HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter actinomycetemcomitans (GCA_002266485.1)

Select a Genome:
BAKTA Annotations for GCA_002266485.1
Genome Selected: Aggregatibacter actinomycetemcomitans
ContigsBases CDSrRNA tmRNAtRNA
7 2,291,820 2166 10 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4571 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4571 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 NPOT01000001.1 GCA002266485_00001 gene open 1-1262 rrs
2 NPOT01000001.1 GCA002266485_00003 gene open 1640-4662 rrl
3 NPOT01000001.1 GCA002266485_00004 gene open 4911-5026 rrf
4 NPOT01000001.1 GCA002266485_00005 gene open 5077-5192 rrf
5 NPOT01000001.1 GCA002266485_00016 gene open 14774-14871 AaHKsRNA22
6 NPOT01000001.1 GCA002266485_00028 gene open 28018-28115 AaHKsRNA22
7 NPOT01000001.1 GCA002266485_00085 gene open 97298-97399 AaHKsRNA22
8 NPOT01000001.1 GCA002266485_00091 gene open 108805-109079 JA03
9 NPOT01000001.1 GCA002266485_00113 gene open 134770-134868 AaHKsRNA22
10 NPOT01000001.1 GCA002266485_00115 gene open 136017-136405 RNaseP_bact_a
11 NPOT01000001.1 GCA002266485_00144 gene open 162301-162398 AaHKsRNA22
12 NPOT01000001.1 GCA002266485_00177 gene open 187949-188050 AaHKsRNA22
13 NPOT01000001.1 GCA002266485_00226 gene open 240809-240904 AaHKsRNA22
14 NPOT01000001.1 GCA002266485_00287 gene open 304126-304202 AaHKsRNA20
15 NPOT01000001.1 GCA002266485_00290 gene open 306298-306398 AaHKsRNA22
16 NPOT01000001.1 GCA002266485_00297 gene open 310233-310315 AaHKsRNA69
17 NPOT01000001.1 GCA002266485_00308 gene open 320806-320904 Bacteria_small_SRP
18 NPOT01000001.1 GCA002266485_00346 gene open 354164-354261 AaHKsRNA22
19 NPOT01000001.1 GCA002266485_00394 gene open 413014-413094 AaHKsRNA22
20 NPOT01000001.1 GCA002266485_00450 gene open 468598-468713 rrf
21 NPOT01000001.1 GCA002266485_00530 gene open 556677-556776 AaHKsRNA22
22 NPOT01000001.1 GCA002266485_00559 gene open 590320-590421 AaHKsRNA22
23 NPOT01000001.1 GCA002266485_00570 gene open 600519-600692 gcvB
24 NPOT01000001.1 GCA002266485_00587 gene open 617629-617728 AaHKsRNA22
25 NPOT01000001.1 GCA002266485_00631 gene open 673033-673128 AaHKsRNA22
26 NPOT01000001.1 GCA002266485_00656 gene open 695406-695507 AaHKsRNA22
27 NPOT01000001.1 GCA002266485_00747 gene open 785598-785678 asdA
28 NPOT01000001.1 GCA002266485_00762 gene open 800043-800140 AaHKsRNA22
29 NPOT01000001.1 GCA002266485_00767 gene open 802571-802672 AaHKsRNA22
30 NPOT01000001.1 GCA002266485_00803 gene open 836012-836107 AaHKsRNA22
31 NPOT01000001.1 GCA002266485_00812 gene open 846610-846706 AaHKsRNA22
32 NPOT01000001.1 GCA002266485_00848 gene open 883777-883872 AaHKsRNA22
33 NPOT01000001.1 GCA002266485_00905 gene open 932878-932974 AaHKsRNA22
34 NPOT01000001.1 GCA002266485_00919 gene open 942982-943097 rrf
35 NPOT01000001.1 GCA002266485_00920 gene open 943346-946368 rrl
36 NPOT01000001.1 GCA002266485_00923 gene open 946933-948472 rrs
37 NPOT01000001.1 GCA002266485_00016 ncRNA open 14774-14871 Aggregatibacter sRNA 22
38 NPOT01000001.1 GCA002266485_00028 ncRNA open 28018-28115 Aggregatibacter sRNA 22
