HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lactobacillus acidophilus (GCA_001591845.1)

Select a Genome:
BAKTA Annotations for GCA_001591845.1
Genome Selected: Lactobacillus acidophilus
ContigsBases CDSrRNA tmRNAtRNA
18 1955274 1873 3 1 55
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3920 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3920 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 BCVR01000003.1 GCA001591845_01206 gene open 131210-132094 rsmA
2502 BCVR01000003.1 GCA001591845_01207 gene open 132084-132671 rnmV
2503 BCVR01000003.1 GCA001591845_01208 gene open 132658-133425 tatD
2504 BCVR01000003.1 GCA001591845_01209 gene open 133425-135401 metG
2505 BCVR01000003.1 GCA001591845_01210 gene open 135498-138161 mgtA
2506 BCVR01000003.1 GCA001591845_01211 gene open 138451-139068
2507 BCVR01000003.1 GCA001591845_01212 gene open 139049-139528 comEB
2508 BCVR01000003.1 GCA001591845_01213 gene open 139552-140574 trpS
2509 BCVR01000003.1 GCA001591845_01214 gene open 140680-141279 sRAP
2510 BCVR01000003.1 GCA001591845_01216 gene open 141446-142108
2511 BCVR01000003.1 GCA001591845_01217 gene open 142186-142647 greA
2512 BCVR01000003.1 GCA001591845_01218 gene open 142862-143287 ibpA
2513 BCVR01000003.1 GCA001591845_01219 gene open 143431-144747 pepE
2514 BCVR01000003.1 GCA001591845_01220 gene open 144800-145744 yejF
2515 BCVR01000003.1 GCA001591845_01221 gene open 145765-146823 dppD
2516 BCVR01000003.1 GCA001591845_01222 gene open 146839-147870 dppC
2517 BCVR01000003.1 GCA001591845_01223 gene open 147878-148807 opp3b
2518 BCVR01000003.1 GCA001591845_01224 gene open 148969-150111 guaB
2519 BCVR01000003.1 GCA001591845_01225 gene open 150259-151887 oppA
2520 BCVR01000003.1 GCA001591845_01226 gene open 151967-153592 oppA
2521 BCVR01000003.1 GCA001591845_01227 gene open 153761-154414 rnaY
2522 BCVR01000003.1 GCA001591845_01228 gene open 154414-155727 pepC
2523 BCVR01000003.1 GCA001591845_01230 gene open 155931-156287
2524 BCVR01000003.1 GCA001591845_01231 gene open 156395-157657 tyrS
2525 BCVR01000003.1 GCA001591845_01232 gene open 157911-159302
2526 BCVR01000003.1 GCA001591845_01233 gene open 159403-162393 mdoB
2527 BCVR01000003.1 GCA001591845_01234 gene open 162436-163053 plsY1
2528 BCVR01000003.1 GCA001591845_01235 gene open 163053-164156 cps2a
2529 BCVR01000003.1 GCA001591845_01236 gene open 164257-164817 galM
2530 BCVR01000003.1 GCA001591845_01237 gene open 164881-165483 pcp
2531 BCVR01000003.1 GCA001591845_01238 gene open 165698-166390 gpmA
2532 BCVR01000003.1 GCA001591845_01239 gene open 166556-167317
2533 BCVR01000003.1 GCA001591845_01240 gene open 167392-168186
2534 BCVR01000003.1 GCA001591845_01241 gene open 168198-169163 mviM
2535 BCVR01000003.1 GCA001591845_01242 gene open 169253-171088 trkA
2536 BCVR01000003.1 GCA001591845_01243 gene open 171212-172306 cwlA
2537 BCVR01000003.1 GCA001591845_01244 gene open 172325-173554 flgJ
2538 BCVR01000003.1 GCA001591845_01245 gene open 173917-175287
2539 BCVR01000003.1 GCA001591845_01246 gene open 175455-176492 xrtG
2540 BCVR01000003.1 GCA001591845_01247 gene open 176492-177853 bcsA
2541 BCVR01000003.1 GCA001591845_01248 gene open 177819-178184
2542 BCVR01000003.1 GCA001591845_01249 gene open 178259-179593 slpA
2543 BCVR01000003.1 GCA001591845_01250 gene open 180237-180686
2544 BCVR01000003.1 GCA001591845_01251 gene open 180789-181223
2545 BCVR01000003.1 GCA001591845_01252 gene open 181711-183729 kup1
2546 BCVR01000003.1 GCA001591845_01253 gene open 183908-185860 pepO
2547 BCVR01000003.1 GCA001591845_01254 gene open 185934-187151 araJ
2548 BCVR01000003.1 GCA001591845_01255 gene open 187258-188469
2549 BCVR01000003.1 GCA001591845_01256 gene open 188469-189032 paaD
2550 BCVR01000003.1 GCA001591845_01257 gene open 189089-189802 nrdG
2551 BCVR01000003.1 GCA001591845_01258 gene open 189786-191981 nrdD
2552 BCVR01000003.1 GCA001591845_01259 gene open 192160-193428
2553 BCVR01000003.1 GCA001591845_01260 gene open 193450-195399 asnB
2554 BCVR01000003.1 GCA001591845_01261 gene open 195515-196912
2555 BCVR01000003.1 GCA001591845_01262 gene open 196968-197453
2556 BCVR01000003.1 GCA001591845_01263 gene open 197604-198176 tag
2557 BCVR01000003.1 GCA001591845_01264 gene open 198224-199036 phnE
2558 BCVR01000003.1 GCA001591845_01265 gene open 199036-199833 phnE
2559 BCVR01000003.1 GCA001591845_01266 gene open 199833-200606 phnC
2560 BCVR01000003.1 GCA001591845_01267 gene open 200632-201561 phnD
2561 BCVR01000003.1 GCA001591845_01268 gene open 201906-202391 uspA
2562 BCVR01000003.1 GCA001591845_01269 gene open 202541-203344 oca4
2563 BCVR01000003.1 GCA001591845_01270 gene open 203365-203853 ptsN
2564 BCVR01000003.1 GCA001591845_01271 gene open 203969-204445 rCL
2565 BCVR01000003.1 GCA001591845_01272 gene open 204815-205969 nagA
2566 BCVR01000003.1 GCA001591845_01273 gene open 206125-209139 yicI
2567 BCVR01000003.1 GCA001591845_01274 gene open 209563-210384 aes
2568 BCVR01000003.1 GCA001591845_01275 gene open 210356-211141
2569 BCVR01000003.1 GCA001591845_01276 gene open 211138-212271
2570 BCVR01000003.1 GCA001591845_01277 gene open 212362-213102 merR
2571 BCVR01000003.1 GCA001591845_01278 gene open 213132-214214 ddl
2572 BCVR01000003.1 GCA001591845_01279 gene open 214367-215605
2573 BCVR01000003.1 GCA001591845_01280 gene open 215651-216388 glnQ
2574 BCVR01000003.1 GCA001591845_01281 gene open 216381-217856 hisJ
2575 BCVR01000003.1 GCA001591845_01282 gene open 217983-218807
2576 BCVR01000003.1 GCA001591845_01283 gene open 218820-219503 acrR
2577 BCVR01000003.1 GCA001591845_01284 gene open 219662-220648 prsA
