HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria flavescens (GCA_001618085.1)

Select a Genome:
BAKTA Annotations for GCA_001618085.1
Genome Selected: Neisseria flavescens
ContigsBases CDSrRNA tmRNAtRNA
67 2316621 2294 3 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4727 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4727 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 LAEK01000044.1 GCA001618085_00620 CDS open 10291-11361 _na     356_aa ATP synthase F0%2C A subunit
2502 LAEK01000044.1 GCA001618085_00621 CDS open 11565-12599 _na     344_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
2503 LAEK01000044.1 GCA001618085_00622 CDS open 12675-13034 _na     119_aa hypothetical protein
2504 LAEK01000044.1 GCA001618085_00623 CDS open 12980-13885 _na     301_aa acetate kinase
2505 LAEK01000044.1 GCA001618085_00624 CDS open 14098-15267 _na     389_aa prpF 2-methylaconitate cis-trans isomerase PrpF
2506 LAEK01000044.1 GCA001618085_00625 CDS open 15385-17991 _na     868_aa acnD Fe/S-dependent 2-methylisocitrate dehydratase AcnD
2507 LAEK01000044.1 GCA001618085_00626 CDS open 18390-19544 _na     384_aa prpC 2-methylcitrate synthase
2508 LAEK01000044.1 GCA001618085_00627 CDS open 19629-20504 _na     291_aa prpB methylisocitrate lyase
2509 LAEK01000044.1 GCA001618085_00628 CDS open 21268-21690 _na     140_aa Secreted protein
2510 LAEK01000044.1 GCA001618085_00606 gene open 877-1236
2511 LAEK01000044.1 GCA001618085_00607 gene open 1728-2342
2512 LAEK01000044.1 GCA001618085_00608 gene open 2349-2699
2513 LAEK01000044.1 GCA001618085_00609 gene open 2889-3992
2514 LAEK01000044.1 GCA001618085_00610 gene open 4098-4289
2515 LAEK01000044.1 GCA001618085_00611 gene open 4286-4915
2516 LAEK01000044.1 GCA001618085_00612 gene open 4945-5406
2517 LAEK01000044.1 GCA001618085_00613 gene open 5654-5878
2518 LAEK01000044.1 GCA001618085_00614 gene open 5875-6273 insH
2519 LAEK01000044.1 GCA001618085_00615 gene open 6509-6883 rodA
2520 LAEK01000044.1 GCA001618085_00616 gene open 7087-8394
2521 LAEK01000044.1 GCA001618085_00617 gene open 8387-8821
2522 LAEK01000044.1 GCA001618085_00618 gene open 8955-9461
2523 LAEK01000044.1 GCA001618085_00619 gene open 9508-10224
2524 LAEK01000044.1 GCA001618085_00620 gene open 10291-11361
2525 LAEK01000044.1 GCA001618085_00621 gene open 11565-12599 purM
2526 LAEK01000044.1 GCA001618085_00622 gene open 12675-13034
2527 LAEK01000044.1 GCA001618085_00623 gene open 12980-13885
2528 LAEK01000044.1 GCA001618085_00624 gene open 14098-15267 prpF
2529 LAEK01000044.1 GCA001618085_00625 gene open 15385-17991 acnD
2530 LAEK01000044.1 GCA001618085_00626 gene open 18390-19544 prpC
2531 LAEK01000044.1 GCA001618085_00627 gene open 19629-20504 prpB
2532 LAEK01000044.1 GCA001618085_00628 gene open 21268-21690
2533 LAEK01000045.1 GCA001618085_00650 CDS open 367-786 _na     139_aa YadA-like domain protein
2534 LAEK01000045.1 GCA001618085_00651 CDS open 993-1997 _na     334_aa dusA tRNA dihydrouridine(20/20a) synthase DusA
2535 LAEK01000045.1 GCA001618085_00652 CDS open 2214-2834 _na     206_aa tsaC L-threonylcarbamoyladenylate synthase
2536 LAEK01000045.1 GCA001618085_00650 gene open 367-786
2537 LAEK01000045.1 GCA001618085_00651 gene open 993-1997 dusA
2538 LAEK01000045.1 GCA001618085_00652 gene open 2214-2834 tsaC
2539 LAEK01000047.1 rep_origin open 141724-142370
2540 LAEK01000047.1 regulatory_region open 40528-40627 TPP riboswitch aptamer (THI element)
2541 LAEK01000047.1 GCA001618085_00654 CDS open 120-317 _na     65_aa hypothetical protein
2542 LAEK01000047.1 GCA001618085_00655 CDS open 388-576 _na     62_aa hypothetical protein
2543 LAEK01000047.1 GCA001618085_00656 CDS open 557-1093 _na     178_aa Zeta toxin domain-containing protein
2544 LAEK01000047.1 GCA001618085_00657 CDS open 1235-2656 _na     473_aa cysS cysteine--tRNA ligase
2545 LAEK01000047.1 GCA001618085_00658 CDS open 2900-6040 _na     1046_aa hypothetical protein
2546 LAEK01000047.1 GCA001618085_00659 CDS open 6510-7115 _na     201_aa Nitroreductase domain-containing protein
2547 LAEK01000047.1 GCA001618085_00660 CDS open 7131-7526 _na     131_aa doxX DoxX family protein
2548 LAEK01000047.1 GCA001618085_00661 CDS open 7655-8545 _na     296_aa dmlR HTH-type transcriptional regulator DmlR
2549 LAEK01000047.1 GCA001618085_00662 CDS open 8603-8944 _na     113_aa Secreted protein
2550 LAEK01000047.1 GCA001618085_00663 CDS open 9145-11418 _na     757_aa tex putative protein NMB0075
2551 LAEK01000047.1 GCA001618085_00664 CDS open 11548-12564 _na     338_aa galE UDP-glucose 4-epimerase GalE
2552 LAEK01000047.1 GCA001618085_00665 CDS open 12681-13748 _na     355_aa rffG dTDP-glucose 4%2C6-dehydratase
2553 LAEK01000047.1 GCA001618085_00666 CDS open 13822-14688 _na     288_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2554 LAEK01000047.1 GCA001618085_00667 CDS open 14727-15281 _na     184_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
2555 LAEK01000047.1 GCA001618085_00668 CDS open 15316-16551 _na     411_aa Capsule polysaccharide biosynthesis protein
2556 LAEK01000047.1 GCA001618085_00669 CDS open 16560-16781 _na     73_aa hypothetical protein
2557 LAEK01000047.1 GCA001618085_00670 CDS open 17143-18549 _na     468_aa Sel1 repeat family protein
2558 LAEK01000047.1 GCA001618085_00671 CDS open 18766-19980 _na     404_aa gltS sodium/glutamate symporter
2559 LAEK01000047.1 GCA001618085_00672 CDS open 20086-21108 _na     340_aa Lysozyme inhibitor LprI-like N-terminal domain-containing protein
2560 LAEK01000047.1 GCA001618085_00673 CDS open 21162-22241 _na     359_aa sppA Signal peptide peptidase SppA
2561 LAEK01000047.1 GCA001618085_00674 CDS open 22346-23347 _na     333_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
