BAKTAGenome Explorer: Actinomyces oris clade-079 (GCA_001929375.1)
Select a Genome:
|
BAKTA Annotations for GCA_001929375.1
|
Search & Sort all 5285 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | MSGO01000033.1 | GCA001929375_01508 | CDS | open | 15737-15970 | _na 77_aa | Antitoxin | |
| 3002 | MSGO01000033.1 | GCA001929375_01509 | CDS | open | 15974-16288 | _na 104_aa | mazF3 | mRNA interferase MazF3 |
| 3003 | MSGO01000033.1 | GCA001929375_01510 | CDS | open | 16323-17444 | _na 373_aa | Peptidase M50 | |
| 3004 | MSGO01000033.1 | GCA001929375_01511 | CDS | open | 17745-18530 | _na 261_aa | recB | Recombinase RecB |
| 3005 | MSGO01000033.1 | GCA001929375_01512 | CDS | open | 18920-19078 | _na 52_aa | putative transporter component | |
| 3006 | MSGO01000033.1 | GCA001929375_01513 | CDS | open | 19226-19381 | _na 51_aa | tusA | UPF0033 domain-containing protein |
| 3007 | MSGO01000033.1 | GCA001929375_01514 | CDS | open | 19405-20385 | _na 326_aa | pdxI | NADP-dependent oxidoreductase domain-containing protein |
| 3008 | MSGO01000033.1 | GCA001929375_01515 | CDS | open | 20465-20794 | _na 109_aa | DNA primase | |
| 3009 | MSGO01000033.1 | GCA001929375_01516 | CDS | open | 20867-21967 | _na 366_aa | ndh | Mercuric reductase |
| 3010 | MSGO01000033.1 | GCA001929375_01517 | CDS | open | 22016-24067 | _na 683_aa | Peptidase M3A/M3B catalytic domain-containing protein | |
| 3011 | MSGO01000033.1 | GCA001929375_01518 | CDS | open | 24126-24695 | _na 189_aa | tetR | TetR family transcriptional regulator |
| 3012 | MSGO01000033.1 | GCA001929375_01519 | CDS | open | 24692-25663 | _na 323_aa | MFS transporter | |
| 3013 | MSGO01000033.1 | GCA001929375_01520 | CDS | open | 25776-26903 | _na 375_aa | Phosphoribosyl-ATP diphosphatase | |
| 3014 | MSGO01000033.1 | GCA001929375_01521 | CDS | open | 27095-28387 | _na 430_aa | DUF2868 domain-containing protein | |
| 3015 | MSGO01000033.1 | GCA001929375_01522 | CDS | open | 29093-29407 | _na 104_aa | DUF202 domain-containing protein | |
| 3016 | MSGO01000033.1 | GCA001929375_01490 | gene | open | 17-625 | amiR | ||
| 3017 | MSGO01000033.1 | GCA001929375_01492 | gene | open | 875-1213 | cdd | ||
| 3018 | MSGO01000033.1 | GCA001929375_01493 | gene | open | 1289-2719 | pyk | ||
| 3019 | MSGO01000033.1 | GCA001929375_01494 | gene | open | 2843-3868 | lgt | ||
| 3020 | MSGO01000033.1 | GCA001929375_01495 | gene | open | 3869-4693 | trpC | ||
| 3021 | MSGO01000033.1 | GCA001929375_01496 | gene | open | 4809-5186 | hisI | ||
| 3022 | MSGO01000033.1 | GCA001929375_01497 | gene | open | 5199-5435 | |||
| 3023 | MSGO01000033.1 | GCA001929375_01498 | gene | open | 5687-6088 | |||
| 3024 | MSGO01000033.1 | GCA001929375_01499 | gene | open | 6467-6802 | |||
| 3025 | MSGO01000033.1 | GCA001929375_01500 | gene | open | 7091-7189 | |||
| 3026 | MSGO01000033.1 | GCA001929375_01501 | gene | open | 7155-7925 | hisF | ||
| 3027 | MSGO01000033.1 | GCA001929375_01502 | gene | open | 7922-8950 | |||
| 3028 | MSGO01000033.1 | GCA001929375_01503 | gene | open | 9481-10920 | pafA | ||
| 3029 | MSGO01000033.1 | GCA001929375_01504 | gene | open | 10923-11138 | |||
| 3030 | MSGO01000033.1 | GCA001929375_01505 | gene | open | 11150-12871 | dop | ||
| 3031 | MSGO01000033.1 | GCA001929375_01506 | gene | open | 12868-14562 | arc | ||
| 3032 | MSGO01000033.1 | GCA001929375_01507 | gene | open | 14555-15646 | |||
| 3033 | MSGO01000033.1 | GCA001929375_01508 | gene | open | 15737-15970 | |||
| 3034 | MSGO01000033.1 | GCA001929375_01509 | gene | open | 15974-16288 | mazF3 | ||
| 3035 | MSGO01000033.1 | GCA001929375_01510 | gene | open | 16323-17444 | |||
| 3036 | MSGO01000033.1 | GCA001929375_01511 | gene | open | 17745-18530 | recB | ||
| 3037 | MSGO01000033.1 | GCA001929375_01512 | gene | open | 18920-19078 | |||
| 3038 | MSGO01000033.1 | GCA001929375_01513 | gene | open | 19226-19381 | tusA | ||
| 3039 | MSGO01000033.1 | GCA001929375_01514 | gene | open | 19405-20385 | pdxI | ||
| 3040 | MSGO01000033.1 | GCA001929375_01515 | gene | open | 20465-20794 | |||
| 3041 | MSGO01000033.1 | GCA001929375_01516 | gene | open | 20867-21967 | ndh | ||
| 3042 | MSGO01000033.1 | GCA001929375_01517 | gene | open | 22016-24067 | |||
| 3043 | MSGO01000033.1 | GCA001929375_01518 | gene | open | 24126-24695 | tetR | ||
| 3044 | MSGO01000033.1 | GCA001929375_01519 | gene | open | 24692-25663 | |||
| 3045 | MSGO01000033.1 | GCA001929375_01520 | gene | open | 25776-26903 | |||
| 3046 | MSGO01000033.1 | GCA001929375_01521 | gene | open | 27095-28387 | |||
| 3047 | MSGO01000033.1 | GCA001929375_01522 | gene | open | 29093-29407 | |||
| 3048 | MSGO01000033.1 | GCA001929375_01491 | gene | open | 679-755 | trnL | ||
| 3049 | MSGO01000033.1 | GCA001929375_01491 | tRNA | open | 679-755 | trnL | tRNA-Leu(caa) | |
| 3050 | MSGO01000034.1 | repeat_region | open | 11251-12320 | CRISPR array with 12 repeats of length 36%2C consensus sequence GCTGGGAATCAGTCACCAGACCCCTTGATAGACTTC and spacer length 57 | |||
| 3051 | MSGO01000034.1 | repeat_region | open | 11955-12320 | CRISPR array with 6 repeats of length 36%2C consensus sequence GCTGGGAATCAGTCACCAGACCCCTTGATAGACTTC and spacer length 28 | |||
| 3052 | MSGO01000034.1 | GCA001929375_01523 | CDS | open | 36-320 | _na 94_aa | Transposase | |
| 3053 | MSGO01000034.1 | GCA001929375_01524 | CDS | open | 596-937 | _na 113_aa | hypothetical protein | |
| 3054 | MSGO01000034.1 | GCA001929375_01525 | CDS | open | 934-1275 | _na 113_aa | Gamma-glutamyltransferase | |
| 3055 | MSGO01000034.1 | GCA001929375_01526 | CDS | open | 1468-1818 | _na 116_aa | hypothetical protein | |
| 3056 | MSGO01000034.1 | GCA001929375_01527 | CDS | open | 2074-3489 | _na 471_aa | LssY-like C-terminal domain-containing protein | |
| 3057 | MSGO01000034.1 | GCA001929375_01528 | CDS | open | 3486-4343 | _na 285_aa | Suppressor of fused protein (SUFU) | |
| 3058 | MSGO01000034.1 | GCA001929375_01529 | CDS | open | 4559-5545 | _na 328_aa | purR | HTH lacI-type domain-containing protein |
| 3059 | MSGO01000034.1 | GCA001929375_01530 | CDS | open | 5796-8972 | _na 1058_aa | lacZ | Beta-galactosidase |
| 3060 | MSGO01000034.1 | GCA001929375_01531 | CDS | open | 8969-10534 | _na 521_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3061 | MSGO01000034.1 | GCA001929375_01532 | CDS | open | 10719-11012 | _na 97_aa | hypothetical protein | |
| 3062 | MSGO01000034.1 | GCA001929375_01533 | CDS | open | 12360-12680 | _na 106_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3063 | MSGO01000034.1 | GCA001929375_01534 | CDS | open | 12680-13453 | _na 257_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 3064 | MSGO01000034.1 | GCA001929375_01535 | CDS | open | 13438-13587 | _na 49_aa | hypothetical protein | |