2578 BCVR01000003.1 GCA001591845_01285 gene open 220735-221187 recG
2579 BCVR01000003.1 GCA001591845_01286 gene open 221663-221941
2580 BCVR01000003.1 GCA001591845_01139 gene open 69148-69221 trnP
2581 BCVR01000003.1 GCA001591845_01140 gene open 69256-69330 trnG
2582 BCVR01000003.1 GCA001591845_01141 gene open 69453-69527 trnG
2583 BCVR01000003.1 GCA001591845_01215 gene open 141321-141391 trnG
2584 BCVR01000003.1 GCA001591845_01229 gene open 155801-155873 trnT
2585 BCVR01000003.1 GCA001591845_01139 tRNA open 69148-69221 trnP tRNA-Pro(cgg)
2586 BCVR01000003.1 GCA001591845_01140 tRNA open 69256-69330 trnG tRNA-Gly(gcc)
2587 BCVR01000003.1 GCA001591845_01141 tRNA open 69453-69527 trnG tRNA-Gly(gcc)
2588 BCVR01000003.1 GCA001591845_01215 tRNA open 141321-141391 trnG tRNA-Gly(ccc)
2589 BCVR01000003.1 GCA001591845_01229 tRNA open 155801-155873 trnT tRNA-Thr(ggt)
2590 BCVR01000004.1 regulatory_region open 34809-34888 Ribosomal protein L21 leader
2591 BCVR01000004.1 regulatory_region open 41561-41808 T-box leader
2592 BCVR01000004.1 regulatory_region open 83667-83772 PyrR binding site
2593 BCVR01000004.1 regulatory_region open 106755-106989 T-box leader
2594 BCVR01000004.1 GCA001591845_01287 CDS open 43-1800 _na     585_aa ddpA Oligopeptide ABC trasporter substrate binding protein
2595 BCVR01000004.1 GCA001591845_01288 CDS open 2002-3771 _na     589_aa ddpA Oligopeptide ABC trasporter substrate binding protein
2596 BCVR01000004.1 GCA001591845_01289 CDS open 3983-4912 _na     309_aa dppC Oligopeptide ABC transporter permease protein
2597 BCVR01000004.1 GCA001591845_01290 CDS open 4927-5886 _na     319_aa opp4B oligopeptide ABC transporter permease
2598 BCVR01000004.1 GCA001591845_01291 CDS open 5889-6875 _na     328_aa yejF Oligopeptide ABC transporter (ATP-binding protein)
2599 BCVR01000004.1 GCA001591845_01292 CDS open 6879-7910 _na     343_aa dppD Oligopeptide ABC transporter ATP-binding protein
2600 BCVR01000004.1 GCA001591845_01293 CDS open 8027-8269 _na     80_aa acpP acyl carrier protein
2601 BCVR01000004.1 GCA001591845_01294 CDS open 8302-9303 _na     333_aa plsX phosphate acyltransferase PlsX
2602 BCVR01000004.1 GCA001591845_01295 CDS open 9323-11359 _na     678_aa recG ATP-dependent DNA helicase RecG
2603 BCVR01000004.1 GCA001591845_01296 CDS open 11364-13025 _na     553_aa fakA DhaL domain-containing protein
2604 BCVR01000004.1 GCA001591845_01297 CDS open 13047-13409 _na     120_aa yloU Asp23/Gls24 family envelope stress response protein
2605 BCVR01000004.1 GCA001591845_01298 CDS open 13577-13762 _na     61_aa rpmB 50S ribosomal protein L28
2606 BCVR01000004.1 GCA001591845_01299 CDS open 13873-14178 _na     101_aa Phage protein
2607 BCVR01000004.1 GCA001591845_01300 CDS open 14225-14911 _na     228_aa thiN thiamine diphosphokinase
2608 BCVR01000004.1 GCA001591845_01301 CDS open 14911-15561 _na     216_aa rpe ribulose-phosphate 3-epimerase
2609 BCVR01000004.1 GCA001591845_01302 CDS open 15572-16462 _na     296_aa rsgA ribosome small subunit-dependent GTPase A
2610 BCVR01000004.1 GCA001591845_01303 CDS open 16464-18488 _na     674_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2611 BCVR01000004.1 GCA001591845_01304 CDS open 18478-19233 _na     251_aa pTC1 Stp1/IreP family PP2C-type Ser/Thr phosphatase
2612 BCVR01000004.1 GCA001591845_01305 CDS open 19238-20569 _na     443_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
2613 BCVR01000004.1 GCA001591845_01306 CDS open 20556-21500 _na     314_aa fmt methionyl-tRNA formyltransferase
2614 BCVR01000004.1 GCA001591845_01307 CDS open 21513-23912 _na     799_aa priA primosomal protein N'
2615 BCVR01000004.1 GCA001591845_01308 CDS open 23963-24187 _na     74_aa rpoZ DNA-directed RNA polymerase subunit omega
2616 BCVR01000004.1 GCA001591845_01309 CDS open 24190-24804 _na     204_aa gmk guanylate kinase
2617 BCVR01000004.1 GCA001591845_01310 CDS open 24915-25352 _na     145_aa yhfF ASCH domain-containing protein
2618 BCVR01000004.1 GCA001591845_01311 CDS open 25345-27027 _na     560_aa recN DNA repair protein RecN
2619 BCVR01000004.1 GCA001591845_01312 CDS open 27038-27850 _na     270_aa yqxC Ribosomal RNA large subunit methyltransferase J
2620 BCVR01000004.1 GCA001591845_01313 CDS open 27851-28720 _na     289_aa ispA Geranylgeranyl diphosphate (GGPP) synthase
2621 BCVR01000004.1 GCA001591845_01314 CDS open 28723-28965 _na     80_aa xseB exodeoxyribonuclease VII small subunit
2622 BCVR01000004.1 GCA001591845_01315 CDS open 28946-30313 _na     455_aa xseA exodeoxyribonuclease VII large subunit
2623 BCVR01000004.1 GCA001591845_01316 CDS open 30300-31151 _na     283_aa folD Bifunctional protein FolD
2624 BCVR01000004.1 GCA001591845_01317 CDS open 31445-31837 _na     130_aa nusB transcription antitermination factor NusB
2625 BCVR01000004.1 GCA001591845_01318 CDS open 31837-32271 _na     144_aa yloU Alkaline shock protein 23
2626 BCVR01000004.1 GCA001591845_01319 CDS open 32290-32859 _na     189_aa efp elongation factor P
2627 BCVR01000004.1 GCA001591845_01320 CDS open 32940-34049 _na     369_aa pepP X-Pro dipeptidase
2628 BCVR01000004.1 GCA001591845_01321 CDS open 34174-34464 _na     96_aa rpmA 50S ribosomal protein L27
2629 BCVR01000004.1 GCA001591845_01322 CDS open 34483-34794 _na     103_aa rplU 50S ribosomal protein L21
2630 BCVR01000004.1 GCA001591845_01323 CDS open 34961-35797 _na     278_aa yitT putative conserved
2631 BCVR01000004.1 GCA001591845_01324 CDS open 35884-37257 _na     457_aa Putative V-type sodium ATP synthase subunit
