HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Moraxella catarrhalis (GCA_001656255.1)

Select a Genome:
BAKTA Annotations for GCA_001656255.1
Genome Selected: Moraxella catarrhalis
ContigsBases CDSrRNA tmRNAtRNA
30 1881225 1700 3 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3501 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3501 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 LXHH01000025.1 GCA001656255_00062 gene open 72895-75057 aceB
3002 LXHH01000025.1 GCA001656255_00063 gene open 75369-78845 cafA
3003 LXHH01000025.1 GCA001656255_00064 gene open 79625-80773 rluA
3004 LXHH01000025.1 GCA001656255_00065 gene open 80882-82432 ppx
3005 LXHH01000025.1 GCA001656255_00066 gene open 82566-83363 accA
3006 LXHH01000025.1 GCA001656255_00067 gene open 83458-84813 ttcA
3007 LXHH01000025.1 GCA001656255_00068 gene open 84939-85784 proC
3008 LXHH01000025.1 GCA001656255_00069 gene open 85820-86383 yggT
3009 LXHH01000025.1 GCA001656255_00070 gene open 86445-87242 thiD
3010 LXHH01000025.1 GCA001656255_00073 gene open 87833-88510
3011 LXHH01000025.1 GCA001656255_00074 gene open 88531-89940 hemN
3012 LXHH01000025.1 GCA001656255_00075 gene open 90126-90698 pth
3013 LXHH01000025.1 GCA001656255_00076 gene open 90775-91449 rplY
3014 LXHH01000025.1 GCA001656255_00077 gene open 91925-93421 putP
3015 LXHH01000025.1 GCA001656255_00078 gene open 93832-94047 rpsU
3016 LXHH01000025.1 GCA001656255_00079 gene open 94207-94482 minE
3017 LXHH01000025.1 GCA001656255_00080 gene open 94485-95300 minD
3018 LXHH01000025.1 GCA001656255_00081 gene open 95455-96237 minC
3019 LXHH01000025.1 GCA001656255_00082 gene open 96334-97440 secA
3020 LXHH01000025.1 GCA001656255_00083 gene open 97616-98572 plsC
3021 LXHH01000025.1 GCA001656255_00084 gene open 98978-99652 ompA
3022 LXHH01000025.1 GCA001656255_00085 gene open 100279-100803 cytC5
3023 LXHH01000025.1 GCA001656255_00087 gene open 101350-102822 gatB
3024 LXHH01000025.1 GCA001656255_00088 gene open 102895-104370 gatA
3025 LXHH01000025.1 GCA001656255_00089 gene open 104469-104756 gatC
3026 LXHH01000025.1 GCA001656255_00090 gene open 105082-105693 maf
3027 LXHH01000025.1 GCA001656255_00091 gene open 105882-107510 rng
3028 LXHH01000025.1 GCA001656255_00092 gene open 107912-108223 rpsJ
3029 LXHH01000025.1 GCA001656255_00093 gene open 108276-108914 rplC
3030 LXHH01000025.1 GCA001656255_00094 gene open 108929-109531 rplD
3031 LXHH01000025.1 GCA001656255_00095 gene open 109528-109857 rplW
3032 LXHH01000025.1 GCA001656255_00096 gene open 109868-110695 rplB
3033 LXHH01000025.1 GCA001656255_00097 gene open 110708-110983 rpsS
3034 LXHH01000025.1 GCA001656255_00098 gene open 110993-111322 rplV
3035 LXHH01000025.1 GCA001656255_00099 gene open 111325-112047 rpsC
3036 LXHH01000025.1 GCA001656255_00100 gene open 112051-112464 rplP
3037 LXHH01000025.1 GCA001656255_00101 gene open 112464-112661 rpmC
3038 LXHH01000025.1 GCA001656255_00102 gene open 112658-112930 rpsQ
3039 LXHH01000025.1 GCA001656255_00103 gene open 113039-113407 rplN
3040 LXHH01000025.1 GCA001656255_00104 gene open 113425-113742 rplX
3041 LXHH01000025.1 GCA001656255_00105 gene open 113763-114299 rplE
3042 LXHH01000025.1 GCA001656255_00106 gene open 114311-114616 rpsN
3043 LXHH01000025.1 GCA001656255_00107 gene open 114631-115029 rpsH
3044 LXHH01000025.1 GCA001656255_00108 gene open 115180-115713 rplF
3045 LXHH01000025.1 GCA001656255_00109 gene open 115725-116075 rplR
3046 LXHH01000025.1 GCA001656255_00110 gene open 116078-116575 rpsE
3047 LXHH01000025.1 GCA001656255_00111 gene open 116593-116772 rpmD
3048 LXHH01000025.1 GCA001656255_00112 gene open 116772-117212 rplO
3049 LXHH01000025.1 GCA001656255_00113 gene open 117216-118541 secY
3050 LXHH01000025.1 GCA001656255_00114 gene open 118812-119168 rpsM
3051 LXHH01000025.1 GCA001656255_00115 gene open 119189-119581 rpsK
3052 LXHH01000025.1 GCA001656255_00116 gene open 119594-120235 rpsD
3053 LXHH01000025.1 GCA001656255_00117 gene open 120260-121264 rpoA
3054 LXHH01000025.1 GCA001656255_00118 gene open 121283-121642 rplQ
3055 LXHH01000025.1 GCA001656255_00119 gene open 121729-122295 tsaC
3056 LXHH01000025.1 GCA001656255_00120 gene open 122300-123028 epmC
3057 LXHH01000025.1 GCA001656255_00121 gene open 123224-123766 yceD
3058 LXHH01000025.1 GCA001656255_00122 gene open 124004-124186 rpmF
3059 LXHH01000025.1 GCA001656255_00123 gene open 124469-125428 fabD
3060 LXHH01000025.1 GCA001656255_00124 gene open 125425-126153 fabG
3061 LXHH01000025.1 GCA001656255_00125 gene open 126341-126577 acpP
3062 LXHH01000025.1 GCA001656255_00126 gene open 126792-127292 lysM
3063 LXHH01000025.1 GCA001656255_00127 gene open 127597-128079
3064 LXHH01000025.1 GCA001656255_00128 gene open 128472-130304
3065 LXHH01000025.1 GCA001656255_00129 gene open 130304-130819 ilvN
3066 LXHH01000025.1 GCA001656255_00130 gene open 130983-132005 ilvC
3067 LXHH01000025.1 GCA001656255_00131 gene open 132114-132524
3068 LXHH01000025.1 GCA001656255_00132 gene open 132861-133073 cspD
3069 LXHH01000025.1 GCA001656255_00133 gene open 133219-133809 ruvC
3070 LXHH01000025.1 GCA001656255_00134 gene open 133965-134546 fxsA
3071 LXHH01000025.1 GCA001656255_00135 gene open 134570-135964 norM
