HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptidiphaga gingivicola (GCA_001652275.1)

Select a Genome:
BAKTA Annotations for GCA_001652275.1
Genome Selected: Peptidiphaga gingivicola
ContigsBases CDSrRNA tmRNAtRNA
3 2524828 2059 9 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4244 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4244 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 LVZK01000001.1 GCA001652275_01453 gene open 1712907-1714256
3002 LVZK01000001.1 GCA001652275_01454 gene open 1714376-1715215 pyrF
3003 LVZK01000001.1 GCA001652275_01455 gene open 1715226-1715783 gmk
3004 LVZK01000001.1 GCA001652275_01456 gene open 1715818-1716087 rpoZ
3005 LVZK01000001.1 GCA001652275_01457 gene open 1716066-1717328 coaBC
3006 LVZK01000001.1 GCA001652275_01458 gene open 1717337-1718524 metK
3007 LVZK01000001.1 GCA001652275_01459 gene open 1718681-1720987
3008 LVZK01000001.1 GCA001652275_01460 gene open 1721161-1721496
3009 LVZK01000001.1 GCA001652275_01461 gene open 1721598-1722530 fmt
3010 LVZK01000001.1 GCA001652275_01462 gene open 1722534-1724102
3011 LVZK01000001.1 GCA001652275_01463 gene open 1724112-1724774 rpe
3012 LVZK01000001.1 GCA001652275_01464 gene open 1724955-1727345
3013 LVZK01000001.1 GCA001652275_01465 gene open 1729189-1730409
3014 LVZK01000001.1 GCA001652275_01466 gene open 1730738-1731343 tetR
3015 LVZK01000001.1 GCA001652275_01467 gene open 1731673-1732440
3016 LVZK01000001.1 GCA001652275_01468 gene open 1732616-1733596
3017 LVZK01000001.1 GCA001652275_01469 gene open 1733865-1734902
3018 LVZK01000001.1 GCA001652275_01470 gene open 1734985-1736199
3019 LVZK01000001.1 GCA001652275_01471 gene open 1736237-1737364
3020 LVZK01000001.1 GCA001652275_01472 gene open 1737361-1737477
3021 LVZK01000001.1 GCA001652275_01473 gene open 1737423-1738472
3022 LVZK01000001.1 GCA001652275_01474 gene open 1738469-1739398
3023 LVZK01000001.1 GCA001652275_01475 gene open 1739395-1741995
3024 LVZK01000001.1 GCA001652275_01476 gene open 1741992-1743782 lnt
3025 LVZK01000001.1 GCA001652275_01477 gene open 1743779-1744543
3026 LVZK01000001.1 GCA001652275_01478 gene open 1744607-1744963 rbpA
3027 LVZK01000001.1 GCA001652275_01479 gene open 1745183-1746685 hscA
3028 LVZK01000001.1 GCA001652275_01480 gene open 1746868-1748808
3029 LVZK01000001.1 GCA001652275_01481 gene open 1748922-1749494
3030 LVZK01000001.1 GCA001652275_01482 gene open 1749658-1750449 merR
3031 LVZK01000001.1 GCA001652275_01483 gene open 1750446-1750889
3032 LVZK01000001.1 GCA001652275_01485 gene open 1751454-1756778
3033 LVZK01000001.1 GCA001652275_01486 gene open 1756785-1757210
3034 LVZK01000001.1 GCA001652275_01487 gene open 1757735-1758634
3035 LVZK01000001.1 GCA001652275_01488 gene open 1758840-1759229
3036 LVZK01000001.1 GCA001652275_01489 gene open 1759480-1760304
3037 LVZK01000001.1 GCA001652275_01490 gene open 1760432-1760911
3038 LVZK01000001.1 GCA001652275_01491 gene open 1761098-1762363
3039 LVZK01000001.1 GCA001652275_01492 gene open 1762537-1764414 ccmA
3040 LVZK01000001.1 GCA001652275_01493 gene open 1764314-1765153
3041 LVZK01000001.1 GCA001652275_01494 gene open 1765225-1766130
3042 LVZK01000001.1 GCA001652275_01495 gene open 1766207-1767889 der
3043 LVZK01000001.1 GCA001652275_01496 gene open 1767886-1769718
3044 LVZK01000001.1 GCA001652275_01497 gene open 1769715-1770458
3045 LVZK01000001.1 GCA001652275_01498 gene open 1770455-1771024 scpB
3046 LVZK01000001.1 GCA001652275_01499 gene open 1771017-1771943
3047 LVZK01000001.1 GCA001652275_01500 gene open 1771934-1772785
3048 LVZK01000001.1 GCA001652275_01501 gene open 1772799-1773728 xerD
3049 LVZK01000001.1 GCA001652275_01502 gene open 1773839-1775914 tkt
3050 LVZK01000001.1 GCA001652275_01503 gene open 1776083-1777588 zwf
3051 LVZK01000001.1 GCA001652275_01504 gene open 1777601-1778530
3052 LVZK01000001.1 GCA001652275_01505 gene open 1778772-1779017 secG
3053 LVZK01000001.1 GCA001652275_01506 gene open 1779179-1779955 tpiA
3054 LVZK01000001.1 GCA001652275_01507 gene open 1779955-1781148
3055 LVZK01000001.1 GCA001652275_01508 gene open 1781219-1782223 gap
3056 LVZK01000001.1 GCA001652275_01509 gene open 1782562-1783545 whiA
3057 LVZK01000001.1 GCA001652275_01510 gene open 1783586-1784611
3058 LVZK01000001.1 GCA001652275_01511 gene open 1784608-1785555 rapZ
3059 LVZK01000001.1 GCA001652275_01512 gene open 1785694-1787898 uvrC
3060 LVZK01000001.1 GCA001652275_01513 gene open 1787899-1790823 uvrA
3061 LVZK01000001.1 GCA001652275_01514 gene open 1790900-1791178
3062 LVZK01000001.1 GCA001652275_01515 gene open 1791278-1792246
3063 LVZK01000001.1 GCA001652275_01516 gene open 1792356-1793591 terC
3064 LVZK01000001.1 GCA001652275_01517 gene open 1793787-1795874 uvrB
3065 LVZK01000001.1 GCA001652275_01518 gene open 1796059-1797189 coaE
3066 LVZK01000001.1 GCA001652275_01519 gene open 1797501-1798316
3067 LVZK01000001.1 GCA001652275_01520 gene open 1798535-1799332
3068 LVZK01000001.1 GCA001652275_01521 gene open 1799501-1801288 gcl
3069 LVZK01000001.1 GCA001652275_01522 gene open 1801400-1801816
3070 LVZK01000001.1 GCA001652275_01523 gene open 1801857-1802858