2632 BCVR01000004.1 GCA001591845_01325 CDS open 37388-38413 _na     341_aa ilvE branched-chain amino acid aminotransferase
2633 BCVR01000004.1 GCA001591845_01326 CDS open 38464-38643 _na     59_aa pptA 2-hydroxymuconate tautomerase
2634 BCVR01000004.1 GCA001591845_01327 CDS open 38717-39298 _na     193_aa pepQ Putative PepQ
2635 BCVR01000004.1 GCA001591845_01328 CDS open 39335-39916 _na     193_aa pepQ Putative PepQ
2636 BCVR01000004.1 GCA001591845_01329 CDS open 40122-40247 _na     41_aa Putative oligopeptide ABC transporter substrate bindingprotein
2637 BCVR01000004.1 GCA001591845_01330 CDS open 40241-40612 _na     123_aa Oligopeptide ABC transporter substrate binding protein
2638 BCVR01000004.1 GCA001591845_01331 CDS open 40937-41491 _na     184_aa Peptide binding protein
2639 BCVR01000004.1 GCA001591845_01332 CDS open 41891-42673 _na     260_aa aph Kanamycin kinase
2640 BCVR01000004.1 GCA001591845_01333 CDS open 42682-44478 _na     598_aa DUF2207 domain-containing protein
2641 BCVR01000004.1 GCA001591845_01334 CDS open 44489-45325 _na     278_aa Putative alpha-beta superfamily hydrolase
2642 BCVR01000004.1 GCA001591845_01335 CDS open 45514-46746 _na     410_aa Lysin
2643 BCVR01000004.1 GCA001591845_01337 CDS open 47287-48204 _na     305_aa yczE Integral membrane protein
2644 BCVR01000004.1 GCA001591845_01338 CDS open 48608-49504 _na     298_aa aes Lipase
2645 BCVR01000004.1 GCA001591845_01339 CDS open 49515-49874 _na     119_aa arsC Arsenate reductase
2646 BCVR01000004.1 GCA001591845_01340 CDS open 49909-51492 _na     527_aa mdlB ABC transporter ATP binding and permease protein
2647 BCVR01000004.1 GCA001591845_01341 CDS open 51492-53069 _na     525_aa mdlB ABC transporter ATP binding and permease protein
2648 BCVR01000004.1 GCA001591845_01342 CDS open 53401-54216 _na     271_aa cof HAD family hydrolase
2649 BCVR01000004.1 GCA001591845_01343 CDS open 54361-56358 _na     665_aa ABC superfamily ATP-binding cassette transporter ABC protein
2650 BCVR01000004.1 GCA001591845_01344 CDS open 56407-58449 _na     680_aa ganA Beta-galactosidase
2651 BCVR01000004.1 GCA001591845_01345 CDS open 58463-60742 _na     759_aa yicI alpha-xylosidase
2652 BCVR01000004.1 GCA001591845_01346 CDS open 60747-62237 _na     496_aa bglB Beta-glucosidase
2653 BCVR01000004.1 GCA001591845_01347 CDS open 62227-63111 _na     294_aa nagC Transcriptional regulator%2C glucose kinase
2654 BCVR01000004.1 GCA001591845_01348 CDS open 63249-64394 _na     381_aa nagC Transcriptional xylose repressor
2655 BCVR01000004.1 GCA001591845_01349 CDS open 64525-65778 _na     417_aa celB Permease IIC component
2656 BCVR01000004.1 GCA001591845_01350 CDS open 65898-66509 _na     203_aa Putative bacteriophage-related protein
2657 BCVR01000004.1 GCA001591845_01351 CDS open 66642-66857 _na     71_aa G-protein coupled receptors family 1 profile domain-containing protein
2658 BCVR01000004.1 GCA001591845_01352 CDS open 66889-67272 _na     127_aa yiaG Putative transcriptional regulator phage-related
2659 BCVR01000004.1 GCA001591845_01353 CDS open 67283-67576 _na     97_aa Putative bacteriophage related protein
2660 BCVR01000004.1 GCA001591845_01354 CDS open 67806-70187 _na     793_aa pepX Xaa-Pro dipeptidyl-peptidase
2661 BCVR01000004.1 GCA001591845_01355 CDS open 70251-70688 _na     145_aa msrB Peptide methionine sulfoxide reductase MsrB
2662 BCVR01000004.1 GCA001591845_01356 CDS open 70741-71022 _na     93_aa hypothetical protein
2663 BCVR01000004.1 GCA001591845_01357 CDS open 71142-72005 _na     287_aa glcU Transmembrane protein
2664 BCVR01000004.1 GCA001591845_01358 CDS open 72255-75308 _na     1017_aa Putative mucus binding protein
2665 BCVR01000004.1 GCA001591845_01359 CDS open 75914-76114 _na     66_aa Putative biofilm-associated surface protein
2666 BCVR01000004.1 GCA001591845_01360 CDS open 76458-79646 _na     1062_aa carB carbamoyl-phosphate synthase large subunit
2667 BCVR01000004.1 GCA001591845_01361 CDS open 79639-80724 _na     361_aa carA carbamoyl phosphate synthase small subunit
2668 BCVR01000004.1 GCA001591845_01362 CDS open 80725-81531 _na     268_aa Dihydroorotase
2669 BCVR01000004.1 GCA001591845_01363 CDS open 81591-82001 _na     136_aa hypothetical protein
2670 BCVR01000004.1 GCA001591845_01364 CDS open 82001-82957 _na     318_aa pyrB aspartate carbamoyltransferase catalytic subunit
2671 BCVR01000004.1 GCA001591845_01365 CDS open 83098-83640 _na     180_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
2672 BCVR01000004.1 GCA001591845_01366 CDS open 83817-84008 _na     63_aa hypothetical protein
2673 BCVR01000004.1 GCA001591845_01367 CDS open 83995-84741 _na     248_aa Dihydroorotate dehydrogenase B (NAD(+))%2C catalytic subunit
2674 BCVR01000004.1 GCA001591845_01368 CDS open 84993-85700 _na     235_aa pyrF orotidine-5'-phosphate decarboxylase
2675 BCVR01000004.1 GCA001591845_01369 CDS open 85700-86338 _na     212_aa pyrE Orotate phosphoribosyltransferase
2676 BCVR01000004.1 GCA001591845_01370 CDS open 86408-87055 _na     215_aa ywnB NAD(P)-binding domain-containing protein
2677 BCVR01000004.1 GCA001591845_01371 CDS open 87485-90112 _na     875_aa mgtA Cation-transporting ATPase
2678 BCVR01000004.1 GCA001591845_01372 CDS open 90196-91542 _na     448_aa clcA Cloride channel-like protein
2679 BCVR01000004.1 GCA001591845_01373 CDS open 91665-92333 _na     222_aa Peptidase M10 metallopeptidase domain-containing protein
2680 BCVR01000004.1 GCA001591845_01374 CDS open 92448-105428 _na     4326_aa Mucus binding protein Mub
2681 BCVR01000004.1 GCA001591845_01375 CDS open 105731-106243 _na     170_aa Acetyltransferase