2562 LAEK01000047.1 GCA001618085_00675 CDS open 23505-24035 _na     176_aa Cytochrome b561
2563 LAEK01000047.1 GCA001618085_00676 CDS open 24269-25798 _na     509_aa cysW Sulfate transport system permease protein CysW
2564 LAEK01000047.1 GCA001618085_00677 CDS open 25913-26476 _na     187_aa hptA hypoxanthine-guanine phosphoribosyltransferase
2565 LAEK01000047.1 GCA001618085_00678 CDS open 26534-26962 _na     142_aa PTS system fructose IIA component
2566 LAEK01000047.1 GCA001618085_00679 CDS open 27012-27281 _na     89_aa ptsH HPr family phosphocarrier protein
2567 LAEK01000047.1 GCA001618085_00680 CDS open 27281-29044 _na     587_aa Phosphoenolpyruvate-protein phosphotransferase
2568 LAEK01000047.1 GCA001618085_00681 CDS open 29562-30677 _na     371_aa fepB Vitamin B12-binding protein
2569 LAEK01000047.1 GCA001618085_00682 CDS open 30795-31841 _na     348_aa fepD Hemin transport system permease protein HmuU
2570 LAEK01000047.1 GCA001618085_00683 CDS open 31852-32619 _na     255_aa fepC Hemin import ATP-binding protein HmuV
2571 LAEK01000047.1 GCA001618085_00684 CDS open 32788-33219 _na     143_aa petE Copper (Cu2+) binding protein
2572 LAEK01000047.1 GCA001618085_00685 CDS open 33358-34620 _na     420_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
2573 LAEK01000047.1 GCA001618085_00686 CDS open 34968-36698 _na     576_aa OPT family oligopeptide transporter
2574 LAEK01000047.1 GCA001618085_00687 CDS open 37227-38231 _na     334_aa quinone-dependent dihydroorotate dehydrogenase
2575 LAEK01000047.1 GCA001618085_00688 CDS open 38288-38980 _na     230_aa rnhB ribonuclease HII
2576 LAEK01000047.1 GCA001618085_00689 CDS open 39036-40166 _na     376_aa Fusaric acid resistance protein conserved region
2577 LAEK01000047.1 GCA001618085_00691 CDS open 40722-42611 _na     629_aa thiC phosphomethylpyrimidine synthase ThiC
2578 LAEK01000047.1 GCA001618085_00692 CDS open 42703-44241 _na     512_aa murJ murein biosynthesis integral membrane protein MurJ
2579 LAEK01000047.1 GCA001618085_00693 CDS open 44251-45426 _na     391_aa lpxB lipid-A-disaccharide synthase
2580 LAEK01000047.1 GCA001618085_00694 CDS open 45586-46362 _na     258_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2581 LAEK01000047.1 GCA001618085_00695 CDS open 46437-46886 _na     149_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2582 LAEK01000047.1 GCA001618085_00696 CDS open 46960-48000 _na     346_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
2583 LAEK01000047.1 GCA001618085_00697 CDS open 48102-48611 _na     169_aa Outer membrane protein chaperone
2584 LAEK01000047.1 GCA001618085_00698 CDS open 48723-51125 _na     800_aa bamA outer membrane protein assembly factor BamA
2585 LAEK01000047.1 GCA001618085_00699 CDS open 51129-52469 _na     446_aa rseP RIP metalloprotease RseP
2586 LAEK01000047.1 GCA001618085_00700 CDS open 52601-53818 _na     405_aa ispC 1-deoxy-D-xylulose-5-phosphate reductoisomerase
2587 LAEK01000047.1 GCA001618085_00701 CDS open 53899-54648 _na     249_aa SIMPL domain-containing protein
2588 LAEK01000047.1 GCA001618085_00702 CDS open 54682-55476 _na     264_aa Phosphatidate cytidylyltransferase
2589 LAEK01000047.1 GCA001618085_00703 CDS open 55482-56228 _na     248_aa isoprenyl transferase
2590 LAEK01000047.1 GCA001618085_00704 CDS open 56286-56843 _na     185_aa frr ribosome recycling factor
2591 LAEK01000047.1 GCA001618085_00705 CDS open 57515-57880 _na     121_aa hypothetical protein
2592 LAEK01000047.1 GCA001618085_00706 CDS open 57966-58265 _na     99_aa Inner membrane protein
2593 LAEK01000047.1 GCA001618085_00707 CDS open 58303-58428 _na     41_aa hypothetical protein
2594 LAEK01000047.1 GCA001618085_00708 CDS open 58486-59928 _na     480_aa nuoN NADH-quinone oxidoreductase subunit NuoN
2595 LAEK01000047.1 GCA001618085_00709 CDS open 59938-61434 _na     498_aa nuoM NADH-quinone oxidoreductase subunit M
2596 LAEK01000047.1 GCA001618085_00710 CDS open 61530-63554 _na     674_aa nuoL NADH-quinone oxidoreductase subunit L
2597 LAEK01000047.1 GCA001618085_00711 CDS open 63557-63862 _na     101_aa nuoK NADH-quinone oxidoreductase subunit NuoK
2598 LAEK01000047.1 GCA001618085_00712 CDS open 63859-64530 _na     223_aa nuoJ NADH-quinone oxidoreductase subunit J
2599 LAEK01000047.1 GCA001618085_00713 CDS open 64542-65021 _na     159_aa nuoI NADH-quinone oxidoreductase subunit NuoI
2600 LAEK01000047.1 GCA001618085_00714 CDS open 65103-66179 _na     358_aa nuoH NADH-quinone oxidoreductase subunit NuoH
2601 LAEK01000047.1 GCA001618085_00715 CDS open 66182-68443 _na     753_aa nuoG NADH-quinone oxidoreductase subunit NuoG
2602 LAEK01000047.1 GCA001618085_00716 CDS open 68502-69797 _na     431_aa nuoF NADH-quinone oxidoreductase subunit NuoF
2603 LAEK01000047.1 GCA001618085_00717 CDS open 69887-70411 _na     174_aa DUF1643 domain-containing protein
2604 LAEK01000047.1 GCA001618085_00718 CDS open 70438-70911 _na     157_aa nuoE NADH-quinone oxidoreductase subunit NuoE
2605 LAEK01000047.1 GCA001618085_00719 CDS open 70911-72167 _na     418_aa nuoD NADH-quinone oxidoreductase subunit D
2606 LAEK01000047.1 GCA001618085_00720 CDS open 72157-72750 _na     197_aa nuoC NADH-quinone oxidoreductase subunit C
2607 LAEK01000047.1 GCA001618085_00721 CDS open 72763-73245 _na     160_aa nuoB NADH-quinone oxidoreductase subunit B
2608 LAEK01000047.1 GCA001618085_00722 CDS open 73236-73592 _na     118_aa nuoA NADH-quinone oxidoreductase subunit A
2609 LAEK01000047.1 GCA001618085_00723 CDS open 73927-75384 _na     485_aa Di-/tripeptide transporter
2610 LAEK01000047.1 GCA001618085_00724 CDS open 75583-76686 _na     367_aa prfB peptide chain release factor 2
