582-2027634 | |||
| 3630 | AP014925.1 | GCA001548195_02320 | gene | open | 2027644-2029134 | gldK | ||
| 3631 | AP014925.1 | GCA001548195_02321 | gene | open | 2029134-2029934 | gldL | ||
| 3632 | AP014925.1 | GCA001548195_02322 | gene | open | 2030045-2031634 | gldM | ||
| 3633 | AP014925.1 | GCA001548195_02323 | gene | open | 2031712-2032761 | gldN | ||
| 3634 | AP014925.1 | GCA001548195_02324 | gene | open | 2032860-2033480 | |||
| 3635 | AP014925.1 | GCA001548195_02325 | gene | open | 2034077-2036767 | |||
| 3636 | AP014925.1 | GCA001548195_02326 | gene | open | 2036785-2037723 | fecR | ||
| 3637 | AP014925.1 | GCA001548195_02327 | gene | open | 2037720-2038214 | |||
| 3638 | AP014925.1 | GCA001548195_02328 | gene | open | 2038562-2038732 | |||
| 3639 | AP014925.1 | GCA001548195_02329 | gene | open | 2038723-2039403 | |||
| 3640 | AP014925.1 | GCA001548195_02330 | gene | open | 2039422-2040594 | |||
| 3641 | AP014925.1 | GCA001548195_02331 | gene | open | 2040752-2041366 | ykuD | ||
| 3642 | AP014925.1 | GCA001548195_02332 | gene | open | 2041370-2041987 | |||
| 3643 | AP014925.1 | GCA001548195_02333 | gene | open | 2042625-2043197 | |||
| 3644 | AP014925.1 | GCA001548195_02334 | gene | open | 2043303-2043689 | |||
| 3645 | AP014925.1 | GCA001548195_02335 | gene | open | 2043722-2044621 | |||
| 3646 | AP014925.1 | GCA001548195_02341 | gene | open | 2050285-2050497 | |||
| 3647 | AP014925.1 | GCA001548195_02342 | gene | open | 2050562-2050687 | |||
| 3648 | AP014925.1 | GCA001548195_02343 | gene | open | 2050930-2051466 | |||
| 3649 | AP014925.1 | GCA001548195_02344 | gene | open | 2051535-2052089 | |||
| 3650 | AP014925.1 | GCA001548195_02345 | gene | open | 2052677-2054242 | |||
| 3651 | AP014925.1 | GCA001548195_02346 | gene | open | 2054255-2055094 | |||
| 3652 | AP014925.1 | GCA001548195_02347 | gene | open | 2055136-2055783 | |||
| 3653 | AP014925.1 | GCA001548195_02348 | gene | open | 2055894-2056040 | |||
| 3654 | AP014925.1 | GCA001548195_02349 | gene | open | 2056019-2056414 | |||
| 3655 | AP014925.1 | GCA001548195_02350 | gene | open | 2057094-2058212 | |||
| 3656 | AP014925.1 | GCA001548195_02351 | gene | open | 2058229-2059425 | |||
| 3657 | AP014925.1 | GCA001548195_02352 | gene | open | 2059508-2060758 | |||
| 3658 | AP014925.1 | GCA001548195_02353 | gene | open | 2061563-2061772 | |||
| 3659 | AP014925.1 | GCA001548195_02354 | gene | open | 2061785-2062003 | |||
| 3660 | AP014925.1 | GCA001548195_02355 | gene | open | 2062015-2062311 | |||
| 3661 | AP014925.1 | GCA001548195_02356 | gene | open | 2062308-2062712 | |||
| 3662 | AP014925.1 | GCA001548195_02357 | gene | open | 2062916-2063332 | |||
| 3663 | AP014925.1 | GCA001548195_02358 | gene | open | 2063353-2063883 | |||
| 3664 | AP014925.1 | GCA001548195_02359 | gene | open | 2063900-2065174 | |||
| 3665 | AP014925.1 | GCA001548195_02360 | gene | open | 2065202-2065456 | |||
| 3666 | AP014925.1 | GCA001548195_02361 | gene | open | 2065461-2065691 | |||
| 3667 | AP014925.1 | GCA001548195_02362 | gene | open | 2065893-2066906 | |||
| 3668 | AP014925.1 | GCA001548195_02363 | gene | open | 2066906-2068474 | |||
| 3669 | AP014925.1 | GCA001548195_02364 | gene | open | 2068596-2069111 | |||
| 3670 | AP014925.1 | GCA001548195_02365 | gene | open | 2069095-2069556 | |||
| 3671 | AP014925.1 | GCA001548195_02366 | gene | open | 2069584-2070429 | traP | ||
| 3672 | AP014925.1 | GCA001548195_02367 | gene | open | 2070429-2071013 | traO | ||
| 3673 | AP014925.1 | GCA001548195_02368 | gene | open | 2071015-2071935 | traN | ||
| 3674 | AP014925.1 | GCA001548195_02369 | gene | open | 2071974-2073341 | traM | ||
| 3675 | AP014925.1 | GCA001548195_02370 | gene | open | 2073292-2073624 | |||
| 3676 | AP014925.1 | GCA001548195_02371 | gene | open | 2073621-2074244 | traK | ||
| 3677 | AP014925.1 | GCA001548195_02372 | gene | open | 2074264-2075340 | traJ | ||
| 3678 | AP014925.1 | GCA001548195_02373 | gene | open | 2075343-2075972 | |||
| 3679 | AP014925.1 | GCA001548195_02374 | gene | open | 2076101-2078587 | traC | ||
| 3680 | AP014925.1 | GCA001548195_02375 | gene | open | 2078584-2078961 | traF | ||
| 3681 | AP014925.1 | GCA001548195_02376 | gene | open | 2078966-2079265 | traE | ||
| 3682 | AP014925.1 | GCA001548195_02377 | gene | open | 2079413-2080015 | |||
| 3683 | AP014925.1 | GCA001548195_02378 | gene | open | 2080003-2080743 | |||
| 3684 | AP014925.1 | GCA001548195_02379 | gene | open | 2080773-2081363 | traD | ||
| 3685 | AP014925.1 | GCA001548195_02380 | gene | open | 2081360-2081713 | |||
| 3686 | AP014925.1 | GCA001548195_02381 | gene | open | 2081739-2082170 | |||
| 3687 | AP014925.1 | GCA001548195_02382 | gene | open | 2082154-2082936 | |||
| 3688 | AP014925.1 | GCA001548195_02383 | gene | open | 2082938-2083351 | |||