2682 BCVR01000004.1 GCA001591845_01376 CDS open 106315-106611 _na     98_aa hypothetical protein
2683 BCVR01000004.1 GCA001591845_01377 CDS open 107026-107877 _na     283_aa nlpA lipoprotein
2684 BCVR01000004.1 GCA001591845_01378 CDS open 107915-108208 _na     97_aa Phage protein
2685 BCVR01000004.1 GCA001591845_01379 CDS open 108383-109048 _na     221_aa sdaA L-serine ammonia-lyase
2686 BCVR01000004.1 GCA001591845_01380 CDS open 109062-109943 _na     293_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
2687 BCVR01000004.1 GCA001591845_01381 CDS open 109953-110267 _na     104_aa paaD MIP18 family-like domain-containing protein
2688 BCVR01000004.1 GCA001591845_01382 CDS open 110581-112326 _na     581_aa ddpA Oligopeptide ABC trasporter substrate binding protein
2689 BCVR01000004.1 GCA001591845_01383 CDS open 112408-112515 _na     35_aa hypothetical protein
2690 BCVR01000004.1 GCA001591845_01384 CDS open 112596-113960 _na     454_aa fadH2 Peroxidase (Npx)
2691 BCVR01000004.1 GCA001591845_01385 CDS open 114227-114574 _na     115_aa yafQ Type II toxin-antitoxin system YafQ family toxin
2692 BCVR01000004.1 GCA001591845_01386 CDS open 114574-114852 _na     92_aa Antitoxin
2693 BCVR01000004.1 GCA001591845_01387 CDS open 114923-115561 _na     212_aa ywnB Oxidoreductase
2694 BCVR01000004.1 GCA001591845_01388 CDS open 115795-116136 _na     113_aa mazF mRNA interferase
2695 BCVR01000004.1 GCA001591845_01389 CDS open 116438-116809 _na     123_aa ASCH domain-containing protein
2696 BCVR01000004.1 GCA001591845_01390 CDS open 116829-117455 _na     208_aa mA1133 GyrI-like small molecule binding domain-containing protein
2697 BCVR01000004.1 GCA001591845_01391 CDS open 117638-118426 _na     262_aa Cell surface protein
2698 BCVR01000004.1 GCA001591845_01392 CDS open 118544-119398 _na     284_aa lysR Transcriptional regulator
2699 BCVR01000004.1 GCA001591845_01393 CDS open 119507-121621 _na     704_aa Fumarate reductase flavoprotein subunit
2700 BCVR01000004.1 GCA001591845_01394 CDS open 121686-121811 _na     41_aa hypothetical protein
2701 BCVR01000004.1 GCA001591845_01395 CDS open 121868-122023 _na     51_aa hypothetical protein
2702 BCVR01000004.1 GCA001591845_01396 CDS open 122492-123595 _na     367_aa gGDEF Regulator components
2703 BCVR01000004.1 GCA001591845_01397 CDS open 123726-124421 _na     231_aa eAL EAL domain-containing protein
2704 BCVR01000004.1 GCA001591845_01398 CDS open 124459-125262 _na     267_aa eAL EAL domain-containing protein
2705 BCVR01000004.1 GCA001591845_01399 CDS open 125262-125552 _na     96_aa hypothetical protein
2706 BCVR01000004.1 GCA001591845_01400 CDS open 125549-126538 _na     329_aa Glycosyltransferase 2-like domain-containing protein
2707 BCVR01000004.1 GCA001591845_01401 CDS open 126535-127047 _na     170_aa ABC transporter permease
2708 BCVR01000004.1 GCA001591845_01402 CDS open 127205-128125 _na     306_aa fadH NADH-dependent oxidoreductase
2709 BCVR01000004.1 GCA001591845_01403 CDS open 128407-128553 _na     48_aa hypothetical protein
2710 BCVR01000004.1 GCA001591845_01404 CDS open 128635-129756 _na     373_aa putative transposase
2711 BCVR01000004.1 GCA001591845_01405 CDS open 129995-130168 _na     57_aa fadH NADH-dependent oxidoreductase
2712 BCVR01000004.1 GCA001591845_01406 CDS open 130283-130837 _na     184_aa pncA Pyrazinamidase-nicotinamidase
2713 BCVR01000004.1 GCA001591845_01407 CDS open 130930-131064 _na     44_aa Gram-positive signal peptide protein%2C YSIRK family
2714 BCVR01000004.1 GCA001591845_01408 CDS open 131141-132637 _na     498_aa yjeM glutamate/gamma-aminobutyrate family transporter YjeM
2715 BCVR01000004.1 GCA001591845_01409 CDS open 132768-133463 _na     231_aa Alpha/beta hydrolase
2716 BCVR01000004.1 GCA001591845_01410 CDS open 133483-133656 _na     57_aa hypothetical protein
2717 BCVR01000004.1 GCA001591845_01411 CDS open 133805-134563 _na     252_aa Surface layer protein A domain-containing protein
2718 BCVR01000004.1 GCA001591845_01412 CDS open 134663-135355 _na     230_aa aRA1 putative oxidoreductase
2719 BCVR01000004.1 GCA001591845_01413 CDS open 135367-135774 _na     135_aa yhfA OsmC family peroxiredoxin
2720 BCVR01000004.1 GCA001591845_01414 CDS open 135792-136970 _na     392_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
2721 BCVR01000004.1 GCA001591845_01415 CDS open 137019-138293 _na     424_aa baeS histidine kinase
2722 BCVR01000004.1 GCA001591845_01416 CDS open 138303-138968 _na     221_aa ompR Two-component response regulator
2723 BCVR01000004.1 GCA001591845_01417 CDS open 138976-139587 _na     203_aa RelA/SpoT domain-containing protein
2724 BCVR01000004.1 GCA001591845_01418 CDS open 139815-140810 _na     331_aa dhaK dihydroxyacetone kinase subunit DhaK
2725 BCVR01000004.1 GCA001591845_01419 CDS open 140823-141407 _na     194_aa dhaL dihydroxyacetone kinase subunit DhaL
2726 BCVR01000004.1 GCA001591845_01420 CDS open 141404-141775 _na     123_aa dhaM phosphoenolpyruvate--glycerone phosphotransferase
2727 BCVR01000004.1 GCA001591845_01421 CDS open 141793-142500 _na     235_aa glpF Glycerol uptake facilitator protein
2728 BCVR01000004.1 GCA001591845_01422 CDS open 142749-144191 _na     480_aa gtfA sucrose phosphorylase
2729 BCVR01000004.1 GCA001591845_01423 CDS open 144201-146399 _na     732_aa melA Alpha-galactosidase Mel36A
2730 BCVR01000004.1 GCA001591845_01424 CDS open 146411-147523 _na     370_aa malK ABC transporter domain-containing protein
2731 BCVR01000004.1 GCA001591845_01425 CDS open 147555-148388 _na     277_aa ugpE Sugar ABC transporter%2C permease protein