3072 LXHH01000025.1 GCA001656255_00136 gene open 136130-137305 ftsW
3073 LXHH01000025.1 GCA001656255_00137 gene open 137479-138879 murD
3074 LXHH01000025.1 GCA001656255_00138 gene open 139078-139416 glnK
3075 LXHH01000025.1 GCA001656255_00139 gene open 139546-139911
3076 LXHH01000025.1 GCA001656255_00140 gene open 140103-140351
3077 LXHH01000025.1 GCA001656255_00141 gene open 140380-141378 nUC1
3078 LXHH01000025.1 GCA001656255_00142 gene open 141525-142757 mutY
3079 LXHH01000025.1 GCA001656255_00143 gene open 142788-143774
3080 LXHH01000025.1 GCA001656255_00145 gene open 144111-145067 ldhA
3081 LXHH01000025.1 GCA001656255_00146 gene open 145277-148141 rapA
3082 LXHH01000025.1 GCA001656255_00147 gene open 148227-149741 yifB
3083 LXHH01000025.1 GCA001656255_00148 gene open 149834-151984 fadH
3084 LXHH01000025.1 GCA001656255_00149 gene open 152267-152602
3085 LXHH01000025.1 GCA001656255_00150 gene open 152781-153569 map
3086 LXHH01000025.1 GCA001656255_00151 gene open 153695-156445 glnD
3087 LXHH01000025.1 GCA001656255_00152 gene open 156660-157472
3088 LXHH01000025.1 GCA001656255_00154 gene open 158248-159483 fimB
3089 LXHH01000025.1 GCA001656255_00155 gene open 160399-161442
3090 LXHH01000025.1 GCA001656255_00156 gene open 161564-162631
3091 LXHH01000025.1 GCA001656255_00157 gene open 162835-163035
3092 LXHH01000025.1 GCA001656255_00158 gene open 163032-163352
3093 LXHH01000025.1 GCA001656255_00159 gene open 163362-163766
3094 LXHH01000025.1 GCA001656255_00160 gene open 163914-164138
3095 LXHH01000025.1 GCA001656255_00161 gene open 164285-164812
3096 LXHH01000025.1 GCA001656255_00162 gene open 164814-165116
3097 LXHH01000025.1 GCA001656255_00163 gene open 165234-165587
3098 LXHH01000025.1 GCA001656255_00164 gene open 165639-166196 dnaG
3099 LXHH01000025.1 GCA001656255_00165 gene open 166261-168339
3100 LXHH01000025.1 GCA001656255_00166 gene open 170163-171665 brkB
3101 LXHH01000025.1 GCA001656255_00167 gene open 171982-172587 wrbA
3102 LXHH01000025.1 GCA001656255_00168 gene open 172584-173015
3103 LXHH01000025.1 GCA001656255_00169 gene open 173246-173908
3104 LXHH01000025.1 GCA001656255_00170 gene open 174291-174581 groES
3105 LXHH01000025.1 GCA001656255_00171 gene open 174708-176345 groL
3106 LXHH01000025.1 GCA001656255_00172 gene open 176547-177425 lgt
3107 LXHH01000025.1 GCA001656255_00173 gene open 177422-178264 thyA
3108 LXHH01000025.1 GCA001656255_00174 gene open 178261-178776 folA
3109 LXHH01000025.1 GCA001656255_00175 gene open 178828-179871 apbE
3110 LXHH01000025.1 GCA001656255_00176 gene open 180010-180450
3111 LXHH01000025.1 GCA001656255_00177 gene open 180519-181715 ubiM
3112 LXHH01000025.1 GCA001656255_00178 gene open 182029-183024 xerA
3113 LXHH01000025.1 GCA001656255_00179 gene open 183024-183923 dapF
3114 LXHH01000025.1 GCA001656255_00180 gene open 184191-185498 lysA
3115 LXHH01000025.1 GCA001656255_00181 gene open 185553-185699 lptM
3116 LXHH01000025.1 GCA001656255_00182 gene open 186055-187239 ackA
3117 LXHH01000025.1 GCA001656255_00183 gene open 187328-188797 pta
3118 LXHH01000025.1 GCA001656255_00184 gene open 189002-189142 ykgO
3119 LXHH01000025.1 GCA001656255_00185 gene open 189277-190050 yaaA
3120 LXHH01000025.1 GCA001656255_00186 gene open 190268-191335 caiD
3121 LXHH01000025.1 GCA001656255_00187 gene open 191427-192032 glpG
3122 LXHH01000025.1 GCA001656255_00188 gene open 192560-194215 ompA
3123 LXHH01000025.1 GCA001656255_00189 gene open 194491-195243 rsuA
3124 LXHH01000025.1 GCA001656255_00190 gene open 195253-197049
3125 LXHH01000025.1 GCA001656255_00191 gene open 197403-197891 slpA
3126 LXHH01000025.1 GCA001656255_00192 gene open 198147-199124
3127 LXHH01000025.1 GCA001656255_00193 gene open 199225-200259 metE
3128 LXHH01000025.1 GCA001656255_00194 gene open 200388-200921 rutF
3129 LXHH01000025.1 GCA001656255_00195 gene open 201096-202694 abgT
3130 LXHH01000025.1 GCA001656255_00196 gene open 203023-204555 katE
3131 LXHH01000025.1 GCA001656255_00197 gene open 204667-205902 nqrF
3132 LXHH01000025.1 GCA001656255_00198 gene open 205922-206530 nqrE
3133 LXHH01000025.1 GCA001656255_00199 gene open 206530-207201 nqrD
3134 LXHH01000025.1 GCA001656255_00200 gene open 207204-208013 nqrC
3135 LXHH01000025.1 GCA001656255_00201 gene open 207997-209229 nqrB
3136 LXHH01000025.1 GCA001656255_00202 gene open 209232-210584 nqrA
3137 LXHH01000025.1 GCA001656255_00203 gene open 211107-211838 hisA
3138 LXHH01000025.1 GCA001656255_00204 gene open 211969-214281 rnr
3139 LXHH01000025.1 GCA001656255_00205 gene open 214400-214918 rimI
3140 LXHH01000025.1 GCA001656255_00206 gene open 215006-215446 infC
3141 LXHH01000025.1 GCA001656255_00207 gene open 215596-216918
3142 LXHH01000025.1 GCA001656255_00208 gene open 217030-218949 thrS
3143 LXHH01000025.1 GCA001656255_00209 gene open 219331-219678
3144 LXHH01000025.1 GCA001656255_00210 gene open 220180-221577
3145 LXHH01000025.1 GCA001656255_00211 gene open 221577-221948
3146 LXHH01000025.1 GCA001656255_00212 gene open 222218-222739
3147 LXHH01000025.1 GCA001656255_00213 gene open 222741-223163
3148 LXHH01000025.1 GCA001656255_00214 gene open 223394-224071