| 3689 | AP014925.1 | GCA001548195_02384 | gene | open | 2083733-2084146 | mobA | ||
| 3690 | AP014925.1 | GCA001548195_02385 | gene | open | 2084131-2085366 | |||
| 3691 | AP014925.1 | GCA001548195_02386 | gene | open | 2085551-2087560 | virD4 | ||
| 3692 | AP014925.1 | GCA001548195_02387 | gene | open | 2088350-2088670 | rteC | ||
| 3693 | AP014925.1 | GCA001548195_02388 | gene | open | 2088699-2088932 | |||
| 3694 | AP014925.1 | GCA001548195_02389 | gene | open | 2089044-2089847 | |||
| 3695 | AP014925.1 | GCA001548195_02390 | gene | open | 2089951-2090349 | |||
| 3696 | AP014925.1 | GCA001548195_02391 | gene | open | 2090560-2091291 | |||
| 3697 | AP014925.1 | GCA001548195_02392 | gene | open | 2091305-2092330 | |||
| 3698 | AP014925.1 | GCA001548195_02393 | gene | open | 2092472-2093374 | |||
| 3699 | AP014925.1 | GCA001548195_02394 | gene | open | 2093405-2093836 | |||
| 3700 | AP014925.1 | GCA001548195_02395 | gene | open | 2094048-2094602 | |||
| 3701 | AP014925.1 | GCA001548195_02396 | gene | open | 2094615-2096465 | |||
| 3702 | AP014925.1 | GCA001548195_02397 | gene | open | 2096492-2097787 | |||
| 3703 | AP014925.1 | GCA001548195_02398 | gene | open | 2097876-2098856 | araC | ||
| 3704 | AP014925.1 | GCA001548195_02399 | gene | open | 2098982-2100163 | |||
| 3705 | AP014925.1 | GCA001548195_02400 | gene | open | 2100182-2102557 | |||
| 3706 | AP014925.1 | GCA001548195_02401 | gene | open | 2102757-2104502 | mdlB | ||
| 3707 | AP014925.1 | GCA001548195_02402 | gene | open | 2104505-2106202 | mdlB | ||
| 3708 | AP014925.1 | GCA001548195_02403 | gene | open | 2106377-2107771 | |||
| 3709 | AP014925.1 | GCA001548195_02404 | gene | open | 2107806-2109935 | |||
| 3710 | AP014925.1 | GCA001548195_02405 | gene | open | 2110073-2110504 | |||
| 3711 | AP014925.1 | GCA001548195_02406 | gene | open | 2110491-2115956 | |||
| 3712 | AP014925.1 | GCA001548195_02407 | gene | open | 2116045-2116365 | |||
| 3713 | AP014925.1 | GCA001548195_02408 | gene | open | 2116349-2116702 | |||
| 3714 | AP014925.1 | GCA001548195_02409 | gene | open | 2116924-2117202 | |||
| 3715 | AP014925.1 | GCA001548195_02410 | gene | open | 2117240-2117542 | |||
| 3716 | AP014925.1 | GCA001548195_02411 | gene | open | 2117592-2117954 | |||
| 3717 | AP014925.1 | GCA001548195_02412 | gene | open | 2117970-2119205 | xerD | ||
| 3718 | AP014925.1 | GCA001548195_02413 | gene | open | 2119880-2121247 | |||
| 3719 | AP014925.1 | GCA001548195_02414 | gene | open | 2121364-2123949 | |||
| 3720 | AP014925.1 | GCA001548195_02415 | gene | open | 2124589-2125344 | |||
| 3721 | AP014925.1 | GCA001548195_02416 | gene | open | 2125592-2126776 | tolA | ||
| 3722 | AP014925.1 | GCA001548195_02417 | gene | open | 2126773-2127633 | tolA | ||
| 3723 | AP014925.1 | GCA001548195_02418 | gene | open | 2127634-2127864 | |||
| 3724 | AP014925.1 | GCA001548195_02419 | gene | open | 2127858-2128511 | |||
| 3725 | AP014925.1 | GCA001548195_02420 | gene | open | 2129351-2129551 | |||
| 3726 | AP014925.1 | GCA001548195_02421 | gene | open | 2129630-2130193 | |||
| 3727 | AP014925.1 | GCA001548195_02422 | gene | open | 2130275-2130640 | dut | ||
| 3728 | AP014925.1 | GCA001548195_02423 | gene | open | 2130948-2131046 | |||
| 3729 | AP014925.1 | GCA001548195_00548 | gene | open | 33628-33698 | trnQ | ||
| 3730 | AP014925.1 | GCA001548195_00568 | gene | open | 55799-55870 | trnR | ||
| 3731 | AP014925.1 | GCA001548195_00577 | gene | open | 66723-66804 | trnL | ||
| 3732 | AP014925.1 | GCA001548195_00685 | gene | open | 188970-189055 | trnL | ||
| 3733 | AP014925.1 | GCA001548195_00796 | gene | open | 314619-314692 | trnI | ||
| 3734 | AP014925.1 | GCA001548195_00836 | gene | open | 361320-361392 | trnP | ||
| 3735 | AP014925.1 | GCA001548195_00852 | gene | open | 380543-380616 | trnN | ||
| 3736 | AP014925.1 | GCA001548195_00929 | gene | open | 475425-475496 | trnE | ||
| 3737 | AP014925.1 | GCA001548195_01056 | gene | open | 654059-654132 | trnI | ||
| 3738 | AP014925.1 | GCA001548195_01057 | gene | open | 654154-654227 | trnA | ||
| 3739 | AP014925.1 | GCA001548195_01122 | gene | open | 737066-737136 | trnQ | ||
| 3740 | AP014925.1 | GCA001548195_01132 | gene | open | 751990-752071 | trnL | ||
| 3741 | AP014925.1 | GCA001548195_01196 | gene | open | 812918-812991 | trnM | ||
| 3742 | AP014925.1 | GCA001548195_01248 | gene | open | 870209-870283 | trnP | ||
| 3743 | AP014925.1 | GCA001548195_01391 | gene | open | 1038821-1038893 | trnF | ||
| 3744 | AP014925.1 | GCA001548195_01574 | gene | open | 1239022-1239095 | trnP | ||
| 3745 | AP014925.1 | GCA001548195_01575 | gene | open | 1239128-1239200 | trnG | ||
| 3746 | AP014925.1 | GCA001548195_01576 | gene | open | 1239248-1239327 | trnL | ||
| 3747 | AP014925.1 | GCA001548195_01577 | gene | open | 1239353-1239436 | trnL | ||