2732 BCVR01000004.1 GCA001591845_01426 CDS open 148401-149276 _na     291_aa ugpA ABC transporter transporter permease
2733 BCVR01000004.1 GCA001591845_01427 CDS open 149290-150546 _na     418_aa ugpB ABC transporter sugar binding protein
2734 BCVR01000004.1 GCA001591845_01428 CDS open 150790-151629 _na     279_aa araC Msm operon regulatory protein
2735 BCVR01000004.1 GCA001591845_01429 CDS open 151687-152121 _na     144_aa soxR Transcriptional regulator family
2736 BCVR01000004.1 GCA001591845_01430 CDS open 152282-153754 _na     490_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
2737 BCVR01000004.1 GCA001591845_01431 CDS open 153754-154335 _na     193_aa DUF4811 domain-containing protein
2738 BCVR01000004.1 GCA001591845_01432 CDS open 154567-154860 _na     97_aa DUF4160 domain-containing protein
2739 BCVR01000004.1 GCA001591845_01433 CDS open 154853-155128 _na     91_aa hypothetical protein
2740 BCVR01000004.1 GCA001591845_01434 CDS open 155251-155931 _na     226_aa hypothetical protein
2741 BCVR01000004.1 GCA001591845_01435 CDS open 156154-156396 _na     80_aa Cyclophilin-like domain-containing protein
2742 BCVR01000004.1 GCA001591845_01436 CDS open 156569-157453 _na     294_aa Putative surface layer protein
2743 BCVR01000004.1 GCA001591845_01437 CDS open 157611-158597 _na     328_aa galM Galactose-1-epimerase
2744 BCVR01000004.1 GCA001591845_01438 CDS open 158599-160062 _na     487_aa galT2 UDP-glucose--hexose-1-phosphate uridylyltransferase
2745 BCVR01000004.1 GCA001591845_01439 CDS open 160082-161245 _na     387_aa galK galactokinase
2746 BCVR01000004.1 GCA001591845_01440 CDS open 161462-162481 _na     339_aa Putative mucus binding protein
2747 BCVR01000004.1 GCA001591845_01441 CDS open 162646-163275 _na     209_aa Putative regulator
2748 BCVR01000004.1 GCA001591845_01442 CDS open 163397-165400 _na     667_aa lacA Beta-galactosidase LacA
2749 BCVR01000004.1 GCA001591845_01443 CDS open 165411-167330 _na     639_aa melB Lactose permease
2750 BCVR01000004.1 GCA001591845_01287 gene open 43-1800 ddpA
2751 BCVR01000004.1 GCA001591845_01288 gene open 2002-3771 ddpA
2752 BCVR01000004.1 GCA001591845_01289 gene open 3983-4912 dppC
2753 BCVR01000004.1 GCA001591845_01290 gene open 4927-5886 opp4B
2754 BCVR01000004.1 GCA001591845_01291 gene open 5889-6875 yejF
2755 BCVR01000004.1 GCA001591845_01292 gene open 6879-7910 dppD
2756 BCVR01000004.1 GCA001591845_01293 gene open 8027-8269 acpP
2757 BCVR01000004.1 GCA001591845_01294 gene open 8302-9303 plsX
2758 BCVR01000004.1 GCA001591845_01295 gene open 9323-11359 recG
2759 BCVR01000004.1 GCA001591845_01296 gene open 11364-13025 fakA
2760 BCVR01000004.1 GCA001591845_01297 gene open 13047-13409 yloU
2761 BCVR01000004.1 GCA001591845_01298 gene open 13577-13762 rpmB
2762 BCVR01000004.1 GCA001591845_01299 gene open 13873-14178
2763 BCVR01000004.1 GCA001591845_01300 gene open 14225-14911 thiN
2764 BCVR01000004.1 GCA001591845_01301 gene open 14911-15561 rpe
2765 BCVR01000004.1 GCA001591845_01302 gene open 15572-16462 rsgA
2766 BCVR01000004.1 GCA001591845_01303 gene open 16464-18488 pknB
2767 BCVR01000004.1 GCA001591845_01304 gene open 18478-19233 pTC1
2768 BCVR01000004.1 GCA001591845_01305 gene open 19238-20569 rsmB
2769 BCVR01000004.1 GCA001591845_01306 gene open 20556-21500 fmt
2770 BCVR01000004.1 GCA001591845_01307 gene open 21513-23912 priA
2771 BCVR01000004.1 GCA001591845_01308 gene open 23963-24187 rpoZ
2772 BCVR01000004.1 GCA001591845_01309 gene open 24190-24804 gmk
2773 BCVR01000004.1 GCA001591845_01310 gene open 24915-25352 yhfF
2774 BCVR01000004.1 GCA001591845_01311 gene open 25345-27027 recN
2775 BCVR01000004.1 GCA001591845_01312 gene open 27038-27850 yqxC
2776 BCVR01000004.1 GCA001591845_01313 gene open 27851-28720 ispA
2777 BCVR01000004.1 GCA001591845_01314 gene open 28723-28965 xseB
2778 BCVR01000004.1 GCA001591845_01315 gene open 28946-30313 xseA
2779 BCVR01000004.1 GCA001591845_01316 gene open 30300-31151 folD
2780 BCVR01000004.1 GCA001591845_01317 gene open 31445-31837 nusB
2781 BCVR01000004.1 GCA001591845_01318 gene open 31837-32271 yloU
2782 BCVR01000004.1 GCA001591845_01319 gene open 32290-32859 efp
2783 BCVR01000004.1 GCA001591845_01320 gene open 32940-34049 pepP
2784 BCVR01000004.1 GCA001591845_01321 gene open 34174-34464 rpmA
2785 BCVR01000004.1 GCA001591845_01322 gene open 34483-34794 rplU
2786 BCVR01000004.1 GCA001591845_01323 gene open 34961-35797 yitT
2787 BCVR01000004.1 GCA001591845_01324 gene open 35884-37257
2788 BCVR01000004.1 GCA001591845_01325 gene open 37388-38413 ilvE
2789 BCVR01000004.1 GCA001591845_01326 gene open 38464-38643 pptA
2790 BCVR01000004.1 GCA001591845_01327 gene open 38717-39298 pepQ
2791 BCVR01000004.1 GCA001591845_01328 gene open 39335-39916 pepQ
2792 BCVR01000004.1 GCA001591845_01329 gene open 40122-40247
2793 BCVR01000004.1 GCA001591845_01330 gene open 40241-40612
2794 BCVR01000004.1 GCA001591845_01331 gene open 40937-41491
2795 BCVR01000004.1 GCA001591845_01332 gene open 41891-42673 aph
2796 BCVR01000004.1 GCA001591845_01333 gene open 42682-44478
2797 BCVR01000004.1 GCA001591845_01334 gene open 44489-45325
2798 BCVR01000004.1 GCA001591845_01335 gene open 45514-46746
2799 BCVR01000004.1 GCA001591845_01337 gene open 47287-48204 yczE
2800 BCVR01000004.1 GCA001591845_01338 gene open 48608-49504 aes
2801 BCVR01000004.1 GCA001591845_01339 gene open 49515-49874 arsC
2802 BCVR01000004.1 GCA001591845_01340 gene open 49909-51492 mdlB
2803 BCVR01000004.1 GCA001591845_01341 gene open 51492-53069 mdlB
2804 BCVR01000004.1 GCA001591845_01342 gene open 53401-54216 cof
