HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-079 (GCA_001937365.1)

Select a Genome:
BAKTA Annotations for GCA_001937365.1
Genome Selected: Actinomyces oris clade-079
ContigsBases CDSrRNA tmRNAtRNA
87 3,046,442 2496 0 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5121 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 5121 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 MSKK01000050.1 GCA001937365_02234 gene open 29846-31873 gyrB
4502 MSKK01000050.1 GCA001937365_02235 gene open 32200-32877
4503 MSKK01000050.1 GCA001937365_02236 gene open 32870-34087 recF
4504 MSKK01000050.1 GCA001937365_02237 gene open 34101-35231 dnaN
4505 MSKK01000050.1 GCA001937365_02238 gene open 35889-37568 dnaA
4506 MSKK01000050.1 GCA001937365_02239 gene open 38166-38303 rpmH
4507 MSKK01000050.1 GCA001937365_02240 gene open 38395-38673 rnpA
4508 MSKK01000050.1 GCA001937365_02241 gene open 38696-38980 yidD
4509 MSKK01000050.1 GCA001937365_02242 gene open 39074-40258 yidC
4510 MSKK01000050.1 GCA001937365_02243 gene open 40312-40917
4511 MSKK01000050.1 GCA001937365_02244 gene open 40920-41564 rsmG
4512 MSKK01000050.1 GCA001937365_02245 gene open 41672-42574 parA
4513 MSKK01000050.1 GCA001937365_02246 gene open 42574-44163 parB
4514 MSKK01000050.1 GCA001937365_02247 gene open 48144-48986
4515 MSKK01000050.1 GCA001937365_02248 gene open 49262-50209 ddlA
4516 MSKK01000050.1 GCA001937365_02249 gene open 50218-51654 aRO8
4517 MSKK01000050.1 GCA001937365_02250 gene open 51755-53194 thrC
4518 MSKK01000050.1 GCA001937365_02251 gene open 53420-53746 trxA
4519 MSKK01000050.1 GCA001937365_02252 gene open 53855-54781 trxB
4520 MSKK01000050.1 GCA001937365_02253 gene open 54868-59163 mviN
4521 MSKK01000050.1 GCA001937365_02254 gene open 59160-61616
4522 MSKK01000050.1 GCA001937365_02255 gene open 61613-62122 yjhB
4523 MSKK01000050.1 GCA001937365_02256 gene open 62312-63799 pcnB
4524 MSKK01000050.1 GCA001937365_02257 gene open 63810-65027
4525 MSKK01000050.1 GCA001937365_02258 gene open 65166-66674 galA
4526 MSKK01000050.1 GCA001937365_02259 gene open 66720-68030
4527 MSKK01000050.1 GCA001937365_02260 gene open 68420-71209 cas3u
4528 MSKK01000050.1 GCA001937365_02261 gene open 71202-72113
4529 MSKK01000050.1 GCA001937365_02262 gene open 72138-72713
4530 MSKK01000050.1 GCA001937365_02263 gene open 72778-73989
4531 MSKK01000050.1 GCA001937365_02264 gene open 73955-75298 csb2
4532 MSKK01000050.1 GCA001937365_02229 gene open 26203-26278 trnA
4533 MSKK01000050.1 GCA001937365_02231 gene open 26476-26549 trnI
4534 MSKK01000050.1 GCA001937365_02229 tRNA open 26203-26278 trnA tRNA-Ala(tgc)
4535 MSKK01000050.1 GCA001937365_02231 tRNA open 26476-26549 trnI tRNA-Ile(gat)
4536 MSKK01000051.1 GCA001937365_02265 CDS open 60-332 _na     90_aa Transposase
4537 MSKK01000051.1 GCA001937365_02266 CDS open 365-1090 _na     241_aa Restriction endonuclease BglII
4538 MSKK01000051.1 GCA001937365_02267 CDS open 1062-1763 _na     233_aa Helix-turn-helix domain-containing protein
4539 MSKK01000051.1 GCA001937365_02268 CDS open 2283-2936 _na     217_aa citB DNA-binding response regulator
4540 MSKK01000051.1 GCA001937365_02269 CDS open 2979-4283 _na     434_aa histidine kinase
4541 MSKK01000051.1 GCA001937365_02270 CDS open 4388-4873 _na     161_aa Helix-turn-helix domain-containing protein
4542 MSKK01000051.1 GCA001937365_02271 CDS open 5042-6433 _na     463_aa ABC3 transporter permease C-terminal domain-containing protein
4543 MSKK01000051.1 GCA001937365_02272 CDS open 6430-7245 _na     271_aa lolD ABC transporter%2C ATP-binding protein
4544 MSKK01000051.1 GCA001937365_02273 CDS open 7476-8339 _na     287_aa nlpA Lipoprotein
4545 MSKK01000051.1 GCA001937365_02274 CDS open 8468-9184 _na     238_aa metP ABC transmembrane type-1 domain-containing protein
4546 MSKK01000051.1 GCA001937365_02275 CDS open 9181-10443 _na     420_aa ABC transporter domain-containing protein
4547 MSKK01000051.1 GCA001937365_02276 CDS open 10788-11783 _na     331_aa Alpha/beta hydrolase
4548 MSKK01000051.1 GCA001937365_02277 CDS open 11787-12485 _na     232_aa protein-tyrosine-phosphatase
4549 MSKK01000051.1 GCA001937365_02278 CDS open 12682-13626 _na     314_aa pheA prephenate dehydratase
4550 MSKK01000051.1 GCA001937365_02279 CDS open 13998-14900 _na     300_aa fN3K Fructosamine kinase
4551 MSKK01000051.1 GCA001937365_02280 CDS open 15117-17609 _na     830_aa Tat pathway signal sequence domain protein
4552 MSKK01000051.1 GCA001937365_02281 CDS open 17604-18548 _na     314_aa hypothetical protein
4553 MSKK01000051.1 GCA001937365_02265 gene open 60-332
4554 MSKK01000051.1 GCA001937365_02266 gene open 365-1090
4555 MSKK01000051.1 GCA001937365_02267 gene open 1062-1763
4556 MSKK01000051.1 GCA001937365_02268 gene open 2283-2936 citB
4557 MSKK01000051.1 GCA001937365_02269 gene open 2979-4283
4558 MSKK01000051.1 GCA001937365_02270 gene open 4388-4873
4559 MSKK01000051.1 GCA001937365_02271 gene open 5042-6433
4560 MSKK01000051.1 GCA001937365_02272 gene open 6430-7245 lolD
4561 MSKK01000051.1 GCA001937365_02273 gene open 7476-8339 nlpA
4562 MSKK01000051.1 GCA001937365_02274 gene open 8468-9184 metP
4563 MSKK01000051.1 GCA001937365_02275 gene open 9181-10443
4564 MSKK01000051.1 GCA001937365_02276 gene open 10788-11783
4565 MSKK01000051.1 GCA001937365_02277 gene open 11787-12485
4566 MSKK01000051.1 GCA001937365_02278 gene open 12682-13626 pheA