2611 LAEK01000047.1 GCA001618085_00725 CDS open 76784-77500 _na     238_aa truC tRNA pseudouridine(65) synthase TruC
2612 LAEK01000047.1 GCA001618085_00726 CDS open 77641-78369 _na     242_aa ppnN Cytokinin riboside 5'-monophosphate phosphoribohydrolase
2613 LAEK01000047.1 GCA001618085_00727 CDS open 78467-78958 _na     163_aa Surface-adhesin protein E-like domain-containing protein
2614 LAEK01000047.1 GCA001618085_00728 CDS open 78960-79607 _na     215_aa hypothetical protein
2615 LAEK01000047.1 GCA001618085_00729 CDS open 79736-81592 _na     618_aa mdlB Multidrug export ATP-binding/permease protein
2616 LAEK01000047.1 GCA001618085_00730 CDS open 81820-83043 _na     407_aa sstT serine/threonine transporter SstT
2617 LAEK01000047.1 GCA001618085_00731 CDS open 83492-85333 _na     613_aa tamA Translocation and assembly module subunit TamA
2618 LAEK01000047.1 GCA001618085_00732 CDS open 85414-86037 _na     207_aa hypothetical protein
2619 LAEK01000047.1 GCA001618085_00733 CDS open 86034-89561 _na     1175_aa tamB Translocation/assembly module TamB
2620 LAEK01000047.1 GCA001618085_00734 CDS open 89800-89973 _na     57_aa Zinc-finger domain-containing protein
2621 LAEK01000047.1 GCA001618085_00735 CDS open 89986-90564 _na     192_aa RNA polymerase sigma factor
2622 LAEK01000047.1 GCA001618085_00736 CDS open 90707-91393 _na     228_aa DNA-binding domain-containing protein
2623 LAEK01000047.1 GCA001618085_00737 CDS open 91383-92225 _na     280_aa UPF0276 protein NMB2142
2624 LAEK01000047.1 GCA001618085_00738 CDS open 92312-92605 _na     97_aa Periplasmic protein
2625 LAEK01000047.1 GCA001618085_00739 CDS open 92712-93161 _na     149_aa doxX DoxX family protein
2626 LAEK01000047.1 GCA001618085_00740 CDS open 93386-95695 _na     769_aa recQ DNA helicase RecQ
2627 LAEK01000047.1 GCA001618085_00741 CDS open 95875-96111 _na     78_aa Zinc-ribbon domain-containing protein
2628 LAEK01000047.1 GCA001618085_00742 CDS open 96146-96259 _na     37_aa hypothetical protein
2629 LAEK01000047.1 GCA001618085_00743 CDS open 96376-96711 _na     111_aa phnA Putative alkylphosphonate utilization operon protein PhnA
2630 LAEK01000047.1 GCA001618085_00744 CDS open 96771-97109 _na     112_aa Periplasmic protein
2631 LAEK01000047.1 GCA001618085_00745 CDS open 97553-97816 _na     87_aa hypothetical protein
2632 LAEK01000047.1 GCA001618085_00746 CDS open 97813-98508 _na     231_aa DUF2167 domain-containing protein
2633 LAEK01000047.1 GCA001618085_00747 CDS open 98575-99117 _na     180_aa hypothetical protein
2634 LAEK01000047.1 GCA001618085_00748 CDS open 99087-99968 _na     293_aa Glutamyl-tRNA synthetase
2635 LAEK01000047.1 GCA001618085_00749 CDS open 100128-101222 _na     364_aa Vitamin B12-binding protein
2636 LAEK01000047.1 GCA001618085_00750 CDS open 101329-101586 _na     85_aa Cardiolipin synthase N-terminal domain-containing protein
2637 LAEK01000047.1 GCA001618085_00751 CDS open 101657-102313 _na     218_aa DUF218 domain-containing protein
2638 LAEK01000047.1 GCA001618085_00752 CDS open 102339-102698 _na     119_aa arsC arsenate reductase (glutaredoxin)
2639 LAEK01000047.1 GCA001618085_00753 CDS open 102868-103350 _na     160_aa Redoxin family protein
2640 LAEK01000047.1 GCA001618085_00754 CDS open 103429-106455 _na     1008_aa type I site-specific deoxyribonuclease
2641 LAEK01000047.1 GCA001618085_00755 CDS open 106543-107835 _na     430_aa Type I restriction modification DNA specificity domain protein
2642 LAEK01000047.1 GCA001618085_00756 CDS open 107940-108188 _na     82_aa Bro-N domain-containing protein
2643 LAEK01000047.1 GCA001618085_00757 CDS open 108181-109851 _na     556_aa class I SAM-dependent DNA methyltransferase
2644 LAEK01000047.1 GCA001618085_00758 CDS open 109845-110246 _na     133_aa N-6 DNA methylase
2645 LAEK01000047.1 GCA001618085_00759 CDS open 110285-110557 _na     90_aa Putative type I restriction-modification system%2C methyltransferase subunit
2646 LAEK01000047.1 GCA001618085_00760 CDS open 110900-111550 _na     216_aa ftsE Cell division ATP-binding protein FtsE
2647 LAEK01000047.1 GCA001618085_00761 CDS open 111547-112464 _na     305_aa ftsX permease-like cell division protein FtsX
2648 LAEK01000047.1 GCA001618085_00762 CDS open 112634-113914 _na     426_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
2649 LAEK01000047.1 GCA001618085_00763 CDS open 114030-115733 _na     567_aa virD4 type IV secretory system conjugative DNA transfer family protein
2650 LAEK01000047.1 GCA001618085_00764 CDS open 116093-116269 _na     58_aa hypothetical protein
2651 LAEK01000047.1 GCA001618085_00765 CDS open 116308-116817 _na     169_aa hypothetical protein
2652 LAEK01000047.1 GCA001618085_00766 CDS open 117078-117761 _na     227_aa hypothetical protein
2653 LAEK01000047.1 GCA001618085_00767 CDS open 117782-118825 _na     347_aa XVIPCD domain-containing protein
2654 LAEK01000047.1 GCA001618085_00768 CDS open 118982-121039 _na     685_aa metG methionine--tRNA ligase
2655 LAEK01000047.1 GCA001618085_00769 CDS open 121063-121257 _na     64_aa Virulence regulator
2656 LAEK01000047.1 GCA001618085_00770 CDS open 121366-122232 _na     288_aa rsgA ribosome small subunit-dependent GTPase A
2657 LAEK01000047.1 GCA001618085_00771 CDS open 122383-123000 _na     205_aa 3-hydroxyisobutyrate dehydrogenase
2658 LAEK01000047.1 GCA001618085_00772 CDS open 123100-124020 _na     306_aa Phospholipase%2C patatin family
2659 LAEK01000047.1 GCA001618085_00773 CDS open 124129-125985 _na     618_aa vacB Exonuclease
2660 LAEK01000047.1 GCA001618085_00774 CDS open 126120-126347 _na     75_aa xseB exodeoxyribonuclease VII small subunit
2661 LAEK01000047.1 GCA001618085_00775 CDS open 126331-127227 _na     298_aa ispA Geranyltranstransferase