| 3065 | MSGO01000034.1 | GCA001929375_01536 | CDS | open | 13597-16884 | _na 1095_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 3066 | MSGO01000034.1 | GCA001929375_01537 | CDS | open | 17346-18740 | _na 464_aa | Peptidase M20 domain-containing protein 2 | |
| 3067 | MSGO01000034.1 | GCA001929375_01538 | CDS | open | 18884-20095 | _na 403_aa | DAGKc domain-containing protein | |
| 3068 | MSGO01000034.1 | GCA001929375_01539 | CDS | open | 20207-21139 | _na 310_aa | lysR | putative hydrogen peroxide-inducible genes activator |
| 3069 | MSGO01000034.1 | GCA001929375_01540 | CDS | open | 21688-22968 | _na 426_aa | serS | serine--tRNA ligase |
| 3070 | MSGO01000034.1 | GCA001929375_01541 | CDS | open | 22920-23408 | _na 162_aa | hypothetical protein | |
| 3071 | MSGO01000034.1 | GCA001929375_01523 | gene | open | 36-320 | |||
| 3072 | MSGO01000034.1 | GCA001929375_01524 | gene | open | 596-937 | |||
| 3073 | MSGO01000034.1 | GCA001929375_01525 | gene | open | 934-1275 | |||
| 3074 | MSGO01000034.1 | GCA001929375_01526 | gene | open | 1468-1818 | |||
| 3075 | MSGO01000034.1 | GCA001929375_01527 | gene | open | 2074-3489 | |||
| 3076 | MSGO01000034.1 | GCA001929375_01528 | gene | open | 3486-4343 | |||
| 3077 | MSGO01000034.1 | GCA001929375_01529 | gene | open | 4559-5545 | purR | ||
| 3078 | MSGO01000034.1 | GCA001929375_01530 | gene | open | 5796-8972 | lacZ | ||
| 3079 | MSGO01000034.1 | GCA001929375_01531 | gene | open | 8969-10534 | |||
| 3080 | MSGO01000034.1 | GCA001929375_01532 | gene | open | 10719-11012 | |||
| 3081 | MSGO01000034.1 | GCA001929375_01533 | gene | open | 12360-12680 | cas2 | ||
| 3082 | MSGO01000034.1 | GCA001929375_01534 | gene | open | 12680-13453 | cas1 | ||
| 3083 | MSGO01000034.1 | GCA001929375_01535 | gene | open | 13438-13587 | |||
| 3084 | MSGO01000034.1 | GCA001929375_01536 | gene | open | 13597-16884 | cas9 | ||
| 3085 | MSGO01000034.1 | GCA001929375_01537 | gene | open | 17346-18740 | |||
| 3086 | MSGO01000034.1 | GCA001929375_01538 | gene | open | 18884-20095 | |||
| 3087 | MSGO01000034.1 | GCA001929375_01539 | gene | open | 20207-21139 | lysR | ||
| 3088 | MSGO01000034.1 | GCA001929375_01540 | gene | open | 21688-22968 | serS | ||
| 3089 | MSGO01000034.1 | GCA001929375_01541 | gene | open | 22920-23408 | |||
| 3090 | MSGO01000035.1 | GCA001929375_01542 | CDS | open | 19-387 | _na 122_aa | Zinc transporter | |
| 3091 | MSGO01000035.1 | GCA001929375_01543 | CDS | open | 442-1002 | _na 186_aa | hypothetical protein | |
| 3092 | MSGO01000035.1 | GCA001929375_01544 | CDS | open | 1302-2414 | _na 370_aa | Haloacid dehalogenase-like hydrolase | |
| 3093 | MSGO01000035.1 | GCA001929375_01545 | CDS | open | 2408-2809 | _na 133_aa | yjhB | Nudix hydrolase domain-containing protein |
| 3094 | MSGO01000035.1 | GCA001929375_01546 | CDS | open | 2820-3710 | _na 296_aa | rhaT | EamA domain-containing protein |
| 3095 | MSGO01000035.1 | GCA001929375_01547 | CDS | open | 4991-5659 | _na 222_aa | Mutator family transposase | |
| 3096 | MSGO01000035.1 | GCA001929375_01548 | CDS | open | 5942-6100 | _na 52_aa | hypothetical protein | |
| 3097 | MSGO01000035.1 | GCA001929375_01549 | CDS | open | 6205-6411 | _na 68_aa | Transposase | |
| 3098 | MSGO01000035.1 | GCA001929375_01550 | CDS | open | 6875-8182 | _na 435_aa | moeB | Molybdenum cofactor biosynthesis protein MoeB |
| 3099 | MSGO01000035.1 | GCA001929375_01551 | CDS | open | 8238-10379 | _na 713_aa | modB | molybdate ABC transporter permease subunit |
| 3100 | MSGO01000035.1 | GCA001929375_01552 | CDS | open | 10431-11393 | _na 320_aa | modA | molybdate ABC transporter substrate-binding protein |
| 3101 | MSGO01000035.1 | GCA001929375_01553 | CDS | open | 11428-12216 | _na 262_aa | narI | respiratory nitrate reductase subunit gamma |
| 3102 | MSGO01000035.1 | GCA001929375_01554 | CDS | open | 12213-12428 | _na 71_aa | hypothetical protein | |
| 3103 | MSGO01000035.1 | GCA001929375_01555 | CDS | open | 12425-12979 | _na 184_aa | narJ | nitrate reductase molybdenum cofactor assembly chaperone |
| 3104 | MSGO01000035.1 | GCA001929375_01556 | CDS | open | 12981-14678 | _na 565_aa | narH | nitrate reductase subunit beta |
| 3105 | MSGO01000035.1 | GCA001929375_01557 | CDS | open | 14678-18454 | _na 1258_aa | narG | nitrate reductase subunit alpha |
| 3106 | MSGO01000035.1 | GCA001929375_01558 | CDS | open | 18661-19989 | _na 442_aa | narK | Major facilitator superfamily (MFS) profile domain-containing protein |
| 3107 | MSGO01000035.1 | GCA001929375_01559 | CDS | open | 20288-20845 | _na 185_aa | moaB | MoaB/Mog domain-containing protein |
| 3108 | MSGO01000035.1 | GCA001929375_01560 | CDS | open | 20889-21563 | _na 224_aa | mobA | Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
| 3109 | MSGO01000035.1 | GCA001929375_01561 | CDS | open | 21541-22044 | _na 167_aa | moaC | cyclic pyranopterin monophosphate synthase MoaC |
| 3110 | MSGO01000035.1 | GCA001929375_01562 | CDS | open | 22134-23468 | _na 444_aa | glp | gephyrin-like molybdotransferase Glp |
| 3111 | MSGO01000035.1 | GCA001929375_01563 | CDS | open | 23651-24118 | _na 155_aa | Molybdopterin converting factor%2C subunit 2 | |
| 3112 | MSGO01000035.1 | GCA001929375_01564 | CDS | open | 24215-24523 | _na 102_aa | Molybdopterin synthase sulfur carrier subunit | |
| 3113 | MSGO01000035.1 | GCA001929375_01565 | CDS | open | 24548-25666 | _na 372_aa | moaA | GTP 3'%2C8-cyclase MoaA |
| 3114 | MSGO01000035.1 | GCA001929375_01566 | CDS | open | 25869-26165 | _na 98_aa | DUF2249 domain-containing protein | |
| 3115 | MSGO01000035.1 | GCA001929375_01567 | CDS | open | 26394-27575 | _na 393_aa | nnrS | NnrS protein |
| 3116 | MSGO01000035.1 | GCA001929375_01568 | CDS | open | 27572-28960 | _na 462_aa | Copper oxidase | |
| 3117 | MSGO01000035.1 | GCA001929375_01569 | CDS | open | 28957-30606 | _na 549_aa | Copper-containing nitrite reductase | |
| 3118 | MSGO01000035.1 | GCA001929375_01570 | CDS | open | 30746-31477 | _na 243_aa | HTH arsR-type domain-containing protein | |
| 3119 | MSGO01000035.1 | GCA001929375_01571 | CDS | open | 31737-32855 | _na 372_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 3120 | MSGO01000035.1 | GCA001929375_01572 | CDS | open | 32855-34321 | _na 488_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 3121 | MSGO01000035.1 | GCA001929375_01573 | CDS | open | 34318-36594 | _na 758_aa | icdM | NADP-dependent isocitrate dehydrogenase |