4567 MSKK01000051.1 GCA001937365_02279 gene open 13998-14900 fN3K
4568 MSKK01000051.1 GCA001937365_02280 gene open 15117-17609
4569 MSKK01000051.1 GCA001937365_02281 gene open 17604-18548
4570 MSKK01000052.1 GCA001937365_02282 CDS open 156-389 _na     77_aa Small Multidrug Resistance (SMR) protein
4571 MSKK01000052.1 GCA001937365_02283 CDS open 1076-1231 _na     51_aa GTP cyclohydrolase 1
4572 MSKK01000052.1 GCA001937365_02282 gene open 156-389
4573 MSKK01000052.1 GCA001937365_02283 gene open 1076-1231
4574 MSKK01000053.1 GCA001937365_02293 gene open 6705-7095 RNaseP_bact_a
4575 MSKK01000053.1 GCA001937365_02293 ncRNA open 6705-7095 Bacterial RNase P class A
4576 MSKK01000053.1 GCA001937365_02284 CDS open 547-951 _na     134_aa DUF3052 domain-containing protein
4577 MSKK01000053.1 GCA001937365_02286 CDS open 1239-2279 _na     346_aa DUF1266 domain-containing protein
4578 MSKK01000053.1 GCA001937365_02287 CDS open 2368-3540 _na     390_aa aspB Aminotransferase
4579 MSKK01000053.1 GCA001937365_02290 CDS open 4086-4988 _na     300_aa Nif3-like dinuclear metal center hexameric protein
4580 MSKK01000053.1 GCA001937365_02291 CDS open 5035-5769 _na     244_aa dR0291 Zinc ribbon domain protein
4581 MSKK01000053.1 GCA001937365_02292 CDS open 5801-6610 _na     269_aa yaaA Peroxide stress protein YaaA
4582 MSKK01000053.1 GCA001937365_02294 CDS open 7194-8393 _na     399_aa DUF4352 domain-containing protein
4583 MSKK01000053.1 GCA001937365_02295 CDS open 8558-9367 _na     269_aa map type I methionyl aminopeptidase
4584 MSKK01000053.1 GCA001937365_02296 CDS open 9568-10413 _na     281_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
4585 MSKK01000053.1 GCA001937365_02297 CDS open 10617-11948 _na     443_aa glnA type I glutamate--ammonia ligase
4586 MSKK01000053.1 GCA001937365_02298 CDS open 11967-15566 _na     1199_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
4587 MSKK01000053.1 GCA001937365_02299 CDS open 15707-16315 _na     202_aa Histidine phosphatase family protein
4588 MSKK01000053.1 GCA001937365_02300 CDS open 16326-17126 _na     266_aa glnQ ABC transporter domain-containing protein
4589 MSKK01000053.1 GCA001937365_02301 CDS open 17123-18088 _na     321_aa hisM ABC transmembrane type-1 domain-containing protein
4590 MSKK01000053.1 GCA001937365_02302 CDS open 18092-19012 _na     306_aa hisJ Solute-binding protein family 3/N-terminal domain-containing protein
4591 MSKK01000053.1 GCA001937365_02303 CDS open 19168-20592 _na     474_aa glnA type I glutamate--ammonia ligase
4592 MSKK01000053.1 GCA001937365_02304 CDS open 20784-21539 _na     251_aa DUF4191 domain-containing protein
4593 MSKK01000053.1 GCA001937365_02305 CDS open 21623-22654 _na     343_aa lipA Lipoyl synthase
4594 MSKK01000053.1 GCA001937365_02306 CDS open 22735-23421 _na     228_aa lipB lipoyl(octanoyl) transferase LipB
4595 MSKK01000053.1 GCA001937365_02307 CDS open 23524-25269 _na     581_aa non-specific serine/threonine protein kinase
4596 MSKK01000053.1 GCA001937365_02308 CDS open 25333-27600 _na     755_aa All-trans-retinol 13%2C14-reductase
4597 MSKK01000053.1 GCA001937365_02309 CDS open 27688-28308 _na     206_aa tetR TetR family transcriptional regulator
4598 MSKK01000053.1 GCA001937365_02310 CDS open 28447-28689 _na     80_aa Homeodomain-like domain-containing protein
4599 MSKK01000053.1 GCA001937365_02311 CDS open 28692-29666 _na     324_aa Clp R domain-containing protein
4600 MSKK01000053.1 GCA001937365_02312 CDS open 29802-30767 _na     321_aa sucB 2-oxoglutarate dehydrogenase%2C E2 component%2C dihydrolipoamide succinyltransferase
4601 MSKK01000053.1 GCA001937365_02284 gene open 547-951
4602 MSKK01000053.1 GCA001937365_02286 gene open 1239-2279
4603 MSKK01000053.1 GCA001937365_02287 gene open 2368-3540 aspB
4604 MSKK01000053.1 GCA001937365_02290 gene open 4086-4988
4605 MSKK01000053.1 GCA001937365_02291 gene open 5035-5769 dR0291
4606 MSKK01000053.1 GCA001937365_02292 gene open 5801-6610 yaaA
4607 MSKK01000053.1 GCA001937365_02294 gene open 7194-8393
4608 MSKK01000053.1 GCA001937365_02295 gene open 8558-9367 map
4609 MSKK01000053.1 GCA001937365_02296 gene open 9568-10413 panB
4610 MSKK01000053.1 GCA001937365_02297 gene open 10617-11948 glnA
4611 MSKK01000053.1 GCA001937365_02298 gene open 11967-15566
4612 MSKK01000053.1 GCA001937365_02299 gene open 15707-16315
4613 MSKK01000053.1 GCA001937365_02300 gene open 16326-17126 glnQ
4614 MSKK01000053.1 GCA001937365_02301 gene open 17123-18088 hisM
4615 MSKK01000053.1 GCA001937365_02302 gene open 18092-19012 hisJ
4616 MSKK01000053.1 GCA001937365_02303 gene open 19168-20592 glnA
4617 MSKK01000053.1 GCA001937365_02304 gene open 20784-21539
4618 MSKK01000053.1 GCA001937365_02305 gene open 21623-22654 lipA
4619 MSKK01000053.1 GCA001937365_02306 gene open 22735-23421 lipB
4620 MSKK01000053.1 GCA001937365_02307 gene open 23524-25269
4621 MSKK01000053.1 GCA001937365_02308 gene open 25333-27600
4622 MSKK01000053.1 GCA001937365_02309 gene open 27688-28308 tetR
4623 MSKK01000053.1 GCA001937365_02310 gene open 28447-28689
4624 MSKK01000053.1 GCA001937365_02311 gene open 28692-29666
4625 MSKK01000053.1 GCA001937365_02312 gene open 29802-30767 sucB
4626 MSKK01000053.1 GCA001937365_02285 gene open 1115-1190 trnV
4627 MSKK01000053.1 GCA001937365_02288 gene open 3667-3751 trnL
4628 MSKK01000053.1 GCA001937365_02289 gene open 3789-3880 trnI