3149 LXHH01000025.1 GCA001656255_00215 gene open 224192-224533
3150 LXHH01000025.1 GCA001656255_00216 gene open 224967-225092
3151 LXHH01000025.1 GCA001656255_00217 gene open 225451-225723
3152 LXHH01000025.1 GCA001656255_00218 gene open 225933-226571
3153 LXHH01000025.1 GCA001656255_00219 gene open 226584-227450
3154 LXHH01000025.1 GCA001656255_00220 gene open 227636-228289
3155 LXHH01000025.1 GCA001656255_00221 gene open 228529-228762
3156 LXHH01000025.1 GCA001656255_00222 gene open 228752-229057
3157 LXHH01000025.1 GCA001656255_00223 gene open 229057-229515 cdiI
3158 LXHH01000025.1 GCA001656255_00224 gene open 229627-230016
3159 LXHH01000025.1 GCA001656255_00225 gene open 230018-230491
3160 LXHH01000025.1 GCA001656255_00226 gene open 230549-231079
3161 LXHH01000025.1 GCA001656255_00227 gene open 231099-231644
3162 LXHH01000025.1 GCA001656255_00228 gene open 231728-232021
3163 LXHH01000025.1 GCA001656255_00229 gene open 232032-232463
3164 LXHH01000025.1 GCA001656255_00230 gene open 233163-233333
3165 LXHH01000025.1 GCA001656255_00057 gene open 67799-67889 trnS
3166 LXHH01000025.1 GCA001656255_00071 gene open 87477-87568 trnS
3167 LXHH01000025.1 GCA001656255_00072 gene open 87683-87759 trnR
3168 LXHH01000025.1 GCA001656255_00086 gene open 101065-101141 trnP
3169 LXHH01000025.1 GCA001656255_00144 gene open 143982-144057 trnF
3170 LXHH01000025.1 GCA001656255_00057 tRNA open 67799-67889 trnS tRNA-Ser(gga)
3171 LXHH01000025.1 GCA001656255_00071 tRNA open 87477-87568 trnS tRNA-Ser(gct)
3172 LXHH01000025.1 GCA001656255_00072 tRNA open 87683-87759 trnR tRNA-Arg(acg)
3173 LXHH01000025.1 GCA001656255_00086 tRNA open 101065-101141 trnP tRNA-Pro(ggg)
3174 LXHH01000025.1 GCA001656255_00144 tRNA open 143982-144057 trnF tRNA-Phe(gaa)
3175 LXHH01000026.1 GCA001656255_00431 CDS open 20-1681 _na     553_aa fixX Electron transfer flavoprotein-ubiquinone oxidoreductase
3176 LXHH01000026.1 GCA001656255_00432 CDS open 2050-2676 _na     208_aa Proteophosphoglycan
3177 LXHH01000026.1 GCA001656255_00433 CDS open 2742-3599 _na     285_aa murI glutamate racemase
3178 LXHH01000026.1 GCA001656255_00434 CDS open 3748-3933 _na     61_aa H-NS histone family
3179 LXHH01000026.1 GCA001656255_00435 CDS open 4029-5450 _na     473_aa pGRP Membrane-bound lytic murein transglycosylase B
3180 LXHH01000026.1 GCA001656255_00436 CDS open 5551-6084 _na     177_aa msrA Peptide methionine sulfoxide reductase MsrA
3181 LXHH01000026.1 GCA001656255_00437 CDS open 6138-6899 _na     253_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
3182 LXHH01000026.1 GCA001656255_00438 CDS open 6970-8007 _na     345_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
3183 LXHH01000026.1 GCA001656255_00439 CDS open 8123-9037 _na     304_aa mutK ABC transporter
3184 LXHH01000026.1 GCA001656255_00440 CDS open 9134-9802 _na     222_aa ftsN SPOR domain-containing protein
3185 LXHH01000026.1 GCA001656255_00441 CDS open 10016-10252 _na     78_aa DUF2788 domain-containing protein
3186 LXHH01000026.1 GCA001656255_00442 CDS open 10321-10632 _na     103_aa Lipoprotein
3187 LXHH01000026.1 GCA001656255_00443 CDS open 10878-12005 _na     375_aa pucG Class V aminotransferase
3188 LXHH01000026.1 GCA001656255_00444 CDS open 12128-13639 _na     503_aa pepD2 Xaa-His dipeptidase%2C Metallo peptidase%2C MEROPS family M20C
3189 LXHH01000026.1 GCA001656255_00445 CDS open 13989-14453 _na     154_aa ycgN YcgN family cysteine cluster protein
3190 LXHH01000026.1 GCA001656255_00446 CDS open 14758-15600 _na     280_aa corC Magnesium/cobalt efflux protein
3191 LXHH01000026.1 GCA001656255_00447 CDS open 15673-16374 _na     233_aa ygfZ Aminomethyltransferase folate-binding domain protein
3192 LXHH01000026.1 GCA001656255_00448 CDS open 16560-16898 _na     112_aa phnA Alkylphosphonate utilization protein
3193 LXHH01000026.1 GCA001656255_00449 CDS open 16938-18242 _na     434_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
3194 LXHH01000026.1 GCA001656255_00450 CDS open 18544-21342 _na     932_aa secA preprotein translocase subunit SecA
3195 LXHH01000026.1 GCA001656255_00451 CDS open 21512-21805 _na     97_aa Lipoprotein
3196 LXHH01000026.1 GCA001656255_00452 CDS open 21944-23530 _na     528_aa lnt apolipoprotein N-acyltransferase
3197 LXHH01000026.1 GCA001656255_00453 CDS open 23973-26591 _na     872_aa transferrin-binding protein-like solute binding protein
3198 LXHH01000026.1 GCA001656255_00454 CDS open 26824-29826 _na     1000_aa cirA Lactoferrin binding protein A
3199 LXHH01000026.1 GCA001656255_00455 CDS open 29828-31450 _na     540_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
3200 LXHH01000026.1 GCA001656255_00456 CDS open 31677-31859 _na     60_aa hypothetical protein
3201 LXHH01000026.1 GCA001656255_00457 CDS open 32068-33864 _na     598_aa pepP Xaa-Pro aminopeptidase
3202 LXHH01000026.1 GCA001656255_00458 CDS open 33880-35262 _na     460_aa trpE Para-aminobenzoate synthase%2C aminase component
3203 LXHH01000026.1 GCA001656255_00459 CDS open 35442-36674 _na     410_aa fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1
3204 LXHH01000026.1 GCA001656255_00460 CDS open 37030-39210 _na     726_aa ecsC EcsC family protein