3071 LVZK01000001.1 GCA001652275_01524 gene open 1802893-1804230 allB
3072 LVZK01000001.1 GCA001652275_01525 gene open 1804469-1805260 iclR
3073 LVZK01000001.1 GCA001652275_01526 gene open 1805251-1806795
3074 LVZK01000001.1 GCA001652275_01527 gene open 1807057-1807806
3075 LVZK01000001.1 GCA001652275_01528 gene open 1807803-1809281
3076 LVZK01000001.1 GCA001652275_01529 gene open 1809677-1811137 rpsA
3077 LVZK01000001.1 GCA001652275_01530 gene open 1811327-1812133
3078 LVZK01000001.1 GCA001652275_01531 gene open 1812127-1814775 polA
3079 LVZK01000001.1 GCA001652275_01532 gene open 1814980-1815378
3080 LVZK01000001.1 GCA001652275_01533 gene open 1815385-1816011
3081 LVZK01000001.1 GCA001652275_01535 gene open 1816248-1817657 pyk
3082 LVZK01000001.1 GCA001652275_01536 gene open 1817870-1819081 lgt
3083 LVZK01000001.1 GCA001652275_01537 gene open 1819078-1819893 trpA
3084 LVZK01000001.1 GCA001652275_01538 gene open 1819890-1821116 trpB
3085 LVZK01000001.1 GCA001652275_01539 gene open 1821117-1821935 trpC
3086 LVZK01000001.1 GCA001652275_01540 gene open 1821922-1823493
3087 LVZK01000001.1 GCA001652275_01541 gene open 1823667-1824548
3088 LVZK01000001.1 GCA001652275_01542 gene open 1824545-1825933 pafA
3089 LVZK01000001.1 GCA001652275_01543 gene open 1825930-1826106
3090 LVZK01000001.1 GCA001652275_01544 gene open 1826268-1827824 dop
3091 LVZK01000001.1 GCA001652275_01545 gene open 1827841-1829577 arc
3092 LVZK01000001.1 GCA001652275_01546 gene open 1829641-1830735
3093 LVZK01000001.1 GCA001652275_01547 gene open 1830774-1831688 recB
3094 LVZK01000001.1 GCA001652275_01548 gene open 1831753-1832502
3095 LVZK01000001.1 GCA001652275_01549 gene open 1832547-1833380
3096 LVZK01000001.1 GCA001652275_01550 gene open 1833443-1834381
3097 LVZK01000001.1 GCA001652275_01551 gene open 1834397-1834846
3098 LVZK01000001.1 GCA001652275_01552 gene open 1835350-1838469
3099 LVZK01000001.1 GCA001652275_01553 gene open 1838941-1842075
3100 LVZK01000001.1 GCA001652275_01554 gene open 1842283-1845888
3101 LVZK01000001.1 GCA001652275_01555 gene open 1846068-1848086
3102 LVZK01000001.1 GCA001652275_01556 gene open 1848197-1849177
3103 LVZK01000001.1 GCA001652275_01557 gene open 1850142-1850483
3104 LVZK01000001.1 GCA001652275_01558 gene open 1850495-1851598
3105 LVZK01000001.1 GCA001652275_01560 gene open 1851996-1852601
3106 LVZK01000001.1 GCA001652275_01561 gene open 1852695-1856243
3107 LVZK01000001.1 GCA001652275_01562 gene open 1856236-1857786 umuC
3108 LVZK01000001.1 GCA001652275_01563 gene open 1857783-1858613
3109 LVZK01000001.1 GCA001652275_01564 gene open 1858773-1859261
3110 LVZK01000001.1 GCA001652275_01565 gene open 1859787-1860086
3111 LVZK01000001.1 GCA001652275_01566 gene open 1860119-1861060
3112 LVZK01000001.1 GCA001652275_01567 gene open 1861465-1862622
3113 LVZK01000001.1 GCA001652275_01568 gene open 1862777-1863211
3114 LVZK01000001.1 GCA001652275_01569 gene open 1863365-1864147
3115 LVZK01000001.1 GCA001652275_01570 gene open 1864171-1865319
3116 LVZK01000001.1 GCA001652275_01571 gene open 1865511-1866911 glgC
3117 LVZK01000001.1 GCA001652275_01572 gene open 1866916-1867965 serB
3118 LVZK01000001.1 GCA001652275_01573 gene open 1868105-1869670
3119 LVZK01000001.1 GCA001652275_01574 gene open 1869667-1870473
3120 LVZK01000001.1 GCA001652275_01575 gene open 1870615-1871202
3121 LVZK01000001.1 GCA001652275_01576 gene open 1871231-1871824
3122 LVZK01000001.1 GCA001652275_01577 gene open 1871918-1873531 ccmA
3123 LVZK01000001.1 GCA001652275_01578 gene open 1873601-1874482
3124 LVZK01000001.1 GCA001652275_01579 gene open 1874559-1874945
3125 LVZK01000001.1 GCA001652275_01580 gene open 1874938-1875408 sufU
3126 LVZK01000001.1 GCA001652275_01581 gene open 1875431-1876711
3127 LVZK01000001.1 GCA001652275_01582 gene open 1876713-1877465 sufC
3128 LVZK01000001.1 GCA001652275_01583 gene open 1877476-1877811
3129 LVZK01000001.1 GCA001652275_01584 gene open 1877808-1878977 sufD
3130 LVZK01000001.1 GCA001652275_01585 gene open 1878977-1880428 sufB
3131 LVZK01000001.1 GCA001652275_01586 gene open 1880409-1881119
3132 LVZK01000001.1 GCA001652275_01587 gene open 1881351-1881935
3133 LVZK01000001.1 GCA001652275_01588 gene open 1881976-1883637 mviN
3134 LVZK01000001.1 GCA001652275_01589 gene open 1883699-1884526
3135 LVZK01000001.1 GCA001652275_01590 gene open 1884532-1885521
3136 LVZK01000001.1 GCA001652275_01591 gene open 1885532-1886728 steA
3137 LVZK01000001.1 GCA001652275_01592 gene open 1886715-1888406 recN
3138 LVZK01000001.1 GCA001652275_01593 gene open 1888443-1889291
3139 LVZK01000001.1 GCA001652275_01594 gene open 1889292-1890125
3140 LVZK01000001.1 GCA001652275_01595 gene open 1890315-1891421
3141 LVZK01000001.1 GCA001652275_01596 gene open 1891418-1893283
3142 LVZK01000001.1 GCA001652275_00158 gene open 186144-186215 trnK
3143 LVZK01000001.1 GCA001652275_00172 gene open 200111-200183 trnE
3144 LVZK01000001.1 GCA001652275_00173 gene open 200208-200281 trnD
3145 LVZK01000001.1 GCA001652275_00174 gene open 200319-200391 trnF