4629 MSKK01000053.1 GCA001937365_02285 tRNA open 1115-1190 trnV tRNA-Val(tac)
4630 MSKK01000053.1 GCA001937365_02288 tRNA open 3667-3751 trnL tRNA-Leu(taa)
4631 MSKK01000053.1 GCA001937365_02289 tRNA open 3789-3880 trnI tRNA-Ile(tat)
4632 MSKK01000054.1 GCA001937365_02313 CDS open 33-329 _na     98_aa hypothetical protein
4633 MSKK01000054.1 GCA001937365_02314 CDS open 580-1104 _na     174_aa padR Transcription regulator PadR N-terminal domain-containing protein
4634 MSKK01000054.1 GCA001937365_02315 CDS open 1101-1946 _na     281_aa ABC transporter ATP-binding protein
4635 MSKK01000054.1 GCA001937365_02316 CDS open 1943-4156 _na     737_aa ABC transporter permease
4636 MSKK01000054.1 GCA001937365_02317 CDS open 4369-5106 _na     245_aa Pentapeptide repeat-containing protein
4637 MSKK01000054.1 GCA001937365_02318 CDS open 5103-5642 _na     179_aa Cell wall synthesis protein Wag31
4638 MSKK01000054.1 GCA001937365_02319 CDS open 5639-6232 _na     197_aa rloB RloB domain-containing protein
4639 MSKK01000054.1 GCA001937365_02320 CDS open 6234-7535 _na     433_aa ATPase AAA-type core domain-containing protein
4640 MSKK01000054.1 GCA001937365_02321 CDS open 7722-9455 _na     577_aa lysS lysine--tRNA ligase
4641 MSKK01000054.1 GCA001937365_02322 CDS open 9493-10692 _na     399_aa hypothetical protein
4642 MSKK01000054.1 GCA001937365_02323 CDS open 10777-11208 _na     143_aa panD aspartate 1-decarboxylase
4643 MSKK01000054.1 GCA001937365_02324 CDS open 11516-12559 _na     347_aa panC pantoate--beta-alanine ligase
4644 MSKK01000054.1 GCA001937365_02325 CDS open 12765-13739 _na     324_aa Oxidoreductase
4645 MSKK01000054.1 GCA001937365_02326 CDS open 13753-15519 _na     588_aa YdbS-like PH domain-containing protein
4646 MSKK01000054.1 GCA001937365_02327 CDS open 15516-16034 _na     172_aa YdbS-like PH domain-containing protein
4647 MSKK01000054.1 GCA001937365_02328 CDS open 16031-16531 _na     166_aa DUF3180 domain-containing protein
4648 MSKK01000054.1 GCA001937365_02329 CDS open 16531-19239 _na     902_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
4649 MSKK01000054.1 GCA001937365_02330 CDS open 19236-20054 _na     272_aa folP dihydropteroate synthase
4650 MSKK01000054.1 GCA001937365_02331 CDS open 20622-21431 _na     269_aa Peptide ABC transporter ATP-binding protein
4651 MSKK01000054.1 GCA001937365_02332 CDS open 21431-23929 _na     832_aa ABC transporter permease
4652 MSKK01000054.1 GCA001937365_02333 CDS open 24505-25569 _na     354_aa ABC transporter ATP-binding protein
4653 MSKK01000054.1 GCA001937365_02334 CDS open 25569-28052 _na     827_aa ABC transporter permease
4654 MSKK01000054.1 GCA001937365_02335 CDS open 28097-28771 _na     224_aa citB Response regulator receiver domain protein
4655 MSKK01000054.1 GCA001937365_02336 CDS open 28813-30036 _na     407_aa histidine kinase
4656 MSKK01000054.1 GCA001937365_02313 gene open 33-329
4657 MSKK01000054.1 GCA001937365_02314 gene open 580-1104 padR
4658 MSKK01000054.1 GCA001937365_02315 gene open 1101-1946
4659 MSKK01000054.1 GCA001937365_02316 gene open 1943-4156
4660 MSKK01000054.1 GCA001937365_02317 gene open 4369-5106
4661 MSKK01000054.1 GCA001937365_02318 gene open 5103-5642
4662 MSKK01000054.1 GCA001937365_02319 gene open 5639-6232 rloB
4663 MSKK01000054.1 GCA001937365_02320 gene open 6234-7535
4664 MSKK01000054.1 GCA001937365_02321 gene open 7722-9455 lysS
4665 MSKK01000054.1 GCA001937365_02322 gene open 9493-10692
4666 MSKK01000054.1 GCA001937365_02323 gene open 10777-11208 panD
4667 MSKK01000054.1 GCA001937365_02324 gene open 11516-12559 panC
4668 MSKK01000054.1 GCA001937365_02325 gene open 12765-13739
4669 MSKK01000054.1 GCA001937365_02326 gene open 13753-15519
4670 MSKK01000054.1 GCA001937365_02327 gene open 15516-16034
4671 MSKK01000054.1 GCA001937365_02328 gene open 16031-16531
4672 MSKK01000054.1 GCA001937365_02329 gene open 16531-19239 folK
4673 MSKK01000054.1 GCA001937365_02330 gene open 19236-20054 folP
4674 MSKK01000054.1 GCA001937365_02331 gene open 20622-21431
4675 MSKK01000054.1 GCA001937365_02332 gene open 21431-23929
4676 MSKK01000054.1 GCA001937365_02333 gene open 24505-25569
4677 MSKK01000054.1 GCA001937365_02334 gene open 25569-28052
4678 MSKK01000054.1 GCA001937365_02335 gene open 28097-28771 citB
4679 MSKK01000054.1 GCA001937365_02336 gene open 28813-30036
4680 MSKK01000055.1 GCA001937365_02337 CDS open 1131-1793 _na     220_aa hypothetical protein
4681 MSKK01000055.1 GCA001937365_02338 CDS open 3046-3630 _na     194_aa DUF805 domain-containing protein
4682 MSKK01000055.1 GCA001937365_02339 CDS open 4260-4772 _na     170_aa DUF805 domain-containing protein
4683 MSKK01000055.1 GCA001937365_02341 CDS open 5041-5952 _na     303_aa Putative glucose-6-phosphate 1-epimerase
4684 MSKK01000055.1 GCA001937365_02342 CDS open 6022-7482 _na     486_aa AI-2E family transporter
4685 MSKK01000055.1 GCA001937365_02343 CDS open 7495-10896 _na     1133_aa Error-prone DNA polymerase
4686 MSKK01000055.1 GCA001937365_02337 gene open 1131-1793
4687 MSKK01000055.1 GCA001937365_02338 gene open 3046-3630
4688 MSKK01000055.1 GCA001937365_02339 gene open 4260-4772
4689 MSKK01000055.1 GCA001937365_02341 gene open 5041-5952
4690 MSKK01000055.1 GCA001937365_02342 gene open 6022-7482
4691 MSKK01000055.1 GCA001937365_02343 gene open 7495-10896
4692 MSKK01000055.1 GCA001937365_02340 gene open 4837-4927 trnL