| 3122 | MSGO01000035.1 | GCA001929375_01574 | CDS | open | 36817-37317 | _na 166_aa | doxX | DoxX family protein |
| 3123 | MSGO01000035.1 | GCA001929375_01575 | CDS | open | 37587-38330 | _na 247_aa | rpoE | RNA polymerase sigma factor |
| 3124 | MSGO01000035.1 | GCA001929375_01576 | CDS | open | 38327-38764 | _na 145_aa | rsrA | mycothiol system anti-sigma-R factor |
| 3125 | MSGO01000035.1 | GCA001929375_01577 | CDS | open | 39295-40029 | _na 244_aa | yczE | Integral membrane protein |
| 3126 | MSGO01000035.1 | GCA001929375_01578 | CDS | open | 40048-40641 | _na 197_aa | tesA | SGNH hydrolase-type esterase domain-containing protein |
| 3127 | MSGO01000035.1 | GCA001929375_01579 | CDS | open | 40774-44613 | _na 1279_aa | sucA | multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit |
| 3128 | MSGO01000035.1 | GCA001929375_01580 | CDS | open | 44978-46321 | _na 447_aa | mpfA | HlyC/CorC family transporter |
| 3129 | MSGO01000035.1 | GCA001929375_01581 | CDS | open | 46318-47397 | _na 359_aa | mpfA | CNNM transmembrane domain-containing protein |
| 3130 | MSGO01000035.1 | GCA001929375_01582 | CDS | open | 47651-49864 | _na 737_aa | Peptidase M23 | |
| 3131 | MSGO01000035.1 | GCA001929375_01583 | CDS | open | 49877-50632 | _na 251_aa | ugpQ | GP-PDE domain-containing protein |
| 3132 | MSGO01000035.1 | GCA001929375_01584 | CDS | open | 50711-50983 | _na 90_aa | Toxin-antitoxin system%2C toxin component | |
| 3133 | MSGO01000035.1 | GCA001929375_01585 | CDS | open | 51003-51353 | _na 116_aa | Gamma-glutamyltransferase | |
| 3134 | MSGO01000035.1 | GCA001929375_01587 | CDS | open | 51584-53341 | _na 585_aa | argS | arginine--tRNA ligase |
| 3135 | MSGO01000035.1 | GCA001929375_01588 | CDS | open | 53348-54808 | _na 486_aa | lysA | diaminopimelate decarboxylase |
| 3136 | MSGO01000035.1 | GCA001929375_01589 | CDS | open | 54830-56110 | _na 426_aa | Orc1-like AAA ATPase domain-containing protein | |
| 3137 | MSGO01000035.1 | GCA001929375_01542 | gene | open | 19-387 | |||
| 3138 | MSGO01000035.1 | GCA001929375_01543 | gene | open | 442-1002 | |||
| 3139 | MSGO01000035.1 | GCA001929375_01544 | gene | open | 1302-2414 | |||
| 3140 | MSGO01000035.1 | GCA001929375_01545 | gene | open | 2408-2809 | yjhB | ||
| 3141 | MSGO01000035.1 | GCA001929375_01546 | gene | open | 2820-3710 | rhaT | ||
| 3142 | MSGO01000035.1 | GCA001929375_01547 | gene | open | 4991-5659 | |||
| 3143 | MSGO01000035.1 | GCA001929375_01548 | gene | open | 5942-6100 | |||
| 3144 | MSGO01000035.1 | GCA001929375_01549 | gene | open | 6205-6411 | |||
| 3145 | MSGO01000035.1 | GCA001929375_01550 | gene | open | 6875-8182 | moeB | ||
| 3146 | MSGO01000035.1 | GCA001929375_01551 | gene | open | 8238-10379 | modB | ||
| 3147 | MSGO01000035.1 | GCA001929375_01552 | gene | open | 10431-11393 | modA | ||
| 3148 | MSGO01000035.1 | GCA001929375_01553 | gene | open | 11428-12216 | narI | ||
| 3149 | MSGO01000035.1 | GCA001929375_01554 | gene | open | 12213-12428 | |||
| 3150 | MSGO01000035.1 | GCA001929375_01555 | gene | open | 12425-12979 | narJ | ||
| 3151 | MSGO01000035.1 | GCA001929375_01556 | gene | open | 12981-14678 | narH | ||
| 3152 | MSGO01000035.1 | GCA001929375_01557 | gene | open | 14678-18454 | narG | ||
| 3153 | MSGO01000035.1 | GCA001929375_01558 | gene | open | 18661-19989 | narK | ||
| 3154 | MSGO01000035.1 | GCA001929375_01559 | gene | open | 20288-20845 | moaB | ||
| 3155 | MSGO01000035.1 | GCA001929375_01560 | gene | open | 20889-21563 | mobA | ||
| 3156 | MSGO01000035.1 | GCA001929375_01561 | gene | open | 21541-22044 | moaC | ||
| 3157 | MSGO01000035.1 | GCA001929375_01562 | gene | open | 22134-23468 | glp | ||
| 3158 | MSGO01000035.1 | GCA001929375_01563 | gene | open | 23651-24118 | |||
| 3159 | MSGO01000035.1 | GCA001929375_01564 | gene | open | 24215-24523 | |||
| 3160 | MSGO01000035.1 | GCA001929375_01565 | gene | open | 24548-25666 | moaA | ||
| 3161 | MSGO01000035.1 | GCA001929375_01566 | gene | open | 25869-26165 | |||
| 3162 | MSGO01000035.1 | GCA001929375_01567 | gene | open | 26394-27575 | nnrS | ||
| 3163 | MSGO01000035.1 | GCA001929375_01568 | gene | open | 27572-28960 | |||
| 3164 | MSGO01000035.1 | GCA001929375_01569 | gene | open | 28957-30606 | |||
| 3165 | MSGO01000035.1 | GCA001929375_01570 | gene | open | 30746-31477 | |||
| 3166 | MSGO01000035.1 | GCA001929375_01571 | gene | open | 31737-32855 | rsgA | ||
| 3167 | MSGO01000035.1 | GCA001929375_01572 | gene | open | 32855-34321 | aroA | ||
| 3168 | MSGO01000035.1 | GCA001929375_01573 | gene | open | 34318-36594 | icdM | ||
| 3169 | MSGO01000035.1 | GCA001929375_01574 | gene | open | 36817-37317 | doxX | ||
| 3170 | MSGO01000035.1 | GCA001929375_01575 | gene | open | 37587-38330 | rpoE | ||
| 3171 | MSGO01000035.1 | GCA001929375_01576 | gene | open | 38327-38764 | rsrA | ||
| 3172 | MSGO01000035.1 | GCA001929375_01577 | gene | open | 39295-40029 | yczE | ||
| 3173 | MSGO01000035.1 | GCA001929375_01578 | gene | open | 40048-40641 | tesA | ||
| 3174 | MSGO01000035.1 | GCA001929375_01579 | gene | open | 40774-44613 | sucA | ||
| 3175 | MSGO01000035.1 | GCA001929375_01580 | gene | open | 44978-46321 | mpfA | ||
| 3176 | MSGO01000035.1 | GCA001929375_01581 | gene | open | 46318-47397 | mpfA | ||
| 3177 | MSGO01000035.1 | GCA001929375_01582 | gene | open | 47651-49864 | |||
| 3178 | MSGO01000035.1 | GCA001929375_01583 | gene | open | 49877-50632 | ugpQ | ||
| 3179 | MSGO01000035.1 | GCA001929375_01584 | gene | open | 50711-50983 | |||
| 3180 | MSGO01000035.1 | GCA001929375_01585 | gene | open | 51003-51353 | |||
| 3181 | MSGO01000035.1 | GCA001929375_01587 | gene | open | 51584-53341 | argS | ||
| 3182 | MSGO01000035.1 | GCA001929375_01588 | gene | open | 53348-54808 | lysA | ||
| 3183 | MSGO01000035.1 | GCA001929375_01589 | gene | open | 54830-56110 | |||
| 3184 | MSGO01000035.1 | GCA001929375_01586 | gene | open | 51449-51524 | trnR | ||
| 3185 | MSGO01000035.1 | GCA001929375_01586 | tRNA | open | 51449-51524 | trnR | tRNA-Arg(ccg) | |
| 3186 | MSGO01000036.1 | GCA001929375_01612 | gene | open | 25017-25111 | Bacteria_small_SRP | ||
| 3187 | MSGO01000036.1 | GCA001929375_01727 | gene | open | 156786-156896 | Actinomyces-1 | ||
| 3188 | MSGO01000036.1 | GCA001929375_01731 | gene | open | 159359-159468 | Actinomyces-1 | ||
| 3189 | MSGO01000036.1 | GCA001929375_01612 | ncRNA | open | 25017-25111 | Bacterial small signal recognition particle RNA | ||
| 3190 | MSGO01000036.1 | GCA001929375_01727 | ncRNA | open | 156786-156896 | Actinomyces-1 RNA | ||