3205 LXHH01000026.1 GCA001656255_00461 CDS open 39427-39801 _na     124_aa rpsL 30S ribosomal protein S12
3206 LXHH01000026.1 GCA001656255_00462 CDS open 39922-40395 _na     157_aa rpsG 30S ribosomal protein S7
3207 LXHH01000026.1 GCA001656255_00463 CDS open 40555-42681 _na     708_aa fusA elongation factor G
3208 LXHH01000026.1 GCA001656255_00431 gene open 20-1681 fixX
3209 LXHH01000026.1 GCA001656255_00432 gene open 2050-2676
3210 LXHH01000026.1 GCA001656255_00433 gene open 2742-3599 murI
3211 LXHH01000026.1 GCA001656255_00434 gene open 3748-3933
3212 LXHH01000026.1 GCA001656255_00435 gene open 4029-5450 pGRP
3213 LXHH01000026.1 GCA001656255_00436 gene open 5551-6084 msrA
3214 LXHH01000026.1 GCA001656255_00437 gene open 6138-6899 cmoA
3215 LXHH01000026.1 GCA001656255_00438 gene open 6970-8007 cmoB
3216 LXHH01000026.1 GCA001656255_00439 gene open 8123-9037 mutK
3217 LXHH01000026.1 GCA001656255_00440 gene open 9134-9802 ftsN
3218 LXHH01000026.1 GCA001656255_00441 gene open 10016-10252
3219 LXHH01000026.1 GCA001656255_00442 gene open 10321-10632
3220 LXHH01000026.1 GCA001656255_00443 gene open 10878-12005 pucG
3221 LXHH01000026.1 GCA001656255_00444 gene open 12128-13639 pepD2
3222 LXHH01000026.1 GCA001656255_00445 gene open 13989-14453 ycgN
3223 LXHH01000026.1 GCA001656255_00446 gene open 14758-15600 corC
3224 LXHH01000026.1 GCA001656255_00447 gene open 15673-16374 ygfZ
3225 LXHH01000026.1 GCA001656255_00448 gene open 16560-16898 phnA
3226 LXHH01000026.1 GCA001656255_00449 gene open 16938-18242 hemL
3227 LXHH01000026.1 GCA001656255_00450 gene open 18544-21342 secA
3228 LXHH01000026.1 GCA001656255_00451 gene open 21512-21805
3229 LXHH01000026.1 GCA001656255_00452 gene open 21944-23530 lnt
3230 LXHH01000026.1 GCA001656255_00453 gene open 23973-26591
3231 LXHH01000026.1 GCA001656255_00454 gene open 26824-29826 cirA
3232 LXHH01000026.1 GCA001656255_00455 gene open 29828-31450
3233 LXHH01000026.1 GCA001656255_00456 gene open 31677-31859
3234 LXHH01000026.1 GCA001656255_00457 gene open 32068-33864 pepP
3235 LXHH01000026.1 GCA001656255_00458 gene open 33880-35262 trpE
3236 LXHH01000026.1 GCA001656255_00459 gene open 35442-36674 fabB
3237 LXHH01000026.1 GCA001656255_00460 gene open 37030-39210 ecsC
3238 LXHH01000026.1 GCA001656255_00461 gene open 39427-39801 rpsL
3239 LXHH01000026.1 GCA001656255_00462 gene open 39922-40395 rpsG
3240 LXHH01000026.1 GCA001656255_00463 gene open 40555-42681 fusA
3241 LXHH01000027.1 GCA001656255_00578 CDS open 1706-2752 _na     348_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3242 LXHH01000027.1 GCA001656255_00579 CDS open 3081-5306 _na     741_aa icdM NADP-dependent isocitrate dehydrogenase
3243 LXHH01000027.1 GCA001656255_00580 CDS open 5467-6576 _na     369_aa Peptide chain release factor 1
3244 LXHH01000027.1 GCA001656255_00581 CDS open 6855-7820 _na     321_aa hemH ferrochelatase
3245 LXHH01000027.1 GCA001656255_00582 CDS open 8370-9434 _na     354_aa lipA lipoyl synthase
3246 LXHH01000027.1 GCA001656255_00583 CDS open 9594-10532 _na     312_aa pldB Lysophospholipase
3247 LXHH01000027.1 GCA001656255_00584 CDS open 10664-11485 _na     273_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
3248 LXHH01000027.1 GCA001656255_00585 CDS open 11688-12473 _na     261_aa tcdA tRNA threonylcarbamoyladenosine dehydratase
3249 LXHH01000027.1 GCA001656255_00586 CDS open 12466-13305 _na     279_aa tatD Hydrolase
3250 LXHH01000027.1 GCA001656255_00587 CDS open 13417-14457 _na     346_aa 5'-nucleotidase
3251 LXHH01000027.1 GCA001656255_00588 CDS open 14539-15081 _na     180_aa fimT Type II secretion system protein H
3252 LXHH01000027.1 GCA001656255_00589 CDS open 15065-16483 _na     472_aa glcD D-lactate dehydrogenase (cytochrome)
3253 LXHH01000027.1 GCA001656255_00590 CDS open 17341-18390 _na     349_aa recA recombinase RecA
3254 LXHH01000027.1 GCA001656255_00591 CDS open 18400-19338 _na     312_aa recX Regulatory protein RecX
3255 LXHH01000027.1 GCA001656255_00592 CDS open 19367-20269 _na     300_aa yciV Phosphatase
3256 LXHH01000027.1 GCA001656255_00593 CDS open 20357-21490 _na     377_aa ftsZ cell division protein FtsZ
3257 LXHH01000027.1 GCA001656255_00594 CDS open 21669-22967 _na     432_aa ftsA cell division protein FtsA
3258 LXHH01000027.1 GCA001656255_00595 CDS open 23036-23704 _na     222_aa ftsQ Cell division protein FtsQ
3259 LXHH01000027.1 GCA001656255_00596 CDS open 24126-24752 _na     208_aa dedA Alkaline phosphatase
3260 LXHH01000027.1 GCA001656255_00597 CDS open 24742-25545 _na     267_aa Cof-type HAD-IIB family hydrolase
3261 LXHH01000027.1 GCA001656255_00578 gene open 1706-2752 tsaD
3262 LXHH01000027.1 GCA001656255_00579 gene open 3081-5306 icdM
3263 LXHH01000027.1 GCA001656255_00580 gene open 5467-6576
3264 LXHH01000027.1 GCA001656255_00581 gene open 6855-7820 hemH
3265 LXHH01000027.1 GCA001656255_00582 gene open 8370-9434 lipA
3266 LXHH01000027.1 GCA001656255_00583 gene open 9594-10532 pldB
3267 LXHH01000027.1 GCA001656255_00584 gene open 10664-11485 dapD
3268 LXHH01000027.1 GCA001656255_00585 gene open 11688-12473 tcdA
3269 LXHH01000027.1 GCA001656255_00586 gene open 12466-13305 tatD