4693 MSKK01000055.1 GCA001937365_02340 tRNA open 4837-4927 trnL tRNA-Leu(gag)
4694 MSKK01000056.1 GCA001937365_02344 CDS open 112-3888 _na     1258_aa narG nitrate reductase subunit alpha
4695 MSKK01000056.1 GCA001937365_02345 CDS open 3888-5585 _na     565_aa narH nitrate reductase subunit beta
4696 MSKK01000056.1 GCA001937365_02346 CDS open 5587-6354 _na     255_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
4697 MSKK01000056.1 GCA001937365_02347 CDS open 6351-7139 _na     262_aa narI respiratory nitrate reductase subunit gamma
4698 MSKK01000056.1 GCA001937365_02348 CDS open 7174-8148 _na     324_aa modA molybdate ABC transporter substrate-binding protein
4699 MSKK01000056.1 GCA001937365_02349 CDS open 8200-10341 _na     713_aa modB molybdate ABC transporter permease subunit
4700 MSKK01000056.1 GCA001937365_02350 CDS open 10368-11690 _na     440_aa moeB Molybdenum cofactor biosynthesis protein MoeB
4701 MSKK01000056.1 GCA001937365_02344 gene open 112-3888 narG
4702 MSKK01000056.1 GCA001937365_02345 gene open 3888-5585 narH
4703 MSKK01000056.1 GCA001937365_02346 gene open 5587-6354 narJ
4704 MSKK01000056.1 GCA001937365_02347 gene open 6351-7139 narI
4705 MSKK01000056.1 GCA001937365_02348 gene open 7174-8148 modA
4706 MSKK01000056.1 GCA001937365_02349 gene open 8200-10341 modB
4707 MSKK01000056.1 GCA001937365_02350 gene open 10368-11690 moeB
4708 MSKK01000057.1 GCA001937365_02371 gene open 22845-22954 Actinomyces-1
4709 MSKK01000057.1 GCA001937365_02371 ncRNA open 22845-22954 Actinomyces-1 RNA
4710 MSKK01000057.1 GCA001937365_02351 CDS open 177-1589 _na     470_aa DUF1023 domain-containing protein
4711 MSKK01000057.1 GCA001937365_02352 CDS open 2701-3309 _na     202_aa helix-turn-helix domain-containing protein
4712 MSKK01000057.1 GCA001937365_02353 CDS open 4155-4544 _na     129_aa transposase family protein
4713 MSKK01000057.1 GCA001937365_02354 CDS open 4617-5489 _na     290_aa wcaA Glucosyl-3-phosphoglycerate synthase
4714 MSKK01000057.1 GCA001937365_02355 CDS open 6035-8059 _na     674_aa DUF885 domain-containing protein
4715 MSKK01000057.1 GCA001937365_02356 CDS open 8888-9499 _na     203_aa Flavodoxin-like fold domain-containing protein
4716 MSKK01000057.1 GCA001937365_02357 CDS open 9503-9652 _na     49_aa hypothetical protein
4717 MSKK01000057.1 GCA001937365_02358 CDS open 9645-10052 _na     135_aa hypothetical protein
4718 MSKK01000057.1 GCA001937365_02359 CDS open 10333-11223 _na     296_aa DUF5926 domain-containing protein
4719 MSKK01000057.1 GCA001937365_02360 CDS open 11393-12391 _na     332_aa DUF5129 domain-containing protein
4720 MSKK01000057.1 GCA001937365_02361 CDS open 12681-13079 _na     132_aa ridA Enamine/imine deaminase
4721 MSKK01000057.1 GCA001937365_02362 CDS open 13279-14334 _na     351_aa hypothetical protein
4722 MSKK01000057.1 GCA001937365_02363 CDS open 14555-16237 _na     560_aa pgm phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent)
4723 MSKK01000057.1 GCA001937365_02364 CDS open 16386-16922 _na     178_aa N-acetyltransferase domain-containing protein
4724 MSKK01000057.1 GCA001937365_02365 CDS open 17269-18180 _na     303_aa YwiC-like protein
4725 MSKK01000057.1 GCA001937365_02366 CDS open 18229-19383 _na     384_aa hisC histidinol-phosphate transaminase
4726 MSKK01000057.1 GCA001937365_02367 CDS open 19430-19837 _na     135_aa Phage holin family protein
4727 MSKK01000057.1 GCA001937365_02368 CDS open 19975-21945 _na     656_aa Alpha/beta hydrolase
4728 MSKK01000057.1 GCA001937365_02369 CDS open 21942-22169 _na     75_aa hypothetical protein
4729 MSKK01000057.1 GCA001937365_02370 CDS open 22349-22714 _na     121_aa hypothetical protein
4730 MSKK01000057.1 GCA001937365_02372 CDS open 23116-23787 _na     223_aa Class I SAM-dependent methyltransferase
4731 MSKK01000057.1 GCA001937365_02373 CDS open 23947-24339 _na     130_aa DNA mismatch endonuclease Vsr
4732 MSKK01000057.1 GCA001937365_02374 CDS open 24419-27433 _na     1004_aa Putative endonuclease Z1 domain-containing protein
4733 MSKK01000057.1 GCA001937365_02375 CDS open 27437-28429 _na     330_aa PD-(D/E)XK motif protein
4734 MSKK01000057.1 GCA001937365_02376 CDS open 28433-29941 _na     502_aa mutL Histidine kinase/HSP90-like ATPase domain-containing protein
4735 MSKK01000057.1 GCA001937365_02377 CDS open 29944-33357 _na     1137_aa Swt1-like HEPN domain-containing protein
4736 MSKK01000057.1 GCA001937365_02378 CDS open 33359-36178 _na     939_aa DUF1156 domain-containing protein
4737 MSKK01000057.1 GCA001937365_02379 CDS open 36326-37420 _na     364_aa dcm Cytosine-specific methyltransferase
4738 MSKK01000057.1 GCA001937365_02380 CDS open 37569-38375 _na     268_aa FAD-binding FR-type domain-containing protein
4739 MSKK01000057.1 GCA001937365_02381 CDS open 38497-38967 _na     156_aa XRE family transcriptional regulator
4740 MSKK01000057.1 GCA001937365_02382 CDS open 39143-39433 _na     96_aa GNAT family N-acetyltransferase
4741 MSKK01000057.1 GCA001937365_02351 gene open 177-1589
4742 MSKK01000057.1 GCA001937365_02352 gene open 2701-3309
4743 MSKK01000057.1 GCA001937365_02353 gene open 4155-4544
4744 MSKK01000057.1 GCA001937365_02354 gene open 4617-5489 wcaA
4745 MSKK01000057.1 GCA001937365_02355 gene open 6035-8059
4746 MSKK01000057.1 GCA001937365_02356 gene open 8888-9499
4747 MSKK01000057.1 GCA001937365_02357 gene open 9503-9652