3146 LVZK01000001.1 GCA001652275_00299 gene open 353836-353908 trnR
3147 LVZK01000001.1 GCA001652275_00412 gene open 503496-503569 trnI
3148 LVZK01000001.1 GCA001652275_00414 gene open 503750-503822 trnA
3149 LVZK01000001.1 GCA001652275_00439 gene open 533679-533762 trnL
3150 LVZK01000001.1 GCA001652275_00583 gene open 699498-699571 trnG
3151 LVZK01000001.1 GCA001652275_00601 gene open 715647-715736 trnS
3152 LVZK01000001.1 GCA001652275_00605 gene open 718429-718516 trnS
3153 LVZK01000001.1 GCA001652275_00626 gene open 746283-746371 trnS
3154 LVZK01000001.1 GCA001652275_00644 gene open 765859-765932 trnP
3155 LVZK01000001.1 GCA001652275_00701 gene open 850233-850308 trnT
3156 LVZK01000001.1 GCA001652275_00729 gene open 881989-882073 trnS
3157 LVZK01000001.1 GCA001652275_00740 gene open 898244-898316 trnT
3158 LVZK01000001.1 GCA001652275_00765 gene open 929568-929639 trnR
3159 LVZK01000001.1 GCA001652275_00775 gene open 943616-943691 trnA
3160 LVZK01000001.1 GCA001652275_00862 gene open 1037848-1037918 trnQ
3161 LVZK01000001.1 GCA001652275_00879 gene open 1059036-1059109 trnL
3162 LVZK01000001.1 GCA001652275_01017 gene open 1221167-1221247 trnY
3163 LVZK01000001.1 GCA001652275_01018 gene open 1221331-1221403 trnT
3164 LVZK01000001.1 GCA001652275_01019 gene open 1221426-1221499 trnM
3165 LVZK01000001.1 GCA001652275_01027 gene open 1231328-1231399 trnW
3166 LVZK01000001.1 GCA001652275_01290 gene open 1536997-1537078 trnL
3167 LVZK01000001.1 GCA001652275_01309 gene open 1559294-1559365 trnQ
3168 LVZK01000001.1 GCA001652275_01310 gene open 1559400-1559472 trnE
3169 LVZK01000001.1 GCA001652275_01311 gene open 1559512-1559584 trnE
3170 LVZK01000001.1 GCA001652275_01353 gene open 1604456-1604531 trnA
3171 LVZK01000001.1 GCA001652275_01484 gene open 1751192-1751265 trnP
3172 LVZK01000001.1 GCA001652275_01534 gene open 1816160-1816240 trnL
3173 LVZK01000001.1 GCA001652275_01559 gene open 1851767-1851851 trnL
3174 LVZK01000001.1 GCA001652275_00158 tRNA open 186144-186215 trnK tRNA-Lys(ttt)
3175 LVZK01000001.1 GCA001652275_00172 tRNA open 200111-200183 trnE tRNA-Glu(ttc)
3176 LVZK01000001.1 GCA001652275_00173 tRNA open 200208-200281 trnD tRNA-Asp(gtc)
3177 LVZK01000001.1 GCA001652275_00174 tRNA open 200319-200391 trnF tRNA-Phe(gaa)
3178 LVZK01000001.1 GCA001652275_00299 tRNA open 353836-353908 trnR tRNA-Arg(acg)
3179 LVZK01000001.1 GCA001652275_00412 tRNA open 503496-503569 trnI tRNA-Ile(gat)
3180 LVZK01000001.1 GCA001652275_00414 tRNA open 503750-503822 trnA tRNA-Ala(tgc)
3181 LVZK01000001.1 GCA001652275_00439 tRNA open 533679-533762 trnL tRNA-Leu(cag)
3182 LVZK01000001.1 GCA001652275_00583 tRNA open 699498-699571 trnG tRNA-Gly(ccc)
3183 LVZK01000001.1 GCA001652275_00601 tRNA open 715647-715736 trnS tRNA-Ser(gct)
3184 LVZK01000001.1 GCA001652275_00605 tRNA open 718429-718516 trnS tRNA-Ser(tga)
3185 LVZK01000001.1 GCA001652275_00626 tRNA open 746283-746371 trnS tRNA-Ser(cga)
3186 LVZK01000001.1 GCA001652275_00644 tRNA open 765859-765932 trnP tRNA-Pro(cgg)
3187 LVZK01000001.1 GCA001652275_00701 tRNA open 850233-850308 trnT tRNA-Thr(cgt)
3188 LVZK01000001.1 GCA001652275_00729 tRNA open 881989-882073 trnS tRNA-Ser(gga)
3189 LVZK01000001.1 GCA001652275_00740 tRNA open 898244-898316 trnT tRNA-Thr(tgt)
3190 LVZK01000001.1 GCA001652275_00765 tRNA open 929568-929639 trnR tRNA-Arg(cct)
3191 LVZK01000001.1 GCA001652275_00775 tRNA open 943616-943691 trnA tRNA-Ala(cgc)
3192 LVZK01000001.1 GCA001652275_00862 tRNA open 1037848-1037918 trnQ tRNA-Gln(ttg)
3193 LVZK01000001.1 GCA001652275_00879 tRNA open 1059036-1059109 trnL tRNA-Leu(taa)
3194 LVZK01000001.1 GCA001652275_01017 tRNA open 1221167-1221247 trnY tRNA-Tyr(gta)
3195 LVZK01000001.1 GCA001652275_01018 tRNA open 1221331-1221403 trnT tRNA-Thr(ggt)
3196 LVZK01000001.1 GCA001652275_01019 tRNA open 1221426-1221499 trnM tRNA-Met(cat)
3197 LVZK01000001.1 GCA001652275_01027 tRNA open 1231328-1231399 trnW tRNA-Trp(cca)
3198 LVZK01000001.1 GCA001652275_01290 tRNA open 1536997-1537078 trnL tRNA-Leu(tag)
3199 LVZK01000001.1 GCA001652275_01309 tRNA open 1559294-1559365 trnQ tRNA-Gln(ctg)
3200 LVZK01000001.1 GCA001652275_01310 tRNA open 1559400-1559472 trnE tRNA-Glu(ctc)
3201 LVZK01000001.1 GCA001652275_01311 tRNA open 1559512-1559584 trnE tRNA-Glu(ctc)
3202 LVZK01000001.1 GCA001652275_01353 tRNA open 1604456-1604531 trnA tRNA-Ala(ggc)
3203 LVZK01000001.1 GCA001652275_01484 tRNA open 1751192-1751265 trnP tRNA-Pro(ggg)
3204 LVZK01000001.1 GCA001652275_01534 tRNA open 1816160-1816240 trnL tRNA-Leu(caa)
3205 LVZK01000001.1 GCA001652275_01559 tRNA open 1851767-1851851 trnL tRNA-Leu(gag)
3206 LVZK01000002.1 GCA001652275_01727 gene open 169377-169497 rrf
3207 LVZK01000002.1 GCA001652275_01728 gene open 169606-172703 rrl
3208 LVZK01000002.1 GCA001652275_01729 gene open 172869-174406 rrs
3209 LVZK01000002.1 GCA001652275_01727 rRNA open 169377-169497 rrf 5S ribosomal RNA
3210 LVZK01000002.1 GCA001652275_01728 rRNA open 169606-172703 rrl 23S ribosomal RNA
3211 LVZK01000002.1 GCA001652275_01729 rRNA open 172869-174406 rrs 16S ribosomal RNA