2662 LAEK01000047.1 GCA001618085_00776 CDS open 127384-128916 _na     510_aa ftsY signal recognition particle-docking protein FtsY
2663 LAEK01000047.1 GCA001618085_00777 CDS open 129062-130630 _na     522_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
2664 LAEK01000047.1 GCA001618085_00778 CDS open 130760-132130 _na     456_aa purB adenylosuccinate lyase
2665 LAEK01000047.1 GCA001618085_00779 CDS open 132341-132781 _na     146_aa Surface-adhesin protein E-like domain-containing protein
2666 LAEK01000047.1 GCA001618085_00780 CDS open 133159-133797 _na     212_aa Threonylcarbamoyl-AMP synthase
2667 LAEK01000047.1 GCA001618085_00781 CDS open 133800-135071 _na     423_aa purD Phosphoribosylamine--glycine ligase
2668 LAEK01000047.1 GCA001618085_00782 CDS open 135212-135523 _na     103_aa DUF4298 domain-containing protein
2669 LAEK01000047.1 GCA001618085_00783 CDS open 135578-136189 _na     203_aa yigZ Putative YigZ family protein
2670 LAEK01000047.1 GCA001618085_00784 CDS open 136251-137183 _na     310_aa fixB Electron transfer flavoprotein%2C alpha subunit
2671 LAEK01000047.1 GCA001618085_00785 CDS open 137194-137943 _na     249_aa fixA Electron transfer flavoprotein subunit beta
2672 LAEK01000047.1 GCA001618085_00786 CDS open 138128-138376 _na     82_aa glycosyltransferase family 9 protein
2673 LAEK01000047.1 GCA001618085_00787 CDS open 138373-139095 _na     240_aa waaC lipopolysaccharide heptosyltransferase I
2674 LAEK01000047.1 GCA001618085_00788 CDS open 139143-139778 _na     211_aa nicotinamidase
2675 LAEK01000047.1 GCA001618085_00789 CDS open 139949-140623 _na     224_aa tsaA tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO
2676 LAEK01000047.1 GCA001618085_00790 CDS open 140719-141723 _na     334_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2677 LAEK01000047.1 GCA001618085_00791 CDS open 141809-141904 _na     31_aa hypothetical protein
2678 LAEK01000047.1 GCA001618085_00792 CDS open 142373-143287 _na     304_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
2679 LAEK01000047.1 GCA001618085_00793 CDS open 143311-143643 _na     110_aa hypothetical protein
2680 LAEK01000047.1 GCA001618085_00794 CDS open 143524-145293 _na     589_aa ggt gamma-glutamyltransferase
2681 LAEK01000047.1 GCA001618085_00795 CDS open 145776-147224 _na     482_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
2682 LAEK01000047.1 GCA001618085_00796 CDS open 147823-148416 _na     197_aa tnp IS1595 family transposase
2683 LAEK01000047.1 GCA001618085_00797 CDS open 148536-149003 _na     155_aa pncC Nicotinamide-nucleotide amidohydrolase PncC
2684 LAEK01000047.1 GCA001618085_00798 CDS open 149131-149808 _na     225_aa hypothetical protein
2685 LAEK01000047.1 GCA001618085_00799 CDS open 149876-150523 _na     215_aa hypothetical protein
2686 LAEK01000047.1 GCA001618085_00800 CDS open 150600-150794 _na     64_aa hypothetical protein
2687 LAEK01000047.1 GCA001618085_00801 CDS open 150980-151096 _na     38_aa hypothetical protein
2688 LAEK01000047.1 GCA001618085_00654 gene open 120-317
2689 LAEK01000047.1 GCA001618085_00655 gene open 388-576
2690 LAEK01000047.1 GCA001618085_00656 gene open 557-1093
2691 LAEK01000047.1 GCA001618085_00657 gene open 1235-2656 cysS
2692 LAEK01000047.1 GCA001618085_00658 gene open 2900-6040
2693 LAEK01000047.1 GCA001618085_00659 gene open 6510-7115
2694 LAEK01000047.1 GCA001618085_00660 gene open 7131-7526 doxX
2695 LAEK01000047.1 GCA001618085_00661 gene open 7655-8545 dmlR
2696 LAEK01000047.1 GCA001618085_00662 gene open 8603-8944
2697 LAEK01000047.1 GCA001618085_00663 gene open 9145-11418 tex
2698 LAEK01000047.1 GCA001618085_00664 gene open 11548-12564 galE
2699 LAEK01000047.1 GCA001618085_00665 gene open 12681-13748 rffG
2700 LAEK01000047.1 GCA001618085_00666 gene open 13822-14688 rfbA
2701 LAEK01000047.1 GCA001618085_00667 gene open 14727-15281 rfbC
2702 LAEK01000047.1 GCA001618085_00668 gene open 15316-16551
2703 LAEK01000047.1 GCA001618085_00669 gene open 16560-16781
2704 LAEK01000047.1 GCA001618085_00670 gene open 17143-18549
2705 LAEK01000047.1 GCA001618085_00671 gene open 18766-19980 gltS
2706 LAEK01000047.1 GCA001618085_00672 gene open 20086-21108
2707 LAEK01000047.1 GCA001618085_00673 gene open 21162-22241 sppA
2708 LAEK01000047.1 GCA001618085_00674 gene open 22346-23347 pdxA
2709 LAEK01000047.1 GCA001618085_00675 gene open 23505-24035
2710 LAEK01000047.1 GCA001618085_00676 gene open 24269-25798 cysW
2711 LAEK01000047.1 GCA001618085_00677 gene open 25913-26476 hptA
2712 LAEK01000047.1 GCA001618085_00678 gene open 26534-26962
2713 LAEK01000047.1 GCA001618085_00679 gene open 27012-27281 ptsH
2714 LAEK01000047.1 GCA001618085_00680 gene open 27281-29044
2715 LAEK01000047.1 GCA001618085_00681 gene open 29562-30677 fepB
2716 LAEK01000047.1 GCA001618085_00682 gene open 30795-31841 fepD
2717 LAEK01000047.1 GCA001618085_00683 gene open 31852-32619 fepC
2718 LAEK01000047.1 GCA001618085_00684 gene open 32788-33219 petE
2719 LAEK01000047.1 GCA001618085_00685 gene open 33358-34620 waaA
2720 LAEK01000047.1 GCA001618085_00686 gene open 34968-36698
2721 LAEK01000047.1 GCA001618085_00687 gene open 37227-38231
2722 LAEK01000047.1 GCA001618085_00688 gene open 38288-38980 rnhB
2723 LAEK01000047.1 GCA001618085_00689 gene open 39036-40166
2724 LAEK01000047.1 GCA001618085_00691 gene open 40722-42611 thiC
2725 LAEK01000047.1 GCA001618085_00692 gene open 42703-44241 murJ
2726 LAEK01000047.1 GCA001618085_00693 gene open 44251-45426 lpxB
2727 LAEK01000047.1 GCA001618085_00694 gene open 45586-46362 lpxA
2728 LAEK01000047.1 GCA001618085_00695 gene open 46437-46886 fabZ
2729 LAEK01000047.1 GCA001618085_00696 gene open 46960-48000 lpxD