| 3191 | MSGO01000036.1 | GCA001929375_01731 | ncRNA | open | 159359-159468 | Actinomyces-1 RNA | ||
| 3192 | MSGO01000036.1 | GCA001929375_01590 | CDS | open | 639-884 | _na 81_aa | hypothetical protein | |
| 3193 | MSGO01000036.1 | GCA001929375_01591 | CDS | open | 1256-1561 | _na 101_aa | ESX-1 secretion-associated protein | |
| 3194 | MSGO01000036.1 | GCA001929375_01592 | CDS | open | 1670-2128 | _na 152_aa | YbaB/EbfC family nucleoid-associated protein | |
| 3195 | MSGO01000036.1 | GCA001929375_01593 | CDS | open | 2338-3822 | _na 494_aa | Peptidase S8/S53 domain-containing protein | |
| 3196 | MSGO01000036.1 | GCA001929375_01594 | CDS | open | 3819-5144 | _na 441_aa | eccB | type VII secretion protein EccB |
| 3197 | MSGO01000036.1 | GCA001929375_01595 | CDS | open | 5144-6442 | _na 432_aa | eccD | Type VII secretion integral membrane protein EccD |
| 3198 | MSGO01000036.1 | GCA001929375_01596 | CDS | open | 6791-7123 | _na 110_aa | ESAT-6-like protein | |
| 3199 | MSGO01000036.1 | GCA001929375_01597 | CDS | open | 7170-7460 | _na 96_aa | ESAT-6-like protein | |
| 3200 | MSGO01000036.1 | GCA001929375_01598 | CDS | open | 7559-8902 | _na 447_aa | RDD domain-containing protein | |
| 3201 | MSGO01000036.1 | GCA001929375_01599 | CDS | open | 8899-10257 | _na 452_aa | eccD | Type VII secretion integral membrane protein EccD |
| 3202 | MSGO01000036.1 | GCA001929375_01600 | CDS | open | 10409-14509 | _na 1366_aa | Type VII secretion protein EccCa | |
| 3203 | MSGO01000036.1 | GCA001929375_01601 | CDS | open | 14703-16118 | _na 471_aa | Annexin A7 | |
| 3204 | MSGO01000036.1 | GCA001929375_01602 | CDS | open | 16210-16932 | _na 240_aa | guaA1 | Glutamine amidotransferase domain-containing protein |
| 3205 | MSGO01000036.1 | GCA001929375_01603 | CDS | open | 16994-17377 | _na 127_aa | DUF4190 domain-containing protein | |
| 3206 | MSGO01000036.1 | GCA001929375_01604 | CDS | open | 17608-19041 | _na 477_aa | Nitrate reductase | |
| 3207 | MSGO01000036.1 | GCA001929375_01605 | CDS | open | 19704-20279 | _na 191_aa | lytR | LytR family transcriptional regulator |
| 3208 | MSGO01000036.1 | GCA001929375_01606 | CDS | open | 20435-20773 | _na 112_aa | Transcription regulator of the Arc/MetJ class | |
| 3209 | MSGO01000036.1 | GCA001929375_01607 | CDS | open | 21144-22208 | _na 354_aa | Serine/threonine protein kinase | |
| 3210 | MSGO01000036.1 | GCA001929375_01608 | CDS | open | 22277-22987 | _na 236_aa | tetR | TetR family transcriptional regulator |
| 3211 | MSGO01000036.1 | GCA001929375_01609 | CDS | open | 23206-23883 | _na 225_aa | Septum formation-related domain-containing protein | |
| 3212 | MSGO01000036.1 | GCA001929375_01610 | CDS | open | 23928-24539 | _na 203_aa | Septum formation-related domain-containing protein | |
| 3213 | MSGO01000036.1 | GCA001929375_01613 | CDS | open | 25129-25239 | _na 36_aa | hypothetical protein | |
| 3214 | MSGO01000036.1 | GCA001929375_01614 | CDS | open | 25351-29067 | _na 1238_aa | DNA polymerase III subunit gamma and tau | |
| 3215 | MSGO01000036.1 | GCA001929375_01615 | CDS | open | 29069-29677 | _na 202_aa | recR | recombination mediator RecR |
| 3216 | MSGO01000036.1 | GCA001929375_01616 | CDS | open | 29769-30860 | _na 363_aa | ABC transporter permease | |
| 3217 | MSGO01000036.1 | GCA001929375_01617 | CDS | open | 30857-31801 | _na 314_aa | ABC transporter domain-containing protein | |
| 3218 | MSGO01000036.1 | GCA001929375_01618 | CDS | open | 31945-33369 | _na 474_aa | HTH arsR-type domain-containing protein | |
| 3219 | MSGO01000036.1 | GCA001929375_01619 | CDS | open | 33721-35202 | _na 493_aa | metL1 | aspartate kinase |
| 3220 | MSGO01000036.1 | GCA001929375_01620 | CDS | open | 35199-36278 | _na 359_aa | asd | aspartate-semialdehyde dehydrogenase |
| 3221 | MSGO01000036.1 | GCA001929375_01621 | CDS | open | 36442-36714 | _na 90_aa | copG | CopG family transcriptional regulator |
| 3222 | MSGO01000036.1 | GCA001929375_01622 | CDS | open | 36724-37038 | _na 104_aa | relE | Addiction module toxin RelE |
| 3223 | MSGO01000036.1 | GCA001929375_01623 | CDS | open | 37180-37932 | _na 250_aa | Ion transporter | |
| 3224 | MSGO01000036.1 | GCA001929375_01624 | CDS | open | 38031-38939 | _na 302_aa | DUF1648 domain-containing protein | |
| 3225 | MSGO01000036.1 | GCA001929375_01625 | CDS | open | 39116-40306 | _na 396_aa | Fido domain-containing protein | |
| 3226 | MSGO01000036.1 | GCA001929375_01626 | CDS | open | 40726-41712 | _na 328_aa | DUF1648 domain-containing protein | |
| 3227 | MSGO01000036.1 | GCA001929375_01627 | CDS | open | 42152-42532 | _na 126_aa | cnoX | Thioredoxin |
| 3228 | MSGO01000036.1 | GCA001929375_01628 | CDS | open | 42671-43612 | _na 313_aa | Protein-ADP-ribose hydrolase | |
| 3229 | MSGO01000036.1 | GCA001929375_01629 | CDS | open | 43840-45288 | _na 482_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 3230 | MSGO01000036.1 | GCA001929375_01630 | CDS | open | 45776-46825 | _na 349_aa | hemB | porphobilinogen synthase |
| 3231 | MSGO01000036.1 | GCA001929375_01631 | CDS | open | 47109-48362 | _na 417_aa | Uroporphyrinogen-III synthase | |
| 3232 | MSGO01000036.1 | GCA001929375_01632 | CDS | open | 48367-49590 | _na 407_aa | hemC | hydroxymethylbilane synthase |
| 3233 | MSGO01000036.1 | GCA001929375_01633 | CDS | open | 49720-51393 | _na 557_aa | Protoporphyrinogen oxidase | |
| 3234 | MSGO01000036.1 | GCA001929375_01634 | CDS | open | 51390-52775 | _na 461_aa | uroporphyrinogen decarboxylase | |
| 3235 | MSGO01000036.1 | GCA001929375_01635 | CDS | open | 52976-54469 | _na 497_aa | glutamyl-tRNA reductase | |
| 3236 | MSGO01000036.1 | GCA001929375_01636 | CDS | open | 54462-55937 | _na 491_aa | Coproporphyrin III ferrochelatase | |
| 3237 | MSGO01000036.1 | GCA001929375_01637 | CDS | open | 55976-56785 | _na 269_aa | hemQ | hydrogen peroxide-dependent heme synthase |
| 3238 | MSGO01000036.1 | GCA001929375_01638 | CDS | open | 56984-57205 | _na 73_aa | Antitoxin | |
| 3239 | MSGO01000036.1 | GCA001929375_01639 | CDS | open | 57202-57594 | _na 130_aa | pilT | Twitching motility protein PilT |
| 3240 | MSGO01000036.1 | GCA001929375_01640 | CDS | open | 58037-58741 | _na 234_aa | Lipoprotein | |
| 3241 | MSGO01000036.1 | GCA001929375_01641 | CDS | open | 58851-58994 | _na 47_aa | hypothetical protein | |
| 3242 | MSGO01000036.1 | GCA001929375_01642 | CDS | open | 59237-59740 | _na 167_aa | dps | DNA protection during starvation protein 2 |