3212 LVZK01000002.1 GCA001652275_01600 CDS open 205-1770 _na     521_aa Schlafen AlbA-2 domain-containing protein
3213 LVZK01000002.1 GCA001652275_01601 CDS open 2242-2835 _na     197_aa HEAT repeat domain-containing protein
3214 LVZK01000002.1 GCA001652275_01602 CDS open 3167-3778 _na     203_aa HEAT repeat domain-containing protein
3215 LVZK01000002.1 GCA001652275_01603 CDS open 4480-5982 _na     500_aa putP sodium/proline symporter PutP
3216 LVZK01000002.1 GCA001652275_01604 CDS open 6384-7877 _na     497_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
3217 LVZK01000002.1 GCA001652275_01605 CDS open 7877-9385 _na     502_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
3218 LVZK01000002.1 GCA001652275_01606 CDS open 9385-9705 _na     106_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
3219 LVZK01000002.1 GCA001652275_01607 CDS open 9753-11048 _na     431_aa Cardiolipin synthase B
3220 LVZK01000002.1 GCA001652275_01608 CDS open 11183-13582 _na     799_aa ligA NAD-dependent DNA ligase LigA
3221 LVZK01000002.1 GCA001652275_01609 CDS open 13802-15058 _na     418_aa histidine kinase
3222 LVZK01000002.1 GCA001652275_01610 CDS open 15051-15743 _na     230_aa DNA-binding response regulator
3223 LVZK01000002.1 GCA001652275_01611 CDS open 15740-16480 _na     246_aa Peptide ABC transporter ATP-binding protein
3224 LVZK01000002.1 GCA001652275_01612 CDS open 16477-19056 _na     859_aa ABC3 transporter permease C-terminal domain-containing protein
3225 LVZK01000002.1 GCA001652275_01613 CDS open 19175-19429 _na     84_aa whiB Transcriptional regulator WhiB
3226 LVZK01000002.1 GCA001652275_01614 CDS open 19537-20979 _na     480_aa histidine kinase
3227 LVZK01000002.1 GCA001652275_01615 CDS open 21017-21484 _na     155_aa DUF2505 domain-containing protein
3228 LVZK01000002.1 GCA001652275_01616 CDS open 21481-22284 _na     267_aa thymidylate synthase
3229 LVZK01000002.1 GCA001652275_01617 CDS open 22298-22852 _na     184_aa dihydrofolate reductase
3230 LVZK01000002.1 GCA001652275_01618 CDS open 22982-24943 _na     653_aa ABC transporter
3231 LVZK01000002.1 GCA001652275_01619 CDS open 24940-26691 _na     583_aa Multidrug ABC transporter ATP-binding protein
3232 LVZK01000002.1 GCA001652275_01620 CDS open 26968-27150 _na     60_aa hypothetical protein
3233 LVZK01000002.1 GCA001652275_01621 CDS open 27482-28468 _na     328_aa Tat pathway signal sequence
3234 LVZK01000002.1 GCA001652275_01622 CDS open 28835-29857 _na     340_aa Methylenetetrahydrofolate reductase
3235 LVZK01000002.1 GCA001652275_01623 CDS open 29948-32260 _na     770_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
3236 LVZK01000002.1 GCA001652275_01624 CDS open 32498-33841 _na     447_aa Enterochelin esterase N-terminal domain-containing protein
3237 LVZK01000002.1 GCA001652275_01625 CDS open 33971-35584 _na     537_aa Sodium:proton antiporter
3238 LVZK01000002.1 GCA001652275_01626 CDS open 35661-36731 _na     356_aa HTH araC/xylS-type domain-containing protein
3239 LVZK01000002.1 GCA001652275_01627 CDS open 36814-37389 _na     191_aa Isochorismatase
3240 LVZK01000002.1 GCA001652275_01628 CDS open 37307-39244 _na     645_aa SGNH/GDSL hydrolase family protein
3241 LVZK01000002.1 GCA001652275_01629 CDS open 39611-41128 _na     505_aa Sodium:solute symporter
3242 LVZK01000002.1 GCA001652275_01630 CDS open 41353-44787 _na     1144_aa Beta-galactosidase
3243 LVZK01000002.1 GCA001652275_01631 CDS open 44913-45923 _na     336_aa lacI LacI family transcriptional regulator
3244 LVZK01000002.1 GCA001652275_01632 CDS open 46186-46923 _na     245_aa NAD-dependent protein deacylase
3245 LVZK01000002.1 GCA001652275_01633 CDS open 47120-50536 _na     1138_aa PPi-type phosphoenolpyruvate carboxykinase
3246 LVZK01000002.1 GCA001652275_01634 CDS open 51008-51685 _na     225_aa TIR domain-containing protein
3247 LVZK01000002.1 GCA001652275_01635 CDS open 51685-52512 _na     275_aa hypothetical protein
3248 LVZK01000002.1 GCA001652275_01636 CDS open 52543-52749 _na     68_aa hypothetical protein
3249 LVZK01000002.1 GCA001652275_01637 CDS open 52795-53190 _na     131_aa hypothetical protein
3250 LVZK01000002.1 GCA001652275_01639 CDS open 54533-57571 _na     1012_aa UPF0182 protein A4H34_08085
3251 LVZK01000002.1 GCA001652275_01640 CDS open 57725-58399 _na     224_aa hypothetical protein
3252 LVZK01000002.1 GCA001652275_01641 CDS open 58584-59642 _na     352_aa endopeptidase La
3253 LVZK01000002.1 GCA001652275_01642 CDS open 60020-61393 _na     457_aa Hydrolase
3254 LVZK01000002.1 GCA001652275_01643 CDS open 61532-62668 _na     378_aa THIF-type NAD/FAD binding fold domain-containing protein
3255 LVZK01000002.1 GCA001652275_01644 CDS open 62603-64606 _na     667_aa DNA 3'-5' helicase
3256 LVZK01000002.1 GCA001652275_01645 CDS open 64770-65012 _na     80_aa NrdH-redoxin
3257 LVZK01000002.1 GCA001652275_01646 CDS open 65092-65691 _na     199_aa tetR TetR family transcriptional regulator
3258 LVZK01000002.1 GCA001652275_01647 CDS open 65688-65777 _na     29_aa hypothetical protein
3259 LVZK01000002.1 GCA001652275_01648 CDS open 65835-66281 _na     148_aa DUF6041 domain-containing protein