2805 BCVR01000004.1 GCA001591845_01343 gene open 54361-56358
2806 BCVR01000004.1 GCA001591845_01344 gene open 56407-58449 ganA
2807 BCVR01000004.1 GCA001591845_01345 gene open 58463-60742 yicI
2808 BCVR01000004.1 GCA001591845_01346 gene open 60747-62237 bglB
2809 BCVR01000004.1 GCA001591845_01347 gene open 62227-63111 nagC
2810 BCVR01000004.1 GCA001591845_01348 gene open 63249-64394 nagC
2811 BCVR01000004.1 GCA001591845_01349 gene open 64525-65778 celB
2812 BCVR01000004.1 GCA001591845_01350 gene open 65898-66509
2813 BCVR01000004.1 GCA001591845_01351 gene open 66642-66857
2814 BCVR01000004.1 GCA001591845_01352 gene open 66889-67272 yiaG
2815 BCVR01000004.1 GCA001591845_01353 gene open 67283-67576
2816 BCVR01000004.1 GCA001591845_01354 gene open 67806-70187 pepX
2817 BCVR01000004.1 GCA001591845_01355 gene open 70251-70688 msrB
2818 BCVR01000004.1 GCA001591845_01356 gene open 70741-71022
2819 BCVR01000004.1 GCA001591845_01357 gene open 71142-72005 glcU
2820 BCVR01000004.1 GCA001591845_01358 gene open 72255-75308
2821 BCVR01000004.1 GCA001591845_01359 gene open 75914-76114
2822 BCVR01000004.1 GCA001591845_01360 gene open 76458-79646 carB
2823 BCVR01000004.1 GCA001591845_01361 gene open 79639-80724 carA
2824 BCVR01000004.1 GCA001591845_01362 gene open 80725-81531
2825 BCVR01000004.1 GCA001591845_01363 gene open 81591-82001
2826 BCVR01000004.1 GCA001591845_01364 gene open 82001-82957 pyrB
2827 BCVR01000004.1 GCA001591845_01365 gene open 83098-83640 pyrR
2828 BCVR01000004.1 GCA001591845_01366 gene open 83817-84008
2829 BCVR01000004.1 GCA001591845_01367 gene open 83995-84741
2830 BCVR01000004.1 GCA001591845_01368 gene open 84993-85700 pyrF
2831 BCVR01000004.1 GCA001591845_01369 gene open 85700-86338 pyrE
2832 BCVR01000004.1 GCA001591845_01370 gene open 86408-87055 ywnB
2833 BCVR01000004.1 GCA001591845_01371 gene open 87485-90112 mgtA
2834 BCVR01000004.1 GCA001591845_01372 gene open 90196-91542 clcA
2835 BCVR01000004.1 GCA001591845_01373 gene open 91665-92333
2836 BCVR01000004.1 GCA001591845_01374 gene open 92448-105428
2837 BCVR01000004.1 GCA001591845_01375 gene open 105731-106243
2838 BCVR01000004.1 GCA001591845_01376 gene open 106315-106611
2839 BCVR01000004.1 GCA001591845_01377 gene open 107026-107877 nlpA
2840 BCVR01000004.1 GCA001591845_01378 gene open 107915-108208
2841 BCVR01000004.1 GCA001591845_01379 gene open 108383-109048 sdaA
2842 BCVR01000004.1 GCA001591845_01380 gene open 109062-109943 sdaAA
2843 BCVR01000004.1 GCA001591845_01381 gene open 109953-110267 paaD
2844 BCVR01000004.1 GCA001591845_01382 gene open 110581-112326 ddpA
2845 BCVR01000004.1 GCA001591845_01383 gene open 112408-112515
2846 BCVR01000004.1 GCA001591845_01384 gene open 112596-113960 fadH2
2847 BCVR01000004.1 GCA001591845_01385 gene open 114227-114574 yafQ
2848 BCVR01000004.1 GCA001591845_01386 gene open 114574-114852
2849 BCVR01000004.1 GCA001591845_01387 gene open 114923-115561 ywnB
2850 BCVR01000004.1 GCA001591845_01388 gene open 115795-116136 mazF
2851 BCVR01000004.1 GCA001591845_01389 gene open 116438-116809
2852 BCVR01000004.1 GCA001591845_01390 gene open 116829-117455 mA1133
2853 BCVR01000004.1 GCA001591845_01391 gene open 117638-118426
2854 BCVR01000004.1 GCA001591845_01392 gene open 118544-119398 lysR
2855 BCVR01000004.1 GCA001591845_01393 gene open 119507-121621
2856 BCVR01000004.1 GCA001591845_01394 gene open 121686-121811
2857 BCVR01000004.1 GCA001591845_01395 gene open 121868-122023
2858 BCVR01000004.1 GCA001591845_01396 gene open 122492-123595 gGDEF
2859 BCVR01000004.1 GCA001591845_01397 gene open 123726-124421 eAL
2860 BCVR01000004.1 GCA001591845_01398 gene open 124459-125262 eAL
2861 BCVR01000004.1 GCA001591845_01399 gene open 125262-125552
2862 BCVR01000004.1 GCA001591845_01400 gene open 125549-126538
2863 BCVR01000004.1 GCA001591845_01401 gene open 126535-127047
2864 BCVR01000004.1 GCA001591845_01402 gene open 127205-128125 fadH
2865 BCVR01000004.1 GCA001591845_01403 gene open 128407-128553
2866 BCVR01000004.1 GCA001591845_01404 gene open 128635-129756
2867 BCVR01000004.1 GCA001591845_01405 gene open 129995-130168 fadH
2868 BCVR01000004.1 GCA001591845_01406 gene open 130283-130837 pncA
2869 BCVR01000004.1 GCA001591845_01407 gene open 130930-131064
2870 BCVR01000004.1 GCA001591845_01408 gene open 131141-132637 yjeM
2871 BCVR01000004.1 GCA001591845_01409 gene open 132768-133463
2872 BCVR01000004.1 GCA001591845_01410 gene open 133483-133656
2873 BCVR01000004.1 GCA001591845_01411 gene open 133805-134563
2874 BCVR01000004.1 GCA001591845_01412 gene open 134663-135355 aRA1
2875 BCVR01000004.1 GCA001591845_01413 gene open 135367-135774 yhfA
2876 BCVR01000004.1 GCA001591845_01414 gene open 135792-136970 araJ
2877 BCVR01000004.1 GCA001591845_01415 gene open 137019-138293 baeS
2878 BCVR01000004.1 GCA001591845_01416 gene open 138303-138968 ompR
2879 BCVR01000004.1 GCA001591845_01417 gene open 138976-139587
2880 BCVR01000004.1 GCA001591845_01418 gene open 139815-140810 dhaK
2881 BCVR01000004.1 GCA001591845_01419 gene open 140823-141407 dhaL
2882 BCVR01000004.1 GCA001591845_01420 gene open 141404-141775 dhaM
2883 BCVR01000004.1 GCA001591845_01421 gene open 141793-142500 glpF
2884 BCVR01000004.1 GCA001591845_01422 gene open 142749-144191 gtfA
2885 BCVR01000004.1 GCA001591845_01423 gene open 144201-146399 melA
2886 BCVR01000004.1 GCA001591845_01424 gene open 146411-147523 malK
2887 BCVR01000004.1 GCA001591845_01425 gene open 147555-148388 ugpE
2888 BCVR01000004.1 GCA001591845_01426 gene open 148401-149276 ugpA
2889 BCVR01000004.1 GCA001591845_01427 gene open 149290-150546 ugpB