2730 LAEK01000047.1 GCA001618085_00697 gene open 48102-48611
2731 LAEK01000047.1 GCA001618085_00698 gene open 48723-51125 bamA
2732 LAEK01000047.1 GCA001618085_00699 gene open 51129-52469 rseP
2733 LAEK01000047.1 GCA001618085_00700 gene open 52601-53818 ispC
2734 LAEK01000047.1 GCA001618085_00701 gene open 53899-54648
2735 LAEK01000047.1 GCA001618085_00702 gene open 54682-55476
2736 LAEK01000047.1 GCA001618085_00703 gene open 55482-56228
2737 LAEK01000047.1 GCA001618085_00704 gene open 56286-56843 frr
2738 LAEK01000047.1 GCA001618085_00705 gene open 57515-57880
2739 LAEK01000047.1 GCA001618085_00706 gene open 57966-58265
2740 LAEK01000047.1 GCA001618085_00707 gene open 58303-58428
2741 LAEK01000047.1 GCA001618085_00708 gene open 58486-59928 nuoN
2742 LAEK01000047.1 GCA001618085_00709 gene open 59938-61434 nuoM
2743 LAEK01000047.1 GCA001618085_00710 gene open 61530-63554 nuoL
2744 LAEK01000047.1 GCA001618085_00711 gene open 63557-63862 nuoK
2745 LAEK01000047.1 GCA001618085_00712 gene open 63859-64530 nuoJ
2746 LAEK01000047.1 GCA001618085_00713 gene open 64542-65021 nuoI
2747 LAEK01000047.1 GCA001618085_00714 gene open 65103-66179 nuoH
2748 LAEK01000047.1 GCA001618085_00715 gene open 66182-68443 nuoG
2749 LAEK01000047.1 GCA001618085_00716 gene open 68502-69797 nuoF
2750 LAEK01000047.1 GCA001618085_00717 gene open 69887-70411
2751 LAEK01000047.1 GCA001618085_00718 gene open 70438-70911 nuoE
2752 LAEK01000047.1 GCA001618085_00719 gene open 70911-72167 nuoD
2753 LAEK01000047.1 GCA001618085_00720 gene open 72157-72750 nuoC
2754 LAEK01000047.1 GCA001618085_00721 gene open 72763-73245 nuoB
2755 LAEK01000047.1 GCA001618085_00722 gene open 73236-73592 nuoA
2756 LAEK01000047.1 GCA001618085_00723 gene open 73927-75384
2757 LAEK01000047.1 GCA001618085_00724 gene open 75583-76686 prfB
2758 LAEK01000047.1 GCA001618085_00725 gene open 76784-77500 truC
2759 LAEK01000047.1 GCA001618085_00726 gene open 77641-78369 ppnN
2760 LAEK01000047.1 GCA001618085_00727 gene open 78467-78958
2761 LAEK01000047.1 GCA001618085_00728 gene open 78960-79607
2762 LAEK01000047.1 GCA001618085_00729 gene open 79736-81592 mdlB
2763 LAEK01000047.1 GCA001618085_00730 gene open 81820-83043 sstT
2764 LAEK01000047.1 GCA001618085_00731 gene open 83492-85333 tamA
2765 LAEK01000047.1 GCA001618085_00732 gene open 85414-86037
2766 LAEK01000047.1 GCA001618085_00733 gene open 86034-89561 tamB
2767 LAEK01000047.1 GCA001618085_00734 gene open 89800-89973
2768 LAEK01000047.1 GCA001618085_00735 gene open 89986-90564
2769 LAEK01000047.1 GCA001618085_00736 gene open 90707-91393
2770 LAEK01000047.1 GCA001618085_00737 gene open 91383-92225
2771 LAEK01000047.1 GCA001618085_00738 gene open 92312-92605
2772 LAEK01000047.1 GCA001618085_00739 gene open 92712-93161 doxX
2773 LAEK01000047.1 GCA001618085_00740 gene open 93386-95695 recQ
2774 LAEK01000047.1 GCA001618085_00741 gene open 95875-96111
2775 LAEK01000047.1 GCA001618085_00742 gene open 96146-96259
2776 LAEK01000047.1 GCA001618085_00743 gene open 96376-96711 phnA
2777 LAEK01000047.1 GCA001618085_00744 gene open 96771-97109
2778 LAEK01000047.1 GCA001618085_00745 gene open 97553-97816
2779 LAEK01000047.1 GCA001618085_00746 gene open 97813-98508
2780 LAEK01000047.1 GCA001618085_00747 gene open 98575-99117
2781 LAEK01000047.1 GCA001618085_00748 gene open 99087-99968
2782 LAEK01000047.1 GCA001618085_00749 gene open 100128-101222
2783 LAEK01000047.1 GCA001618085_00750 gene open 101329-101586
2784 LAEK01000047.1 GCA001618085_00751 gene open 101657-102313
2785 LAEK01000047.1 GCA001618085_00752 gene open 102339-102698 arsC
2786 LAEK01000047.1 GCA001618085_00753 gene open 102868-103350
2787 LAEK01000047.1 GCA001618085_00754 gene open 103429-106455
2788 LAEK01000047.1 GCA001618085_00755 gene open 106543-107835
2789 LAEK01000047.1 GCA001618085_00756 gene open 107940-108188
2790 LAEK01000047.1 GCA001618085_00757 gene open 108181-109851
2791 LAEK01000047.1 GCA001618085_00758 gene open 109845-110246
2792 LAEK01000047.1 GCA001618085_00759 gene open 110285-110557
2793 LAEK01000047.1 GCA001618085_00760 gene open 110900-111550 ftsE
2794 LAEK01000047.1 GCA001618085_00761 gene open 111547-112464 ftsX
2795 LAEK01000047.1 GCA001618085_00762 gene open 112634-113914 murA
2796 LAEK01000047.1 GCA001618085_00763 gene open 114030-115733 virD4
2797 LAEK01000047.1 GCA001618085_00764 gene open 116093-116269
2798 LAEK01000047.1 GCA001618085_00765 gene open 116308-116817
2799 LAEK01000047.1 GCA001618085_00766 gene open 117078-117761
2800 LAEK01000047.1 GCA001618085_00767 gene open 117782-118825
2801 LAEK01000047.1 GCA001618085_00768 gene open 118982-121039 metG
2802 LAEK01000047.1 GCA001618085_00769 gene open 121063-121257
2803 LAEK01000047.1 GCA001618085_00770 gene open 121366-122232 rsgA
2804 LAEK01000047.1 GCA001618085_00771 gene open 122383-123000
2805 LAEK01000047.1 GCA001618085_00772 gene open 123100-124020
2806 LAEK01000047.1 GCA001618085_00773 gene open 124129-125985 vacB
2807 LAEK01000047.1 GCA001618085_00774 gene open 126120-126347 xseB
2808 LAEK01000047.1 GCA001618085_00775 gene open 126331-127227 ispA
2809 LAEK01000047.1 GCA001618085_00776 gene open 127384-128916 ftsY
2810 LAEK01000047.1 GCA001618085_00777 gene open 129062-130630 msrB
2811 LAEK01000047.1 GCA001618085_00778 gene open 130760-132130 purB
2812 LAEK01000047.1 GCA001618085_00779 gene open 132341-132781
2813 LAEK01000047.1 GCA001618085_00780 gene open 133159-133797
2814 LAEK01000047.1 GCA001618085_00781 gene open 133800-135071 purD
2815 LAEK01000047.1 GCA001618085_00782 gene open 135212-135523
2816 LAEK01000047.1 GCA001618085_00783 gene open 135578-136189 yigZ
2817 LAEK01000047.1 GCA001618085_00784 gene open 136251-137183 fixB
2818 LAEK01000047.1 GCA001618085_00785 gene open 137194-137943 fixA