| 3748 | AP014925.1 | GCA001548195_01578 | gene | open | 1239464-1239536 | trnG | ||
| 3749 | AP014925.1 | GCA001548195_01641 | gene | open | 1306126-1306199 | trnD | ||
| 3750 | AP014925.1 | GCA001548195_01642 | gene | open | 1306228-1306301 | trnD | ||
| 3751 | AP014925.1 | GCA001548195_01799 | gene | open | 1486395-1486468 | trnR | ||
| 3752 | AP014925.1 | GCA001548195_01827 | gene | open | 1512899-1512976 | trnV | ||
| 3753 | AP014925.1 | GCA001548195_01828 | gene | open | 1512979-1513060 | trnY | ||
| 3754 | AP014925.1 | GCA001548195_01855 | gene | open | 1544227-1544300 | trnT | ||
| 3755 | AP014925.1 | GCA001548195_01872 | gene | open | 1556364-1556437 | trnH | ||
| 3756 | AP014925.1 | GCA001548195_01933 | gene | open | 1629003-1629075 | trnK | ||
| 3757 | AP014925.1 | GCA001548195_02010 | gene | open | 1716864-1716934 | trnC | ||
| 3758 | AP014925.1 | GCA001548195_02077 | gene | open | 1788022-1788096 | trnV | ||
| 3759 | AP014925.1 | GCA001548195_02078 | gene | open | 1788145-1788219 | trnV | ||
| 3760 | AP014925.1 | GCA001548195_02213 | gene | open | 1917962-1918034 | trnW | ||
| 3761 | AP014925.1 | GCA001548195_02215 | gene | open | 1919346-1919417 | trnT | ||
| 3762 | AP014925.1 | GCA001548195_02216 | gene | open | 1919425-1919497 | trnG | ||
| 3763 | AP014925.1 | GCA001548195_02217 | gene | open | 1919566-1919647 | trnY | ||
| 3764 | AP014925.1 | GCA001548195_02218 | gene | open | 1919668-1919741 | trnT | ||
| 3765 | AP014925.1 | GCA001548195_02338 | gene | open | 2048409-2048482 | trnA | ||
| 3766 | AP014925.1 | GCA001548195_02339 | gene | open | 2048504-2048577 | trnI | ||
| 3767 | AP014925.1 | GCA001548195_00548 | tRNA | open | 33628-33698 | trnQ | tRNA-Gln(ttg) | |
| 3768 | AP014925.1 | GCA001548195_00568 | tRNA | open | 55799-55870 | trnR | tRNA-Arg(cct) | |
| 3769 | AP014925.1 | GCA001548195_00577 | tRNA | open | 66723-66804 | trnL | tRNA-Leu(caa) | |
| 3770 | AP014925.1 | GCA001548195_00685 | tRNA | open | 188970-189055 | trnL | tRNA-Leu(taa) | |
| 3771 | AP014925.1 | GCA001548195_00796 | tRNA | open | 314619-314692 | trnI | tRNA-Ile2(cat) | |
| 3772 | AP014925.1 | GCA001548195_00836 | tRNA | open | 361320-361392 | trnP | tRNA-Pro(cgg) | |
| 3773 | AP014925.1 | GCA001548195_00852 | tRNA | open | 380543-380616 | trnN | tRNA-Asn(gtt) | |
| 3774 | AP014925.1 | GCA001548195_00929 | tRNA | open | 475425-475496 | trnE | tRNA-Glu(ttc) | |
| 3775 | AP014925.1 | GCA001548195_01056 | tRNA | open | 654059-654132 | trnI | tRNA-Ile(gat) | |
| 3776 | AP014925.1 | GCA001548195_01057 | tRNA | open | 654154-654227 | trnA | tRNA-Ala(tgc) | |
| 3777 | AP014925.1 | GCA001548195_01122 | tRNA | open | 737066-737136 | trnQ | tRNA-Gln(ctg) | |
| 3778 | AP014925.1 | GCA001548195_01132 | tRNA | open | 751990-752071 | trnL | tRNA-Leu(tag) | |
| 3779 | AP014925.1 | GCA001548195_01196 | tRNA | open | 812918-812991 | trnM | tRNA-Met(cat) | |
| 3780 | AP014925.1 | GCA001548195_01248 | tRNA | open | 870209-870283 | trnP | tRNA-Pro(ggg) | |
| 3781 | AP014925.1 | GCA001548195_01391 | tRNA | open | 1038821-1038893 | trnF | tRNA-Phe(gaa) | |
| 3782 | AP014925.1 | GCA001548195_01574 | tRNA | open | 1239022-1239095 | trnP | tRNA-Pro(tgg) | |
| 3783 | AP014925.1 | GCA001548195_01575 | tRNA | open | 1239128-1239200 | trnG | tRNA-Gly(gcc) | |
| 3784 | AP014925.1 | GCA001548195_01576 | tRNA | open | 1239248-1239327 | trnL | tRNA-Leu(cag) | |
| 3785 | AP014925.1 | GCA001548195_01577 | tRNA | open | 1239353-1239436 | trnL | tRNA-Leu(gag) | |
| 3786 | AP014925.1 | GCA001548195_01578 | tRNA | open | 1239464-1239536 | trnG | tRNA-Gly(gcc) | |
| 3787 | AP014925.1 | GCA001548195_01641 | tRNA | open | 1306126-1306199 | trnD | tRNA-Asp(gtc) | |
| 3788 | AP014925.1 | GCA001548195_01642 | tRNA | open | 1306228-1306301 | trnD | tRNA-Asp(gtc) | |
| 3789 | AP014925.1 | GCA001548195_01799 | tRNA | open | 1486395-1486468 | trnR | tRNA-Arg(acg) | |
| 3790 | AP014925.1 | GCA001548195_01827 | tRNA | open | 1512899-1512976 | trnV | tRNA-Val(tac) | |
| 3791 | AP014925.1 | GCA001548195_01828 | tRNA | open | 1512979-1513060 | trnY | tRNA-Tyr(gta) | |
| 3792 | AP014925.1 | GCA001548195_01855 | tRNA | open | 1544227-1544300 | trnT | tRNA-Thr(tgt) | |
| 3793 | AP014925.1 | GCA001548195_01872 | tRNA | open | 1556364-1556437 | trnH | tRNA-His(gtg) | |
| 3794 | AP014925.1 | GCA001548195_01933 | tRNA | open | 1629003-1629075 | trnK | tRNA-Lys(ttt) | |
| 3795 | AP014925.1 | GCA001548195_02010 | tRNA | open | 1716864-1716934 | trnC | tRNA-Cys(gca) | |
| 3796 | AP014925.1 | GCA001548195_02077 | tRNA | open | 1788022-1788096 | trnV | tRNA-Val(tac) | |
| 3797 | AP014925.1 | GCA001548195_02078 | tRNA | open | 1788145-1788219 | trnV | tRNA-Val(tac) | |
| 3798 | AP014925.1 | GCA001548195_02213 | tRNA | open | 1917962-1918034 | trnW | tRNA-Trp(cca) | |