3270 LXHH01000027.1 GCA001656255_00587 gene open 13417-14457
3271 LXHH01000027.1 GCA001656255_00588 gene open 14539-15081 fimT
3272 LXHH01000027.1 GCA001656255_00589 gene open 15065-16483 glcD
3273 LXHH01000027.1 GCA001656255_00590 gene open 17341-18390 recA
3274 LXHH01000027.1 GCA001656255_00591 gene open 18400-19338 recX
3275 LXHH01000027.1 GCA001656255_00592 gene open 19367-20269 yciV
3276 LXHH01000027.1 GCA001656255_00593 gene open 20357-21490 ftsZ
3277 LXHH01000027.1 GCA001656255_00594 gene open 21669-22967 ftsA
3278 LXHH01000027.1 GCA001656255_00595 gene open 23036-23704 ftsQ
3279 LXHH01000027.1 GCA001656255_00596 gene open 24126-24752 dedA
3280 LXHH01000027.1 GCA001656255_00597 gene open 24742-25545
3281 LXHH01000028.1 GCA001656255_00802 CDS open 567-1781 _na     404_aa trpB tryptophan synthase subunit beta
3282 LXHH01000028.1 GCA001656255_00803 CDS open 1822-2565 _na     247_aa 3-hydroxypropionate dehydrogenase
3283 LXHH01000028.1 GCA001656255_00804 CDS open 2582-3220 _na     212_aa trpF phosphoribosylanthranilate isomerase
3284 LXHH01000028.1 GCA001656255_00805 CDS open 3566-5284 _na     572_aa proS proline--tRNA ligase
3285 LXHH01000028.1 GCA001656255_00806 CDS open 5368-6210 _na     280_aa queF NADPH-dependent 7-cyano-7-deazaguanine reductase QueF
3286 LXHH01000028.1 GCA001656255_00807 CDS open 6297-7070 _na     257_aa yadH Transport permease protein
3287 LXHH01000028.1 GCA001656255_00808 CDS open 7143-8111 _na     322_aa rbbA ABC transporter%2C ATP-binding protein
3288 LXHH01000028.1 GCA001656255_00809 CDS open 8342-8908 _na     188_aa cytC5 Cytochrome c class I
3289 LXHH01000028.1 GCA001656255_00811 CDS open 9344-9880 _na     178_aa gloA lactoylglutathione lyase
3290 LXHH01000028.1 GCA001656255_00812 CDS open 9922-10548 _na     208_aa cynT Carbonic anhydrase
3291 LXHH01000028.1 GCA001656255_00813 CDS open 10569-11513 _na     314_aa SPOR domain-containing protein
3292 LXHH01000028.1 GCA001656255_00814 CDS open 11526-12644 _na     372_aa aroB 3-dehydroquinate synthase
3293 LXHH01000028.1 GCA001656255_00815 CDS open 12641-13276 _na     211_aa aroK Shikimate kinase
3294 LXHH01000028.1 GCA001656255_00816 CDS open 13469-14890 _na     473_aa pilQ Type IV pilus secretin PilQ family protein
3295 LXHH01000028.1 GCA001656255_00817 CDS open 14894-15547 _na     217_aa pilP Type IV pilus biogenesis protein PilP
3296 LXHH01000028.1 GCA001656255_00818 CDS open 15537-16175 _na     212_aa pilO Type IV pilus biogenesis protein PilO
3297 LXHH01000028.1 GCA001656255_00819 CDS open 16168-18045 _na     625_aa pilM Type IV pilus biogenesis protein PilN
3298 LXHH01000028.1 GCA001656255_00820 CDS open 18079-19548 _na     489_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
3299 LXHH01000028.1 GCA001656255_00821 CDS open 19711-19920 _na     69_aa hypothetical protein
3300 LXHH01000028.1 GCA001656255_00822 CDS open 19896-21719 _na     607_aa mltE Soluble lytic murein transglycosylase
3301 LXHH01000028.1 GCA001656255_00823 CDS open 21970-22956 _na     328_aa mdh malate dehydrogenase
3302 LXHH01000028.1 GCA001656255_00824 CDS open 23114-23359 _na     81_aa DUF2789 domain-containing protein
3303 LXHH01000028.1 GCA001656255_00802 gene open 567-1781 trpB
3304 LXHH01000028.1 GCA001656255_00803 gene open 1822-2565
3305 LXHH01000028.1 GCA001656255_00804 gene open 2582-3220 trpF
3306 LXHH01000028.1 GCA001656255_00805 gene open 3566-5284 proS
3307 LXHH01000028.1 GCA001656255_00806 gene open 5368-6210 queF
3308 LXHH01000028.1 GCA001656255_00807 gene open 6297-7070 yadH
3309 LXHH01000028.1 GCA001656255_00808 gene open 7143-8111 rbbA
3310 LXHH01000028.1 GCA001656255_00809 gene open 8342-8908 cytC5
3311 LXHH01000028.1 GCA001656255_00811 gene open 9344-9880 gloA
3312 LXHH01000028.1 GCA001656255_00812 gene open 9922-10548 cynT
3313 LXHH01000028.1 GCA001656255_00813 gene open 10569-11513
3314 LXHH01000028.1 GCA001656255_00814 gene open 11526-12644 aroB
3315 LXHH01000028.1 GCA001656255_00815 gene open 12641-13276 aroK
3316 LXHH01000028.1 GCA001656255_00816 gene open 13469-14890 pilQ
3317 LXHH01000028.1 GCA001656255_00817 gene open 14894-15547 pilP
3318 LXHH01000028.1 GCA001656255_00818 gene open 15537-16175 pilO
3319 LXHH01000028.1 GCA001656255_00819 gene open 16168-18045 pilM
3320 LXHH01000028.1 GCA001656255_00820 gene open 18079-19548 miaB
3321 LXHH01000028.1 GCA001656255_00821 gene open 19711-19920
3322 LXHH01000028.1 GCA001656255_00822 gene open 19896-21719 mltE
3323 LXHH01000028.1 GCA001656255_00823 gene open 21970-22956 mdh
3324 LXHH01000028.1 GCA001656255_00824 gene open 23114-23359
3325 LXHH01000028.1 GCA001656255_00810 gene open 9212-9288 trnR
3326 LXHH01000028.1 GCA001656255_00810 tRNA open 9212-9288 trnR tRNA-Arg(ccg)
3327 LXHH01000029.1 rep_origin open 27816-28410
3328 LXHH01000029.1 repeat_region open 7-1788 CRISPR array with 30 repeats of length 28%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAA and spacer length 32
3329 LXHH01000029.1 repeat_region open 1811-2045 CRISPR array with 4 repeats of length 29%2C consensus sequence CTTCACGACCGCATAGGTCGCTTAGAAAA and spacer length 36
