HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces oris clade-079 (GCA_001937365.1)

Select a Genome:
BAKTA Annotations for GCA_001937365.1
Genome Selected: Actinomyces oris clade-079
ContigsBases CDSrRNA tmRNAtRNA
87 3046442 2496 0 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5121 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 5121 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 MSKK01000042.1 GCA001937365_02060 CDS open 127657-128859 _na     400_aa hypothetical protein
4002 MSKK01000042.1 GCA001937365_01944 gene open 813-1127
4003 MSKK01000042.1 GCA001937365_01945 gene open 1840-2583
4004 MSKK01000042.1 GCA001937365_01946 gene open 2559-3131
4005 MSKK01000042.1 GCA001937365_01947 gene open 3323-4450
4006 MSKK01000042.1 GCA001937365_01948 gene open 4506-6020 proP
4007 MSKK01000042.1 GCA001937365_01949 gene open 6017-6586 tetR
4008 MSKK01000042.1 GCA001937365_01950 gene open 6645-8696
4009 MSKK01000042.1 GCA001937365_01951 gene open 8745-9845 ndh
4010 MSKK01000042.1 GCA001937365_01952 gene open 9918-10226
4011 MSKK01000042.1 GCA001937365_01953 gene open 10306-11286 pdxI
4012 MSKK01000042.1 GCA001937365_01954 gene open 11310-11540 tusA
4013 MSKK01000042.1 GCA001937365_01955 gene open 11611-12099
4014 MSKK01000042.1 GCA001937365_01956 gene open 12442-13227 recB
4015 MSKK01000042.1 GCA001937365_01957 gene open 13528-14649
4016 MSKK01000042.1 GCA001937365_01958 gene open 14684-14998 mazF3
4017 MSKK01000042.1 GCA001937365_01959 gene open 15002-15235
4018 MSKK01000042.1 GCA001937365_01960 gene open 15326-16417
4019 MSKK01000042.1 GCA001937365_01961 gene open 16410-18104 arc
4020 MSKK01000042.1 GCA001937365_01962 gene open 18101-19822 dop
4021 MSKK01000042.1 GCA001937365_01963 gene open 19834-20049
4022 MSKK01000042.1 GCA001937365_01964 gene open 20052-21491 pafA
4023 MSKK01000042.1 GCA001937365_01965 gene open 22022-23050
4024 MSKK01000042.1 GCA001937365_01966 gene open 23047-23817 hisF
4025 MSKK01000042.1 GCA001937365_01967 gene open 23783-23881
4026 MSKK01000042.1 GCA001937365_01968 gene open 24171-24506
4027 MSKK01000042.1 GCA001937365_01969 gene open 24885-25286
4028 MSKK01000042.1 GCA001937365_01970 gene open 25385-25774
4029 MSKK01000042.1 GCA001937365_01971 gene open 25787-26164 hisI
4030 MSKK01000042.1 GCA001937365_01972 gene open 26280-27104 trpC
4031 MSKK01000042.1 GCA001937365_01973 gene open 27105-28148 lgt
4032 MSKK01000042.1 GCA001937365_01974 gene open 28272-29702 pyk
4033 MSKK01000042.1 GCA001937365_01975 gene open 29776-30174 cdd
4034 MSKK01000042.1 GCA001937365_01977 gene open 30361-30969 amiR
4035 MSKK01000042.1 GCA001937365_01978 gene open 31003-31641
4036 MSKK01000042.1 GCA001937365_01979 gene open 31755-34496 polA
4037 MSKK01000042.1 GCA001937365_01980 gene open 34808-36262 rpsA
4038 MSKK01000042.1 GCA001937365_01981 gene open 36463-38205
4039 MSKK01000042.1 GCA001937365_01982 gene open 38351-38944 coaE
4040 MSKK01000042.1 GCA001937365_01983 gene open 39062-39751
4041 MSKK01000042.1 GCA001937365_01984 gene open 39767-39856
4042 MSKK01000042.1 GCA001937365_01985 gene open 40104-42200 uvrB
4043 MSKK01000042.1 GCA001937365_01986 gene open 42491-43951 arcD
4044 MSKK01000042.1 GCA001937365_01987 gene open 44014-45255 arcA
4045 MSKK01000042.1 GCA001937365_01988 gene open 45586-46638 terC
4046 MSKK01000042.1 GCA001937365_01989 gene open 46635-49124 mgtA
4047 MSKK01000042.1 GCA001937365_01990 gene open 49138-49797
4048 MSKK01000042.1 GCA001937365_01991 gene open 49767-50051
4049 MSKK01000042.1 GCA001937365_01992 gene open 50191-53037 uvrA
4050 MSKK01000042.1 GCA001937365_01993 gene open 53110-55809
4051 MSKK01000042.1 GCA001937365_01994 gene open 56017-57393 qRI1
4052 MSKK01000042.1 GCA001937365_01999 gene open 58154-60310 uvrC
4053 MSKK01000042.1 GCA001937365_02000 gene open 60361-60573 mopI
4054 MSKK01000042.1 GCA001937365_02001 gene open 60717-61559 bglG
4055 MSKK01000042.1 GCA001937365_02002 gene open 61743-63593 nagE
4056 MSKK01000042.1 GCA001937365_02003 gene open 63647-65110 bglH
4057 MSKK01000042.1 GCA001937365_02004 gene open 65142-66428 purT
4058 MSKK01000042.1 GCA001937365_02005 gene open 66549-67523 rapZ
4059 MSKK01000042.1 GCA001937365_02006 gene open 67527-68522 cofD
4060 MSKK01000042.1 GCA001937365_02007 gene open 68802-69782 whiA
4061 MSKK01000042.1 GCA001937365_02008 gene open 70031-71038 gap
4062 MSKK01000042.1 GCA001937365_02009 gene open 71151-72344 pgk
4063 MSKK01000042.1 GCA001937365_02010 gene open 72360-73139 tpiA
4064 MSKK01000042.1 GCA001937365_02011 gene open 73371-73613 secG
4065 MSKK01000042.1 GCA001937365_02012 gene open 73792-74628 xerD
4066 MSKK01000042.1 GCA001937365_02013 gene open 74789-75661 parA
4067 MSKK01000042.1 GCA001937365_02014 gene open 75651-76472 scpA
4068 MSKK01000042.1 GCA001937365_02015 gene open 76469-77068 scpB
4069 MSKK01000042.1 GCA001937365_02016 gene open 77065-78039 rsuA
4070 MSKK01000042.1 GCA001937365_02017 gene open 78036-79196
4071 MSKK01000042.1 GCA001937365_02018 gene open 79327-81486 der
4072 MSKK01000042.1 GCA001937365_02019 gene open 81575-83230 pgi
4073 MSKK01000042.1 GCA001937365_02020 gene open 83294-83590
4074 MSKK01000042.1 GCA001937365_02021 gene open 83652-84521