4748 MSKK01000057.1 GCA001937365_02358 gene open 9645-10052
4749 MSKK01000057.1 GCA001937365_02359 gene open 10333-11223
4750 MSKK01000057.1 GCA001937365_02360 gene open 11393-12391
4751 MSKK01000057.1 GCA001937365_02361 gene open 12681-13079 ridA
4752 MSKK01000057.1 GCA001937365_02362 gene open 13279-14334
4753 MSKK01000057.1 GCA001937365_02363 gene open 14555-16237 pgm
4754 MSKK01000057.1 GCA001937365_02364 gene open 16386-16922
4755 MSKK01000057.1 GCA001937365_02365 gene open 17269-18180
4756 MSKK01000057.1 GCA001937365_02366 gene open 18229-19383 hisC
4757 MSKK01000057.1 GCA001937365_02367 gene open 19430-19837
4758 MSKK01000057.1 GCA001937365_02368 gene open 19975-21945
4759 MSKK01000057.1 GCA001937365_02369 gene open 21942-22169
4760 MSKK01000057.1 GCA001937365_02370 gene open 22349-22714
4761 MSKK01000057.1 GCA001937365_02372 gene open 23116-23787
4762 MSKK01000057.1 GCA001937365_02373 gene open 23947-24339
4763 MSKK01000057.1 GCA001937365_02374 gene open 24419-27433
4764 MSKK01000057.1 GCA001937365_02375 gene open 27437-28429
4765 MSKK01000057.1 GCA001937365_02376 gene open 28433-29941 mutL
4766 MSKK01000057.1 GCA001937365_02377 gene open 29944-33357
4767 MSKK01000057.1 GCA001937365_02378 gene open 33359-36178
4768 MSKK01000057.1 GCA001937365_02379 gene open 36326-37420 dcm
4769 MSKK01000057.1 GCA001937365_02380 gene open 37569-38375
4770 MSKK01000057.1 GCA001937365_02381 gene open 38497-38967
4771 MSKK01000057.1 GCA001937365_02382 gene open 39143-39433
4772 MSKK01000058.1 GCA001937365_02383 CDS open 159-1886 _na     575_aa PQQ-binding-like beta-propeller repeat protein
4773 MSKK01000058.1 GCA001937365_02383 gene open 159-1886
4774 MSKK01000059.1 GCA001937365_02384 CDS open 108-884 _na     258_aa Sugar (Glycoside-Pentoside-Hexuronide) transporter
4775 MSKK01000059.1 GCA001937365_02385 CDS open 881-4060 _na     1059_aa lacZ Beta-galactosidase
4776 MSKK01000059.1 GCA001937365_02386 CDS open 4310-5296 _na     328_aa purR HTH lacI-type domain-containing protein
4777 MSKK01000059.1 GCA001937365_02387 CDS open 5518-6375 _na     285_aa Suppressor of fused protein (SUFU)
4778 MSKK01000059.1 GCA001937365_02388 CDS open 6372-7787 _na     471_aa LssY-like C-terminal domain-containing protein
4779 MSKK01000059.1 GCA001937365_02389 CDS open 7916-8638 _na     240_aa Lipoprotein
4780 MSKK01000059.1 GCA001937365_02390 CDS open 8926-9627 _na     233_aa Lipoprotein
4781 MSKK01000059.1 GCA001937365_02391 CDS open 9739-10713 _na     324_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
4782 MSKK01000059.1 GCA001937365_02392 CDS open 10869-11816 _na     315_aa Tat pathway signal protein
4783 MSKK01000059.1 GCA001937365_02393 CDS open 11893-12765 _na     290_aa Tat pathway signal sequence
4784 MSKK01000059.1 GCA001937365_02394 CDS open 13767-14762 _na     331_aa DEAD/DEAH box helicase family protein
4785 MSKK01000059.1 GCA001937365_02395 CDS open 14759-16966 _na     735_aa helicase-related protein
4786 MSKK01000059.1 GCA001937365_02396 CDS open 16917-18851 _na     644_aa type ISP restriction/modification enzyme
4787 MSKK01000059.1 GCA001937365_02397 CDS open 19476-20450 _na     324_aa ftsH ATP-dependent zinc metalloprotease FtsH
4788 MSKK01000059.1 GCA001937365_02398 CDS open 22386-22982 _na     198_aa S8 family serine peptidase
4789 MSKK01000059.1 GCA001937365_02399 CDS open 23143-23454 _na     103_aa higA HigA family addiction module antitoxin
4790 MSKK01000059.1 GCA001937365_02400 CDS open 23511-24083 _na     190_aa ImmA/IrrE family metallo-endopeptidase
4791 MSKK01000059.1 GCA001937365_02401 CDS open 24224-25366 _na     380_aa Sugar porter family MFS transporter
4792 MSKK01000059.1 GCA001937365_02384 gene open 108-884
4793 MSKK01000059.1 GCA001937365_02385 gene open 881-4060 lacZ
4794 MSKK01000059.1 GCA001937365_02386 gene open 4310-5296 purR
4795 MSKK01000059.1 GCA001937365_02387 gene open 5518-6375
4796 MSKK01000059.1 GCA001937365_02388 gene open 6372-7787
4797 MSKK01000059.1 GCA001937365_02389 gene open 7916-8638
4798 MSKK01000059.1 GCA001937365_02390 gene open 8926-9627
4799 MSKK01000059.1 GCA001937365_02391 gene open 9739-10713 nrdF
4800 MSKK01000059.1 GCA001937365_02392 gene open 10869-11816
4801 MSKK01000059.1 GCA001937365_02393 gene open 11893-12765
4802 MSKK01000059.1 GCA001937365_02394 gene open 13767-14762
4803 MSKK01000059.1 GCA001937365_02395 gene open 14759-16966
4804 MSKK01000059.1 GCA001937365_02396 gene open 16917-18851
4805 MSKK01000059.1 GCA001937365_02397 gene open 19476-20450 ftsH
4806 MSKK01000059.1 GCA001937365_02398 gene open 22386-22982
4807 MSKK01000059.1 GCA001937365_02399 gene open 23143-23454 higA
4808 MSKK01000059.1 GCA001937365_02400 gene open 23511-24083
4809 MSKK01000059.1 GCA001937365_02401 gene open 24224-25366
4810 MSKK01000060.1 GCA001937365_02402 CDS open 35-589 _na     184_aa hypothetical protein
4811 MSKK01000060.1 GCA001937365_02403 CDS open 690-1703 _na     337_aa pstC phosphate ABC transporter permease subunit PstC
4812 MSKK01000060.1 GCA001937365_02404 CDS open 1705-2931 _na     408_aa pstA phosphate ABC transporter permease PstA
4813 MSKK01000060.1 GCA001937365_02405 CDS open 2999-3778 _na     259_aa pstB phosphate ABC transporter ATP-binding protein PstB
4814 MSKK01000060.1 GCA001937365_02406 CDS open 4222-4893 _na     223_aa ompR OmpR/PhoB-type domain-containing protein