3260 LVZK01000002.1 GCA001652275_01649 CDS open 66598-67464 _na     288_aa Divinyl chlorophyllide a 8-vinyl-reductase%2C chloroplastic
3261 LVZK01000002.1 GCA001652275_01650 CDS open 67545-68003 _na     152_aa marR MarR family transcriptional regulator
3262 LVZK01000002.1 GCA001652275_01651 CDS open 68226-68597 _na     123_aa Glyoxalase
3263 LVZK01000002.1 GCA001652275_01652 CDS open 69249-69392 _na     47_aa hypothetical protein
3264 LVZK01000002.1 GCA001652275_01653 CDS open 69415-69858 _na     147_aa Transmembrane protein
3265 LVZK01000002.1 GCA001652275_01654 CDS open 69936-70436 _na     166_aa Transmembrane protein
3266 LVZK01000002.1 GCA001652275_01655 CDS open 70472-71815 _na     447_aa nudC NAD(+) diphosphatase
3267 LVZK01000002.1 GCA001652275_01656 CDS open 72344-74569 _na     741_aa glgX glycogen debranching protein GlgX
3268 LVZK01000002.1 GCA001652275_01657 CDS open 74708-75880 _na     390_aa trpS tryptophan--tRNA ligase
3269 LVZK01000002.1 GCA001652275_01658 CDS open 75969-77849 _na     626_aa RCK N-terminal domain-containing protein
3270 LVZK01000002.1 GCA001652275_01659 CDS open 77846-80698 _na     950_aa WD40 repeat domain-containing protein
3271 LVZK01000002.1 GCA001652275_01660 CDS open 80695-83043 _na     782_aa WD40 repeat domain-containing protein
3272 LVZK01000002.1 GCA001652275_01661 CDS open 84044-86011 _na     655_aa Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase
3273 LVZK01000002.1 GCA001652275_01662 CDS open 86026-87546 _na     506_aa Aminoglycoside phosphotransferase domain-containing protein
3274 LVZK01000002.1 GCA001652275_01663 CDS open 87771-90068 _na     765_aa glgB 1%2C4-alpha-glucan branching protein GlgB
3275 LVZK01000002.1 GCA001652275_01664 CDS open 90614-91639 _na     341_aa lacI LacI family transcriptional regulator
3276 LVZK01000002.1 GCA001652275_01665 CDS open 91645-93513 _na     622_aa Amylase
3277 LVZK01000002.1 GCA001652275_01666 CDS open 93510-94412 _na     300_aa Thioredoxin domain-containing protein
3278 LVZK01000002.1 GCA001652275_01667 CDS open 94420-95445 _na     341_aa Lipoprotein
3279 LVZK01000002.1 GCA001652275_01668 CDS open 95438-97066 _na     542_aa hypothetical protein
3280 LVZK01000002.1 GCA001652275_01669 CDS open 97274-98677 _na     467_aa Cell division protein DivIVA
3281 LVZK01000002.1 GCA001652275_01670 CDS open 98818-99609 _na     263_aa AB hydrolase-1 domain-containing protein
3282 LVZK01000002.1 GCA001652275_01671 CDS open 99753-100037 _na     94_aa ATP/GTP-binding protein
3283 LVZK01000002.1 GCA001652275_01672 CDS open 100037-100732 _na     231_aa nucS endonuclease NucS
3284 LVZK01000002.1 GCA001652275_01673 CDS open 100812-101222 _na     136_aa DUF2550 domain-containing protein
3285 LVZK01000002.1 GCA001652275_01674 CDS open 101289-101549 _na     86_aa F0F1 ATP synthase subunit epsilon
3286 LVZK01000002.1 GCA001652275_01675 CDS open 101549-103003 _na     484_aa atpD F0F1 ATP synthase subunit beta
3287 LVZK01000002.1 GCA001652275_01676 CDS open 103013-103945 _na     310_aa F0F1 ATP synthase subunit gamma
3288 LVZK01000002.1 GCA001652275_01677 CDS open 103948-105579 _na     543_aa atpA F0F1 ATP synthase subunit alpha
3289 LVZK01000002.1 GCA001652275_01678 CDS open 105616-106431 _na     271_aa F0F1 ATP synthase subunit delta
3290 LVZK01000002.1 GCA001652275_01679 CDS open 106432-106980 _na     182_aa atpF F0F1 ATP synthase subunit B
3291 LVZK01000002.1 GCA001652275_01680 CDS open 106983-107192 _na     69_aa atpE ATP synthase F0 subunit C
3292 LVZK01000002.1 GCA001652275_01681 CDS open 107221-108030 _na     269_aa atpB F0F1 ATP synthase subunit A
3293 LVZK01000002.1 GCA001652275_01682 CDS open 108259-108822 _na     187_aa hypothetical protein
3294 LVZK01000002.1 GCA001652275_01683 CDS open 108803-110425 _na     540_aa undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase
3295 LVZK01000002.1 GCA001652275_01684 CDS open 110425-111042 _na     205_aa L-threonylcarbamoyladenylate synthase
3296 LVZK01000002.1 GCA001652275_01685 CDS open 111057-111977 _na     306_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
3297 LVZK01000002.1 GCA001652275_01686 CDS open 111974-113071 _na     365_aa prfA peptide chain release factor 1
3298 LVZK01000002.1 GCA001652275_01687 CDS open 113148-113363 _na     71_aa rpmE 50S ribosomal protein L31
3299 LVZK01000002.1 GCA001652275_01688 CDS open 113581-115716 _na     711_aa rho transcription termination factor Rho
3300 LVZK01000002.1 GCA001652275_01689 CDS open 115973-116872 _na     299_aa thrB homoserine kinase
3301 LVZK01000002.1 GCA001652275_01690 CDS open 116872-117969 _na     365_aa thrC threonine synthase
3302 LVZK01000002.1 GCA001652275_01691 CDS open 117969-119246 _na     425_aa Homoserine dehydrogenase
3303 LVZK01000002.1 GCA001652275_01692 CDS open 119702-120499 _na     265_aa 3-dehydroquinate dehydratase
3304 LVZK01000002.1 GCA001652275_01693 CDS open 120580-121965 _na     461_aa lysA diaminopimelate decarboxylase
3305 LVZK01000002.1 GCA001652275_01694 CDS open 121973-123649 _na     558_aa argS arginine--tRNA ligase