4075 MSKK01000042.1 GCA001937365_02022 gene open 84665-85609
4076 MSKK01000042.1 GCA001937365_02024 gene open 86264-86701
4077 MSKK01000042.1 GCA001937365_02025 gene open 86724-87785
4078 MSKK01000042.1 GCA001937365_02026 gene open 87866-88657
4079 MSKK01000042.1 GCA001937365_02027 gene open 88650-89618 opcA
4080 MSKK01000042.1 GCA001937365_02028 gene open 89615-91078 zwf
4081 MSKK01000042.1 GCA001937365_02029 gene open 91555-93030 gndA
4082 MSKK01000042.1 GCA001937365_02030 gene open 93101-95812 pepN
4083 MSKK01000042.1 GCA001937365_02031 gene open 96070-96522 fHA
4084 MSKK01000042.1 GCA001937365_02032 gene open 96519-97283 soxR
4085 MSKK01000042.1 GCA001937365_02033 gene open 97493-97891
4086 MSKK01000042.1 GCA001937365_02034 gene open 98158-98736 soxR
4087 MSKK01000042.1 GCA001937365_02035 gene open 98898-99857
4088 MSKK01000042.1 GCA001937365_02036 gene open 99881-101482 hscA
4089 MSKK01000042.1 GCA001937365_02037 gene open 101791-103029 pitA
4090 MSKK01000042.1 GCA001937365_02038 gene open 103026-103271
4091 MSKK01000042.1 GCA001937365_02039 gene open 103319-104851
4092 MSKK01000042.1 GCA001937365_02040 gene open 105077-107149
4093 MSKK01000042.1 GCA001937365_02041 gene open 107233-108261 purR
4094 MSKK01000042.1 GCA001937365_02042 gene open 108373-108996 tesA
4095 MSKK01000042.1 GCA001937365_02043 gene open 109338-109601
4096 MSKK01000042.1 GCA001937365_02044 gene open 109683-110561
4097 MSKK01000042.1 GCA001937365_02045 gene open 110593-111714 pfkA
4098 MSKK01000042.1 GCA001937365_02046 gene open 111945-112304 rbpA
4099 MSKK01000042.1 GCA001937365_02047 gene open 112313-113152 wcaA
4100 MSKK01000042.1 GCA001937365_02048 gene open 113222-114946 lnt
4101 MSKK01000042.1 GCA001937365_02049 gene open 114918-115835
4102 MSKK01000042.1 GCA001937365_02050 gene open 115894-118836 dob10
4103 MSKK01000042.1 GCA001937365_02051 gene open 118858-119829 lCB5
4104 MSKK01000042.1 GCA001937365_02052 gene open 119877-120698 tatC
4105 MSKK01000042.1 GCA001937365_02053 gene open 120744-121004 tatA
4106 MSKK01000042.1 GCA001937365_02054 gene open 121116-122087 pafC
4107 MSKK01000042.1 GCA001937365_02055 gene open 122090-123118
4108 MSKK01000042.1 GCA001937365_02056 gene open 123187-124359
4109 MSKK01000042.1 GCA001937365_02057 gene open 124352-125740
4110 MSKK01000042.1 GCA001937365_02058 gene open 125737-126492
4111 MSKK01000042.1 GCA001937365_02059 gene open 126591-127382
4112 MSKK01000042.1 GCA001937365_02060 gene open 127657-128859
4113 MSKK01000042.1 GCA001937365_01976 gene open 30230-30306 trnL
4114 MSKK01000042.1 GCA001937365_01995 gene open 57553-57625 trnV
4115 MSKK01000042.1 GCA001937365_01996 gene open 57776-57848 trnG
4116 MSKK01000042.1 GCA001937365_01997 gene open 57885-57955 trnC
4117 MSKK01000042.1 GCA001937365_01998 gene open 57957-58031 trnV
4118 MSKK01000042.1 GCA001937365_02023 gene open 86087-86163 trnP
4119 MSKK01000042.1 GCA001937365_01976 tRNA open 30230-30306 trnL tRNA-Leu(caa)
4120 MSKK01000042.1 GCA001937365_01995 tRNA open 57553-57625 trnV tRNA-Val(cac)
4121 MSKK01000042.1 GCA001937365_01996 tRNA open 57776-57848 trnG tRNA-Gly(gcc)
4122 MSKK01000042.1 GCA001937365_01997 tRNA open 57885-57955 trnC tRNA-Cys(gca)
4123 MSKK01000042.1 GCA001937365_01998 tRNA open 57957-58031 trnV tRNA-Val(gac)
4124 MSKK01000042.1 GCA001937365_02023 tRNA open 86087-86163 trnP tRNA-Pro(ggg)
4125 MSKK01000043.1 GCA001937365_02061 CDS open 413-1867 _na     484_aa Adenylosuccinate lyase
4126 MSKK01000043.1 GCA001937365_02062 CDS open 2228-2392 _na     54_aa hypothetical protein
4127 MSKK01000043.1 GCA001937365_02063 CDS open 2638-3864 _na     408_aa Thiopeptide-type bacteriocin biosynthesis domain protein
4128 MSKK01000043.1 GCA001937365_02064 CDS open 3861-6503 _na     880_aa DUF222 domain-containing protein
4129 MSKK01000043.1 GCA001937365_02065 CDS open 6500-7726 _na     408_aa pqqD PqqD family protein
4130 MSKK01000043.1 GCA001937365_02066 CDS open 7824-8027 _na     67_aa Thiocillin family RiPP
4131 MSKK01000043.1 GCA001937365_02067 CDS open 8233-8970 _na     245_aa Nitroreductase domain-containing protein
4132 MSKK01000043.1 GCA001937365_02068 CDS open 8960-10792 _na     610_aa Bacteriocin biosynthesis protein
4133 MSKK01000043.1 GCA001937365_02069 CDS open 10794-11576 _na     260_aa Cyclodehydratase
4134 MSKK01000043.1 GCA001937365_02070 CDS open 11582-12964 _na     460_aa ycaO YcaO domain-containing protein
4135 MSKK01000043.1 GCA001937365_02071 CDS open 13230-13955 _na     241_aa DNA-binding response regulator
4136 MSKK01000043.1 GCA001937365_02072 CDS open 14001-14996 _na     331_aa hypothetical protein
4137 MSKK01000043.1 GCA001937365_02073 CDS open 15143-15424 _na     93_aa frmR Copper-sensing transcriptional repressor CsoR
4138 MSKK01000043.1 GCA001937365_02074 CDS open 15509-15778 _na     89_aa copZ HMA domain-containing protein
4139 MSKK01000043.1 GCA001937365_02075 CDS open 15861-18665 _na     934_aa ATPase P
4140 MSKK01000043.1 GCA001937365_02076 CDS open 18683-19348 _na     221_aa SMI1/KNR4 family protein
4141 MSKK01000043.1 GCA001937365_02077 CDS open 19758-21155 _na     465_aa cysteine-S-conjugate beta-lyase