4815 MSKK01000060.1 GCA001937365_02407 CDS open 5024-6223 _na     399_aa terC Tellurium resistance protein TerC
4816 MSKK01000060.1 GCA001937365_02408 CDS open 6526-7263 _na     245_aa THAP4-like heme-binding beta-barrel domain-containing protein
4817 MSKK01000060.1 GCA001937365_02409 CDS open 7263-8492 _na     409_aa Aminomethyltransferase
4818 MSKK01000060.1 GCA001937365_02410 CDS open 8735-9130 _na     131_aa DUF2516 domain-containing protein
4819 MSKK01000060.1 GCA001937365_02411 CDS open 9130-9558 _na     142_aa dtd D-aminoacyl-tRNA deacylase
4820 MSKK01000060.1 GCA001937365_02412 CDS open 9746-10315 _na     189_aa DUF3995 domain-containing protein
4821 MSKK01000060.1 GCA001937365_02413 CDS open 10427-10654 _na     75_aa DUF559 domain-containing protein
4822 MSKK01000060.1 GCA001937365_02414 CDS open 11051-11203 _na     50_aa hypothetical protein
4823 MSKK01000060.1 GCA001937365_02415 CDS open 11674-12699 _na     341_aa ilvA Pyridoxal-phosphate dependent protein
4824 MSKK01000060.1 GCA001937365_02416 CDS open 12782-13693 _na     303_aa lysR HTH lysR-type domain-containing protein
4825 MSKK01000060.1 GCA001937365_02417 CDS open 13808-14758 _na     316_aa Ribonucleoside hydrolase
4826 MSKK01000060.1 GCA001937365_02418 CDS open 14755-16209 _na     484_aa MFS transporter
4827 MSKK01000060.1 GCA001937365_02419 CDS open 16262-17254 _na     330_aa HTH lacI-type domain-containing protein
4828 MSKK01000060.1 GCA001937365_02420 CDS open 17284-18267 _na     327_aa Ribokinase
4829 MSKK01000060.1 GCA001937365_02421 CDS open 18387-20297 _na     636_aa Tat pathway signal sequence domain protein
4830 MSKK01000060.1 GCA001937365_02402 gene open 35-589
4831 MSKK01000060.1 GCA001937365_02403 gene open 690-1703 pstC
4832 MSKK01000060.1 GCA001937365_02404 gene open 1705-2931 pstA
4833 MSKK01000060.1 GCA001937365_02405 gene open 2999-3778 pstB
4834 MSKK01000060.1 GCA001937365_02406 gene open 4222-4893 ompR
4835 MSKK01000060.1 GCA001937365_02407 gene open 5024-6223 terC
4836 MSKK01000060.1 GCA001937365_02408 gene open 6526-7263
4837 MSKK01000060.1 GCA001937365_02409 gene open 7263-8492
4838 MSKK01000060.1 GCA001937365_02410 gene open 8735-9130
4839 MSKK01000060.1 GCA001937365_02411 gene open 9130-9558 dtd
4840 MSKK01000060.1 GCA001937365_02412 gene open 9746-10315
4841 MSKK01000060.1 GCA001937365_02413 gene open 10427-10654
4842 MSKK01000060.1 GCA001937365_02414 gene open 11051-11203
4843 MSKK01000060.1 GCA001937365_02415 gene open 11674-12699 ilvA
4844 MSKK01000060.1 GCA001937365_02416 gene open 12782-13693 lysR
4845 MSKK01000060.1 GCA001937365_02417 gene open 13808-14758
4846 MSKK01000060.1 GCA001937365_02418 gene open 14755-16209
4847 MSKK01000060.1 GCA001937365_02419 gene open 16262-17254
4848 MSKK01000060.1 GCA001937365_02420 gene open 17284-18267
4849 MSKK01000060.1 GCA001937365_02421 gene open 18387-20297
4850 MSKK01000061.1 regulatory_region open 488-577 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
4851 MSKK01000061.1 GCA001937365_02422 CDS open 725-3220 _na     831_aa Tat pathway signal sequence domain protein
4852 MSKK01000061.1 GCA001937365_02423 CDS open 3230-4507 _na     425_aa Beta-carotene 15%2C15'-monooxygenase
4853 MSKK01000061.1 GCA001937365_02424 CDS open 4504-5445 _na     313_aa sucD succinate--CoA ligase subunit alpha
4854 MSKK01000061.1 GCA001937365_02425 CDS open 5449-6654 _na     401_aa sucC ADP-forming succinate--CoA ligase subunit beta
4855 MSKK01000061.1 GCA001937365_02426 CDS open 6937-9120 _na     727_aa hypothetical protein
4856 MSKK01000061.1 GCA001937365_02427 CDS open 9778-9918 _na     46_aa LPXTG-motif protein cell wall anchor domain protein
4857 MSKK01000061.1 GCA001937365_02422 gene open 725-3220
4858 MSKK01000061.1 GCA001937365_02423 gene open 3230-4507
4859 MSKK01000061.1 GCA001937365_02424 gene open 4504-5445 sucD
4860 MSKK01000061.1 GCA001937365_02425 gene open 5449-6654 sucC
4861 MSKK01000061.1 GCA001937365_02426 gene open 6937-9120
4862 MSKK01000061.1 GCA001937365_02427 gene open 9778-9918
4863 MSKK01000062.1 GCA001937365_02428 CDS open 210-692 _na     160_aa cdnL CarD-like/TRCF RNAP-interacting domain-containing protein
4864 MSKK01000062.1 GCA001937365_02429 CDS open 835-1653 _na     272_aa regX3 Sensory transduction protein RegX3
4865 MSKK01000062.1 GCA001937365_02430 CDS open 1650-2885 _na     411_aa senX3 Sensor-like histidine kinase SenX3
4866 MSKK01000062.1 GCA001937365_02431 CDS open 3088-3768 _na     226_aa phoU phosphate signaling complex protein PhoU
4867 MSKK01000062.1 GCA001937365_02432 CDS open 3859-4596 _na     245_aa gpmA phosphoglyceromutase
4868 MSKK01000062.1 GCA001937365_02433 CDS open 4860-5189 _na     109_aa Lsr2 family protein
4869 MSKK01000062.1 GCA001937365_02435 CDS open 6205-7752 _na     515_aa ansP Amino acid permease/ SLC12A domain-containing protein
4870 MSKK01000062.1 GCA001937365_02436 CDS open 7772-8770 _na     332_aa L-asparaginase%2C type I
4871 MSKK01000062.1 GCA001937365_02437 CDS open 8907-10457 _na     516_aa TAP-like protein
4872 MSKK01000062.1 GCA001937365_02438 CDS open 10602-11765 _na     387_aa Alpha/beta hydrolase
4873 MSKK01000062.1 GCA001937365_02428 gene open 210-692 cdnL
4874 MSKK01000062.1 GCA001937365_02429 gene open 835-1653 regX3
4875 MSKK01000062.1 GCA001937365_02430 gene open 1650-2885 senX3
4876 MSKK01000062.1 GCA001937365_02431 gene open 3088-3768 phoU