3330 LXHH01000029.1 repeat_region open 2187-2345 CRISPR array with 3 repeats of length 28%2C consensus sequence CTTCACGACCGCATAGGTCGCTTAGAAA and spacer length 32
3331 LXHH01000029.1 GCA001656255_01691 CDS open 2448-2969 _na     173_aa grpE nucleotide exchange factor GrpE
3332 LXHH01000029.1 GCA001656255_01692 CDS open 3172-5079 _na     635_aa dnaK molecular chaperone DnaK
3333 LXHH01000029.1 GCA001656255_01693 CDS open 5233-5490 _na     85_aa nqrM (Na+)-NQR maturation NqrM
3334 LXHH01000029.1 GCA001656255_01694 CDS open 5554-6426 _na     290_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
3335 LXHH01000029.1 GCA001656255_01695 CDS open 6498-7256 _na     252_aa hemD Uroporphyrinogen-III synthase
3336 LXHH01000029.1 GCA001656255_01696 CDS open 7253-8218 _na     321_aa hemC hydroxymethylbilane synthase
3337 LXHH01000029.1 GCA001656255_01697 CDS open 8442-9842 _na     466_aa argH argininosuccinate lyase
3338 LXHH01000029.1 GCA001656255_01698 CDS open 10021-11862 _na     613_aa mdlB ABC transporter%2C ATP-binding protein
3339 LXHH01000029.1 GCA001656255_01699 CDS open 11971-13842 _na     623_aa thiC phosphomethylpyrimidine synthase ThiC
3340 LXHH01000029.1 GCA001656255_01700 CDS open 14183-15439 _na     418_aa dadA D-amino acid dehydrogenase
3341 LXHH01000029.1 GCA001656255_01701 CDS open 15448-15804 _na     118_aa ridA Aminoacrylate peracid reductase
3342 LXHH01000029.1 GCA001656255_01702 CDS open 15850-17130 _na     426_aa valine--pyruvate transaminase
3343 LXHH01000029.1 GCA001656255_01703 CDS open 17170-18345 _na     391_aa lysA Ornithine decarboxylase
3344 LXHH01000029.1 GCA001656255_01704 CDS open 18484-18846 _na     120_aa fkpA Peptidyl-prolyl cis-trans isomerase
3345 LXHH01000029.1 GCA001656255_01705 CDS open 18855-19349 _na     164_aa Rare lipoprotein A
3346 LXHH01000029.1 GCA001656255_01706 CDS open 19669-21228 _na     519_aa guaA glutamine-hydrolyzing GMP synthase
3347 LXHH01000029.1 GCA001656255_01707 CDS open 21403-23862 _na     819_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3348 LXHH01000029.1 GCA001656255_01708 CDS open 23999-25207 _na     402_aa recF DNA replication/repair protein RecF
3349 LXHH01000029.1 GCA001656255_01709 CDS open 25211-26368 _na     385_aa dnaN DNA polymerase III subunit beta
3350 LXHH01000029.1 GCA001656255_01710 CDS open 26405-27808 _na     467_aa dnaA chromosomal replication initiator protein DnaA
3351 LXHH01000029.1 GCA001656255_01711 CDS open 28411-28545 _na     44_aa rpmH 50S ribosomal protein L34
3352 LXHH01000029.1 GCA001656255_01712 CDS open 28657-28875 _na     72_aa ribonuclease P protein component
3353 LXHH01000029.1 GCA001656255_01713 CDS open 29087-29407 _na     106_aa yidD membrane protein insertion efficiency factor YidD
3354 LXHH01000029.1 GCA001656255_01714 CDS open 29576-31219 _na     547_aa yidC membrane protein insertase YidC
3355 LXHH01000029.1 GCA001656255_01715 CDS open 31385-32785 _na     466_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
3356 LXHH01000029.1 GCA001656255_01716 CDS open 32888-33358 _na     156_aa nrdR transcriptional regulator NrdR
3357 LXHH01000029.1 GCA001656255_01717 CDS open 33355-34407 _na     350_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
3358 LXHH01000029.1 GCA001656255_01718 CDS open 34690-35358 _na     222_aa ribC riboflavin synthase
3359 LXHH01000029.1 GCA001656255_01719 CDS open 35489-36514 _na     341_aa fmt methionyl-tRNA formyltransferase
3360 LXHH01000029.1 GCA001656255_01720 CDS open 36504-37850 _na     448_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
3361 LXHH01000029.1 GCA001656255_01721 CDS open 38169-39584 _na     471_aa thrC threonine synthase
3362 LXHH01000029.1 GCA001656255_01722 CDS open 39621-40832 _na     403_aa dprA DNA-processing protein DprA
3363 LXHH01000029.1 GCA001656255_01723 CDS open 40819-41433 _na     204_aa tsaC Threonylcarbamoyl-AMP synthase
3364 LXHH01000029.1 GCA001656255_01724 CDS open 41502-41762 _na     86_aa yeaQ Transglycosylase
3365 LXHH01000029.1 GCA001656255_01725 CDS open 41929-43023 _na     364_aa ribBA bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
3366 LXHH01000029.1 GCA001656255_01726 CDS open 43138-44376 _na     412_aa rarA Replication-associated recombination protein A
3367 LXHH01000029.1 GCA001656255_01727 CDS open 44532-44963 _na     143_aa Putative vgr related protein
3368 LXHH01000029.1 GCA001656255_01728 CDS open 45048-45656 _na     202_aa rsmC Ribosomal RNA small subunit methyltransferase C
3369 LXHH01000029.1 GCA001656255_01729 CDS open 45889-47670 _na     593_aa aF0785 DUF389 domain-containing protein
3370 LXHH01000029.1 GCA001656255_01730 CDS open 47697-47930 _na     77_aa 2-methylaconitate isomerase
3371 LXHH01000029.1 GCA001656255_01731 CDS open 48298-48573 _na     91_aa hypothetical protein
3372 LXHH01000029.1 GCA001656255_01732 CDS open 48619-49551 _na     310_aa rocF arginase
3373 LXHH01000029.1 GCA001656255_01733 CDS open 49592-50845 _na     417_aa rocD ornithine--oxo-acid transaminase
3374 LXHH01000029.1 GCA001656255_01734 CDS open 51043-51504 _na     153_aa hemerythrin domain-containing protein
3375 LXHH01000029.1 GCA001656255_01735 CDS open 51775-52575 _na     266_aa czcD Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter
3376 LXHH01000029.1 GCA001656255_01736 CDS open 52743-53984 _na     413_aa DNA (cytosine-5-)-methyltransferase
3377 LXHH01000029.1 GCA001656255_01737 CDS open 54053-54766 _na     237_aa Eco47II family restriction endonuclease
3378 LXHH01000029.1 GCA001656255_01738 CDS open 55037-56272 _na     411_aa anmK anhydro-N-acetylmuramic acid kinase
3379 LXHH01000029.1 GCA001656255_01739 CDS open 56434-57645 _na     403_aa tyrS tyrosine--tRNA ligase
3380 LXHH01000029.1 GCA001656255_01740 CDS open 57647-57925 _na     92_aa hypothetical protein
3381 LXHH01000029.1 GCA001656255_01741 CDS open 58016-58678 _na     220_aa yitT YitT family protein
3382 LXHH01000029.1 GCA001656255_01742 CDS open 58664-59368 _na     234_aa znuB Manganese ABC transporter%2C inner membrane permease protein SitD
3383 LXHH01000029.1 GCA001656255_01743 CDS open 59510-60367 _na     285_aa znuB Iron ABC transporter permease
3384 LXHH01000029.1 GCA001656255_01744 CDS open 60364-61272 _na     302_aa znuC Manganese ABC transporter%2C ATP-binding protein SitB
3385 LXHH01000029.1 GCA001656255_01745 CDS open 61272-62198 _na     308_aa znuA Manganese ABC transporter%2C periplasmic-binding protein SitA
3386 LXHH01000029.1 GCA001656255_01746 CDS open 62739-62918 _na     59_aa hypothetical protein
3387 LXHH01000029.1 GCA001656255_01747 CDS open 62915-63214 _na     99_aa hypothetical protein
3388 LXHH01000029.1 GCA001656255_01691 gene open 2448-2969 grpE
3389 LXHH01000029.1 GCA001656255_01692 gene open 3172-5079 dnaK
3390 LXHH01000029.1 GCA001656255_01693 gene open 5233-5490 nqrM
3391 LXHH01000029.1 GCA001656255_01694 gene open 5554-6426 rlmB
3392 LXHH01000029.1 GCA001656255_01695 gene open 6498-7256 hemD
3393 LXHH01000029.1 GCA001656255_01696 gene open 7253-8218 hemC
3394 LXHH01000029.1 GCA001656255_01697 gene open 8442-9842 argH
3395 LXHH01000029.1 GCA001656255_01698 gene open 10021-11862 mdlB
3396 LXHH01000029.1 GCA001656255_01699 gene open 11971-13842 thiC
3397 LXHH01000029.1 GCA001656255_01700 gene open 14183-15439 dadA
3398 LXHH01000029.1 GCA001656255_01701 gene open 15448-15804 ridA
3399 LXHH01000029.1 GCA001656255_01702 gene open 15850-17130
3400 LXHH01000029.1 GCA001656255_01703 gene open 17170-18345 lysA
3401 LXHH01000029.1 GCA001656255_01704 gene open 18484-18846 fkpA
3402 LXHH01000029.1 GCA001656255_01705 gene open 18855-19349
3403 LXHH01000029.1 GCA001656255_01706 gene open 19669-21228 guaA
3404 LXHH01000029.1 GCA001656255_01707 gene open 21403-23862 gyrB
3405 LXHH01000029.1 GCA001656255_01708 gene open 23999-25207 recF
3406 LXHH01000029.1 GCA001656255_01709 gene open 25211-26368 dnaN
3407 LXHH01000029.1 GCA001656255_01710 gene open 26405-27808 dnaA
3408 LXHH01000029.1 GCA001656255_01711 gene open 28411-28545 rpmH
3409 LXHH01000029.1 GCA001656255_01712 gene open 28657-28875
3410 LXHH01000029.1 GCA001656255_01713 gene open 29087-29407 yidD
3411 LXHH01000029.1 GCA001656255_01714 gene open 29576-31219 yidC
3412 LXHH01000029.1 GCA001656255_01715 gene open 31385-32785 mnmE
3413 LXHH01000029.1 GCA001656255_01716 gene open 32888-33358 nrdR
3414 LXHH01000029.1 GCA001656255_01717 gene open 33355-34407 ribD
3415 LXHH01000029.1 GCA001656255_01718 gene open 34690-35358 ribC
3416 LXHH01000029.1 GCA001656255_01719 gene open 35489-36514 fmt
3417 LXHH01000029.1 GCA001656255_01720 gene open 36504-37850 rsmB
3418 LXHH01000029.1 GCA001656255_01721 gene open 38169-39584 thrC
3419 LXHH01000029.1 GCA001656255_01722 gene open 39621-40832 dprA
3420 LXHH01000029.1 GCA001656255_01723 gene open 40819-41433 tsaC
3421 LXHH01000029.1 GCA001656255_01724 gene open 41502-41762 yeaQ
3422 LXHH01000029.1 GCA001656255_01725 gene open 41929-43023 ribBA
3423 LXHH01000029.1 GCA001656255_01726 gene open 43138-44376 rarA
3424 LXHH01000029.1 GCA001656255_01727 gene open 44532-44963
3425 LXHH01000029.1 GCA001656255_01728 gene open 45048-45656 rsmC
3426 LXHH01000029.1 GCA001656255_01729 gene open 45889-47670 aF0785
3427 LXHH01000029.1 GCA001656255_01730 gene open 47697-47930
3428 LXHH01000029.1 GCA001656255_01731 gene open 48298-48573
3429 LXHH01000029.1 GCA001656255_01732 gene open 48619-49551 rocF
3430 LXHH01000029.1 GCA001656255_01733 gene open 49592-50845 rocD
3431 LXHH01000029.1 GCA001656255_01734 gene open 51043-51504
3432 LXHH01000029.1 GCA001656255_01735 gene open 51775-52575 czcD
3433 LXHH01000029.1 GCA001656255_01736 gene open 52743-53984
3434 LXHH01000029.1 GCA001656255_01737 gene open 54053-54766
3435 LXHH01000029.1 GCA001656255_01738 gene open 55037-56272 anmK
3436 LXHH01000029.1 GCA001656255_01739 gene open 56434-57645 tyrS
3437 LXHH01000029.1 GCA001656255_01740 gene open 57647-57925
3438 LXHH01000029.1 GCA001656255_01741 gene open 58016-58678 yitT
3439 LXHH01000029.1 GCA001656255_01742 gene open 58664-59368 znuB
3440 LXHH01000029.1 GCA001656255_01743 gene open 59510-60367 znuB
3441 LXHH01000029.1 GCA001656255_01744 gene open 60364-61272 znuC
3442 LXHH01000029.1 GCA001656255_01745 gene open 61272-62198 znuA
3443 LXHH01000029.1 GCA001656255_01746 gene open 62739-62918
3444 LXHH01000029.1 GCA001656255_01747 gene open 62915-63214