4142 MSKK01000043.1 GCA001937365_02078 CDS open 21287-22495 _na     402_aa metC Cystathionine gamma-synthase
4143 MSKK01000043.1 GCA001937365_02079 CDS open 23061-24251 _na     396_aa hypothetical protein
4144 MSKK01000043.1 GCA001937365_02081 CDS open 25059-26399 _na     446_aa Cardiolipin synthase N-terminal domain-containing protein
4145 MSKK01000043.1 GCA001937365_02083 CDS open 26977-27687 _na     236_aa DNA alkylation repair enzyme
4146 MSKK01000043.1 GCA001937365_02085 CDS open 28682-30031 _na     449_aa yihS N-acylglucosamine 2-epimerase
4147 MSKK01000043.1 GCA001937365_02086 CDS open 30166-31788 _na     540_aa Glucoside ABC transporter substrate-binding protein
4148 MSKK01000043.1 GCA001937365_02087 CDS open 31788-32921 _na     377_aa Haloacid dehalogenase
4149 MSKK01000043.1 GCA001937365_02088 CDS open 32933-34213 _na     426_aa serS serine--tRNA ligase
4150 MSKK01000043.1 GCA001937365_02089 CDS open 34773-35705 _na     310_aa lysR putative hydrogen peroxide-inducible genes activator
4151 MSKK01000043.1 GCA001937365_02090 CDS open 35817-37028 _na     403_aa DAGKc domain-containing protein
4152 MSKK01000043.1 GCA001937365_02091 CDS open 37172-37345 _na     57_aa hypothetical protein
4153 MSKK01000043.1 GCA001937365_02061 gene open 413-1867
4154 MSKK01000043.1 GCA001937365_02062 gene open 2228-2392
4155 MSKK01000043.1 GCA001937365_02063 gene open 2638-3864
4156 MSKK01000043.1 GCA001937365_02064 gene open 3861-6503
4157 MSKK01000043.1 GCA001937365_02065 gene open 6500-7726 pqqD
4158 MSKK01000043.1 GCA001937365_02066 gene open 7824-8027
4159 MSKK01000043.1 GCA001937365_02067 gene open 8233-8970
4160 MSKK01000043.1 GCA001937365_02068 gene open 8960-10792
4161 MSKK01000043.1 GCA001937365_02069 gene open 10794-11576
4162 MSKK01000043.1 GCA001937365_02070 gene open 11582-12964 ycaO
4163 MSKK01000043.1 GCA001937365_02071 gene open 13230-13955
4164 MSKK01000043.1 GCA001937365_02072 gene open 14001-14996
4165 MSKK01000043.1 GCA001937365_02073 gene open 15143-15424 frmR
4166 MSKK01000043.1 GCA001937365_02074 gene open 15509-15778 copZ
4167 MSKK01000043.1 GCA001937365_02075 gene open 15861-18665
4168 MSKK01000043.1 GCA001937365_02076 gene open 18683-19348
4169 MSKK01000043.1 GCA001937365_02077 gene open 19758-21155
4170 MSKK01000043.1 GCA001937365_02078 gene open 21287-22495 metC
4171 MSKK01000043.1 GCA001937365_02079 gene open 23061-24251
4172 MSKK01000043.1 GCA001937365_02081 gene open 25059-26399
4173 MSKK01000043.1 GCA001937365_02083 gene open 26977-27687
4174 MSKK01000043.1 GCA001937365_02085 gene open 28682-30031 yihS
4175 MSKK01000043.1 GCA001937365_02086 gene open 30166-31788
4176 MSKK01000043.1 GCA001937365_02087 gene open 31788-32921
4177 MSKK01000043.1 GCA001937365_02088 gene open 32933-34213 serS
4178 MSKK01000043.1 GCA001937365_02089 gene open 34773-35705 lysR
4179 MSKK01000043.1 GCA001937365_02090 gene open 35817-37028
4180 MSKK01000043.1 GCA001937365_02091 gene open 37172-37345
4181 MSKK01000043.1 GCA001937365_02080 gene open 24822-24897 trnR
4182 MSKK01000043.1 GCA001937365_02082 gene open 26612-26698 trnS
4183 MSKK01000043.1 GCA001937365_02084 gene open 28392-28480 trnS
4184 MSKK01000043.1 GCA001937365_02080 tRNA open 24822-24897 trnR tRNA-Arg(acg)
4185 MSKK01000043.1 GCA001937365_02082 tRNA open 26612-26698 trnS tRNA-Ser(gct)
4186 MSKK01000043.1 GCA001937365_02084 tRNA open 28392-28480 trnS tRNA-Ser(tga)
4187 MSKK01000044.1 regulatory_region open 9076-9231 c-di-AMP riboswitch aptamer (ydaO/yuaA leader)
4188 MSKK01000044.1 GCA001937365_02092 CDS open 99-884 _na     261_aa cpaB Pilus assembly protein CpaB
4189 MSKK01000044.1 GCA001937365_02093 CDS open 987-1436 _na     149_aa mscL large conductance mechanosensitive channel protein MscL
4190 MSKK01000044.1 GCA001937365_02094 CDS open 2071-2397 _na     108_aa Transcriptional regulator
4191 MSKK01000044.1 GCA001937365_02095 CDS open 2443-6753 _na     1436_aa Restriction endonuclease type II-like domain-containing protein
4192 MSKK01000044.1 GCA001937365_02097 CDS open 7127-8065 _na     312_aa uspA UspA domain-containing protein
4193 MSKK01000044.1 GCA001937365_02098 CDS open 8263-9072 _na     269_aa NlpC/P60 domain-containing protein
4194 MSKK01000044.1 GCA001937365_02099 CDS open 9689-10360 _na     223_aa mntR Iron-dependent repressor IdeR
4195 MSKK01000044.1 GCA001937365_02100 CDS open 10614-11918 _na     434_aa hypothetical protein
4196 MSKK01000044.1 GCA001937365_02101 CDS open 12013-13530 _na     505_aa nCS2 Permease
4197 MSKK01000044.1 GCA001937365_02102 CDS open 13799-14782 _na     327_aa DUF418 domain-containing protein
4198 MSKK01000044.1 GCA001937365_02103 CDS open 14869-15897 _na     342_aa Serine protease
4199 MSKK01000044.1 GCA001937365_02104 CDS open 16076-20995 _na     1639_aa DEAD/DEAH box helicase
4200 MSKK01000044.1 GCA001937365_02105 CDS open 21063-21899 _na     278_aa udg4 Type-5 uracil-DNA glycosylase
4201 MSKK01000044.1 GCA001937365_02092 gene open 99-884 cpaB
4202 MSKK01000044.1 GCA001937365_02093 gene open 987-1436 mscL
4203 MSKK01000044.1 GCA001937365_02094 gene open 2071-2397
4204 MSKK01000044.1 GCA001937365_02095 gene open 2443-6753
4205 MSKK01000044.1 GCA001937365_02097 gene open 7127-8065 uspA