| 3243 | MSGO01000036.1 | GCA001929375_01643 | CDS | open | 60008-60646 | _na 212_aa | Tat pathway signal sequence domain protein | |
| 3244 | MSGO01000036.1 | GCA001929375_01644 | CDS | open | 60640-61644 | _na 334_aa | Ig-like domain-containing protein | |
| 3245 | MSGO01000036.1 | GCA001929375_01645 | CDS | open | 61839-62141 | _na 100_aa | WXG100 family type VII secretion target | |
| 3246 | MSGO01000036.1 | GCA001929375_01646 | CDS | open | 62469-63179 | _na 236_aa | flgA | Flagellar biosynthesis protein FlgA |
| 3247 | MSGO01000036.1 | GCA001929375_01647 | CDS | open | 63179-63937 | _na 252_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 3248 | MSGO01000036.1 | GCA001929375_01648 | CDS | open | 63934-65250 | _na 438_aa | cpaF | CpaF family protein |
| 3249 | MSGO01000036.1 | GCA001929375_01649 | CDS | open | 65247-66122 | _na 291_aa | Type II secretion system protein | |
| 3250 | MSGO01000036.1 | GCA001929375_01650 | CDS | open | 66119-67042 | _na 307_aa | Type II secretion protein F | |
| 3251 | MSGO01000036.1 | GCA001929375_01651 | CDS | open | 67092-67310 | _na 72_aa | Integral membrane protein | |
| 3252 | MSGO01000036.1 | GCA001929375_01652 | CDS | open | 67355-67747 | _na 130_aa | Peptidase M20 | |
| 3253 | MSGO01000036.1 | GCA001929375_01653 | CDS | open | 67744-68187 | _na 147_aa | TadE-like domain-containing protein | |
| 3254 | MSGO01000036.1 | GCA001929375_01654 | CDS | open | 68184-68891 | _na 235_aa | tadE | TadE family protein |
| 3255 | MSGO01000036.1 | GCA001929375_01655 | CDS | open | 68894-71572 | _na 892_aa | Bacterial transcriptional activator domain-containing protein | |
| 3256 | MSGO01000036.1 | GCA001929375_01656 | CDS | open | 71583-76229 | _na 1548_aa | ftsK | Cell division protein FtsK |
| 3257 | MSGO01000036.1 | GCA001929375_01657 | CDS | open | 76780-79038 | _na 752_aa | DUF6571 domain-containing protein | |
| 3258 | MSGO01000036.1 | GCA001929375_01658 | CDS | open | 79064-79327 | _na 87_aa | hypothetical protein | |
| 3259 | MSGO01000036.1 | GCA001929375_01659 | CDS | open | 79702-80283 | _na 193_aa | acrR | Transcriptional regulator%2C TetR family |
| 3260 | MSGO01000036.1 | GCA001929375_01660 | CDS | open | 80358-81680 | _na 440_aa | amyA | Glycosyl hydrolase family 13 catalytic domain-containing protein |
| 3261 | MSGO01000036.1 | GCA001929375_01661 | CDS | open | 81823-82224 | _na 133_aa | pilT | Twitching motility protein PilT |
| 3262 | MSGO01000036.1 | GCA001929375_01662 | CDS | open | 82221-82448 | _na 75_aa | Toxin-antitoxin system antitoxin subunit | |
| 3263 | MSGO01000036.1 | GCA001929375_01663 | CDS | open | 82640-83140 | _na 166_aa | yjhB | Nudix hydrolase domain-containing protein |
| 3264 | MSGO01000036.1 | GCA001929375_01664 | CDS | open | 83428-85527 | _na 699_aa | feoB | ferrous iron transport protein B |
| 3265 | MSGO01000036.1 | GCA001929375_01665 | CDS | open | 85524-85907 | _na 127_aa | feoA | Iron transporter FeoA |
| 3266 | MSGO01000036.1 | GCA001929375_01666 | CDS | open | 86150-86686 | _na 178_aa | nifU | NIF system FeS cluster assembly NifU C-terminal domain-containing protein |
| 3267 | MSGO01000036.1 | GCA001929375_01667 | CDS | open | 86770-88896 | _na 708_aa | feoB | ferrous iron transport protein B |
| 3268 | MSGO01000036.1 | GCA001929375_01668 | CDS | open | 88893-89288 | _na 131_aa | feoA | FeoA domain protein |
| 3269 | MSGO01000036.1 | GCA001929375_01669 | CDS | open | 89533-89787 | _na 84_aa | hypothetical protein | |
| 3270 | MSGO01000036.1 | GCA001929375_01670 | CDS | open | 90214-90969 | _na 251_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 3271 | MSGO01000036.1 | GCA001929375_01671 | CDS | open | 90966-92276 | _na 436_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 3272 | MSGO01000036.1 | GCA001929375_01672 | CDS | open | 92472-94082 | _na 536_aa | Diacylglycerol kinase family protein | |
| 3273 | MSGO01000036.1 | GCA001929375_01673 | CDS | open | 94996-95115 | _na 39_aa | hypothetical protein | |
| 3274 | MSGO01000036.1 | GCA001929375_01674 | CDS | open | 95369-96010 | _na 213_aa | NYN domain-containing protein | |
| 3275 | MSGO01000036.1 | GCA001929375_01676 | CDS | open | 96739-97287 | _na 182_aa | ymdB | O-acetyl-ADP-ribose deacetylase |
| 3276 | MSGO01000036.1 | GCA001929375_01677 | CDS | open | 97460-98365 | _na 301_aa | 3-oxoacyl-[acyl-carrier protein] reductase | |
| 3277 | MSGO01000036.1 | GCA001929375_01678 | CDS | open | 98594-99580 | _na 328_aa | yaeI | Calcineurin-like phosphoesterase domain-containing protein |
| 3278 | MSGO01000036.1 | GCA001929375_01679 | CDS | open | 99634-101721 | _na 695_aa | mrcB | peptidoglycan glycosyltransferase |
| 3279 | MSGO01000036.1 | GCA001929375_01680 | CDS | open | 102238-102573 | _na 111_aa | whiB | Transcriptional regulator WhiB |
| 3280 | MSGO01000036.1 | GCA001929375_01681 | CDS | open | 102631-102822 | _na 63_aa | DUF4177 domain-containing protein | |
| 3281 | MSGO01000036.1 | GCA001929375_01682 | CDS | open | 102980-103657 | _na 225_aa | crp | Crp/Fnr family transcriptional regulator |
| 3282 | MSGO01000036.1 | GCA001929375_01683 | CDS | open | 103862-104635 | _na 257_aa | nth | endonuclease III |
| 3283 | MSGO01000036.1 | GCA001929375_01684 | CDS | open | 104744-105652 | _na 302_aa | menH | AB hydrolase-1 domain-containing protein |
| 3284 | MSGO01000036.1 | GCA001929375_01685 | CDS | open | 106071-106394 | _na 107_aa | azlD | Branched-chain amino acid transporter AzlD |
| 3285 | MSGO01000036.1 | GCA001929375_01686 | CDS | open | 106394-107116 | _na 240_aa | azlC | Azaleucine resistance protein AzlC |
| 3286 | MSGO01000036.1 | GCA001929375_01687 | CDS | open | 107178-110093 | _na 971_aa | Conserved domain protein | |
| 3287 | MSGO01000036.1 | GCA001929375_01688 | CDS | open | 110188-111027 | _na 279_aa | Tat pathway signal sequence domain protein | |
| 3288 | MSGO01000036.1 | GCA001929375_01689 | CDS | open | 111106-112278 | _na 390_aa | Fido domain-containing protein | |
| 3289 | MSGO01000036.1 | GCA001929375_01690 | CDS | open | 112337-113275 | _na 312_aa | HAD family hydrolase | |
| 3290 | MSGO01000036.1 | GCA001929375_01691 | CDS | open | 113615-114775 | _na 386_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 3291 | MSGO01000036.1 | GCA001929375_01692 | CDS | open | 114763-116019 | _na 418_aa | Helicase | |
| 3292 | MSGO01000036.1 | GCA001929375_01693 | CDS | open | 116016-117326 | _na 436_aa | Type II secretion system F domain protein | |
| 3293 | MSGO01000036.1 | GCA001929375_01694 | CDS | open | 117467-117979 | _na 170_aa | YdbS-like PH domain-containing protein | |