| 3799 | AP014925.1 | GCA001548195_02215 | tRNA | open | 1919346-1919417 | trnT | tRNA-Thr(ggt) | |
| 3800 | AP014925.1 | GCA001548195_02216 | tRNA | open | 1919425-1919497 | trnG | tRNA-Gly(tcc) | |
| 3801 | AP014925.1 | GCA001548195_02217 | tRNA | open | 1919566-1919647 | trnY | tRNA-Tyr(gta) | |
| 3802 | AP014925.1 | GCA001548195_02218 | tRNA | open | 1919668-1919741 | trnT | tRNA-Thr(tgt) | |
| 3803 | AP014925.1 | GCA001548195_02338 | tRNA | open | 2048409-2048482 | trnA | tRNA-Ala(tgc) | |
| 3804 | AP014925.1 | GCA001548195_02339 | tRNA | open | 2048504-2048577 | trnI | tRNA-Ile(gat) | |
| 3805 | AP014926.1 | GCA001548195_00288 | gene | open | 347718-349250 | rrs | ||
| 3806 | AP014926.1 | GCA001548195_00291 | gene | open | 349762-352671 | rrl | ||
| 3807 | AP014926.1 | GCA001548195_00292 | gene | open | 352781-352893 | rrf | ||
| 3808 | AP014926.1 | regulatory_region | open | 39430-39612 | Cobalamin riboswitch aptamer | |||
| 3809 | AP014926.1 | regulatory_region | open | 200003-200068 | DUF805 RNA | |||
| 3810 | AP014926.1 | regulatory_region | open | 202478-202542 | DUF805 RNA | |||
| 3811 | AP014926.1 | GCA001548195_00288 | rRNA | open | 347718-349250 | rrs | 16S ribosomal RNA | |
| 3812 | AP014926.1 | GCA001548195_00291 | rRNA | open | 349762-352671 | rrl | 23S ribosomal RNA | |
| 3813 | AP014926.1 | GCA001548195_00292 | rRNA | open | 352781-352893 | rrf | 5S ribosomal RNA | |
| 3814 | AP014926.1 | repeat_region | open | 340557-341258 | CRISPR array with 11 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATACAAC and spacer length 29 | |||
| 3815 | AP014926.1 | GCA001548195_00001 | CDS | open | 3-320 | _na 106_aa | AI-2E family transporter | |
| 3816 | AP014926.1 | GCA001548195_00002 | CDS | open | 556-948 | _na 130_aa | DUF1896 domain-containing protein | |
| 3817 | AP014926.1 | GCA001548195_00003 | CDS | open | 974-2206 | _na 410_aa | xerD | Tyrosine recombinase XerD |
| 3818 | AP014926.1 | GCA001548195_00004 | CDS | open | 2688-3980 | _na 430_aa | Tyr recombinase domain-containing protein | |
| 3819 | AP014926.1 | GCA001548195_00005 | CDS | open | 3988-4761 | _na 257_aa | putative ATP-dependent endonuclease%2C OLD family | |
| 3820 | AP014926.1 | GCA001548195_00006 | CDS | open | 4787-5062 | _na 91_aa | putative ATP-dependent endonuclease%2C OLD family | |
| 3821 | AP014926.1 | GCA001548195_00007 | CDS | open | 5892-7175 | _na 427_aa | ATPase | |
| 3822 | AP014926.1 | GCA001548195_00008 | CDS | open | 7332-7991 | _na 219_aa | Mobilization protein | |
| 3823 | AP014926.1 | GCA001548195_00009 | CDS | open | 8013-8936 | _na 307_aa | MobA/VirD2-like nuclease domain-containing protein | |
| 3824 | AP014926.1 | GCA001548195_00010 | CDS | open | 8933-9280 | _na 115_aa | Mobilization protein | |
| 3825 | AP014926.1 | GCA001548195_00011 | CDS | open | 9385-10275 | _na 296_aa | Zinc finger CHC2-type domain-containing protein | |
| 3826 | AP014926.1 | GCA001548195_00012 | CDS | open | 10471-11508 | _na 345_aa | Mobilization protein | |
| 3827 | AP014926.1 | GCA001548195_00013 | CDS | open | 11505-11774 | _na 89_aa | DUF3853 domain-containing protein | |
| 3828 | AP014926.1 | GCA001548195_00014 | CDS | open | 12171-12374 | _na 67_aa | DNA-binding helix-turn-helix protein | |
| 3829 | AP014926.1 | GCA001548195_00015 | CDS | open | 12466-15786 | _na 1106_aa | Helicase C-terminal domain protein | |
| 3830 | AP014926.1 | GCA001548195_00016 | CDS | open | 15802-19104 | _na 1100_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3831 | AP014926.1 | GCA001548195_00017 | CDS | open | 19128-20060 | _na 310_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3832 | AP014926.1 | GCA001548195_00018 | CDS | open | 20072-20800 | _na 242_aa | master DNA invertase Mpi family serine-type recombinase | |
| 3833 | AP014926.1 | GCA001548195_00020 | CDS | open | 21318-22109 | _na 263_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 3834 | AP014926.1 | GCA001548195_00021 | CDS | open | 22684-24333 | _na 549_aa | Alkaline protease | |
| 3835 | AP014926.1 | GCA001548195_00023 | CDS | open | 24738-25352 | _na 204_aa | IS982 family transposase | |
| 3836 | AP014926.1 | GCA001548195_00024 | CDS | open | 25934-26323 | _na 129_aa | DUF3127 domain-containing protein | |
| 3837 | AP014926.1 | GCA001548195_00025 | CDS | open | 26608-27732 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 3838 | AP014926.1 | GCA001548195_00026 | CDS | open | 27747-28658 | _na 303_aa | Exonuclease domain-containing protein | |
| 3839 | AP014926.1 | GCA001548195_00027 | CDS | open | 28661-29863 | _na 400_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 3840 | AP014926.1 | GCA001548195_00028 | CDS | open | 29838-30725 | _na 295_aa | DUF4835 domain-containing protein | |
| 3841 | AP014926.1 | GCA001548195_00029 | CDS | open | 30737-32407 | _na 556_aa | recN | DNA repair protein RecN |