4206 MSKK01000044.1 GCA001937365_02098 gene open 8263-9072
4207 MSKK01000044.1 GCA001937365_02099 gene open 9689-10360 mntR
4208 MSKK01000044.1 GCA001937365_02100 gene open 10614-11918
4209 MSKK01000044.1 GCA001937365_02101 gene open 12013-13530 nCS2
4210 MSKK01000044.1 GCA001937365_02102 gene open 13799-14782
4211 MSKK01000044.1 GCA001937365_02103 gene open 14869-15897
4212 MSKK01000044.1 GCA001937365_02104 gene open 16076-20995
4213 MSKK01000044.1 GCA001937365_02105 gene open 21063-21899 udg4
4214 MSKK01000044.1 GCA001937365_02096 gene open 6953-7025 trnR
4215 MSKK01000044.1 GCA001937365_02096 tRNA open 6953-7025 trnR tRNA-Arg(cct)
4216 MSKK01000045.1 GCA001937365_02106 CDS open 336-2222 _na     628_aa ilvD dihydroxy-acid dehydratase
4217 MSKK01000045.1 GCA001937365_02107 CDS open 2304-3152 _na     282_aa ABC transporter domain-containing protein
4218 MSKK01000045.1 GCA001937365_02108 CDS open 3149-4066 _na     305_aa ABC transporter domain-containing protein
4219 MSKK01000045.1 GCA001937365_02109 CDS open 4115-5671 _na     518_aa ddpA Solute-binding protein family 5 domain-containing protein
4220 MSKK01000045.1 GCA001937365_02110 CDS open 5677-7416 _na     579_aa ABC transporter%2C permease protein
4221 MSKK01000045.1 GCA001937365_02111 CDS open 7556-8089 _na     177_aa DUF4242 domain-containing protein
4222 MSKK01000045.1 GCA001937365_02112 CDS open 8245-8568 _na     107_aa Transcriptional regulator
4223 MSKK01000045.1 GCA001937365_02113 CDS open 9068-10633 _na     521_aa ilvA threonine ammonia-lyase%2C biosynthetic
4224 MSKK01000045.1 GCA001937365_02114 CDS open 10843-11397 _na     184_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
4225 MSKK01000045.1 GCA001937365_02115 CDS open 11542-13422 _na     626_aa ATPase of the ABC class
4226 MSKK01000045.1 GCA001937365_02116 CDS open 13613-14563 _na     316_aa Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system
4227 MSKK01000045.1 GCA001937365_02117 CDS open 14675-15403 _na     242_aa Conserved domain protein
4228 MSKK01000045.1 GCA001937365_02118 CDS open 16411-17784 _na     457_aa SLH domain-containing protein
4229 MSKK01000045.1 GCA001937365_02119 CDS open 18003-18473 _na     156_aa hypothetical protein
4230 MSKK01000045.1 GCA001937365_02120 CDS open 18601-19317 _na     238_aa msrA Peptide methionine sulfoxide reductase MsrA
4231 MSKK01000045.1 GCA001937365_02121 CDS open 19409-19972 _na     187_aa hypothetical protein
4232 MSKK01000045.1 GCA001937365_02122 CDS open 20081-20566 _na     161_aa greA Transcription elongation factor GreA
4233 MSKK01000045.1 GCA001937365_02123 CDS open 20899-21609 _na     236_aa yqfA Hemolysin III family channel protein
4234 MSKK01000045.1 GCA001937365_02124 CDS open 21989-22813 _na     274_aa uppS isoprenyl transferase
4235 MSKK01000045.1 GCA001937365_02125 CDS open 23023-23736 _na     237_aa fadR HTH gntR-type domain-containing protein
4236 MSKK01000045.1 GCA001937365_02126 CDS open 23863-24390 _na     175_aa gntK Gluconokinase
4237 MSKK01000045.1 GCA001937365_02127 CDS open 24529-25941 _na     470_aa gntT Gluconate transporter
4238 MSKK01000045.1 GCA001937365_02128 CDS open 26171-27724 _na     517_aa DEAD/DEAH box helicase
4239 MSKK01000045.1 GCA001937365_02129 CDS open 27911-28177 _na     88_aa Transglycosylase
4240 MSKK01000045.1 GCA001937365_02130 CDS open 28266-29159 _na     297_aa Esterase
4241 MSKK01000045.1 GCA001937365_02131 CDS open 29318-29821 _na     167_aa Integrase SAM-like N-terminal domain-containing protein
4242 MSKK01000045.1 GCA001937365_02133 CDS open 30214-30876 _na     220_aa DNA-directed RNA polymerase subunit beta
4243 MSKK01000045.1 GCA001937365_02134 CDS open 31331-34186 _na     951_aa ppk RNA degradosome polyphosphate kinase
4244 MSKK01000045.1 GCA001937365_02135 CDS open 34199-35227 _na     342_aa yjhB Nudix hydrolase domain-containing protein
4245 MSKK01000045.1 GCA001937365_02136 CDS open 35344-35673 _na     109_aa Cell surface protein
4246 MSKK01000045.1 GCA001937365_02106 gene open 336-2222 ilvD
4247 MSKK01000045.1 GCA001937365_02107 gene open 2304-3152
4248 MSKK01000045.1 GCA001937365_02108 gene open 3149-4066
4249 MSKK01000045.1 GCA001937365_02109 gene open 4115-5671 ddpA
4250 MSKK01000045.1 GCA001937365_02110 gene open 5677-7416
4251 MSKK01000045.1 GCA001937365_02111 gene open 7556-8089
4252 MSKK01000045.1 GCA001937365_02112 gene open 8245-8568
4253 MSKK01000045.1 GCA001937365_02113 gene open 9068-10633 ilvA
4254 MSKK01000045.1 GCA001937365_02114 gene open 10843-11397 ssuE
4255 MSKK01000045.1 GCA001937365_02115 gene open 11542-13422
4256 MSKK01000045.1 GCA001937365_02116 gene open 13613-14563
4257 MSKK01000045.1 GCA001937365_02117 gene open 14675-15403
4258 MSKK01000045.1 GCA001937365_02118 gene open 16411-17784
4259 MSKK01000045.1 GCA001937365_02119 gene open 18003-18473
4260 MSKK01000045.1 GCA001937365_02120 gene open 18601-19317 msrA
4261 MSKK01000045.1 GCA001937365_02121 gene open 19409-19972
4262 MSKK01000045.1 GCA001937365_02122 gene open 20081-20566 greA
4263 MSKK01000045.1 GCA001937365_02123 gene open 20899-21609 yqfA
4264 MSKK01000045.1 GCA001937365_02124 gene open 21989-22813 uppS
4265 MSKK01000045.1 GCA001937365_02125 gene open 23023-23736 fadR