3445 LXHH01000030.1 repeat_region open 32445-35009 CRISPR array with 43 repeats of length 28%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAA and spacer length 32
3446 LXHH01000030.1 GCA001656255_00492 CDS open 38-631 _na     197_aa yIH1 YigZ family protein
3447 LXHH01000030.1 GCA001656255_00493 CDS open 800-1504 _na     234_aa rsuA Pseudouridine synthase
3448 LXHH01000030.1 GCA001656255_00494 CDS open 1518-2519 _na     333_aa dsbG Thiol:disulfide interchange protein
3449 LXHH01000030.1 GCA001656255_00495 CDS open 2780-3931 _na     383_aa dnaJ molecular chaperone DnaJ
3450 LXHH01000030.1 GCA001656255_00496 CDS open 4093-5040 _na     315_aa yfeH Sodium-dependent transporter
3451 LXHH01000030.1 GCA001656255_00497 CDS open 5058-6251 _na     397_aa metC Cystathionine beta-lyase
3452 LXHH01000030.1 GCA001656255_00498 CDS open 6296-7093 _na     265_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3453 LXHH01000030.1 GCA001656255_00499 CDS open 7389-8369 _na     326_aa yheT Hydrolase%2C alpha/beta fold family functionally coupled to Phosphoribulokinase
3454 LXHH01000030.1 GCA001656255_00500 CDS open 8454-9293 _na     279_aa dnaJ DnaJ-class molecular chaperone CbpA
3455 LXHH01000030.1 GCA001656255_00501 CDS open 9300-11249 _na     649_aa abc-f ribosomal protection-like ABC-F family protein
3456 LXHH01000030.1 GCA001656255_00502 CDS open 11468-12013 _na     181_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
3457 LXHH01000030.1 GCA001656255_00503 CDS open 12268-13440 _na     390_aa caiA Butyryl-CoA dehydrogenase
3458 LXHH01000030.1 GCA001656255_00504 CDS open 13437-14825 _na     462_aa norV Rubredoxin-NAD+ reductase
3459 LXHH01000030.1 GCA001656255_00505 CDS open 14908-16323 _na     471_aa tauA Cyanate ABC transporter%2C substrate binding protein
3460 LXHH01000030.1 GCA001656255_00506 CDS open 16313-17197 _na     294_aa ntrB nitrate ABC transporter permease
3461 LXHH01000030.1 GCA001656255_00507 CDS open 17187-18047 _na     286_aa tauB Cyanate ABC transporter%2C ATP-binding protein
3462 LXHH01000030.1 GCA001656255_00508 CDS open 18194-18526 _na     110_aa erpA iron-sulfur cluster insertion protein ErpA
3463 LXHH01000030.1 GCA001656255_00509 CDS open 18675-20225 _na     516_aa gshA glutamate--cysteine ligase
3464 LXHH01000030.1 GCA001656255_00510 CDS open 20321-20830 _na     169_aa dsbB Disulfide bond formation protein B
3465 LXHH01000030.1 GCA001656255_00511 CDS open 20921-22303 _na     460_aa mpl UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase
3466 LXHH01000030.1 GCA001656255_00512 CDS open 22649-23125 _na     158_aa Putative thioesterase
3467 LXHH01000030.1 GCA001656255_00513 CDS open 23197-23487 _na     96_aa yggX oxidative damage protection protein
3468 LXHH01000030.1 GCA001656255_00514 CDS open 23665-24255 _na     196_aa cas6f type I-F CRISPR-associated endoribonuclease Cas6/Csy4
3469 LXHH01000030.1 GCA001656255_00515 CDS open 24252-25259 _na     335_aa csy3 type I-F CRISPR-associated protein Csy3
3470 LXHH01000030.1 GCA001656255_00516 CDS open 25289-26224 _na     311_aa csy2 type I-F CRISPR-associated protein Csy2
3471 LXHH01000030.1 GCA001656255_00517 CDS open 26221-27594 _na     457_aa csy1 type I-F CRISPR-associated protein Csy1
3472 LXHH01000030.1 GCA001656255_00518 CDS open 27770-31183 _na     1137_aa cas3f type I-F CRISPR-associated helicase Cas3f
3473 LXHH01000030.1 GCA001656255_00519 CDS open 31185-32135 _na     316_aa cas1f type I-F CRISPR-associated endonuclease Cas1f
3474 LXHH01000030.1 GCA001656255_00492 gene open 38-631 yIH1
3475 LXHH01000030.1 GCA001656255_00493 gene open 800-1504 rsuA
3476 LXHH01000030.1 GCA001656255_00494 gene open 1518-2519 dsbG
3477 LXHH01000030.1 GCA001656255_00495 gene open 2780-3931 dnaJ
3478 LXHH01000030.1 GCA001656255_00496 gene open 4093-5040 yfeH
3479 LXHH01000030.1 GCA001656255_00497 gene open 5058-6251 metC
3480 LXHH01000030.1 GCA001656255_00498 gene open 6296-7093 dapB
3481 LXHH01000030.1 GCA001656255_00499 gene open 7389-8369 yheT
3482 LXHH01000030.1 GCA001656255_00500 gene open 8454-9293 dnaJ
3483 LXHH01000030.1 GCA001656255_00501 gene open 9300-11249 abc-f
3484 LXHH01000030.1 GCA001656255_00502 gene open 11468-12013 yciW
3485 LXHH01000030.1 GCA001656255_00503 gene open 12268-13440 caiA
3486 LXHH01000030.1 GCA001656255_00504 gene open 13437-14825 norV
3487 LXHH01000030.1 GCA001656255_00505 gene open 14908-16323 tauA
3488 LXHH01000030.1 GCA001656255_00506 gene open 16313-17197 ntrB
3489 LXHH01000030.1 GCA001656255_00507 gene open 17187-18047 tauB
3490 LXHH01000030.1 GCA001656255_00508 gene open 18194-18526 erpA
3491 LXHH01000030.1 GCA001656255_00509 gene open 18675-20225 gshA
3492 LXHH01000030.1 GCA001656255_00510 gene open 20321-20830 dsbB
3493 LXHH01000030.1 GCA001656255_00511 gene open 20921-22303 mpl
3494 LXHH01000030.1 GCA001656255_00512 gene open 22649-23125
3495 LXHH01000030.1 GCA001656255_00513 gene open 23197-23487 yggX
3496 LXHH01000030.1 GCA001656255_00514 gene open 23665-24255 cas6f
3497 LXHH01000030.1 GCA001656255_00515 gene open 24252-25259 csy3
3498 LXHH01000030.1 GCA001656255_00516 gene open 25289-26224 csy2
3499 LXHH01000030.1 GCA001656255_00517 gene open 26221-27594 csy1
3500 LXHH01000030.1 GCA001656255_00518 gene open 27770-31183 cas3f