4877 MSKK01000062.1 GCA001937365_02432 gene open 3859-4596 gpmA
4878 MSKK01000062.1 GCA001937365_02433 gene open 4860-5189
4879 MSKK01000062.1 GCA001937365_02435 gene open 6205-7752 ansP
4880 MSKK01000062.1 GCA001937365_02436 gene open 7772-8770
4881 MSKK01000062.1 GCA001937365_02437 gene open 8907-10457
4882 MSKK01000062.1 GCA001937365_02438 gene open 10602-11765
4883 MSKK01000062.1 GCA001937365_02434 gene open 5808-5880 trnT
4884 MSKK01000062.1 GCA001937365_02434 tRNA open 5808-5880 trnT tRNA-Thr(cgt)
4885 MSKK01000063.1 GCA001937365_02439 CDS open 530-1087 _na     185_aa Transposase
4886 MSKK01000063.1 GCA001937365_02440 CDS open 1120-1311 _na     63_aa hypothetical protein
4887 MSKK01000063.1 GCA001937365_02441 CDS open 1525-1776 _na     83_aa DUF4244 domain-containing protein
4888 MSKK01000063.1 GCA001937365_02442 CDS open 1977-2291 _na     104_aa TadE-like protein
4889 MSKK01000063.1 GCA001937365_02443 CDS open 2288-2914 _na     208_aa hypothetical protein
4890 MSKK01000063.1 GCA001937365_02444 CDS open 3155-5275 _na     706_aa Multidrug ABC transporter ATP-binding protein
4891 MSKK01000063.1 GCA001937365_02445 CDS open 5272-7005 _na     577_aa mdlB ABC transporter transmembrane region
4892 MSKK01000063.1 GCA001937365_02446 CDS open 7203-10067 _na     954_aa yprA DEAD/DEAH box helicase
4893 MSKK01000063.1 GCA001937365_02447 CDS open 10425-10853 _na     142_aa zinc transporter
4894 MSKK01000063.1 GCA001937365_02448 CDS open 11204-11611 _na     135_aa DUF6318 domain-containing protein
4895 MSKK01000063.1 GCA001937365_02439 gene open 530-1087
4896 MSKK01000063.1 GCA001937365_02440 gene open 1120-1311
4897 MSKK01000063.1 GCA001937365_02441 gene open 1525-1776
4898 MSKK01000063.1 GCA001937365_02442 gene open 1977-2291
4899 MSKK01000063.1 GCA001937365_02443 gene open 2288-2914
4900 MSKK01000063.1 GCA001937365_02444 gene open 3155-5275
4901 MSKK01000063.1 GCA001937365_02445 gene open 5272-7005 mdlB
4902 MSKK01000063.1 GCA001937365_02446 gene open 7203-10067 yprA
4903 MSKK01000063.1 GCA001937365_02447 gene open 10425-10853
4904 MSKK01000063.1 GCA001937365_02448 gene open 11204-11611
4905 MSKK01000064.1 repeat_region open 1397-2339 CRISPR array with 15 repeats of length 36%2C consensus sequence GCTGGGAATCAGTCACCAGACCCCTTGATAGACTTC and spacer length 28
4906 MSKK01000064.1 GCA001937365_02449 CDS open 43-870 _na     275_aa MFS transporter
4907 MSKK01000064.1 GCA001937365_02450 CDS open 2379-2699 _na     106_aa cas2 CRISPR-associated endonuclease Cas2
4908 MSKK01000064.1 GCA001937365_02451 CDS open 2699-3607 _na     302_aa cas1 type II CRISPR-associated endonuclease Cas1
4909 MSKK01000064.1 GCA001937365_02452 CDS open 3617-6904 _na     1095_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
4910 MSKK01000064.1 GCA001937365_02449 gene open 43-870
4911 MSKK01000064.1 GCA001937365_02450 gene open 2379-2699 cas2
4912 MSKK01000064.1 GCA001937365_02451 gene open 2699-3607 cas1
4913 MSKK01000064.1 GCA001937365_02452 gene open 3617-6904 cas9
4914 MSKK01000065.1 GCA001937365_02453 CDS open 145-480 _na     111_aa WXG100 family type VII secretion target
4915 MSKK01000065.1 GCA001937365_02454 CDS open 687-2048 _na     453_aa HD domain-containing protein
4916 MSKK01000065.1 GCA001937365_02455 CDS open 2258-3856 _na     532_aa baeS histidine kinase
4917 MSKK01000065.1 GCA001937365_02456 CDS open 3856-4593 _na     245_aa ompR Response regulator mprA
4918 MSKK01000065.1 GCA001937365_02457 CDS open 4846-5457 _na     203_aa NYN domain-containing protein
4919 MSKK01000065.1 GCA001937365_02458 CDS open 5813-6658 _na     281_aa pspA PspA/IM30 family protein
4920 MSKK01000065.1 GCA001937365_02453 gene open 145-480
4921 MSKK01000065.1 GCA001937365_02454 gene open 687-2048
4922 MSKK01000065.1 GCA001937365_02455 gene open 2258-3856 baeS
4923 MSKK01000065.1 GCA001937365_02456 gene open 3856-4593 ompR
4924 MSKK01000065.1 GCA001937365_02457 gene open 4846-5457
4925 MSKK01000065.1 GCA001937365_02458 gene open 5813-6658 pspA
4926 MSKK01000066.1 GCA001937365_02459 CDS open 113-664 _na     183_aa Calpain catalytic domain-containing protein
4927 MSKK01000066.1 GCA001937365_02460 CDS open 1022-1237 _na     71_aa hypothetical protein
4928 MSKK01000066.1 GCA001937365_02461 CDS open 1267-2019 _na     250_aa Putative ATPase
4929 MSKK01000066.1 GCA001937365_02462 CDS open 2706-3473 _na     255_aa espG ESX secretion-associated protein EspG
4930 MSKK01000066.1 GCA001937365_02463 CDS open 3470-3946 _na     158_aa DUF1795 domain-containing protein
4931 MSKK01000066.1 GCA001937365_02464 CDS open 5318-6493 _na     391_aa Glycine zipper domain-containing protein
4932 MSKK01000066.1 GCA001937365_02465 CDS open 6533-6808 _na     91_aa hypothetical protein
4933 MSKK01000066.1 GCA001937365_02466 CDS open 7048-7410 _na     120_aa Transposase
4934 MSKK01000066.1 GCA001937365_02467 CDS open 7514-7750 _na     78_aa hypothetical protein
4935 MSKK01000066.1 GCA001937365_02459 gene open 113-664
4936 MSKK01000066.1 GCA001937365_02460 gene open 1022-1237
4937 MSKK01000066.1 GCA001937365_02461 gene open 1267-2019
4938 MSKK01000066.1 GCA001937365_02462 gene open 2706-3473 espG
4939 MSKK01000066.1 GCA001937365_02463 gene open 3470-3946
4940 MSKK01000066.1 GCA001937365_02464 gene open 5318-6493
4941 MSKK01000066.1 GCA001937365_02465 gene open 6533-6808
4942 MSKK01000066.1 GCA001937365_02466 gene open 7048-7410