4266 MSKK01000045.1 GCA001937365_02126 gene open 23863-24390 gntK
4267 MSKK01000045.1 GCA001937365_02127 gene open 24529-25941 gntT
4268 MSKK01000045.1 GCA001937365_02128 gene open 26171-27724
4269 MSKK01000045.1 GCA001937365_02129 gene open 27911-28177
4270 MSKK01000045.1 GCA001937365_02130 gene open 28266-29159
4271 MSKK01000045.1 GCA001937365_02131 gene open 29318-29821
4272 MSKK01000045.1 GCA001937365_02133 gene open 30214-30876
4273 MSKK01000045.1 GCA001937365_02134 gene open 31331-34186 ppk
4274 MSKK01000045.1 GCA001937365_02135 gene open 34199-35227 yjhB
4275 MSKK01000045.1 GCA001937365_02136 gene open 35344-35673
4276 MSKK01000045.1 GCA001937365_02132 gene open 29953-30026 trnK
4277 MSKK01000045.1 GCA001937365_02132 tRNA open 29953-30026 trnK tRNA-Lys(ttt)
4278 MSKK01000046.1 GCA001937365_02137 gene open 98-466 ssrA
4279 MSKK01000046.1 GCA001937365_02137 tmRNA open 98-466 ssrA transfer-messenger RNA%2C SsrA
4280 MSKK01000046.1 GCA001937365_02138 CDS open 611-1171 _na     186_aa smpB SsrA-binding protein SmpB
4281 MSKK01000046.1 GCA001937365_02139 CDS open 1327-2643 _na     438_aa Peptidase M23
4282 MSKK01000046.1 GCA001937365_02140 CDS open 2650-3567 _na     305_aa ftsX permease-like cell division protein FtsX
4283 MSKK01000046.1 GCA001937365_02141 CDS open 3580-4317 _na     245_aa ftsE cell division ATP-binding protein FtsE
4284 MSKK01000046.1 GCA001937365_02142 CDS open 4485-5045 _na     186_aa TY-Chap N-terminal domain-containing protein
4285 MSKK01000046.1 GCA001937365_02143 CDS open 5038-5745 _na     235_aa Single-stranded DNA-binding protein
4286 MSKK01000046.1 GCA001937365_02144 CDS open 5914-7416 _na     500_aa ATP-binding protein
4287 MSKK01000046.1 GCA001937365_02145 CDS open 7413-9014 _na     533_aa G domain-containing protein
4288 MSKK01000046.1 GCA001937365_02147 CDS open 9789-12479 _na     896_aa fHA ABC transporter domain-containing protein
4289 MSKK01000046.1 GCA001937365_02148 CDS open 12567-15074 _na     835_aa non-specific serine/threonine protein kinase
4290 MSKK01000046.1 GCA001937365_02149 CDS open 15196-15870 _na     224_aa orn oligoribonuclease
4291 MSKK01000046.1 GCA001937365_02151 CDS open 16252-17112 _na     286_aa NodB-like y domain-containing protein
4292 MSKK01000046.1 GCA001937365_02152 CDS open 17119-17541 _na     140_aa tagD glycerol-3-phosphate cytidylyltransferase
4293 MSKK01000046.1 GCA001937365_02153 CDS open 18337-19113 _na     258_aa SGNH/GDSL hydrolase family protein
4294 MSKK01000046.1 GCA001937365_02154 CDS open 19267-21663 _na     798_aa Glycosyl transferase
4295 MSKK01000046.1 GCA001937365_02155 CDS open 21660-22238 _na     192_aa hypothetical protein
4296 MSKK01000046.1 GCA001937365_02156 CDS open 22453-22845 _na     130_aa tagD glycerol-3-phosphate cytidylyltransferase
4297 MSKK01000046.1 GCA001937365_02157 CDS open 23135-23491 _na     118_aa CDP-glycerol glycerophosphotransferase family protein
4298 MSKK01000046.1 GCA001937365_02158 CDS open 23488-23649 _na     53_aa hypothetical protein
4299 MSKK01000046.1 GCA001937365_02159 CDS open 23687-24895 _na     402_aa ilvE branched-chain amino acid aminotransferase
4300 MSKK01000046.1 GCA001937365_02160 CDS open 25135-25395 _na     86_aa hypothetical protein
4301 MSKK01000046.1 GCA001937365_02161 CDS open 25478-25588 _na     36_aa hypothetical protein
4302 MSKK01000046.1 GCA001937365_02162 CDS open 25627-26694 _na     355_aa leuB 3-isopropylmalate dehydrogenase
4303 MSKK01000046.1 GCA001937365_02163 CDS open 26811-27431 _na     206_aa HTH tetR-type domain-containing protein
4304 MSKK01000046.1 GCA001937365_02164 CDS open 27428-28687 _na     419_aa MFS transporter
4305 MSKK01000046.1 GCA001937365_02165 CDS open 28773-29804 _na     343_aa ilvC ketol-acid reductoisomerase
4306 MSKK01000046.1 GCA001937365_02166 CDS open 29814-30326 _na     170_aa ilvN acetolactate synthase small subunit
4307 MSKK01000046.1 GCA001937365_02167 CDS open 30332-32116 _na     594_aa ilvB acetolactate synthase large subunit
4308 MSKK01000046.1 GCA001937365_02168 CDS open 32382-34175 _na     597_aa RCK C-terminal domain-containing protein
4309 MSKK01000046.1 GCA001937365_02169 CDS open 34280-35593 _na     437_aa yjjB Threonine/serine exporter family protein
4310 MSKK01000046.1 GCA001937365_02138 gene open 611-1171 smpB
4311 MSKK01000046.1 GCA001937365_02139 gene open 1327-2643
4312 MSKK01000046.1 GCA001937365_02140 gene open 2650-3567 ftsX
4313 MSKK01000046.1 GCA001937365_02141 gene open 3580-4317 ftsE
4314 MSKK01000046.1 GCA001937365_02142 gene open 4485-5045
4315 MSKK01000046.1 GCA001937365_02143 gene open 5038-5745
4316 MSKK01000046.1 GCA001937365_02144 gene open 5914-7416
4317 MSKK01000046.1 GCA001937365_02145 gene open 7413-9014
4318 MSKK01000046.1 GCA001937365_02147 gene open 9789-12479 fHA
4319 MSKK01000046.1 GCA001937365_02148 gene open 12567-15074
4320 MSKK01000046.1 GCA001937365_02149 gene open 15196-15870 orn
4321 MSKK01000046.1 GCA001937365_02151 gene open 16252-17112
4322 MSKK01000046.1 GCA001937365_02152 gene open 17119-17541 tagD
4323 MSKK01000046.1 GCA001937365_02153 gene open 18337-19113
4324 MSKK01000046.1 GCA001937365_02154 gene open 19267-21663