| 3294 | MSGO01000036.1 | GCA001929375_01695 | CDS | open | 118070-118600 | _na 176_aa | yciW | Alkyl hydroperoxide reductase AhpD |
| 3295 | MSGO01000036.1 | GCA001929375_01696 | CDS | open | 118659-119237 | _na 192_aa | Antioxidant%2C AhpC/TSA family | |
| 3296 | MSGO01000036.1 | GCA001929375_01697 | CDS | open | 119533-120354 | _na 273_aa | Luciferase-like domain-containing protein | |
| 3297 | MSGO01000036.1 | GCA001929375_01698 | CDS | open | 120431-122119 | _na 562_aa | Transferase | |
| 3298 | MSGO01000036.1 | GCA001929375_01699 | CDS | open | 122445-122894 | _na 149_aa | hypothetical protein | |
| 3299 | MSGO01000036.1 | GCA001929375_01700 | CDS | open | 122891-123946 | _na 351_aa | Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein | |
| 3300 | MSGO01000036.1 | GCA001929375_01701 | CDS | open | 124112-125761 | _na 549_aa | baeS | histidine kinase |
| 3301 | MSGO01000036.1 | GCA001929375_01702 | CDS | open | 125805-126551 | _na 248_aa | tcrX | putative transcriptional regulatory protein TcrX |
| 3302 | MSGO01000036.1 | GCA001929375_01703 | CDS | open | 126854-128206 | _na 450_aa | PAS domain-containing protein | |
| 3303 | MSGO01000036.1 | GCA001929375_01704 | CDS | open | 128377-129711 | _na 444_aa | Diguanylate cyclase | |
| 3304 | MSGO01000036.1 | GCA001929375_01705 | CDS | open | 129933-132869 | _na 978_aa | topA | type I DNA topoisomerase |
| 3305 | MSGO01000036.1 | GCA001929375_01706 | CDS | open | 133054-133671 | _na 205_aa | DUF3060 domain-containing protein | |
| 3306 | MSGO01000036.1 | GCA001929375_01707 | CDS | open | 133679-134407 | _na 242_aa | ompR | DNA-binding response regulator |
| 3307 | MSGO01000036.1 | GCA001929375_01708 | CDS | open | 134404-135663 | _na 419_aa | histidine kinase | |
| 3308 | MSGO01000036.1 | GCA001929375_01709 | CDS | open | 135784-136869 | _na 361_aa | ompA | Cell envelope biogenesis protein OmpA |
| 3309 | MSGO01000036.1 | GCA001929375_01710 | CDS | open | 136901-137674 | _na 257_aa | tmk | dTMP kinase |
| 3310 | MSGO01000036.1 | GCA001929375_01711 | CDS | open | 137671-138924 | _na 417_aa | dnaX | DNA polymerase III subunit delta' |
| 3311 | MSGO01000036.1 | GCA001929375_01712 | CDS | open | 139044-139628 | _na 194_aa | DUF2892 domain-containing protein | |
| 3312 | MSGO01000036.1 | GCA001929375_01713 | CDS | open | 139893-141356 | _na 487_aa | Alpha/beta hydrolase | |
| 3313 | MSGO01000036.1 | GCA001929375_01714 | CDS | open | 141600-143282 | _na 560_aa | Tripeptidyl aminopeptidase | |
| 3314 | MSGO01000036.1 | GCA001929375_01715 | CDS | open | 143427-144977 | _na 516_aa | TAP-like protein | |
| 3315 | MSGO01000036.1 | GCA001929375_01716 | CDS | open | 145117-146115 | _na 332_aa | L-asparaginase%2C type I | |
| 3316 | MSGO01000036.1 | GCA001929375_01717 | CDS | open | 146135-147682 | _na 515_aa | ansP | Amino acid permease/ SLC12A domain-containing protein |
| 3317 | MSGO01000036.1 | GCA001929375_01719 | CDS | open | 148697-149026 | _na 109_aa | Lsr2 family protein | |
| 3318 | MSGO01000036.1 | GCA001929375_01720 | CDS | open | 149290-150027 | _na 245_aa | gpmA | phosphoglyceromutase |
| 3319 | MSGO01000036.1 | GCA001929375_01721 | CDS | open | 150118-150798 | _na 226_aa | phoU | phosphate signaling complex protein PhoU |
| 3320 | MSGO01000036.1 | GCA001929375_01722 | CDS | open | 151001-152221 | _na 406_aa | senX3 | Sensor-like histidine kinase SenX3 |
| 3321 | MSGO01000036.1 | GCA001929375_01723 | CDS | open | 152218-153036 | _na 272_aa | regX3 | Sensory transduction protein RegX3 |
| 3322 | MSGO01000036.1 | GCA001929375_01724 | CDS | open | 153179-153661 | _na 160_aa | cdnL | CarD-like/TRCF RNAP-interacting domain-containing protein |
| 3323 | MSGO01000036.1 | GCA001929375_01725 | CDS | open | 153714-154559 | _na 281_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 3324 | MSGO01000036.1 | GCA001929375_01726 | CDS | open | 154621-156066 | _na 481_aa | btlA | Major facilitator superfamily (MFS) profile domain-containing protein |
| 3325 | MSGO01000036.1 | GCA001929375_01728 | CDS | open | 157023-157352 | _na 109_aa | ybjQ | UPF0145 protein NCTC10951_01910 |
| 3326 | MSGO01000036.1 | GCA001929375_01729 | CDS | open | 157415-158068 | _na 217_aa | SprT-like domain-containing protein | |
| 3327 | MSGO01000036.1 | GCA001929375_01730 | CDS | open | 158403-159203 | _na 266_aa | Hemagglutinin | |
| 3328 | MSGO01000036.1 | GCA001929375_01732 | CDS | open | 159630-161156 | _na 508_aa | cls | cardiolipin synthase |
| 3329 | MSGO01000036.1 | GCA001929375_01733 | CDS | open | 161114-161983 | _na 289_aa | hypothetical protein | |
| 3330 | MSGO01000036.1 | GCA001929375_01734 | CDS | open | 162058-162189 | _na 43_aa | hypothetical protein | |
| 3331 | MSGO01000036.1 | GCA001929375_01735 | CDS | open | 162299-163237 | _na 312_aa | ABC transporter permease | |
| 3332 | MSGO01000036.1 | GCA001929375_01736 | CDS | open | 163487-164566 | _na 359_aa | hypothetical protein | |
| 3333 | MSGO01000036.1 | GCA001929375_01737 | CDS | open | 164753-165676 | _na 307_aa | hypothetical protein | |
| 3334 | MSGO01000036.1 | GCA001929375_01738 | CDS | open | 165934-167274 | _na 446_aa | DUF1023 domain-containing protein | |
| 3335 | MSGO01000036.1 | GCA001929375_01590 | gene | open | 639-884 | |||
| 3336 | MSGO01000036.1 | GCA001929375_01591 | gene | open | 1256-1561 | |||
| 3337 | MSGO01000036.1 | GCA001929375_01592 | gene | open | 1670-2128 | |||
| 3338 | MSGO01000036.1 | GCA001929375_01593 | gene | open | 2338-3822 | |||
| 3339 | MSGO01000036.1 | GCA001929375_01594 | gene | open | 3819-5144 | eccB | ||
| 3340 | MSGO01000036.1 | GCA001929375_01595 | gene | open | 5144-6442 | eccD | ||
| 3341 | MSGO01000036.1 | GCA001929375_01596 | gene | open | 6791-7123 | |||
| 3342 | MSGO01000036.1 | GCA001929375_01597 | gene | open | 7170-7460 | |||
| 3343 | MSGO01000036.1 | GCA001929375_01598 | gene | open | 7559-8902 | |||
| 3344 | MSGO01000036.1 | GCA001929375_01599 | gene | open | 8899-10257 | eccD | ||
| 3345 | MSGO01000036.1 | GCA001929375_01600 | gene | open | 10409-14509 | |||
| 3346 | MSGO01000036.1 | GCA001929375_01601 | gene | open | 14703-16118 | |||
| 3347 | MSGO01000036.1 | GCA001929375_01602 | gene | open | 16210-16932 | guaA1 | ||
| 3348 | MSGO01000036.1 | GCA001929375_01603 | gene | open | 16994-17377 | |||
| 3349 | MSGO01000036.1 | GCA001929375_01604 | gene | open | 17608-19041 | |||
| 3350 | MSGO01000036.1 | GCA001929375_01605 | gene | open | 19704-20279 | lytR | ||
| 3351 | MSGO01000036.1 | GCA001929375_01606 | gene | open | 20435-20773 | |||
| 3352 | MSGO01000036.1 | GCA001929375_01607 | gene | open | 21144-22208 | |||