2819 LAEK01000047.1 GCA001618085_00786 gene open 138128-138376
2820 LAEK01000047.1 GCA001618085_00787 gene open 138373-139095 waaC
2821 LAEK01000047.1 GCA001618085_00788 gene open 139143-139778
2822 LAEK01000047.1 GCA001618085_00789 gene open 139949-140623 tsaA
2823 LAEK01000047.1 GCA001618085_00790 gene open 140719-141723 gap
2824 LAEK01000047.1 GCA001618085_00791 gene open 141809-141904
2825 LAEK01000047.1 GCA001618085_00792 gene open 142373-143287 lpxC
2826 LAEK01000047.1 GCA001618085_00793 gene open 143311-143643
2827 LAEK01000047.1 GCA001618085_00794 gene open 143524-145293 ggt
2828 LAEK01000047.1 GCA001618085_00795 gene open 145776-147224 gnd
2829 LAEK01000047.1 GCA001618085_00796 gene open 147823-148416 tnp
2830 LAEK01000047.1 GCA001618085_00797 gene open 148536-149003 pncC
2831 LAEK01000047.1 GCA001618085_00798 gene open 149131-149808
2832 LAEK01000047.1 GCA001618085_00799 gene open 149876-150523
2833 LAEK01000047.1 GCA001618085_00800 gene open 150600-150794
2834 LAEK01000047.1 GCA001618085_00801 gene open 150980-151096
2835 LAEK01000047.1 GCA001618085_00690 gene open 40341-40417 trnfM
2836 LAEK01000047.1 GCA001618085_00690 tRNA open 40341-40417 trnfM tRNA-fMet(cat)
2837 LAEK01000048.1 GCA001618085_00314 CDS open 171-821 _na     216_aa Phosphoglycolate phosphatase
2838 LAEK01000048.1 GCA001618085_00315 CDS open 909-1400 _na     163_aa SHOCT domain-containing protein
2839 LAEK01000048.1 GCA001618085_00316 CDS open 1440-2426 _na     328_aa rluA Pseudouridine synthase
2840 LAEK01000048.1 GCA001618085_00317 CDS open 2941-5823 _na     960_aa Ribonuclease E
2841 LAEK01000048.1 GCA001618085_00318 CDS open 6062-6775 _na     237_aa hypothetical protein
2842 LAEK01000048.1 GCA001618085_00319 CDS open 6895-7338 _na     147_aa mscL large conductance mechanosensitive channel protein MscL
2843 LAEK01000048.1 GCA001618085_00320 CDS open 7786-8574 _na     262_aa fabI enoyl-ACP reductase FabI
2844 LAEK01000048.1 GCA001618085_00321 CDS open 8785-10842 _na     685_aa ppk1 polyphosphate kinase 1
2845 LAEK01000048.1 GCA001618085_00322 CDS open 10945-12960 _na     671_aa preP Prolyl endopeptidase
2846 LAEK01000048.1 GCA001618085_00323 CDS open 13479-14684 _na     401_aa site-specific DNA-methyltransferase
2847 LAEK01000048.1 GCA001618085_00324 CDS open 14881-15204 _na     107_aa hypothetical protein
2848 LAEK01000048.1 GCA001618085_00314 gene open 171-821
2849 LAEK01000048.1 GCA001618085_00315 gene open 909-1400
2850 LAEK01000048.1 GCA001618085_00316 gene open 1440-2426 rluA
2851 LAEK01000048.1 GCA001618085_00317 gene open 2941-5823
2852 LAEK01000048.1 GCA001618085_00318 gene open 6062-6775
2853 LAEK01000048.1 GCA001618085_00319 gene open 6895-7338 mscL
2854 LAEK01000048.1 GCA001618085_00320 gene open 7786-8574 fabI
2855 LAEK01000048.1 GCA001618085_00321 gene open 8785-10842 ppk1
2856 LAEK01000048.1 GCA001618085_00322 gene open 10945-12960 preP
2857 LAEK01000048.1 GCA001618085_00323 gene open 13479-14684
2858 LAEK01000048.1 GCA001618085_00324 gene open 14881-15204
2859 LAEK01000049.1 GCA001618085_00004 CDS open 198-2927 _na     909_aa tbp1 Transferrin-binding protein A
2860 LAEK01000049.1 GCA001618085_00005 CDS open 3014-4792 _na     592_aa Slam-dependent surface lipoprotein
2861 LAEK01000049.1 GCA001618085_00006 CDS open 4930-5262 _na     110_aa Glutamate racemase
2862 LAEK01000049.1 GCA001618085_00007 CDS open 5252-5743 _na     163_aa murI glutamate racemase
2863 LAEK01000049.1 GCA001618085_00008 CDS open 5942-6247 _na     101_aa hypothetical protein
2864 LAEK01000049.1 GCA001618085_00009 CDS open 6186-6536 _na     116_aa hypothetical protein
2865 LAEK01000049.1 GCA001618085_00010 CDS open 6651-7007 _na     118_aa hypothetical protein
2866 LAEK01000049.1 GCA001618085_00004 gene open 198-2927 tbp1
2867 LAEK01000049.1 GCA001618085_00005 gene open 3014-4792
2868 LAEK01000049.1 GCA001618085_00006 gene open 4930-5262
2869 LAEK01000049.1 GCA001618085_00007 gene open 5252-5743 murI
2870 LAEK01000049.1 GCA001618085_00008 gene open 5942-6247
2871 LAEK01000049.1 GCA001618085_00009 gene open 6186-6536
2872 LAEK01000049.1 GCA001618085_00010 gene open 6651-7007
2873 LAEK01000050.1 GCA001618085_00802 CDS open 1580-2182 _na     200_aa hypothetical protein
2874 LAEK01000050.1 GCA001618085_00803 CDS open 2224-2454 _na     76_aa hypothetical protein
2875 LAEK01000050.1 GCA001618085_00804 CDS open 2474-3319 _na     281_aa hypothetical protein
2876 LAEK01000050.1 GCA001618085_00805 CDS open 3393-5231 _na     612_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2877 LAEK01000050.1 GCA001618085_00806 CDS open 5393-6766 _na     457_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2878 LAEK01000050.1 GCA001618085_00807 CDS open 6865-7149 _na     94_aa Spore cortex protein
2879 LAEK01000050.1 GCA001618085_00808 CDS open 7211-7858 _na     215_aa pyrimidine 5'-nucleotidase
2880 LAEK01000050.1 GCA001618085_00809 CDS open 7923-8924 _na     333_aa Thiamine-binding periplasmic protein
2881 LAEK01000050.1 GCA001618085_00810 CDS open 9036-9881 _na     281_aa Small-conductance mechanosensitive channel
2882 LAEK01000050.1 GCA001618085_00811 CDS open 10039-10989 _na     316_aa 4-phosphoerythronate dehydrogenase
2883 LAEK01000050.1 GCA001618085_00812 CDS open 11118-11336 _na     72_aa DUF2061 domain-containing protein
2884 LAEK01000050.1 GCA001618085_00813 CDS open 11508-13658 _na     716_aa dinG ATP-dependent DNA helicase DinG
2885 LAEK01000050.1 GCA001618085_00814 CDS open 13742-14197 _na     151_aa Acetyltransferase%2C GNAT family
2886 LAEK01000050.1 GCA001618085_00815 CDS open 14365-14631 _na     88_aa DUF3079 domain-containing protein
2887 LAEK01000050.1 GCA001618085_00816 CDS open 14713-15195 _na     160_aa Dihydrofolate reductase