3306 LVZK01000002.1 GCA001652275_01696 CDS open 123876-124646 _na     256_aa GP-PDE domain-containing protein
3307 LVZK01000002.1 GCA001652275_01697 CDS open 124651-126819 _na     722_aa Peptidase M23 domain-containing protein
3308 LVZK01000002.1 GCA001652275_01698 CDS open 127041-130973 _na     1310_aa multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit
3309 LVZK01000002.1 GCA001652275_01699 CDS open 131438-132025 _na     195_aa Lysophospholipase
3310 LVZK01000002.1 GCA001652275_01700 CDS open 132165-133790 _na     541_aa HNH nuclease domain-containing protein
3311 LVZK01000002.1 GCA001652275_01701 CDS open 134048-134608 _na     186_aa VOC family protein
3312 LVZK01000002.1 GCA001652275_01702 CDS open 135623-135985 _na     120_aa hypothetical protein
3313 LVZK01000002.1 GCA001652275_01703 CDS open 135982-136782 _na     266_aa GAF domain-containing protein
3314 LVZK01000002.1 GCA001652275_01704 CDS open 137240-137782 _na     180_aa rsrA mycothiol system anti-sigma-R factor
3315 LVZK01000002.1 GCA001652275_01705 CDS open 137779-138429 _na     216_aa RNA polymerase sigma factor
3316 LVZK01000002.1 GCA001652275_01706 CDS open 138864-139352 _na     162_aa doxX DoxX family protein
3317 LVZK01000002.1 GCA001652275_01707 CDS open 139349-139447 _na     32_aa hypothetical protein
3318 LVZK01000002.1 GCA001652275_01708 CDS open 139575-141005 _na     476_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
3319 LVZK01000002.1 GCA001652275_01709 CDS open 141002-142036 _na     344_aa rsgA ribosome small subunit-dependent GTPase A
3320 LVZK01000002.1 GCA001652275_01710 CDS open 142039-142908 _na     289_aa Histidinol phosphatase
3321 LVZK01000002.1 GCA001652275_01711 CDS open 142912-143403 _na     163_aa Phosphoribosyltransferase
3322 LVZK01000002.1 GCA001652275_01712 CDS open 143528-144736 _na     402_aa Nuclease SbcCD subunit D
3323 LVZK01000002.1 GCA001652275_01713 CDS open 144792-147827 _na     1011_aa Rad50/SbcC-type AAA domain-containing protein
3324 LVZK01000002.1 GCA001652275_01714 CDS open 148211-150424 _na     737_aa Glycosyl hydrolase family 32
3325 LVZK01000002.1 GCA001652275_01715 CDS open 150607-151053 _na     148_aa DUF6912 domain-containing protein
3326 LVZK01000002.1 GCA001652275_01716 CDS open 151167-152018 _na     283_aa hypothetical protein
3327 LVZK01000002.1 GCA001652275_01717 CDS open 151951-152223 _na     90_aa hypothetical protein
3328 LVZK01000002.1 GCA001652275_01718 CDS open 152916-153122 _na     68_aa Excisionase
3329 LVZK01000002.1 GCA001652275_01719 CDS open 153772-154314 _na     180_aa hypothetical protein
3330 LVZK01000002.1 GCA001652275_01720 CDS open 154334-155026 _na     230_aa tonB Energy transducer TonB
3331 LVZK01000002.1 GCA001652275_01721 CDS open 155141-157978 _na     945_aa secA preprotein translocase subunit SecA
3332 LVZK01000002.1 GCA001652275_01722 CDS open 158092-160515 _na     807_aa Bifunctional metallophosphatase/5'-nucleotidase
3333 LVZK01000002.1 GCA001652275_01723 CDS open 160734-162242 _na     502_aa hypothetical protein
3334 LVZK01000002.1 GCA001652275_01724 CDS open 162673-163419 _na     248_aa Transcriptional regulator
3335 LVZK01000002.1 GCA001652275_01725 CDS open 163606-165819 _na     737_aa PTS beta-glucoside transporter subunit IIABC
3336 LVZK01000002.1 GCA001652275_01726 CDS open 166062-167825 _na     587_aa treC alpha%2Calpha-phosphotrehalase
3337 LVZK01000002.1 GCA001652275_01600 gene open 205-1770
3338 LVZK01000002.1 GCA001652275_01601 gene open 2242-2835
3339 LVZK01000002.1 GCA001652275_01602 gene open 3167-3778
3340 LVZK01000002.1 GCA001652275_01603 gene open 4480-5982 putP
3341 LVZK01000002.1 GCA001652275_01604 gene open 6384-7877 gatB
3342 LVZK01000002.1 GCA001652275_01605 gene open 7877-9385 gatA
3343 LVZK01000002.1 GCA001652275_01606 gene open 9385-9705 gatC
3344 LVZK01000002.1 GCA001652275_01607 gene open 9753-11048
3345 LVZK01000002.1 GCA001652275_01608 gene open 11183-13582 ligA
3346 LVZK01000002.1 GCA001652275_01609 gene open 13802-15058
3347 LVZK01000002.1 GCA001652275_01610 gene open 15051-15743
3348 LVZK01000002.1 GCA001652275_01611 gene open 15740-16480
3349 LVZK01000002.1 GCA001652275_01612 gene open 16477-19056
3350 LVZK01000002.1 GCA001652275_01613 gene open 19175-19429 whiB
3351 LVZK01000002.1 GCA001652275_01614 gene open 19537-20979
3352 LVZK01000002.1 GCA001652275_01615 gene open 21017-21484
3353 LVZK01000002.1 GCA001652275_01616 gene open 21481-22284
3354 LVZK01000002.1 GCA001652275_01617 gene open 22298-22852
3355 LVZK01000002.1 GCA001652275_01618 gene open 22982-24943
3356 LVZK01000002.1 GCA001652275_01619 gene open 24940-26691
3357 LVZK01000002.1 GCA001652275_01620 gene open 26968-27150
3358 LVZK01000002.1 GCA001652275_01621 gene open 27482-28468
3359 LVZK01000002.1 GCA001652275_01622 gene open 28835-29857
3360 LVZK01000002.1 GCA001652275_01623 gene open 29948-32260 metE
3361 LVZK01000002.1 GCA001652275_01624 gene open 32498-33841
3362 LVZK01000002.1 GCA001652275_01625 gene open 33971-35584
3363 LVZK01000002.1 GCA001652275_01626 gene open 35661-36731
3364 LVZK01000002.1 GCA001652275_01627 gene open 36814-37389