| 3353 | MSGO01000036.1 | GCA001929375_01608 | gene | open | 22277-22987 | tetR | ||
| 3354 | MSGO01000036.1 | GCA001929375_01609 | gene | open | 23206-23883 | |||
| 3355 | MSGO01000036.1 | GCA001929375_01610 | gene | open | 23928-24539 | |||
| 3356 | MSGO01000036.1 | GCA001929375_01613 | gene | open | 25129-25239 | |||
| 3357 | MSGO01000036.1 | GCA001929375_01614 | gene | open | 25351-29067 | |||
| 3358 | MSGO01000036.1 | GCA001929375_01615 | gene | open | 29069-29677 | recR | ||
| 3359 | MSGO01000036.1 | GCA001929375_01616 | gene | open | 29769-30860 | |||
| 3360 | MSGO01000036.1 | GCA001929375_01617 | gene | open | 30857-31801 | |||
| 3361 | MSGO01000036.1 | GCA001929375_01618 | gene | open | 31945-33369 | |||
| 3362 | MSGO01000036.1 | GCA001929375_01619 | gene | open | 33721-35202 | metL1 | ||
| 3363 | MSGO01000036.1 | GCA001929375_01620 | gene | open | 35199-36278 | asd | ||
| 3364 | MSGO01000036.1 | GCA001929375_01621 | gene | open | 36442-36714 | copG | ||
| 3365 | MSGO01000036.1 | GCA001929375_01622 | gene | open | 36724-37038 | relE | ||
| 3366 | MSGO01000036.1 | GCA001929375_01623 | gene | open | 37180-37932 | |||
| 3367 | MSGO01000036.1 | GCA001929375_01624 | gene | open | 38031-38939 | |||
| 3368 | MSGO01000036.1 | GCA001929375_01625 | gene | open | 39116-40306 | |||
| 3369 | MSGO01000036.1 | GCA001929375_01626 | gene | open | 40726-41712 | |||
| 3370 | MSGO01000036.1 | GCA001929375_01627 | gene | open | 42152-42532 | cnoX | ||
| 3371 | MSGO01000036.1 | GCA001929375_01628 | gene | open | 42671-43612 | |||
| 3372 | MSGO01000036.1 | GCA001929375_01629 | gene | open | 43840-45288 | hemL | ||
| 3373 | MSGO01000036.1 | GCA001929375_01630 | gene | open | 45776-46825 | hemB | ||
| 3374 | MSGO01000036.1 | GCA001929375_01631 | gene | open | 47109-48362 | |||
| 3375 | MSGO01000036.1 | GCA001929375_01632 | gene | open | 48367-49590 | hemC | ||
| 3376 | MSGO01000036.1 | GCA001929375_01633 | gene | open | 49720-51393 | |||
| 3377 | MSGO01000036.1 | GCA001929375_01634 | gene | open | 51390-52775 | |||
| 3378 | MSGO01000036.1 | GCA001929375_01635 | gene | open | 52976-54469 | |||
| 3379 | MSGO01000036.1 | GCA001929375_01636 | gene | open | 54462-55937 | |||
| 3380 | MSGO01000036.1 | GCA001929375_01637 | gene | open | 55976-56785 | hemQ | ||
| 3381 | MSGO01000036.1 | GCA001929375_01638 | gene | open | 56984-57205 | |||
| 3382 | MSGO01000036.1 | GCA001929375_01639 | gene | open | 57202-57594 | pilT | ||
| 3383 | MSGO01000036.1 | GCA001929375_01640 | gene | open | 58037-58741 | |||
| 3384 | MSGO01000036.1 | GCA001929375_01641 | gene | open | 58851-58994 | |||
| 3385 | MSGO01000036.1 | GCA001929375_01642 | gene | open | 59237-59740 | dps | ||
| 3386 | MSGO01000036.1 | GCA001929375_01643 | gene | open | 60008-60646 | |||
| 3387 | MSGO01000036.1 | GCA001929375_01644 | gene | open | 60640-61644 | |||
| 3388 | MSGO01000036.1 | GCA001929375_01645 | gene | open | 61839-62141 | |||
| 3389 | MSGO01000036.1 | GCA001929375_01646 | gene | open | 62469-63179 | flgA | ||
| 3390 | MSGO01000036.1 | GCA001929375_01647 | gene | open | 63179-63937 | |||
| 3391 | MSGO01000036.1 | GCA001929375_01648 | gene | open | 63934-65250 | cpaF | ||
| 3392 | MSGO01000036.1 | GCA001929375_01649 | gene | open | 65247-66122 | |||
| 3393 | MSGO01000036.1 | GCA001929375_01650 | gene | open | 66119-67042 | |||
| 3394 | MSGO01000036.1 | GCA001929375_01651 | gene | open | 67092-67310 | |||
| 3395 | MSGO01000036.1 | GCA001929375_01652 | gene | open | 67355-67747 | |||
| 3396 | MSGO01000036.1 | GCA001929375_01653 | gene | open | 67744-68187 | |||
| 3397 | MSGO01000036.1 | GCA001929375_01654 | gene | open | 68184-68891 | tadE | ||
| 3398 | MSGO01000036.1 | GCA001929375_01655 | gene | open | 68894-71572 | |||
| 3399 | MSGO01000036.1 | GCA001929375_01656 | gene | open | 71583-76229 | ftsK | ||
| 3400 | MSGO01000036.1 | GCA001929375_01657 | gene | open | 76780-79038 | |||
| 3401 | MSGO01000036.1 | GCA001929375_01658 | gene | open | 79064-79327 | |||
| 3402 | MSGO01000036.1 | GCA001929375_01659 | gene | open | 79702-80283 | acrR | ||
| 3403 | MSGO01000036.1 | GCA001929375_01660 | gene | open | 80358-81680 | amyA | ||
| 3404 | MSGO01000036.1 | GCA001929375_01661 | gene | open | 81823-82224 | pilT | ||
| 3405 | MSGO01000036.1 | GCA001929375_01662 | gene | open | 82221-82448 | |||
| 3406 | MSGO01000036.1 | GCA001929375_01663 | gene | open | 82640-83140 | yjhB | ||
| 3407 | MSGO01000036.1 | GCA001929375_01664 | gene | open | 83428-85527 | feoB | ||
| 3408 | MSGO01000036.1 | GCA001929375_01665 | gene | open | 85524-85907 | feoA | ||
| 3409 | MSGO01000036.1 | GCA001929375_01666 | gene | open | 86150-86686 | nifU | ||
| 3410 | MSGO01000036.1 | GCA001929375_01667 | gene | open | 86770-88896 | feoB | ||
| 3411 | MSGO01000036.1 | GCA001929375_01668 | gene | open | 88893-89288 | feoA | ||
| 3412 | MSGO01000036.1 | GCA001929375_01669 | gene | open | 89533-89787 | |||
| 3413 | MSGO01000036.1 | GCA001929375_01670 | gene | open | 90214-90969 | gatD | ||
| 3414 | MSGO01000036.1 | GCA001929375_01671 | gene | open | 90966-92276 | murT | ||
| 3415 | MSGO01000036.1 | GCA001929375_01672 | gene | open | 92472-94082 | |||
| 3416 | MSGO01000036.1 | GCA001929375_01673 | gene | open | 94996-95115 | |||
| 3417 | MSGO01000036.1 | GCA001929375_01674 | gene | open | 95369-96010 | |||
| 3418 | MSGO01000036.1 | GCA001929375_01676 | gene | open | 96739-97287 | ymdB | ||
| 3419 | MSGO01000036.1 | GCA001929375_01677 | gene | open | 97460-98365 | |||
| 3420 | MSGO01000036.1 | GCA001929375_01678 | gene | open | 98594-99580 | yaeI | ||
| 3421 | MSGO01000036.1 | GCA001929375_01679 | gene | open | 99634-101721 | mrcB | ||
| 3422 | MSGO01000036.1 | GCA001929375_01680 | gene | open | 102238-102573 | whiB | ||
| 3423 | MSGO01000036.1 | GCA001929375_01681 | gene | open | 102631-102822 | |||
| 3424 | MSGO01000036.1 | GCA001929375_01682 | gene | open | 102980-103657 | crp | ||
| 3425 | MSGO01000036.1 | GCA001929375_01683 | gene | open | 103862-104635 | nth | ||
| 3426 | MSGO01000036.1 | GCA001929375_01684 | gene | open | 104744-105652 | menH | ||
| 3427 | MSGO01000036.1 | GCA001929375_01685 | gene | open | 106071-106394 | azlD | ||
| 3428 | MSGO01000036.1 | GCA001929375_01686 | gene | open | 106394-107116 | azlC | ||
| 3429 | MSGO01000036.1 | GCA001929375_01687 | gene | open | 107178-110093 | |||
| 3430 | MSGO01000036.1 | GCA001929375_01688 | gene | open | 110188-111027 | |||
| 3431 | MSGO01000036.1 | GCA001929375_01689 | gene | open | 111106-112278 | |||
| 3432 | MSGO01000036.1 | GCA001929375_01690 | gene | open | 112337-113275 | |||