| 3842 | AP014926.1 | GCA001548195_00030 | CDS | open | 32422-34089 | _na 555_aa | Serine protease | |
| 3843 | AP014926.1 | GCA001548195_00032 | CDS | open | 34650-35870 | _na 406_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 3844 | AP014926.1 | GCA001548195_00033 | CDS | open | 36942-38570 | _na 542_aa | C4-dicarboxylate ABC transporter | |
| 3845 | AP014926.1 | GCA001548195_00034 | CDS | open | 39887-40036 | _na 49_aa | hypothetical protein | |
| 3846 | AP014926.1 | GCA001548195_00035 | CDS | open | 40604-42178 | _na 524_aa | Hemerythrin-like domain-containing protein | |
| 3847 | AP014926.1 | GCA001548195_00036 | CDS | open | 43191-44054 | _na 287_aa | map | type I methionyl aminopeptidase |
| 3848 | AP014926.1 | GCA001548195_00037 | CDS | open | 44147-45181 | _na 344_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 3849 | AP014926.1 | GCA001548195_00038 | CDS | open | 45194-45742 | _na 182_aa | cinA | C-terminal domain of CinA type S |
| 3850 | AP014926.1 | GCA001548195_00039 | CDS | open | 46679-46852 | _na 57_aa | hypothetical protein | |
| 3851 | AP014926.1 | GCA001548195_00040 | CDS | open | 46890-47054 | _na 54_aa | rubredoxin | |
| 3852 | AP014926.1 | GCA001548195_00041 | CDS | open | 47163-49550 | _na 795_aa | Ferric aerobactin receptor | |
| 3853 | AP014926.1 | GCA001548195_00042 | CDS | open | 49766-50404 | _na 212_aa | DUF4827 domain-containing protein | |
| 3854 | AP014926.1 | GCA001548195_00043 | CDS | open | 50471-51862 | _na 463_aa | glmM | phosphoglucosamine mutase |
| 3855 | AP014926.1 | GCA001548195_00044 | CDS | open | 51873-52487 | _na 204_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 3856 | AP014926.1 | GCA001548195_00045 | CDS | open | 52491-54272 | _na 593_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3857 | AP014926.1 | GCA001548195_00046 | CDS | open | 54613-54816 | _na 67_aa | hypothetical protein | |
| 3858 | AP014926.1 | GCA001548195_00047 | CDS | open | 54826-56097 | _na 423_aa | IS4 family transposase | |
| 3859 | AP014926.1 | GCA001548195_00048 | CDS | open | 56346-57245 | _na 299_aa | IS982 family transposase | |
| 3860 | AP014926.1 | GCA001548195_00049 | CDS | open | 57400-58617 | _na 405_aa | ISL3 family transposase | |
| 3861 | AP014926.1 | GCA001548195_00050 | CDS | open | 58589-58789 | _na 66_aa | hypothetical protein | |
| 3862 | AP014926.1 | GCA001548195_00051 | CDS | open | 58903-59319 | _na 138_aa | glmS | methylaspartate mutase subunit S |
| 3863 | AP014926.1 | GCA001548195_00052 | CDS | open | 59323-60708 | _na 461_aa | glmL | methylaspartate mutase accessory protein GlmL |
| 3864 | AP014926.1 | GCA001548195_00053 | CDS | open | 60736-62193 | _na 485_aa | methylaspartate mutase subunit E | |
| 3865 | AP014926.1 | GCA001548195_00054 | CDS | open | 62322-63560 | _na 412_aa | methylaspartate ammonia-lyase | |
| 3866 | AP014926.1 | GCA001548195_00055 | CDS | open | 63605-64981 | _na 458_aa | 3-methylaspartate ammonia-lyase | |
| 3867 | AP014926.1 | GCA001548195_00056 | CDS | open | 65006-65326 | _na 106_aa | Acyl-CoA synthetase | |
| 3868 | AP014926.1 | GCA001548195_00057 | CDS | open | 65471-66415 | _na 314_aa | Lantibiotic ABC transporter | |
| 3869 | AP014926.1 | GCA001548195_00058 | CDS | open | 66416-67258 | _na 280_aa | fumarate hydratase | |
| 3870 | AP014926.1 | GCA001548195_00059 | CDS | open | 67284-67838 | _na 184_aa | Fe-S-containing hydro-lyase | |
| 3871 | AP014926.1 | GCA001548195_00060 | CDS | open | 68618-70741 | _na 707_aa | Dipeptidyl-peptidase | |
| 3872 | AP014926.1 | GCA001548195_00061 | CDS | open | 70781-72274 | _na 497_aa | Polysaccharide biosynthesis protein C-terminal domain-containing protein | |
| 3873 | AP014926.1 | GCA001548195_00062 | CDS | open | 72291-73517 | _na 408_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 3874 | AP014926.1 | GCA001548195_00063 | CDS | open | 74159-74965 | _na 268_aa | Glycosyltransferase RgtA/B/C/D-like domain-containing protein | |
| 3875 | AP014926.1 | GCA001548195_00064 | CDS | open | 75122-76390 | _na 422_aa | Phosphoribosylamine--glycine ligase | |
| 3876 | AP014926.1 | GCA001548195_00065 | CDS | open | 76458-78662 | _na 734_aa | Dipeptidyl peptidase IV | |
| 3877 | AP014926.1 | GCA001548195_00066 | CDS | open | 78652-80145 | _na 497_aa | THUMP domain-containing protein | |
| 3878 | AP014926.1 | GCA001548195_00067 | CDS | open | 80493-81365 | _na 290_aa | rpoD | RNA polymerase sigma-70 domain-containing protein |
| 3879 | AP014926.1 | GCA001548195_00068 | CDS | open | 81948-83333 | _na 461_aa | tssC | Type VI secretion system contractile sheath protein TssC |
| 3880 | AP014926.1 | GCA001548195_00069 | CDS | open | 83353-83811 | _na 152_aa | Type VI secretion protein%2C VC_A0107 family | |
| 3881 | AP014926.1 | GCA001548195_00070 | CDS | open | 84077-84178 | _na 33_aa | hypothetical protein | |