39 NPOT01000001.1 GCA002266485_00085 ncRNA open 97298-97399 Aggregatibacter sRNA 22
40 NPOT01000001.1 GCA002266485_00091 ncRNA open 108805-109079 Aggregatibacter sRNA JA03
41 NPOT01000001.1 GCA002266485_00113 ncRNA open 134770-134868 Aggregatibacter sRNA 22
42 NPOT01000001.1 GCA002266485_00115 ncRNA open 136017-136405 Bacterial RNase P class A
43 NPOT01000001.1 GCA002266485_00144 ncRNA open 162301-162398 Aggregatibacter sRNA 22
44 NPOT01000001.1 GCA002266485_00177 ncRNA open 187949-188050 Aggregatibacter sRNA 22
45 NPOT01000001.1 GCA002266485_00226 ncRNA open 240809-240904 Aggregatibacter sRNA 22
46 NPOT01000001.1 GCA002266485_00287 ncRNA open 304126-304202 Aggregatibacter sRNA 20
47 NPOT01000001.1 GCA002266485_00290 ncRNA open 306298-306398 Aggregatibacter sRNA 22
48 NPOT01000001.1 GCA002266485_00297 ncRNA open 310233-310315 Aggregatibacter sRNA 69
49 NPOT01000001.1 GCA002266485_00308 ncRNA open 320806-320904 Bacterial small signal recognition particle RNA
50 NPOT01000001.1 GCA002266485_00346 ncRNA open 354164-354261 Aggregatibacter sRNA 22
51 NPOT01000001.1 GCA002266485_00394 ncRNA open 413014-413094 Aggregatibacter sRNA 22
52 NPOT01000001.1 GCA002266485_00530 ncRNA open 556677-556776 Aggregatibacter sRNA 22
53 NPOT01000001.1 GCA002266485_00559 ncRNA open 590320-590421 Aggregatibacter sRNA 22
54 NPOT01000001.1 GCA002266485_00570 ncRNA open 600519-600692 gcvB GcvB RNA
55 NPOT01000001.1 GCA002266485_00587 ncRNA open 617629-617728 Aggregatibacter sRNA 22
56 NPOT01000001.1 GCA002266485_00631 ncRNA open 673033-673128 Aggregatibacter sRNA 22
57 NPOT01000001.1 GCA002266485_00656 ncRNA open 695406-695507 Aggregatibacter sRNA 22
58 NPOT01000001.1 GCA002266485_00747 ncRNA open 785598-785678 asdA antisense RNA of dnaA mRNA
59 NPOT01000001.1 GCA002266485_00762 ncRNA open 800043-800140 Aggregatibacter sRNA 22
60 NPOT01000001.1 GCA002266485_00767 ncRNA open 802571-802672 Aggregatibacter sRNA 22
61 NPOT01000001.1 GCA002266485_00803 ncRNA open 836012-836107 Aggregatibacter sRNA 22
62 NPOT01000001.1 GCA002266485_00812 ncRNA open 846610-846706 Aggregatibacter sRNA 22
63 NPOT01000001.1 GCA002266485_00848 ncRNA open 883777-883872 Aggregatibacter sRNA 22
64 NPOT01000001.1 GCA002266485_00905 ncRNA open 932878-932974 Aggregatibacter sRNA 22
65 NPOT01000001.1 regulatory_region open 176278-176426 Molybdenum/Tungsten riboswitch aptamer (Moco RNA motif)
66 NPOT01000001.1 regulatory_region open 361512-361570 Selenocysteine insertion sequence 3
67 NPOT01000001.1 regulatory_region open 423956-424043 TPP riboswitch aptamer (THI element)
68 NPOT01000001.1 regulatory_region open 510894-511068 Lysine riboswitch aptamer
69 NPOT01000001.1 regulatory_region open 818605-818725 Ribosomal S15 leader
70 NPOT01000001.1 GCA002266485_00001 rRNA open 1-1262 rrs 16S ribosomal RNA
71 NPOT01000001.1 GCA002266485_00003 rRNA open 1640-4662 rrl 23S ribosomal RNA
72 NPOT01000001.1 GCA002266485_00004 rRNA open 4911-5026 rrf 5S ribosomal RNA
73 NPOT01000001.1 GCA002266485_00005 rRNA open 5077-5192 rrf 5S ribosomal RNA
74 NPOT01000001.1 GCA002266485_00450 rRNA open 468598-468713 rrf 5S ribosomal RNA