2888 LAEK01000050.1 GCA001618085_00817 CDS open 15389-16189 _na     266_aa factor H-binding protein
2889 LAEK01000050.1 GCA001618085_00818 CDS open 16279-17394 _na     371_aa aspartate-semialdehyde dehydrogenase
2890 LAEK01000050.1 GCA001618085_00819 CDS open 17636-18208 _na     190_aa RDD family protein
2891 LAEK01000050.1 GCA001618085_00820 CDS open 18299-19621 _na     440_aa mltA peptidoglycan lytic exotransglycosylase
2892 LAEK01000050.1 GCA001618085_00821 CDS open 19832-22090 _na     752_aa FG-GAP repeat protein
2893 LAEK01000050.1 GCA001618085_00802 gene open 1580-2182
2894 LAEK01000050.1 GCA001618085_00803 gene open 2224-2454
2895 LAEK01000050.1 GCA001618085_00804 gene open 2474-3319
2896 LAEK01000050.1 GCA001618085_00805 gene open 3393-5231 glmS
2897 LAEK01000050.1 GCA001618085_00806 gene open 5393-6766 glmU
2898 LAEK01000050.1 GCA001618085_00807 gene open 6865-7149
2899 LAEK01000050.1 GCA001618085_00808 gene open 7211-7858
2900 LAEK01000050.1 GCA001618085_00809 gene open 7923-8924
2901 LAEK01000050.1 GCA001618085_00810 gene open 9036-9881
2902 LAEK01000050.1 GCA001618085_00811 gene open 10039-10989
2903 LAEK01000050.1 GCA001618085_00812 gene open 11118-11336
2904 LAEK01000050.1 GCA001618085_00813 gene open 11508-13658 dinG
2905 LAEK01000050.1 GCA001618085_00814 gene open 13742-14197
2906 LAEK01000050.1 GCA001618085_00815 gene open 14365-14631
2907 LAEK01000050.1 GCA001618085_00816 gene open 14713-15195
2908 LAEK01000050.1 GCA001618085_00817 gene open 15389-16189
2909 LAEK01000050.1 GCA001618085_00818 gene open 16279-17394
2910 LAEK01000050.1 GCA001618085_00819 gene open 17636-18208
2911 LAEK01000050.1 GCA001618085_00820 gene open 18299-19621 mltA
2912 LAEK01000050.1 GCA001618085_00821 gene open 19832-22090
2913 LAEK01000051.1 GCA001618085_00002 CDS open 233-535 _na     100_aa trbM TrbM protein
2914 LAEK01000051.1 GCA001618085_00003 CDS open 603-1238 _na     211_aa DUF4189 domain-containing protein
2915 LAEK01000051.1 GCA001618085_00002 gene open 233-535 trbM
2916 LAEK01000051.1 GCA001618085_00003 gene open 603-1238
2917 LAEK01000052.1 repeat_region open 42589-47636 CRISPR array with 77 repeats of length 31%2C consensus sequence CAGCCGCCTTCAGGCGGCTGTGTGTTGAAAC and spacer length 34
2918 LAEK01000052.1 GCA001618085_01277 CDS open 148-342 _na     64_aa NF038104 family lipoprotein
2919 LAEK01000052.1 GCA001618085_01278 CDS open 330-662 _na     110_aa gspG General secretion pathway protein GspG
2920 LAEK01000052.1 GCA001618085_01279 CDS open 810-1505 _na     231_aa aqpZ aquaporin Z
2921 LAEK01000052.1 GCA001618085_01280 CDS open 1658-4702 _na     1014_aa ftsK Cell division protein FtsK
2922 LAEK01000052.1 GCA001618085_01281 CDS open 4867-5544 _na     225_aa Integral membrane protein
2923 LAEK01000052.1 GCA001618085_01282 CDS open 5625-5984 _na     119_aa fluC Fluoride-specific ion channel FluC
2924 LAEK01000052.1 GCA001618085_01283 CDS open 6059-6748 _na     229_aa Suppressor of fused-like domain-containing protein
2925 LAEK01000052.1 GCA001618085_01284 CDS open 6861-7487 _na     208_aa NAD(P)H-hydrate epimerase
2926 LAEK01000052.1 GCA001618085_01285 CDS open 7510-8481 _na     323_aa truB tRNA pseudouridine(55) synthase TruB
2927 LAEK01000052.1 GCA001618085_01286 CDS open 8489-8710 _na     73_aa hypothetical protein
2928 LAEK01000052.1 GCA001618085_01287 CDS open 8797-9354 _na     185_aa hypothetical protein
2929 LAEK01000052.1 GCA001618085_01288 CDS open 9362-9733 _na     123_aa rbfA 30S ribosome-binding factor RbfA
2930 LAEK01000052.1 GCA001618085_01289 CDS open 9821-11329 _na     502_aa ppx exopolyphosphatase
2931 LAEK01000052.1 GCA001618085_01290 CDS open 11503-12126 _na     207_aa Lytic transglycosylase domain-containing protein
2932 LAEK01000052.1 GCA001618085_01291 CDS open 12317-13699 _na     460_aa MFS transporter
2933 LAEK01000052.1 GCA001618085_01292 CDS open 13701-14228 _na     175_aa Single-stranded DNA-binding protein
2934 LAEK01000052.1 GCA001618085_01293 CDS open 14301-15008 _na     235_aa DUF541 domain-containing protein
2935 LAEK01000052.1 GCA001618085_01294 CDS open 15120-15611 _na     163_aa DUF1841 domain-containing protein
2936 LAEK01000052.1 GCA001618085_01295 CDS open 15713-15988 _na     91_aa ftsB cell division protein FtsB
2937 LAEK01000052.1 GCA001618085_01296 CDS open 16012-17298 _na     428_aa eno phosphopyruvate hydratase
2938 LAEK01000052.1 GCA001618085_01297 CDS open 17339-17497 _na     52_aa hypothetical protein
2939 LAEK01000052.1 GCA001618085_01298 CDS open 17559-18446 _na     295_aa Acetylglutamate kinase
2940 LAEK01000052.1 GCA001618085_01299 CDS open 18621-19751 _na     376_aa mpaA Peptidase M14 carboxypeptidase A domain-containing protein
2941 LAEK01000052.1 GCA001618085_01300 CDS open 19826-20686 _na     286_aa lgt prolipoprotein diacylglyceryl transferase
2942 LAEK01000052.1 GCA001618085_01301 CDS open 20763-21005 _na     80_aa trkA TrkA C-terminal domain-containing protein
2943 LAEK01000052.1 GCA001618085_01302 CDS open 21095-22174 _na     359_aa trkA Trk system potassium transporter TrkA
2944 LAEK01000052.1 GCA001618085_01303 CDS open 22270-23721 _na     483_aa citT Integral membrane transport protein
2945 LAEK01000052.1 GCA001618085_01304 CDS open 23937-24500 _na     187_aa NADH dehydrogenase
2946 LAEK01000052.1 GCA001618085_01305 CDS open 24443-25189 _na     248_aa hypothetical protein
2947 LAEK01000052.1 GCA001618085_01306 CDS open 25186-26814 _na     542_aa nadB FAD-dependent oxidoreductase 2 FAD binding domain-containing protein
2948 LAEK01000052.1 GCA001618085_01307 CDS open 26814-27452 _na     212_aa forC 2Fe-2S iron-sulfur cluster binding domain protein