| 3882 | AP014926.1 | GCA001548195_00071 | CDS | open | 84185-84544 | _na 119_aa | DUF5056 domain-containing protein | |
| 3883 | AP014926.1 | GCA001548195_00072 | CDS | open | 84637-84957 | _na 106_aa | hypothetical protein | |
| 3884 | AP014926.1 | GCA001548195_00073 | CDS | open | 84954-85733 | _na 259_aa | DUF1911 domain-containing protein | |
| 3885 | AP014926.1 | GCA001548195_00074 | CDS | open | 86389-87000 | _na 203_aa | Glutamyl-tRNA amidotransferase | |
| 3886 | AP014926.1 | GCA001548195_00075 | CDS | open | 87014-89020 | _na 668_aa | Novel toxin 15 domain-containing protein | |
| 3887 | AP014926.1 | GCA001548195_00076 | CDS | open | 89118-90107 | _na 329_aa | hypothetical protein | |
| 3888 | AP014926.1 | GCA001548195_00077 | CDS | open | 90115-91959 | _na 614_aa | vgrG | VgrG protein |
| 3889 | AP014926.1 | GCA001548195_00078 | CDS | open | 92179-92577 | _na 132_aa | Type VI secretion system needle protein Hcp | |
| 3890 | AP014926.1 | GCA001548195_00079 | CDS | open | 92865-92981 | _na 38_aa | hypothetical protein | |
| 3891 | AP014926.1 | GCA001548195_00080 | CDS | open | 93192-93614 | _na 140_aa | Lysozyme | |
| 3892 | AP014926.1 | GCA001548195_00081 | CDS | open | 93627-95384 | _na 585_aa | tssF | Type VI secretion system baseplate subunit TssF |
| 3893 | AP014926.1 | GCA001548195_00082 | CDS | open | 95381-97822 | _na 813_aa | ATP-dependent Clp protease ATP-binding subunit | |
| 3894 | AP014926.1 | GCA001548195_00083 | CDS | open | 97807-98742 | _na 311_aa | tssG | Type VI secretion system baseplate subunit TssG |
| 3895 | AP014926.1 | GCA001548195_00084 | CDS | open | 98752-99636 | _na 294_aa | tssN | TssN family type VI secretion system protein |
| 3896 | AP014926.1 | GCA001548195_00085 | CDS | open | 99623-100774 | _na 383_aa | tssK | Type VI secretion system baseplate subunit TssK |
| 3897 | AP014926.1 | GCA001548195_00086 | CDS | open | 100789-101274 | _na 161_aa | tssO | Type VI secretion system transmembrane protein TssO |
| 3898 | AP014926.1 | GCA001548195_00087 | CDS | open | 101284-101733 | _na 149_aa | tssO | Type VI secretion system%2C TssO |
| 3899 | AP014926.1 | GCA001548195_00088 | CDS | open | 101742-102716 | _na 324_aa | putative surface layer protein B | |
| 3900 | AP014926.1 | GCA001548195_00089 | CDS | open | 102729-104996 | _na 755_aa | Gingipain domain-containing protein | |
| 3901 | AP014926.1 | GCA001548195_00090 | CDS | open | 105130-105438 | _na 102_aa | hypothetical protein | |
| 3902 | AP014926.1 | GCA001548195_00091 | CDS | open | 105666-105965 | _na 99_aa | Hemolysin coregulated protein Hcp (TssD) | |
| 3903 | AP014926.1 | GCA001548195_00092 | CDS | open | 106285-108108 | _na 607_aa | Type IV secretion protein Rhs | |
| 3904 | AP014926.1 | GCA001548195_00093 | CDS | open | 108120-108968 | _na 282_aa | hypothetical protein | |
| 3905 | AP014926.1 | GCA001548195_00094 | CDS | open | 108952-110112 | _na 386_aa | DUF4280 domain-containing protein | |
| 3906 | AP014926.1 | GCA001548195_00095 | CDS | open | 110133-111041 | _na 302_aa | Tetratricopeptide repeat protein | |
| 3907 | AP014926.1 | GCA001548195_00096 | CDS | open | 111090-111227 | _na 45_aa | hypothetical protein | |
| 3908 | AP014926.1 | GCA001548195_00097 | CDS | open | 111580-113190 | _na 536_aa | DUF6377 domain-containing protein | |
| 3909 | AP014926.1 | GCA001548195_00098 | CDS | open | 114163-115896 | _na 577_aa | ABC transporter | |
| 3910 | AP014926.1 | GCA001548195_00099 | CDS | open | 115922-117676 | _na 584_aa | ABC-type multidrug transport system%2C ATPase and permease component | |
| 3911 | AP014926.1 | GCA001548195_00100 | CDS | open | 117709-118323 | _na 204_aa | HTH tetR-type domain-containing protein | |
| 3912 | AP014926.1 | GCA001548195_00101 | CDS | open | 118311-118517 | _na 68_aa | hypothetical protein | |
| 3913 | AP014926.1 | GCA001548195_00102 | CDS | open | 118589-119860 | _na 423_aa | IS4 family transposase | |
| 3914 | AP014926.1 | GCA001548195_00103 | CDS | open | 120099-120362 | _na 87_aa | hypothetical protein | |
| 3915 | AP014926.1 | GCA001548195_00104 | CDS | open | 120514-121344 | _na 276_aa | Peptidase | |
| 3916 | AP014926.1 | GCA001548195_00105 | CDS | open | 122155-122640 | _na 161_aa | trxA | thioredoxin |
| 3917 | AP014926.1 | GCA001548195_00106 | CDS | open | 122660-123019 | _na 119_aa | HTH marR-type domain-containing protein | |
| 3918 | AP014926.1 | GCA001548195_00107 | CDS | open | 123310-123708 | _na 132_aa | Peroxide stress regulator | |
| 3919 | AP014926.1 | GCA001548195_00108 | CDS | open | 124548-125018 | _na 156_aa | Viral histone-like protein | |
| 3920 | AP014926.1 | GCA001548195_00109 | CDS | open | 125196-125630 | _na 144_aa | Peptidase M15 | |
| 3921 | AP014926.1 | GCA001548195_00110 | CDS | open | 126863-128041 | _na 392_aa | HTH araC/xylS-type domain-containing protein | |