2890 BCVR01000004.1 GCA001591845_01428 gene open 150790-151629 araC
2891 BCVR01000004.1 GCA001591845_01429 gene open 151687-152121 soxR
2892 BCVR01000004.1 GCA001591845_01430 gene open 152282-153754 araJ
2893 BCVR01000004.1 GCA001591845_01431 gene open 153754-154335
2894 BCVR01000004.1 GCA001591845_01432 gene open 154567-154860
2895 BCVR01000004.1 GCA001591845_01433 gene open 154853-155128
2896 BCVR01000004.1 GCA001591845_01434 gene open 155251-155931
2897 BCVR01000004.1 GCA001591845_01435 gene open 156154-156396
2898 BCVR01000004.1 GCA001591845_01436 gene open 156569-157453
2899 BCVR01000004.1 GCA001591845_01437 gene open 157611-158597 galM
2900 BCVR01000004.1 GCA001591845_01438 gene open 158599-160062 galT2
2901 BCVR01000004.1 GCA001591845_01439 gene open 160082-161245 galK
2902 BCVR01000004.1 GCA001591845_01440 gene open 161462-162481
2903 BCVR01000004.1 GCA001591845_01441 gene open 162646-163275
2904 BCVR01000004.1 GCA001591845_01442 gene open 163397-165400 lacA
2905 BCVR01000004.1 GCA001591845_01443 gene open 165411-167330 melB
2906 BCVR01000004.1 GCA001591845_01336 gene open 47078-47151 trnR
2907 BCVR01000004.1 GCA001591845_01336 tRNA open 47078-47151 trnR tRNA-Arg(tct)
2908 BCVR01000005.1 GCA001591845_01489 gene open 49630-49688 Transposase-1
2909 BCVR01000005.1 GCA001591845_01489 ncRNA open 49630-49688 Transposase-1 RNA
2910 BCVR01000005.1 regulatory_region open 39243-39449 T-box leader
2911 BCVR01000005.1 regulatory_region open 53351-53463 Ribosomal protein L20 leader
2912 BCVR01000005.1 repeat_region open 65126-66262 CRISPR array with 19 repeats of length 27%2C consensus sequence GGATCACCTCCACATACGTGGAGAAAA and spacer length 34
2913 BCVR01000005.1 GCA001591845_01444 CDS open 97-1110 _na     337_aa purR Putative ribose operon repressor
2914 BCVR01000005.1 GCA001591845_01445 CDS open 1240-2073 _na     277_aa tktA1 Transketolase%2C alpha subunit
2915 BCVR01000005.1 GCA001591845_01446 CDS open 2066-3007 _na     313_aa tktA2 Transketolase%2C beta subunit
2916 BCVR01000005.1 GCA001591845_01447 CDS open 3022-3129 _na     35_aa hypothetical protein
2917 BCVR01000005.1 GCA001591845_01448 CDS open 3446-4474 _na     342_aa hypothetical protein
2918 BCVR01000005.1 GCA001591845_01449 CDS open 4505-5713 _na     402_aa ackA Acetate kinase
2919 BCVR01000005.1 GCA001591845_01450 CDS open 5772-7181 _na     469_aa araJ Lincomycin-resistance protein
2920 BCVR01000005.1 GCA001591845_01451 CDS open 7454-8185 _na     243_aa Putative fibrinogen-binding protein
2921 BCVR01000005.1 GCA001591845_01452 CDS open 8173-11148 _na     991_aa Putative fibrinogen-binding protein
2922 BCVR01000005.1 GCA001591845_01453 CDS open 11250-12260 _na     336_aa Lipoprotein
2923 BCVR01000005.1 GCA001591845_01454 CDS open 12364-13269 _na     301_aa Putative ABC transporter
2924 BCVR01000005.1 GCA001591845_01455 CDS open 13469-14119 _na     216_aa fetA ABC transporter
2925 BCVR01000005.1 GCA001591845_01456 CDS open 14100-14864 _na     254_aa fetB Putative ABC transport protein
2926 BCVR01000005.1 GCA001591845_01457 CDS open 14917-16254 _na     445_aa glnA type I glutamate--ammonia ligase
2927 BCVR01000005.1 GCA001591845_01458 CDS open 16385-17641 _na     418_aa ynbB Putative aluminum resistance protein
2928 BCVR01000005.1 GCA001591845_01459 CDS open 17634-18554 _na     306_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
2929 BCVR01000005.1 GCA001591845_01460 CDS open 18626-19027 _na     133_aa pspE Putative rhodanese-related sulfurtransferase
2930 BCVR01000005.1 GCA001591845_01461 CDS open 19086-19304 _na     72_aa yqgQ DUF910 domain-containing protein
2931 BCVR01000005.1 GCA001591845_01462 CDS open 19304-19984 _na     226_aa glpG Peptidase S54 rhomboid domain-containing protein
2932 BCVR01000005.1 GCA001591845_01463 CDS open 20019-20582 _na     187_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
2933 BCVR01000005.1 GCA001591845_01464 CDS open 20636-20785 _na     49_aa rpmG 50S ribosomal protein L33
2934 BCVR01000005.1 GCA001591845_01465 CDS open 20862-22970 _na     702_aa rpmG 50S ribosomal protein L33
2935 BCVR01000005.1 GCA001591845_01466 CDS open 23061-25640 _na     859_aa yfhO Putative ABC transporter permease protein
2936 BCVR01000005.1 GCA001591845_01467 CDS open 25756-26679 _na     307_aa badF Glucosamine kinase GspK
2937 BCVR01000005.1 GCA001591845_01468 CDS open 26759-31642 _na     1627_aa aprE PrtP
2938 BCVR01000005.1 GCA001591845_01469 CDS open 32105-32431 _na     108_aa Putative low temperature requirement A protein
2939 BCVR01000005.1 GCA001591845_01470 CDS open 32654-32791 _na     45_aa Putative low temperature requirement A protein
2940 BCVR01000005.1 GCA001591845_01471 CDS open 32812-34095 _na     427_aa pepT peptidase T
2941 BCVR01000005.1 GCA001591845_01472 CDS open 34210-35124 _na     304_aa mdh L-LDH
2942 BCVR01000005.1 GCA001591845_01473 CDS open 35185-35661 _na     158_aa greA transcription elongation factor GreA
2943 BCVR01000005.1 GCA001591845_01474 CDS open 35737-38151 _na     804_aa pheT phenylalanine--tRNA ligase subunit beta
2944 BCVR01000005.1 GCA001591845_01475 CDS open 38155-39204 _na     349_aa pheS phenylalanine--tRNA ligase subunit alpha
2945 BCVR01000005.1 GCA001591845_01476 CDS open 39487-39837 _na     116_aa hxlR Putative transcriptional regulator
2946 BCVR01000005.1 GCA001591845_01477 CDS open 39940-40707 _na     255_aa spoU TrmH family tRNA/rRNA methyltransferase
2947 BCVR01000005.1 GCA001591845_01478 CDS open 40833-41105 _na     90_aa acyP acylphosphatase