2949 LAEK01000052.1 GCA001618085_01308 CDS open 28303-29826 _na     507_aa ttdA Fumarate hydratase class I
2950 LAEK01000052.1 GCA001618085_01310 CDS open 30207-30998 _na     263_aa focA Formate/nitrite transporter
2951 LAEK01000052.1 GCA001618085_01311 CDS open 31245-31679 _na     144_aa yciA acyl-CoA thioester hydrolase YciA
2952 LAEK01000052.1 GCA001618085_01312 CDS open 31804-32733 _na     309_aa pip prolyl aminopeptidase
2953 LAEK01000052.1 GCA001618085_01313 CDS open 33073-33369 _na     98_aa CRISPR-associated endonuclease Cas3''
2954 LAEK01000052.1 GCA001618085_01314 CDS open 33324-35582 _na     752_aa cas3 RNA helicase
2955 LAEK01000052.1 GCA001618085_01315 CDS open 35811-36455 _na     214_aa cas5c type I-C CRISPR-associated protein Cas5c
2956 LAEK01000052.1 GCA001618085_01316 CDS open 36452-37435 _na     327_aa Cas8
2957 LAEK01000052.1 GCA001618085_01317 CDS open 37537-38208 _na     223_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2958 LAEK01000052.1 GCA001618085_01318 CDS open 38221-39072 _na     283_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2959 LAEK01000052.1 GCA001618085_01319 CDS open 39075-39722 _na     215_aa cas4 CRISPR-associated protein Cas4
2960 LAEK01000052.1 GCA001618085_01320 CDS open 39763-40941 _na     392_aa hypothetical protein
2961 LAEK01000052.1 GCA001618085_01321 CDS open 41018-42031 _na     337_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2962 LAEK01000052.1 GCA001618085_01322 CDS open 42106-42399 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
2963 LAEK01000052.1 GCA001618085_01323 CDS open 47945-48253 _na     102_aa HD domain-containing protein
2964 LAEK01000052.1 GCA001618085_01324 CDS open 48287-49423 _na     378_aa frmA S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase
2965 LAEK01000052.1 GCA001618085_01325 CDS open 49432-50259 _na     275_aa fghA S-formylglutathione hydrolase
2966 LAEK01000052.1 GCA001618085_01326 CDS open 50409-52037 _na     542_aa rtcR RNA repair transcriptional activator RtcR
2967 LAEK01000052.1 GCA001618085_01327 CDS open 52052-52807 _na     251_aa tRNA(His) guanylyltransferase
2968 LAEK01000052.1 GCA001618085_01329 CDS open 53838-55412 _na     524_aa 60 kDa SS-A/Ro ribonucleoprotein
2969 LAEK01000052.1 GCA001618085_01330 CDS open 55464-55931 _na     155_aa hypothetical protein
2970 LAEK01000052.1 GCA001618085_01331 CDS open 55965-56408 _na     147_aa Ribose 5-phosphate isomerase B
2971 LAEK01000052.1 GCA001618085_01332 CDS open 56495-57148 _na     217_aa Phosphoesterase
2972 LAEK01000052.1 GCA001618085_01333 CDS open 57286-57750 _na     154_aa nudB dihydroneopterin triphosphate diphosphatase
2973 LAEK01000052.1 GCA001618085_01334 CDS open 57835-58368 _na     177_aa ppa Inorganic pyrophosphatase
2974 LAEK01000052.1 GCA001618085_01335 CDS open 58568-59194 _na     208_aa Knr4/Smi1-like domain-containing protein
2975 LAEK01000052.1 GCA001618085_01336 CDS open 59491-59736 _na     81_aa hypothetical protein
2976 LAEK01000052.1 GCA001618085_01337 CDS open 59733-61247 _na     504_aa cysI assimilatory sulfite reductase (NADPH) hemoprotein subunit
2977 LAEK01000052.1 GCA001618085_01338 CDS open 61385-61957 _na     190_aa Membrane lipoprotein
2978 LAEK01000052.1 GCA001618085_01339 CDS open 62048-62554 _na     168_aa hypothetical protein
2979 LAEK01000052.1 GCA001618085_01340 CDS open 63003-64793 _na     596_aa assimilatory sulfite reductase (NADPH) flavoprotein subunit
2980 LAEK01000052.1 GCA001618085_01341 CDS open 64984-65307 _na     107_aa Guanidinium exporter
2981 LAEK01000052.1 GCA001618085_01342 CDS open 65335-66204 _na     289_aa ABC transmembrane type-1 domain-containing protein
2982 LAEK01000052.1 GCA001618085_01343 CDS open 66216-66641 _na     141_aa sarZ HTH-type transcriptional regulator SarZ
2983 LAEK01000052.1 GCA001618085_01344 CDS open 66698-67735 _na     345_aa yddG aromatic amino acid DMT transporter YddG
2984 LAEK01000052.1 GCA001618085_01345 CDS open 67865-69175 _na     436_aa cysN sulfate adenylyltransferase
2985 LAEK01000052.1 GCA001618085_01346 CDS open 69246-70496 _na     416_aa glyA Serine hydroxymethyltransferase
2986 LAEK01000052.1 GCA001618085_01347 CDS open 70630-71004 _na     124_aa DUF4376 domain-containing protein
2987 LAEK01000052.1 GCA001618085_01348 CDS open 71226-71444 _na     72_aa DUF465 domain-containing protein
2988 LAEK01000052.1 GCA001618085_01349 CDS open 71672-74017 _na     781_aa Outer membrane receptor protein
2989 LAEK01000052.1 GCA001618085_01350 CDS open 74196-74858 _na     220_aa Nitroreductase family protein
2990 LAEK01000052.1 GCA001618085_01351 CDS open 75096-76493 _na     465_aa aspA aspartate ammonia-lyase
2991 LAEK01000052.1 GCA001618085_01352 CDS open 76583-76783 _na     66_aa Cytochrome C oxidase Cbb3
2992 LAEK01000052.1 GCA001618085_01353 CDS open 76976-77122 _na     48_aa CCGSCS motif protein
2993 LAEK01000052.1 GCA001618085_01354 CDS open 77421-78113 _na     230_aa VIT family protein
2994 LAEK01000052.1 GCA001618085_01355 CDS open 78244-81927 _na     1227_aa mfd transcription-repair coupling factor
2995 LAEK01000052.1 GCA001618085_01356 CDS open 82012-83757 _na     581_aa tetratricopeptide repeat protein
2996 LAEK01000052.1 GCA001618085_01357 CDS open 83857-84036 _na     59_aa hypothetical protein
2997 LAEK01000052.1 GCA001618085_01358 CDS open 84437-84775 _na     112_aa Lipoprotein
2998 LAEK01000052.1 GCA001618085_01359 CDS open 84867-85169 _na     100_aa arsR Transcriptional regulator%2C ArsR family
2999 LAEK01000052.1 GCA001618085_01360 CDS open 85249-85770 _na     173_aa Rhodanese domain-containing protein
3000 LAEK01000052.1 GCA001618085_01361 CDS open 85783-85977 _na     64_aa Inner membrane protein YgaP-like transmembrane domain-containing protein