| 3433 | MSGO01000036.1 | GCA001929375_01691 | gene | open | 113615-114775 | |||
| 3434 | MSGO01000036.1 | GCA001929375_01692 | gene | open | 114763-116019 | |||
| 3435 | MSGO01000036.1 | GCA001929375_01693 | gene | open | 116016-117326 | |||
| 3436 | MSGO01000036.1 | GCA001929375_01694 | gene | open | 117467-117979 | |||
| 3437 | MSGO01000036.1 | GCA001929375_01695 | gene | open | 118070-118600 | yciW | ||
| 3438 | MSGO01000036.1 | GCA001929375_01696 | gene | open | 118659-119237 | |||
| 3439 | MSGO01000036.1 | GCA001929375_01697 | gene | open | 119533-120354 | |||
| 3440 | MSGO01000036.1 | GCA001929375_01698 | gene | open | 120431-122119 | |||
| 3441 | MSGO01000036.1 | GCA001929375_01699 | gene | open | 122445-122894 | |||
| 3442 | MSGO01000036.1 | GCA001929375_01700 | gene | open | 122891-123946 | |||
| 3443 | MSGO01000036.1 | GCA001929375_01701 | gene | open | 124112-125761 | baeS | ||
| 3444 | MSGO01000036.1 | GCA001929375_01702 | gene | open | 125805-126551 | tcrX | ||
| 3445 | MSGO01000036.1 | GCA001929375_01703 | gene | open | 126854-128206 | |||
| 3446 | MSGO01000036.1 | GCA001929375_01704 | gene | open | 128377-129711 | |||
| 3447 | MSGO01000036.1 | GCA001929375_01705 | gene | open | 129933-132869 | topA | ||
| 3448 | MSGO01000036.1 | GCA001929375_01706 | gene | open | 133054-133671 | |||
| 3449 | MSGO01000036.1 | GCA001929375_01707 | gene | open | 133679-134407 | ompR | ||
| 3450 | MSGO01000036.1 | GCA001929375_01708 | gene | open | 134404-135663 | |||
| 3451 | MSGO01000036.1 | GCA001929375_01709 | gene | open | 135784-136869 | ompA | ||
| 3452 | MSGO01000036.1 | GCA001929375_01710 | gene | open | 136901-137674 | tmk | ||
| 3453 | MSGO01000036.1 | GCA001929375_01711 | gene | open | 137671-138924 | dnaX | ||
| 3454 | MSGO01000036.1 | GCA001929375_01712 | gene | open | 139044-139628 | |||
| 3455 | MSGO01000036.1 | GCA001929375_01713 | gene | open | 139893-141356 | |||
| 3456 | MSGO01000036.1 | GCA001929375_01714 | gene | open | 141600-143282 | |||
| 3457 | MSGO01000036.1 | GCA001929375_01715 | gene | open | 143427-144977 | |||
| 3458 | MSGO01000036.1 | GCA001929375_01716 | gene | open | 145117-146115 | |||
| 3459 | MSGO01000036.1 | GCA001929375_01717 | gene | open | 146135-147682 | ansP | ||
| 3460 | MSGO01000036.1 | GCA001929375_01719 | gene | open | 148697-149026 | |||
| 3461 | MSGO01000036.1 | GCA001929375_01720 | gene | open | 149290-150027 | gpmA | ||
| 3462 | MSGO01000036.1 | GCA001929375_01721 | gene | open | 150118-150798 | phoU | ||
| 3463 | MSGO01000036.1 | GCA001929375_01722 | gene | open | 151001-152221 | senX3 | ||
| 3464 | MSGO01000036.1 | GCA001929375_01723 | gene | open | 152218-153036 | regX3 | ||
| 3465 | MSGO01000036.1 | GCA001929375_01724 | gene | open | 153179-153661 | cdnL | ||
| 3466 | MSGO01000036.1 | GCA001929375_01725 | gene | open | 153714-154559 | |||
| 3467 | MSGO01000036.1 | GCA001929375_01726 | gene | open | 154621-156066 | btlA | ||
| 3468 | MSGO01000036.1 | GCA001929375_01728 | gene | open | 157023-157352 | ybjQ | ||
| 3469 | MSGO01000036.1 | GCA001929375_01729 | gene | open | 157415-158068 | |||
| 3470 | MSGO01000036.1 | GCA001929375_01730 | gene | open | 158403-159203 | |||
| 3471 | MSGO01000036.1 | GCA001929375_01732 | gene | open | 159630-161156 | cls | ||
| 3472 | MSGO01000036.1 | GCA001929375_01733 | gene | open | 161114-161983 | |||
| 3473 | MSGO01000036.1 | GCA001929375_01734 | gene | open | 162058-162189 | |||
| 3474 | MSGO01000036.1 | GCA001929375_01735 | gene | open | 162299-163237 | |||
| 3475 | MSGO01000036.1 | GCA001929375_01736 | gene | open | 163487-164566 | |||
| 3476 | MSGO01000036.1 | GCA001929375_01737 | gene | open | 164753-165676 | |||
| 3477 | MSGO01000036.1 | GCA001929375_01738 | gene | open | 165934-167274 | |||
| 3478 | MSGO01000036.1 | GCA001929375_01611 | gene | open | 24660-24747 | trnS | ||
| 3479 | MSGO01000036.1 | GCA001929375_01675 | gene | open | 96386-96459 | trnP | ||
| 3480 | MSGO01000036.1 | GCA001929375_01718 | gene | open | 148007-148079 | trnT | ||
| 3481 | MSGO01000036.1 | GCA001929375_01611 | tRNA | open | 24660-24747 | trnS | tRNA-Ser(gga) | |
| 3482 | MSGO01000036.1 | GCA001929375_01675 | tRNA | open | 96386-96459 | trnP | tRNA-Pro(cgg) | |
| 3483 | MSGO01000036.1 | GCA001929375_01718 | tRNA | open | 148007-148079 | trnT | tRNA-Thr(cgt) | |
| 3484 | MSGO01000037.1 | GCA001929375_01739 | CDS | open | 294-560 | _na 88_aa | Abi family protein | |
| 3485 | MSGO01000037.1 | GCA001929375_01740 | CDS | open | 1064-2053 | _na 329_aa | galE | UDP-glucose 4-epimerase GalE |
| 3486 | MSGO01000037.1 | GCA001929375_01741 | CDS | open | 2146-3642 | _na 498_aa | LCP family protein | |
| 3487 | MSGO01000037.1 | GCA001929375_01742 | CDS | open | 3658-4935 | _na 425_aa | Transcriptional regulator | |
| 3488 | MSGO01000037.1 | GCA001929375_01743 | CDS | open | 5166-5996 | _na 276_aa | dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase | |
| 3489 | MSGO01000037.1 | GCA001929375_01744 | CDS | open | 6039-6452 | _na 137_aa | DUF2304 domain-containing protein | |
| 3490 | MSGO01000037.1 | GCA001929375_01745 | CDS | open | 6476-7192 | _na 238_aa | Glycosyltransferase 2-like domain-containing protein | |
| 3491 | MSGO01000037.1 | GCA001929375_01746 | CDS | open | 7446-8102 | _na 218_aa | N-acetyltransferase | |
| 3492 | MSGO01000037.1 | GCA001929375_01747 | CDS | open | 8102-9235 | _na 377_aa | wecE | DegT/DnrJ/EryC1/StrS family aminotransferase |
| 3493 | MSGO01000037.1 | GCA001929375_01748 | CDS | open | 9237-10304 | _na 355_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 3494 | MSGO01000037.1 | GCA001929375_01749 | CDS | open | 10331-11698 | _na 455_aa | rfbX | Polysaccharide biosynthesis protein |
| 3495 | MSGO01000037.1 | GCA001929375_01750 | CDS | open | 11700-12968 | _na 422_aa | Glycosyltransferase%2C group 1 family protein | |
| 3496 | MSGO01000037.1 | GCA001929375_01751 | CDS | open | 12940-14061 | _na 373_aa | rfaB | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein |
| 3497 | MSGO01000037.1 | GCA001929375_01752 | CDS | open | 14091-15173 | _na 360_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 3498 | MSGO01000037.1 | GCA001929375_01753 | CDS | open | 15464-16618 | _na 384_aa | Glycosyl transferase family 1 domain-containing protein | |
| 3499 | MSGO01000037.1 | GCA001929375_01754 | CDS | open | 16615-18036 | _na 473_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 3500 | MSGO01000037.1 | GCA001929375_01755 | CDS | open | 18033-20138 | _na 701_aa | Tat pathway signal sequence |