4325 MSKK01000046.1 GCA001937365_02155 gene open 21660-22238
4326 MSKK01000046.1 GCA001937365_02156 gene open 22453-22845 tagD
4327 MSKK01000046.1 GCA001937365_02157 gene open 23135-23491
4328 MSKK01000046.1 GCA001937365_02158 gene open 23488-23649
4329 MSKK01000046.1 GCA001937365_02159 gene open 23687-24895 ilvE
4330 MSKK01000046.1 GCA001937365_02160 gene open 25135-25395
4331 MSKK01000046.1 GCA001937365_02161 gene open 25478-25588
4332 MSKK01000046.1 GCA001937365_02162 gene open 25627-26694 leuB
4333 MSKK01000046.1 GCA001937365_02163 gene open 26811-27431
4334 MSKK01000046.1 GCA001937365_02164 gene open 27428-28687
4335 MSKK01000046.1 GCA001937365_02165 gene open 28773-29804 ilvC
4336 MSKK01000046.1 GCA001937365_02166 gene open 29814-30326 ilvN
4337 MSKK01000046.1 GCA001937365_02167 gene open 30332-32116 ilvB
4338 MSKK01000046.1 GCA001937365_02168 gene open 32382-34175
4339 MSKK01000046.1 GCA001937365_02169 gene open 34280-35593 yjjB
4340 MSKK01000046.1 GCA001937365_02146 gene open 9322-9394 trnR
4341 MSKK01000046.1 GCA001937365_02150 gene open 15988-16060 trnH
4342 MSKK01000046.1 GCA001937365_02146 tRNA open 9322-9394 trnR tRNA-Arg(tct)
4343 MSKK01000046.1 GCA001937365_02150 tRNA open 15988-16060 trnH tRNA-His(gtg)
4344 MSKK01000047.1 GCA001937365_02170 CDS open 584-1618 _na     344_aa hypothetical protein
4345 MSKK01000047.1 GCA001937365_02171 CDS open 1793-2035 _na     80_aa hypothetical protein
4346 MSKK01000047.1 GCA001937365_02172 CDS open 2376-3020 _na     214_aa hypothetical protein
4347 MSKK01000047.1 GCA001937365_02173 CDS open 3086-3547 _na     153_aa Tat pathway signal sequence domain protein
4348 MSKK01000047.1 GCA001937365_02174 CDS open 3846-5207 _na     453_aa glmM phosphoglucosamine mutase
4349 MSKK01000047.1 GCA001937365_02175 CDS open 5522-6016 _na     164_aa rpsI 30S ribosomal protein S9
4350 MSKK01000047.1 GCA001937365_02176 CDS open 6060-6503 _na     147_aa rplM 50S ribosomal protein L13
4351 MSKK01000047.1 GCA001937365_02177 CDS open 6762-7667 _na     301_aa tRNA pseudouridine synthase A
4352 MSKK01000047.1 GCA001937365_02178 CDS open 7698-8453 _na     251_aa nagC ROK family protein
4353 MSKK01000047.1 GCA001937365_02179 CDS open 8643-10193 _na     516_aa pntA Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
4354 MSKK01000047.1 GCA001937365_02180 CDS open 10210-11685 _na     491_aa NAD(P) transhydrogenase subunit beta
4355 MSKK01000047.1 GCA001937365_02170 gene open 584-1618
4356 MSKK01000047.1 GCA001937365_02171 gene open 1793-2035
4357 MSKK01000047.1 GCA001937365_02172 gene open 2376-3020
4358 MSKK01000047.1 GCA001937365_02173 gene open 3086-3547
4359 MSKK01000047.1 GCA001937365_02174 gene open 3846-5207 glmM
4360 MSKK01000047.1 GCA001937365_02175 gene open 5522-6016 rpsI
4361 MSKK01000047.1 GCA001937365_02176 gene open 6060-6503 rplM
4362 MSKK01000047.1 GCA001937365_02177 gene open 6762-7667
4363 MSKK01000047.1 GCA001937365_02178 gene open 7698-8453 nagC
4364 MSKK01000047.1 GCA001937365_02179 gene open 8643-10193 pntA
4365 MSKK01000047.1 GCA001937365_02180 gene open 10210-11685
4366 MSKK01000048.1 GCA001937365_02181 CDS open 92-328 _na     78_aa Peptidylprolyl isomerase
4367 MSKK01000048.1 GCA001937365_02182 CDS open 321-1073 _na     250_aa pflA anaerobic ribonucleoside-triphosphate reductase activating protein
4368 MSKK01000048.1 GCA001937365_02183 CDS open 1132-1584 _na     150_aa hypothetical protein
4369 MSKK01000048.1 GCA001937365_02184 CDS open 1796-2185 _na     129_aa hypothetical protein
4370 MSKK01000048.1 GCA001937365_02185 CDS open 2306-3376 _na     356_aa Glycosyl hydrolase family 16
4371 MSKK01000048.1 GCA001937365_02186 CDS open 3479-3790 _na     103_aa phd Antitoxin
4372 MSKK01000048.1 GCA001937365_02187 CDS open 3787-4188 _na     133_aa vapC Ribonuclease VapC
4373 MSKK01000048.1 GCA001937365_02188 CDS open 5864-6304 _na     146_aa Tetrapyrrole methyltransferase
4374 MSKK01000048.1 GCA001937365_02189 CDS open 6374-7318 _na     314_aa HNH nuclease domain-containing protein
4375 MSKK01000048.1 GCA001937365_02190 CDS open 7484-7702 _na     72_aa hypothetical protein
4376 MSKK01000048.1 GCA001937365_02191 CDS open 7898-8611 _na     237_aa ABC transporter domain-containing protein
4377 MSKK01000048.1 GCA001937365_02181 gene open 92-328
4378 MSKK01000048.1 GCA001937365_02182 gene open 321-1073 pflA
4379 MSKK01000048.1 GCA001937365_02183 gene open 1132-1584
4380 MSKK01000048.1 GCA001937365_02184 gene open 1796-2185
4381 MSKK01000048.1 GCA001937365_02185 gene open 2306-3376
4382 MSKK01000048.1 GCA001937365_02186 gene open 3479-3790 phd
4383 MSKK01000048.1 GCA001937365_02187 gene open 3787-4188 vapC
4384 MSKK01000048.1 GCA001937365_02188 gene open 5864-6304
4385 MSKK01000048.1 GCA001937365_02189 gene open 6374-7318
4386 MSKK01000048.1 GCA001937365_02190 gene open 7484-7702
4387 MSKK01000048.1 GCA001937365_02191 gene open 7898-8611
4388 MSKK01000049.1 GCA001937365_02192 CDS open 550-1359 _na     269_aa DUF4956 domain-containing protein
4389 MSKK01000049.1 GCA001937365_02193 CDS open 1638-2459 _na     273_aa Molecular chaperone
4390 MSKK01000049.1 GCA001937365_02194 CDS open 2595-3473 _na     292_aa DUF4956 domain-containing protein