4943 MSKK01000066.1 GCA001937365_02467 gene open 7514-7750
4944 MSKK01000067.1 GCA001937365_02468 CDS open 385-705 _na     106_aa hypothetical protein
4945 MSKK01000067.1 GCA001937365_02469 CDS open 1024-1941 _na     305_aa guaA1 GMP synthase [glutamine-hydrolyzing]
4946 MSKK01000067.1 GCA001937365_02470 CDS open 2003-3697 _na     564_aa sSL2 DNA repair helicase XPB
4947 MSKK01000067.1 GCA001937365_02471 CDS open 4110-6653 _na     847_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
4948 MSKK01000067.1 GCA001937365_02468 gene open 385-705
4949 MSKK01000067.1 GCA001937365_02469 gene open 1024-1941 guaA1
4950 MSKK01000067.1 GCA001937365_02470 gene open 2003-3697 sSL2
4951 MSKK01000067.1 GCA001937365_02471 gene open 4110-6653
4952 MSKK01000068.1 GCA001937365_02472 CDS open 389-1162 _na     257_aa ppgK polyphosphate--glucose phosphotransferase
4953 MSKK01000068.1 GCA001937365_02473 CDS open 1281-3275 _na     664_aa oPT OPT family oligopeptide transporter
4954 MSKK01000068.1 GCA001937365_02474 CDS open 3590-4186 _na     198_aa tetR TetR family transcriptional regulator
4955 MSKK01000068.1 GCA001937365_02475 CDS open 4318-5184 _na     288_aa Divinyl chlorophyllide a 8-vinyl-reductase%2C chloroplastic
4956 MSKK01000068.1 GCA001937365_02476 CDS open 5194-6180 _na     328_aa Glycosyl transferase family 2
4957 MSKK01000068.1 GCA001937365_02477 CDS open 6237-6392 _na     51_aa hypothetical protein
4958 MSKK01000068.1 GCA001937365_02478 CDS open 6432-7418 _na     328_aa Xre family DNA binding protein
4959 MSKK01000068.1 GCA001937365_02479 CDS open 7537-8334 _na     265_aa Restriction endonuclease
4960 MSKK01000068.1 GCA001937365_02481 CDS open 8767-10368 _na     533_aa hypothetical protein
4961 MSKK01000068.1 GCA001937365_02482 CDS open 10585-11331 _na     248_aa [ribosomal protein uS5]-alanine N-acetyltransferase
4962 MSKK01000068.1 GCA001937365_02483 CDS open 11331-12542 _na     403_aa glp gephyrin-like molybdotransferase Glp
4963 MSKK01000068.1 GCA001937365_02484 CDS open 12638-13300 _na     220_aa 5-formyltetrahydrofolate cyclo-ligase
4964 MSKK01000068.1 GCA001937365_02472 gene open 389-1162 ppgK
4965 MSKK01000068.1 GCA001937365_02473 gene open 1281-3275 oPT
4966 MSKK01000068.1 GCA001937365_02474 gene open 3590-4186 tetR
4967 MSKK01000068.1 GCA001937365_02475 gene open 4318-5184
4968 MSKK01000068.1 GCA001937365_02476 gene open 5194-6180
4969 MSKK01000068.1 GCA001937365_02477 gene open 6237-6392
4970 MSKK01000068.1 GCA001937365_02478 gene open 6432-7418
4971 MSKK01000068.1 GCA001937365_02479 gene open 7537-8334
4972 MSKK01000068.1 GCA001937365_02481 gene open 8767-10368
4973 MSKK01000068.1 GCA001937365_02482 gene open 10585-11331
4974 MSKK01000068.1 GCA001937365_02483 gene open 11331-12542 glp
4975 MSKK01000068.1 GCA001937365_02484 gene open 12638-13300
4976 MSKK01000068.1 GCA001937365_02480 gene open 8581-8656 trnA
4977 MSKK01000068.1 GCA001937365_02480 tRNA open 8581-8656 trnA tRNA-Ala(cgc)
4978 MSKK01000069.1 GCA001937365_02485 CDS open 254-1108 _na     284_aa Tetratricopeptide repeat protein
4979 MSKK01000069.1 GCA001937365_02486 CDS open 1292-2017 _na     241_aa rplQ 50S ribosomal protein L17
4980 MSKK01000069.1 GCA001937365_02487 CDS open 2048-3049 _na     333_aa DNA-directed RNA polymerase subunit alpha
4981 MSKK01000069.1 GCA001937365_02488 CDS open 3207-3608 _na     133_aa rpsK 30S ribosomal protein S11
4982 MSKK01000069.1 GCA001937365_02489 CDS open 3671-4045 _na     124_aa rpsM 30S ribosomal protein S13
4983 MSKK01000069.1 GCA001937365_02490 CDS open 4211-4324 _na     37_aa rpmJ 50S ribosomal protein L36
4984 MSKK01000069.1 GCA001937365_02491 CDS open 4358-4579 _na     73_aa infA translation initiation factor IF-1
4985 MSKK01000069.1 GCA001937365_02492 CDS open 4955-5836 _na     293_aa map type I methionyl aminopeptidase
4986 MSKK01000069.1 GCA001937365_02493 CDS open 5971-6558 _na     195_aa adk adenylate kinase
4987 MSKK01000069.1 GCA001937365_02494 CDS open 6555-7847 _na     430_aa secY preprotein translocase subunit SecY
4988 MSKK01000069.1 GCA001937365_02495 CDS open 8197-8673 _na     158_aa rplO 50S ribosomal protein L15
4989 MSKK01000069.1 GCA001937365_02496 CDS open 8675-8881 _na     68_aa rpmD 50S ribosomal protein L30
4990 MSKK01000069.1 GCA001937365_02497 CDS open 8881-9588 _na     235_aa rpsE 30S ribosomal protein S5
4991 MSKK01000069.1 GCA001937365_02498 CDS open 9623-10003 _na     126_aa rplR 50S ribosomal protein L18
4992 MSKK01000069.1 GCA001937365_02499 CDS open 10006-10545 _na     179_aa rplF 50S ribosomal protein L6
4993 MSKK01000069.1 GCA001937365_02500 CDS open 10567-10965 _na     132_aa rpsH 30S ribosomal protein S8
4994 MSKK01000069.1 GCA001937365_02501 CDS open 11024-11209 _na     61_aa rpsN type Z 30S ribosomal protein S14
4995 MSKK01000069.1 GCA001937365_02502 CDS open 11211-11768 _na     185_aa rplE 50S ribosomal protein L5
4996 MSKK01000069.1 GCA001937365_02503 CDS open 11771-12115 _na     114_aa rplX 50S ribosomal protein L24
4997 MSKK01000069.1 GCA001937365_02504 CDS open 12118-12486 _na     122_aa rplN 50S ribosomal protein L14
4998 MSKK01000069.1 GCA001937365_02505 CDS open 13338-13631 _na     97_aa rpsQ 30S ribosomal protein S17
4999 MSKK01000069.1 GCA001937365_02506 CDS open 13628-13873 _na     81_aa rpmC 50S ribosomal protein L29
5000 MSKK01000069.1 GCA001937365_02507 CDS open 13873-14292 _na     139_aa rplP 50S ribosomal protein L16