3365 LVZK01000002.1 GCA001652275_01628 gene open 37307-39244
3366 LVZK01000002.1 GCA001652275_01629 gene open 39611-41128
3367 LVZK01000002.1 GCA001652275_01630 gene open 41353-44787
3368 LVZK01000002.1 GCA001652275_01631 gene open 44913-45923 lacI
3369 LVZK01000002.1 GCA001652275_01632 gene open 46186-46923
3370 LVZK01000002.1 GCA001652275_01633 gene open 47120-50536
3371 LVZK01000002.1 GCA001652275_01634 gene open 51008-51685
3372 LVZK01000002.1 GCA001652275_01635 gene open 51685-52512
3373 LVZK01000002.1 GCA001652275_01636 gene open 52543-52749
3374 LVZK01000002.1 GCA001652275_01637 gene open 52795-53190
3375 LVZK01000002.1 GCA001652275_01639 gene open 54533-57571
3376 LVZK01000002.1 GCA001652275_01640 gene open 57725-58399
3377 LVZK01000002.1 GCA001652275_01641 gene open 58584-59642
3378 LVZK01000002.1 GCA001652275_01642 gene open 60020-61393
3379 LVZK01000002.1 GCA001652275_01643 gene open 61532-62668
3380 LVZK01000002.1 GCA001652275_01644 gene open 62603-64606
3381 LVZK01000002.1 GCA001652275_01645 gene open 64770-65012
3382 LVZK01000002.1 GCA001652275_01646 gene open 65092-65691 tetR
3383 LVZK01000002.1 GCA001652275_01647 gene open 65688-65777
3384 LVZK01000002.1 GCA001652275_01648 gene open 65835-66281
3385 LVZK01000002.1 GCA001652275_01649 gene open 66598-67464
3386 LVZK01000002.1 GCA001652275_01650 gene open 67545-68003 marR
3387 LVZK01000002.1 GCA001652275_01651 gene open 68226-68597
3388 LVZK01000002.1 GCA001652275_01652 gene open 69249-69392
3389 LVZK01000002.1 GCA001652275_01653 gene open 69415-69858
3390 LVZK01000002.1 GCA001652275_01654 gene open 69936-70436
3391 LVZK01000002.1 GCA001652275_01655 gene open 70472-71815 nudC
3392 LVZK01000002.1 GCA001652275_01656 gene open 72344-74569 glgX
3393 LVZK01000002.1 GCA001652275_01657 gene open 74708-75880 trpS
3394 LVZK01000002.1 GCA001652275_01658 gene open 75969-77849
3395 LVZK01000002.1 GCA001652275_01659 gene open 77846-80698
3396 LVZK01000002.1 GCA001652275_01660 gene open 80695-83043
3397 LVZK01000002.1 GCA001652275_01661 gene open 84044-86011
3398 LVZK01000002.1 GCA001652275_01662 gene open 86026-87546
3399 LVZK01000002.1 GCA001652275_01663 gene open 87771-90068 glgB
3400 LVZK01000002.1 GCA001652275_01664 gene open 90614-91639 lacI
3401 LVZK01000002.1 GCA001652275_01665 gene open 91645-93513
3402 LVZK01000002.1 GCA001652275_01666 gene open 93510-94412
3403 LVZK01000002.1 GCA001652275_01667 gene open 94420-95445
3404 LVZK01000002.1 GCA001652275_01668 gene open 95438-97066
3405 LVZK01000002.1 GCA001652275_01669 gene open 97274-98677
3406 LVZK01000002.1 GCA001652275_01670 gene open 98818-99609
3407 LVZK01000002.1 GCA001652275_01671 gene open 99753-100037
3408 LVZK01000002.1 GCA001652275_01672 gene open 100037-100732 nucS
3409 LVZK01000002.1 GCA001652275_01673 gene open 100812-101222
3410 LVZK01000002.1 GCA001652275_01674 gene open 101289-101549
3411 LVZK01000002.1 GCA001652275_01675 gene open 101549-103003 atpD
3412 LVZK01000002.1 GCA001652275_01676 gene open 103013-103945
3413 LVZK01000002.1 GCA001652275_01677 gene open 103948-105579 atpA
3414 LVZK01000002.1 GCA001652275_01678 gene open 105616-106431
3415 LVZK01000002.1 GCA001652275_01679 gene open 106432-106980 atpF
3416 LVZK01000002.1 GCA001652275_01680 gene open 106983-107192 atpE
3417 LVZK01000002.1 GCA001652275_01681 gene open 107221-108030 atpB
3418 LVZK01000002.1 GCA001652275_01682 gene open 108259-108822
3419 LVZK01000002.1 GCA001652275_01683 gene open 108803-110425
3420 LVZK01000002.1 GCA001652275_01684 gene open 110425-111042
3421 LVZK01000002.1 GCA001652275_01685 gene open 111057-111977 prmC
3422 LVZK01000002.1 GCA001652275_01686 gene open 111974-113071 prfA
3423 LVZK01000002.1 GCA001652275_01687 gene open 113148-113363 rpmE
3424 LVZK01000002.1 GCA001652275_01688 gene open 113581-115716 rho
3425 LVZK01000002.1 GCA001652275_01689 gene open 115973-116872 thrB
3426 LVZK01000002.1 GCA001652275_01690 gene open 116872-117969 thrC
3427 LVZK01000002.1 GCA001652275_01691 gene open 117969-119246
3428 LVZK01000002.1 GCA001652275_01692 gene open 119702-120499
3429 LVZK01000002.1 GCA001652275_01693 gene open 120580-121965 lysA
3430 LVZK01000002.1 GCA001652275_01694 gene open 121973-123649 argS
3431 LVZK01000002.1 GCA001652275_01696 gene open 123876-124646
3432 LVZK01000002.1 GCA001652275_01697 gene open 124651-126819
3433 LVZK01000002.1 GCA001652275_01698 gene open 127041-130973
3434 LVZK01000002.1 GCA001652275_01699 gene open 131438-132025
3435 LVZK01000002.1 GCA001652275_01700 gene open 132165-133790
3436 LVZK01000002.1 GCA001652275_01701 gene open 134048-134608
3437 LVZK01000002.1 GCA001652275_01702 gene open 135623-135985
3438 LVZK01000002.1 GCA001652275_01703 gene open 135982-136782
3439 LVZK01000002.1 GCA001652275_01704 gene open 137240-137782 rsrA
3440 LVZK01000002.1 GCA001652275_01705 gene open 137779-138429
3441 LVZK01000002.1 GCA001652275_01706 gene open 138864-139352 doxX
3442 LVZK01000002.1 GCA001652275_01707 gene open 139349-139447
3443 LVZK01000002.1 GCA001652275_01708 gene open 139575-141005 aroA
3444 LVZK01000002.1 GCA001652275_01709 gene open 141002-142036 rsgA