4391 MSKK01000049.1 GCA001937365_02195 CDS open 4158-4403 _na     81_aa nrdH Glutaredoxin-like protein NrdH
4392 MSKK01000049.1 GCA001937365_02196 CDS open 4421-4831 _na     136_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
4393 MSKK01000049.1 GCA001937365_02197 CDS open 4816-6972 _na     718_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
4394 MSKK01000049.1 GCA001937365_02198 CDS open 7524-7904 _na     126_aa hicB Antitoxin HicB
4395 MSKK01000049.1 GCA001937365_02199 CDS open 7915-8958 _na     347_aa Bile acid transporter
4396 MSKK01000049.1 GCA001937365_02200 CDS open 9083-9793 _na     236_aa coaA Phosphoribulokinase/Uridine kinase family protein
4397 MSKK01000049.1 GCA001937365_02201 CDS open 10212-10622 _na     136_aa MFS transporter
4398 MSKK01000049.1 GCA001937365_02192 gene open 550-1359
4399 MSKK01000049.1 GCA001937365_02193 gene open 1638-2459
4400 MSKK01000049.1 GCA001937365_02194 gene open 2595-3473
4401 MSKK01000049.1 GCA001937365_02195 gene open 4158-4403 nrdH
4402 MSKK01000049.1 GCA001937365_02196 gene open 4421-4831 nrdI
4403 MSKK01000049.1 GCA001937365_02197 gene open 4816-6972 nrdE
4404 MSKK01000049.1 GCA001937365_02198 gene open 7524-7904 hicB
4405 MSKK01000049.1 GCA001937365_02199 gene open 7915-8958
4406 MSKK01000049.1 GCA001937365_02200 gene open 9083-9793 coaA
4407 MSKK01000049.1 GCA001937365_02201 gene open 10212-10622
4408 MSKK01000050.1 rep_origin open 37569-38165
4409 MSKK01000050.1 repeat_region open 75317-75560 CRISPR array with 4 repeats of length 28%2C consensus sequence GTCAGCCCCGCGTATGCGGGGGTAGAGG and spacer length 33
4410 MSKK01000050.1 GCA001937365_02202 CDS open 75-1565 _na     496_aa hypothetical protein
4411 MSKK01000050.1 GCA001937365_02203 CDS open 2825-3343 _na     172_aa anaerobic C4-dicarboxylate transporter family protein
4412 MSKK01000050.1 GCA001937365_02204 CDS open 3346-3663 _na     105_aa anaerobic C4-dicarboxylate transporter family protein
4413 MSKK01000050.1 GCA001937365_02205 CDS open 3642-3878 _na     78_aa dcuB Anaerobic C4-dicarboxylate transporter DcuB
4414 MSKK01000050.1 GCA001937365_02206 CDS open 4018-7434 _na     1138_aa PPi-type phosphoenolpyruvate carboxykinase
4415 MSKK01000050.1 GCA001937365_02207 CDS open 7628-8905 _na     425_aa AAA family ATPase
4416 MSKK01000050.1 GCA001937365_02208 CDS open 8960-11851 _na     963_aa Cation-transporting P-type ATPase N-terminal domain-containing protein
4417 MSKK01000050.1 GCA001937365_02209 CDS open 11976-12134 _na     52_aa DUF4175 domain-containing protein
4418 MSKK01000050.1 GCA001937365_02210 CDS open 12134-12907 _na     257_aa srtA Sortase
4419 MSKK01000050.1 GCA001937365_02211 CDS open 13101-13637 _na     178_aa crgA Cell division protein CrgA
4420 MSKK01000050.1 GCA001937365_02212 CDS open 14091-14945 _na     284_aa Peptidase S54 rhomboid domain-containing protein
4421 MSKK01000050.1 GCA001937365_02213 CDS open 15132-15662 _na     176_aa ppiB Peptidyl-prolyl cis-trans isomerase
4422 MSKK01000050.1 GCA001937365_02214 CDS open 15831-16376 _na     181_aa Apolipoprotein A1/A4/E domain
4423 MSKK01000050.1 GCA001937365_02215 CDS open 16510-17271 _na     253_aa Heavy-metal chelation domain-containing protein
4424 MSKK01000050.1 GCA001937365_02216 CDS open 17716-18996 _na     426_aa CshA/CshB family fibrillar adhesin-related protein
4425 MSKK01000050.1 GCA001937365_02217 CDS open 19016-19801 _na     261_aa GEVED domain-containing protein
4426 MSKK01000050.1 GCA001937365_02218 CDS open 20030-20242 _na     70_aa prealbumin-like fold domain-containing protein
4427 MSKK01000050.1 GCA001937365_02219 CDS open 20416-20958 _na     180_aa HTH arsR-type domain-containing protein
4428 MSKK01000050.1 GCA001937365_02220 CDS open 21012-21233 _na     73_aa Phospholipase
4429 MSKK01000050.1 GCA001937365_02221 CDS open 21233-22147 _na     304_aa ABC transporter ATP-binding protein
4430 MSKK01000050.1 GCA001937365_02222 CDS open 22147-22935 _na     262_aa ABC transporter
4431 MSKK01000050.1 GCA001937365_02223 CDS open 23023-23343 _na     106_aa Bacterial transcription activator effector binding domain-containing protein
4432 MSKK01000050.1 GCA001937365_02224 CDS open 23521-23988 _na     155_aa Integron-associated effector binding protein domain-containing protein
4433 MSKK01000050.1 GCA001937365_02225 CDS open 24198-24401 _na     67_aa xRE HTH cro/C1-type domain-containing protein
4434 MSKK01000050.1 GCA001937365_02226 CDS open 24398-24787 _na     129_aa DUF3147 domain-containing protein
4435 MSKK01000050.1 GCA001937365_02227 CDS open 24895-25410 _na     171_aa HXXEE domain-containing protein
4436 MSKK01000050.1 GCA001937365_02228 CDS open 25505-26134 _na     209_aa tetR TetR family transcriptional regulator
4437 MSKK01000050.1 GCA001937365_02230 CDS open 26311-26445 _na     44_aa DLW-39 family protein
4438 MSKK01000050.1 GCA001937365_02232 CDS open 26599-27096 _na     165_aa DUF3566 domain-containing protein
4439 MSKK01000050.1 GCA001937365_02233 CDS open 27093-29777 _na     894_aa gyrA DNA gyrase subunit A
4440 MSKK01000050.1 GCA001937365_02234 CDS open 29846-31873 _na     675_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
4441 MSKK01000050.1 GCA001937365_02235 CDS open 32200-32877 _na     225_aa PF05258 family protein