| 3922 | AP014926.1 | GCA001548195_00111 | CDS | open | 128114-129052 | _na 312_aa | HipA-like C-terminal domain-containing protein | |
| 3923 | AP014926.1 | GCA001548195_00112 | CDS | open | 129045-129386 | _na 113_aa | hipA | HipA N-terminal subdomain 1 domain-containing protein |
| 3924 | AP014926.1 | GCA001548195_00113 | CDS | open | 129383-129586 | _na 67_aa | Helix-turn-helix motif | |
| 3925 | AP014926.1 | GCA001548195_00114 | CDS | open | 130089-130535 | _na 148_aa | hypothetical protein | |
| 3926 | AP014926.1 | GCA001548195_00115 | CDS | open | 130596-130862 | _na 88_aa | Secreted protein | |
| 3927 | AP014926.1 | GCA001548195_00116 | CDS | open | 130932-131306 | _na 124_aa | Bona fide RidA/YjgF/TdcF/RutC subgroup | |
| 3928 | AP014926.1 | GCA001548195_00117 | CDS | open | 131428-131844 | _na 138_aa | hypothetical protein | |
| 3929 | AP014926.1 | GCA001548195_00118 | CDS | open | 132105-132257 | _na 50_aa | hypothetical protein | |
| 3930 | AP014926.1 | GCA001548195_00119 | CDS | open | 133970-134185 | _na 71_aa | hypothetical protein | |
| 3931 | AP014926.1 | GCA001548195_00120 | CDS | open | 134598-134741 | _na 47_aa | hypothetical protein | |
| 3932 | AP014926.1 | GCA001548195_00121 | CDS | open | 136415-137125 | _na 236_aa | ABC transporter permease | |
| 3933 | AP014926.1 | GCA001548195_00122 | CDS | open | 137346-137480 | _na 44_aa | hypothetical protein | |
| 3934 | AP014926.1 | GCA001548195_00123 | CDS | open | 137571-138230 | _na 219_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 3935 | AP014926.1 | GCA001548195_00124 | CDS | open | 138377-139036 | _na 219_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 3936 | AP014926.1 | GCA001548195_00125 | CDS | open | 139189-139713 | _na 174_aa | DUF3408 domain-containing protein | |
| 3937 | AP014926.1 | GCA001548195_00126 | CDS | open | 140165-140341 | _na 58_aa | hypothetical protein | |
| 3938 | AP014926.1 | GCA001548195_00127 | CDS | open | 140378-140668 | _na 96_aa | DUF2442 domain-containing protein | |
| 3939 | AP014926.1 | GCA001548195_00128 | CDS | open | 140610-140861 | _na 83_aa | DUF4160 domain-containing protein | |
| 3940 | AP014926.1 | GCA001548195_00129 | CDS | open | 141187-142008 | _na 273_aa | Peptidase | |
| 3941 | AP014926.1 | GCA001548195_00130 | CDS | open | 142581-143324 | _na 247_aa | Peptidase | |
| 3942 | AP014926.1 | GCA001548195_00131 | CDS | open | 143675-143863 | _na 62_aa | hypothetical protein | |
| 3943 | AP014926.1 | GCA001548195_00132 | CDS | open | 144083-145477 | _na 464_aa | Peptidase | |
| 3944 | AP014926.1 | GCA001548195_00133 | CDS | open | 146083-147933 | _na 616_aa | Peptidase C25 gingipain C-terminal domain-containing protein | |
| 3945 | AP014926.1 | GCA001548195_00134 | CDS | open | 148498-148929 | _na 143_aa | osmC | Stress-induced protein OsmC |
| 3946 | AP014926.1 | GCA001548195_00135 | CDS | open | 149225-149938 | _na 237_aa | DUF2975 domain-containing protein | |
| 3947 | AP014926.1 | GCA001548195_00136 | CDS | open | 149953-150165 | _na 70_aa | Transcriptional regulator | |
| 3948 | AP014926.1 | GCA001548195_00137 | CDS | open | 150404-153223 | _na 939_aa | Peptidase M16 family/putative zinc protease | |
| 3949 | AP014926.1 | GCA001548195_00138 | CDS | open | 154288-154965 | _na 225_aa | hmuY | Heme-binding protein HmuY |
| 3950 | AP014926.1 | GCA001548195_00139 | CDS | open | 155098-157407 | _na 769_aa | TonB-dependent receptor | |
| 3951 | AP014926.1 | GCA001548195_00140 | CDS | open | 157547-161956 | _na 1469_aa | CobN/magnesium chelatase family protein | |
| 3952 | AP014926.1 | GCA001548195_00141 | CDS | open | 161964-162662 | _na 232_aa | Sodium:proton antiporter | |
| 3953 | AP014926.1 | GCA001548195_00142 | CDS | open | 162712-163308 | _na 198_aa | MotA/TolQ/ExbB proton channel domain-containing protein | |
| 3954 | AP014926.1 | GCA001548195_00143 | CDS | open | 163312-163647 | _na 111_aa | DUF2149 domain-containing protein | |
| 3955 | AP014926.1 | GCA001548195_00144 | CDS | open | 163903-164178 | _na 91_aa | DNA methylase | |
| 3956 | AP014926.1 | GCA001548195_00145 | CDS | open | 165058-166107 | _na 349_aa | Restriction endonuclease | |
| 3957 | AP014926.1 | GCA001548195_00146 | CDS | open | 166292-167929 | _na 545_aa | Dipeptidase | |
| 3958 | AP014926.1 | GCA001548195_00147 | CDS | open | 167964-169607 | _na 547_aa | Peptidase M23 domain-containing protein | |
| 3959 | AP014926.1 | GCA001548195_00148 | CDS | open | 169807-170013 | _na 68_aa | hypothetical protein | |
| 3960 | AP014926.1 | GCA001548195_00149 | CDS | open | 170010-170981 | _na 323_aa | DUF4296 domain-containing protein | |
| 3961 | AP014926.1 | GCA001548195_00150 | CDS | open | 170998-171666 | _na 222_aa | lipoprotein signal peptidase | |