2948 BCVR01000005.1 GCA001591845_01479 CDS open 41147-42115 _na     322_aa yidC Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein
2949 BCVR01000005.1 GCA001591845_01480 CDS open 42151-43719 _na     522_aa baeS Signal transduction histidine-protein kinase ArlS
2950 BCVR01000005.1 GCA001591845_01481 CDS open 43706-44422 _na     238_aa ompR Two-component system regulator
2951 BCVR01000005.1 GCA001591845_01482 CDS open 44586-45134 _na     182_aa yceD DUF177 domain-containing protein
2952 BCVR01000005.1 GCA001591845_01483 CDS open 45136-46287 _na     383_aa tmcAL nucleotidyltransferase
2953 BCVR01000005.1 GCA001591845_01484 CDS open 46294-46641 _na     115_aa rsfS ribosome silencing factor
2954 BCVR01000005.1 GCA001591845_01485 CDS open 46656-47255 _na     199_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
2955 BCVR01000005.1 GCA001591845_01486 CDS open 47236-47892 _na     218_aa nadD nicotinate-nucleotide adenylyltransferase
2956 BCVR01000005.1 GCA001591845_01487 CDS open 47903-49012 _na     369_aa yqeH ribosome biogenesis GTPase YqeH
2957 BCVR01000005.1 GCA001591845_01488 CDS open 49005-49655 _na     216_aa yqeG HAD phosphatase%2C family IIIA
2958 BCVR01000005.1 GCA001591845_01490 CDS open 49721-50878 _na     385_aa tnpB RNA-guided endonuclease TnpB family protein
2959 BCVR01000005.1 GCA001591845_01491 CDS open 51121-52122 _na     333_aa add adenosine deaminase
2960 BCVR01000005.1 GCA001591845_01492 CDS open 52172-52528 _na     118_aa rplT 50S ribosomal protein L20
2961 BCVR01000005.1 GCA001591845_01493 CDS open 52570-52770 _na     66_aa rpmI 50S ribosomal protein L35
2962 BCVR01000005.1 GCA001591845_01494 CDS open 52792-53241 _na     149_aa infC translation initiation factor IF-3
2963 BCVR01000005.1 GCA001591845_01495 CDS open 53536-54051 _na     171_aa Surface layer protein A domain-containing protein
2964 BCVR01000005.1 GCA001591845_01496 CDS open 54193-54618 _na     141_aa DUF3021 domain-containing protein
2965 BCVR01000005.1 GCA001591845_01497 CDS open 54615-55049 _na     144_aa lytTR HTH LytTR-type domain-containing protein
2966 BCVR01000005.1 GCA001591845_01498 CDS open 55207-57141 _na     644_aa thrS threonine--tRNA ligase
2967 BCVR01000005.1 GCA001591845_01499 CDS open 57421-58329 _na     302_aa dnaI primosomal protein DnaI
2968 BCVR01000005.1 GCA001591845_01500 CDS open 58339-59679 _na     446_aa dnaB2 Chromosome replication initiation
2969 BCVR01000005.1 GCA001591845_01501 CDS open 59682-60149 _na     155_aa nrdR transcriptional regulator NrdR
2970 BCVR01000005.1 GCA001591845_01502 CDS open 60152-60754 _na     200_aa coaE dephospho-CoA kinase
2971 BCVR01000005.1 GCA001591845_01503 CDS open 60751-61581 _na     276_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
2972 BCVR01000005.1 GCA001591845_01504 CDS open 61590-64250 _na     886_aa polA DNA polymerase I
2973 BCVR01000005.1 GCA001591845_01505 CDS open 64436-64573 _na     45_aa hypothetical protein
2974 BCVR01000005.1 GCA001591845_01506 CDS open 66466-67737 _na     423_aa purD Phosphoribosylamine--glycine ligase
2975 BCVR01000005.1 GCA001591845_01507 CDS open 67750-69291 _na     513_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2976 BCVR01000005.1 GCA001591845_01508 CDS open 69288-69890 _na     200_aa purN phosphoribosylglycinamide formyltransferase
2977 BCVR01000005.1 GCA001591845_01509 CDS open 69900-70937 _na     345_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
2978 BCVR01000005.1 GCA001591845_01510 CDS open 70940-72388 _na     482_aa purF amidophosphoribosyltransferase
2979 BCVR01000005.1 GCA001591845_01511 CDS open 72364-74592 _na     742_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
2980 BCVR01000005.1 GCA001591845_01512 CDS open 74589-75260 _na     223_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
2981 BCVR01000005.1 GCA001591845_01513 CDS open 75257-75511 _na     84_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
2982 BCVR01000005.1 GCA001591845_01514 CDS open 75512-76228 _na     238_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
2983 BCVR01000005.1 GCA001591845_01515 CDS open 76433-77581 _na     382_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
2984 BCVR01000005.1 GCA001591845_01516 CDS open 77574-78059 _na     161_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
2985 BCVR01000005.1 GCA001591845_01517 CDS open 78077-79738 _na     553_aa fhs2 formate--tetrahydrofolate ligase
2986 BCVR01000005.1 GCA001591845_01518 CDS open 79925-80599 _na     224_aa fldA Putative flavodoxin
2987 BCVR01000005.1 GCA001591845_01519 CDS open 80746-81627 _na     293_aa hflC Band 7 domain-containing protein
2988 BCVR01000005.1 GCA001591845_01520 CDS open 81645-81953 _na     102_aa relB Type II toxin-antitoxin system antitoxin%2C RelB/DinJ family
2989 BCVR01000005.1 GCA001591845_01521 CDS open 82080-83057 _na     325_aa Bacteriocin helveticin J
2990 BCVR01000005.1 GCA001591845_01522 CDS open 83200-84717 _na     505_aa pepN Aminopeptidase
2991 BCVR01000005.1 GCA001591845_01523 CDS open 84822-85799 _na     325_aa Putative surface protein
2992 BCVR01000005.1 GCA001591845_01444 gene open 97-1110 purR
2993 BCVR01000005.1 GCA001591845_01445 gene open 1240-2073 tktA1
2994 BCVR01000005.1 GCA001591845_01446 gene open 2066-3007 tktA2
2995 BCVR01000005.1 GCA001591845_01447 gene open 3022-3129
2996 BCVR01000005.1 GCA001591845_01448 gene open 3446-4474
2997 BCVR01000005.1 GCA001591845_01449 gene open 4505-5713 ackA
2998 BCVR01000005.1 GCA001591845_01450 gene open 5772-7181 araJ
2999 BCVR01000005.1 GCA001591845_01451 gene open 7454-8185
3000 BCVR01000005.1 GCA001591845_01452 gene open 8173-11148