4442 MSKK01000050.1 GCA001937365_02236 CDS open 32870-34087 _na     405_aa recF DNA replication/repair protein RecF
4443 MSKK01000050.1 GCA001937365_02237 CDS open 34101-35231 _na     376_aa dnaN DNA polymerase III subunit beta
4444 MSKK01000050.1 GCA001937365_02238 CDS open 35889-37568 _na     559_aa dnaA chromosomal replication initiator protein DnaA
4445 MSKK01000050.1 GCA001937365_02239 CDS open 38166-38303 _na     45_aa rpmH 50S ribosomal protein L34
4446 MSKK01000050.1 GCA001937365_02240 CDS open 38395-38673 _na     92_aa rnpA ribonuclease P protein component
4447 MSKK01000050.1 GCA001937365_02241 CDS open 38696-38980 _na     94_aa yidD membrane protein insertion efficiency factor YidD
4448 MSKK01000050.1 GCA001937365_02242 CDS open 39074-40258 _na     394_aa yidC membrane protein insertase YidC
4449 MSKK01000050.1 GCA001937365_02243 CDS open 40312-40917 _na     201_aa R3H domain-containing protein
4450 MSKK01000050.1 GCA001937365_02244 CDS open 40920-41564 _na     214_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
4451 MSKK01000050.1 GCA001937365_02245 CDS open 41672-42574 _na     300_aa parA AAA domain-containing protein
4452 MSKK01000050.1 GCA001937365_02246 CDS open 42574-44163 _na     529_aa parB Chromosome partitioning protein ParB
4453 MSKK01000050.1 GCA001937365_02247 CDS open 48144-48986 _na     280_aa hypothetical protein
4454 MSKK01000050.1 GCA001937365_02248 CDS open 49262-50209 _na     315_aa ddlA D-alanine--D-alanine ligase
4455 MSKK01000050.1 GCA001937365_02249 CDS open 50218-51654 _na     478_aa aRO8 Aminotransferase class I/classII large domain-containing protein
4456 MSKK01000050.1 GCA001937365_02250 CDS open 51755-53194 _na     479_aa thrC threonine synthase
4457 MSKK01000050.1 GCA001937365_02251 CDS open 53420-53746 _na     108_aa trxA thioredoxin
4458 MSKK01000050.1 GCA001937365_02252 CDS open 53855-54781 _na     308_aa trxB thioredoxin-disulfide reductase
4459 MSKK01000050.1 GCA001937365_02253 CDS open 54868-59163 _na     1431_aa mviN Integral membrane protein MviN
4460 MSKK01000050.1 GCA001937365_02254 CDS open 59160-61616 _na     818_aa Conjugal transfer protein
4461 MSKK01000050.1 GCA001937365_02255 CDS open 61613-62122 _na     169_aa yjhB Nudix hydrolase domain-containing protein
4462 MSKK01000050.1 GCA001937365_02256 CDS open 62312-63799 _na     495_aa pcnB CCA tRNA nucleotidyltransferase
4463 MSKK01000050.1 GCA001937365_02257 CDS open 63810-65027 _na     405_aa Gfo/Idh/MocA family oxidoreductase
4464 MSKK01000050.1 GCA001937365_02258 CDS open 65166-66674 _na     502_aa galA Alpha-galactosidase
4465 MSKK01000050.1 GCA001937365_02259 CDS open 66720-68030 _na     436_aa ATP-binding protein
4466 MSKK01000050.1 GCA001937365_02260 CDS open 68420-71209 _na     929_aa cas3u type I-U CRISPR-associated helicase/endonuclease Cas3
4467 MSKK01000050.1 GCA001937365_02261 CDS open 71202-72113 _na     303_aa hypothetical protein
4468 MSKK01000050.1 GCA001937365_02262 CDS open 72138-72713 _na     191_aa Type I-E CRISPR-associated protein Cas6/Cse3/CasE
4469 MSKK01000050.1 GCA001937365_02263 CDS open 72778-73989 _na     403_aa Type I-U CRISPR-associated protein Cas7
4470 MSKK01000050.1 GCA001937365_02264 CDS open 73955-75298 _na     447_aa csb2 type I-U CRISPR-associated protein Csb2
4471 MSKK01000050.1 GCA001937365_02202 gene open 75-1565
4472 MSKK01000050.1 GCA001937365_02203 gene open 2825-3343
4473 MSKK01000050.1 GCA001937365_02204 gene open 3346-3663
4474 MSKK01000050.1 GCA001937365_02205 gene open 3642-3878 dcuB
4475 MSKK01000050.1 GCA001937365_02206 gene open 4018-7434
4476 MSKK01000050.1 GCA001937365_02207 gene open 7628-8905
4477 MSKK01000050.1 GCA001937365_02208 gene open 8960-11851
4478 MSKK01000050.1 GCA001937365_02209 gene open 11976-12134
4479 MSKK01000050.1 GCA001937365_02210 gene open 12134-12907 srtA
4480 MSKK01000050.1 GCA001937365_02211 gene open 13101-13637 crgA
4481 MSKK01000050.1 GCA001937365_02212 gene open 14091-14945
4482 MSKK01000050.1 GCA001937365_02213 gene open 15132-15662 ppiB
4483 MSKK01000050.1 GCA001937365_02214 gene open 15831-16376
4484 MSKK01000050.1 GCA001937365_02215 gene open 16510-17271
4485 MSKK01000050.1 GCA001937365_02216 gene open 17716-18996
4486 MSKK01000050.1 GCA001937365_02217 gene open 19016-19801
4487 MSKK01000050.1 GCA001937365_02218 gene open 20030-20242
4488 MSKK01000050.1 GCA001937365_02219 gene open 20416-20958
4489 MSKK01000050.1 GCA001937365_02220 gene open 21012-21233
4490 MSKK01000050.1 GCA001937365_02221 gene open 21233-22147
4491 MSKK01000050.1 GCA001937365_02222 gene open 22147-22935
4492 MSKK01000050.1 GCA001937365_02223 gene open 23023-23343
4493 MSKK01000050.1 GCA001937365_02224 gene open 23521-23988
4494 MSKK01000050.1 GCA001937365_02225 gene open 24198-24401 xRE
4495 MSKK01000050.1 GCA001937365_02226 gene open 24398-24787
4496 MSKK01000050.1 GCA001937365_02227 gene open 24895-25410
4497 MSKK01000050.1 GCA001937365_02228 gene open 25505-26134 tetR
4498 MSKK01000050.1 GCA001937365_02230 gene open 26311-26445
4499 MSKK01000050.1 GCA001937365_02232 gene open 26599-27096
4500 MSKK01000050.1 GCA001937365_02233 gene open 27093-29777 gyrA