| 3962 | AP014926.1 | GCA001548195_00151 | CDS | open | 171675-172058 | _na 127_aa | dnaK | DnaK suppressor protein%2C putative |
| 3963 | AP014926.1 | GCA001548195_00152 | CDS | open | 172192-175959 | _na 1255_aa | ileS | isoleucine--tRNA ligase |
| 3964 | AP014926.1 | GCA001548195_00153 | CDS | open | 176723-177286 | _na 187_aa | DKNYY family protein | |
| 3965 | AP014926.1 | GCA001548195_00154 | CDS | open | 177561-178349 | _na 262_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3966 | AP014926.1 | GCA001548195_00155 | CDS | open | 178373-179527 | _na 384_aa | Putative carbohydrate metabolism domain-containing protein | |
| 3967 | AP014926.1 | GCA001548195_00156 | CDS | open | 180174-183452 | _na 1092_aa | DUF2723 domain-containing protein | |
| 3968 | AP014926.1 | GCA001548195_00157 | CDS | open | 183712-184332 | _na 206_aa | NodB-like y domain-containing protein | |
| 3969 | AP014926.1 | GCA001548195_00158 | CDS | open | 184301-185311 | _na 336_aa | queG | tRNA epoxyqueuosine(34) reductase QueG |
| 3970 | AP014926.1 | GCA001548195_00159 | CDS | open | 185675-188215 | _na 846_aa | Interpain A | |
| 3971 | AP014926.1 | GCA001548195_00160 | CDS | open | 188349-192815 | _na 1488_aa | Cleaved adhesin domain-containing protein | |
| 3972 | AP014926.1 | GCA001548195_00161 | CDS | open | 193222-193326 | _na 34_aa | hypothetical protein | |
| 3973 | AP014926.1 | GCA001548195_00162 | CDS | open | 193576-194952 | _na 458_aa | TIGR00341 family protein | |
| 3974 | AP014926.1 | GCA001548195_00163 | CDS | open | 195079-197145 | _na 688_aa | T9SS C-terminal target domain-containing protein | |
| 3975 | AP014926.1 | GCA001548195_00164 | CDS | open | 197896-199146 | _na 416_aa | Lipocalin-like domain-containing protein | |
| 3976 | AP014926.1 | GCA001548195_00165 | CDS | open | 200083-201993 | _na 636_aa | Bacteriocin | |
| 3977 | AP014926.1 | GCA001548195_00166 | CDS | open | 202085-202321 | _na 78_aa | Inhibitor I9 domain-containing protein | |
| 3978 | AP014926.1 | GCA001548195_00167 | CDS | open | 202558-204210 | _na 550_aa | Putative subtilisin/elastase | |
| 3979 | AP014926.1 | GCA001548195_00168 | CDS | open | 204630-204908 | _na 92_aa | hxlR | Transcriptional regulator%2C HxlR family |
| 3980 | AP014926.1 | GCA001548195_00169 | CDS | open | 205387-206142 | _na 251_aa | IS982 family transposase | |
| 3981 | AP014926.1 | GCA001548195_00170 | CDS | open | 206227-206352 | _na 41_aa | hypothetical protein | |
| 3982 | AP014926.1 | GCA001548195_00171 | CDS | open | 206598-208037 | _na 479_aa | NADH-quinone oxidoreductase subunit N | |
| 3983 | AP014926.1 | GCA001548195_00172 | CDS | open | 208053-209522 | _na 489_aa | nuoM | Proton-translocating NADH-quinone oxidoreductase%2C chain M |
| 3984 | AP014926.1 | GCA001548195_00173 | CDS | open | 209569-211593 | _na 674_aa | nuoL | NADH-quinone oxidoreductase subunit L |
| 3985 | AP014926.1 | GCA001548195_00174 | CDS | open | 211603-211911 | _na 102_aa | nuoK | NADH-quinone oxidoreductase subunit NuoK |
| 3986 | AP014926.1 | GCA001548195_00175 | CDS | open | 211908-212447 | _na 179_aa | NADH-quinone oxidoreductase subunit J | |
| 3987 | AP014926.1 | GCA001548195_00176 | CDS | open | 212464-212997 | _na 177_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 3988 | AP014926.1 | GCA001548195_00177 | CDS | open | 213038-214132 | _na 364_aa | nuoH | NADH-quinone oxidoreductase subunit NuoH |
| 3989 | AP014926.1 | GCA001548195_00178 | CDS | open | 214179-215753 | _na 524_aa | NADH-quinone oxidoreductase subunit D | |
| 3990 | AP014926.1 | GCA001548195_00179 | CDS | open | 215772-216644 | _na 290_aa | NADH-quinone oxidoreductase subunit B | |
| 3991 | AP014926.1 | GCA001548195_00180 | CDS | open | 216635-216985 | _na 116_aa | NADH-quinone oxidoreductase subunit A | |
| 3992 | AP014926.1 | GCA001548195_00181 | CDS | open | 217729-218235 | _na 168_aa | NERD domain-containing protein | |
| 3993 | AP014926.1 | GCA001548195_00182 | CDS | open | 218232-219464 | _na 410_aa | AAA family ATPase | |
| 3994 | AP014926.1 | GCA001548195_00183 | CDS | open | 219786-220622 | _na 278_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3995 | AP014926.1 | GCA001548195_00184 | CDS | open | 220670-221107 | _na 145_aa | DUF4252 domain-containing protein | |
| 3996 | AP014926.1 | GCA001548195_00185 | CDS | open | 221097-221564 | _na 155_aa | Anti-sigma factor | |
| 3997 | AP014926.1 | GCA001548195_00186 | CDS | open | 221555-222064 | _na 169_aa | Sigma-70 region 2 | |
| 3998 | AP014926.1 | GCA001548195_00187 | CDS | open | 222055-222300 | _na 81_aa | hypothetical protein | |
| 3999 | AP014926.1 | GCA001548195_00188 | CDS | open | 222334-223863 | _na 509_aa | Fido domain-containing protein | |
| 4000 | AP014926.1 | GCA001548195_00189 | CDS | open | 224591-226324 | _na 577_aa | Lipocalin-like domain-containing protein |