3445 LVZK01000002.1 GCA001652275_01710 gene open 142039-142908
3446 LVZK01000002.1 GCA001652275_01711 gene open 142912-143403
3447 LVZK01000002.1 GCA001652275_01712 gene open 143528-144736
3448 LVZK01000002.1 GCA001652275_01713 gene open 144792-147827
3449 LVZK01000002.1 GCA001652275_01714 gene open 148211-150424
3450 LVZK01000002.1 GCA001652275_01715 gene open 150607-151053
3451 LVZK01000002.1 GCA001652275_01716 gene open 151167-152018
3452 LVZK01000002.1 GCA001652275_01717 gene open 151951-152223
3453 LVZK01000002.1 GCA001652275_01718 gene open 152916-153122
3454 LVZK01000002.1 GCA001652275_01719 gene open 153772-154314
3455 LVZK01000002.1 GCA001652275_01720 gene open 154334-155026 tonB
3456 LVZK01000002.1 GCA001652275_01721 gene open 155141-157978 secA
3457 LVZK01000002.1 GCA001652275_01722 gene open 158092-160515
3458 LVZK01000002.1 GCA001652275_01723 gene open 160734-162242
3459 LVZK01000002.1 GCA001652275_01724 gene open 162673-163419
3460 LVZK01000002.1 GCA001652275_01725 gene open 163606-165819
3461 LVZK01000002.1 GCA001652275_01726 gene open 166062-167825 treC
3462 LVZK01000002.1 GCA001652275_01638 gene open 54307-54380 trnfM
3463 LVZK01000002.1 GCA001652275_01695 gene open 123745-123817 trnR
3464 LVZK01000002.1 GCA001652275_01638 tRNA open 54307-54380 trnfM tRNA-fMet(cat)
3465 LVZK01000002.1 GCA001652275_01695 tRNA open 123745-123817 trnR tRNA-Arg(ccg)
3466 LVZK01000003.1 GCA001652275_01831 gene open 114505-114869 RNaseP_bact_a
3467 LVZK01000003.1 GCA001652275_02116 gene open 445918-446038 rrf
3468 LVZK01000003.1 GCA001652275_02117 gene open 446147-449244 rrl
3469 LVZK01000003.1 GCA001652275_02118 gene open 449410-450947 rrs
3470 LVZK01000003.1 GCA001652275_01831 ncRNA open 114505-114869 Bacterial RNase P class A
3471 LVZK01000003.1 GCA001652275_02116 rRNA open 445918-446038 rrf 5S ribosomal RNA
3472 LVZK01000003.1 GCA001652275_02117 rRNA open 446147-449244 rrl 23S ribosomal RNA
3473 LVZK01000003.1 GCA001652275_02118 rRNA open 449410-450947 rrs 16S ribosomal RNA
3474 LVZK01000003.1 repeat_region open 414160-415846 CRISPR array with 28 repeats of length 28%2C consensus sequence GTCTTCCCCGCGCATGCGGGGGTGATCC and spacer length 33
3475 LVZK01000003.1 GCA001652275_01730 CDS open 105-1367 _na     420_aa tyrS tyrosine--tRNA ligase
3476 LVZK01000003.1 GCA001652275_01731 CDS open 1511-1999 _na     162_aa EVE domain-containing protein
3477 LVZK01000003.1 GCA001652275_01732 CDS open 2241-2726 _na     161_aa argR arginine repressor
3478 LVZK01000003.1 GCA001652275_01733 CDS open 2848-4389 _na     513_aa G domain-containing protein
3479 LVZK01000003.1 GCA001652275_01734 CDS open 4392-6122 _na     576_aa Dynamin N-terminal domain-containing protein
3480 LVZK01000003.1 GCA001652275_01735 CDS open 6119-7468 _na     449_aa hisS histidine--tRNA ligase
3481 LVZK01000003.1 GCA001652275_01736 CDS open 7522-8256 _na     244_aa MBL fold metallo-hydrolase
3482 LVZK01000003.1 GCA001652275_01737 CDS open 8414-9760 _na     448_aa ATPase
3483 LVZK01000003.1 GCA001652275_01738 CDS open 9942-10469 _na     175_aa AbiEi antitoxin C-terminal domain-containing protein
3484 LVZK01000003.1 GCA001652275_01739 CDS open 10471-12753 _na     760_aa GTP pyrophosphokinase
3485 LVZK01000003.1 GCA001652275_01740 CDS open 12840-13385 _na     181_aa adenine phosphoribosyltransferase
3486 LVZK01000003.1 GCA001652275_01741 CDS open 13382-14515 _na     377_aa secF Protein-export membrane protein SecF
3487 LVZK01000003.1 GCA001652275_01742 CDS open 14508-16697 _na     729_aa secD Protein translocase subunit SecD
3488 LVZK01000003.1 GCA001652275_01743 CDS open 16710-17102 _na     130_aa yajC Preprotein translocase subunit YajC
3489 LVZK01000003.1 GCA001652275_01744 CDS open 17312-18358 _na     348_aa ruvB Holliday junction branch migration DNA helicase RuvB
3490 LVZK01000003.1 GCA001652275_01745 CDS open 18362-18952 _na     196_aa ruvA Holliday junction branch migration protein RuvA
3491 LVZK01000003.1 GCA001652275_01746 CDS open 19002-19637 _na     211_aa ruvC crossover junction endodeoxyribonuclease RuvC
3492 LVZK01000003.1 GCA001652275_01747 CDS open 19639-20397 _na     252_aa YebC/PmpR family DNA-binding transcriptional regulator
3493 LVZK01000003.1 GCA001652275_01748 CDS open 20909-22570 _na     553_aa DUF1023 domain-containing protein
3494 LVZK01000003.1 GCA001652275_01749 CDS open 22634-23365 _na     243_aa Lipoprotein
3495 LVZK01000003.1 GCA001652275_01750 CDS open 23469-23759 _na     96_aa hypothetical protein
3496 LVZK01000003.1 GCA001652275_01751 CDS open 24306-26270 _na     654_aa prsW PrsW family intramembrane metalloprotease
3497 LVZK01000003.1 GCA001652275_01752 CDS open 26348-27070 _na     240_aa Nudix hydrolase domain-containing protein
3498 LVZK01000003.1 GCA001652275_01753 CDS open 27057-28634 _na     525_aa prsW PrsW family intramembrane metalloprotease
3499 LVZK01000003.1 GCA001652275_01754 CDS open 28643-29212 _na     189_aa NUDIX hydrolase
3500 LVZK01000003.1 GCA001652275_01755 CDS open 29209-30336 _na     375_aa Alpha-(1-2)-phosphatidylinositol mannosyltransferase