75 NPOT01000001.1 GCA002266485_00919 rRNA open 942982-943097 rrf 5S ribosomal RNA
76 NPOT01000001.1 GCA002266485_00920 rRNA open 943346-946368 rrl 23S ribosomal RNA
77 NPOT01000001.1 GCA002266485_00923 rRNA open 946933-948472 rrs 16S ribosomal RNA
78 NPOT01000001.1 repeat_region open 633621-634014 CRISPR array with 7 repeats of length 28%2C consensus sequence CTTCACTGCCGAATAGGCAGCTTAGAAA and spacer length 31
79 NPOT01000001.1 GCA002266485_00008 CDS open 6659-6841 _na     60_aa Transposase
80 NPOT01000001.1 GCA002266485_00010 CDS open 7570-8025 _na     151_aa rimP ribosome maturation factor RimP
81 NPOT01000001.1 GCA002266485_00011 CDS open 8053-9549 _na     498_aa nusA Transcription termination/antitermination protein NusA
82 NPOT01000001.1 GCA002266485_00012 CDS open 9565-12057 _na     830_aa infB translation initiation factor IF-2
83 NPOT01000001.1 GCA002266485_00013 CDS open 12130-12420 _na     96_aa MFS transporter
84 NPOT01000001.1 GCA002266485_00014 CDS open 12589-12975 _na     128_aa rbfA 30S ribosome-binding factor RbfA
85 NPOT01000001.1 GCA002266485_00015 CDS open 12975-13895 _na     306_aa truB tRNA pseudouridine(55) synthase TruB
86 NPOT01000001.1 GCA002266485_00017 CDS open 14919-16106 _na     395_aa tyrS tyrosine--tRNA ligase
87 NPOT01000001.1 GCA002266485_00018 CDS open 16354-17079 _na     241_aa sfsA DNA/RNA nuclease SfsA
88 NPOT01000001.1 GCA002266485_00019 CDS open 17372-18907 _na     511_aa pntA Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha
89 NPOT01000001.1 GCA002266485_00020 CDS open 18918-20342 _na     474_aa pntB Re/Si-specific NAD(P)(+) transhydrogenase subunit beta
90 NPOT01000001.1 GCA002266485_00021 CDS open 20523-20765 _na     80_aa DNA repair protein
91 NPOT01000001.1 GCA002266485_00022 CDS open 21364-22212 _na     282_aa Cell filamentation protein Fic
92 NPOT01000001.1 GCA002266485_00023 CDS open 22724-23833 _na     369_aa selD selenide%2C water dikinase SelD
93 NPOT01000001.1 GCA002266485_00024 CDS open 24061-25131 _na     356_aa ABC transporter ATP-binding protein
94 NPOT01000001.1 GCA002266485_00025 CDS open 25128-25997 _na     289_aa potB Spermidine/putrescine ABC transporter membrane protein
95 NPOT01000001.1 GCA002266485_00026 CDS open 25994-26845 _na     283_aa potC PotC protein
96 NPOT01000001.1 GCA002266485_00027 CDS open 26865-27956 _na     363_aa ynjB Extracellular solute-binding protein
97 NPOT01000001.1 GCA002266485_00029 CDS open 28343-30172 _na     609_aa uvrC excinuclease ABC subunit UvrC
98 NPOT01000001.1 GCA002266485_00030 CDS open 30301-31074 _na     257_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
99 NPOT01000001.1 GCA002266485_00031 CDS open 31076-31255 _na     59_aa trm112 UPF0434 protein ACT75_01300
100 NPOT01000001.1 GCA002266485_00032 CDS open 31277-32251 _na     324_aa lpxK tetraacyldisaccharide 4'-kinase
101 NPOT01000001.1 GCA002266485_00033 CDS open 32270-34018 _na     582_aa msbA lipid A ABC transporter ATP-binding protein/permease MsbA
102 NPOT01000001.1 GCA002266485_00034 CDS open 34065-36365 _na     766_aa comEC DNA internalization-related competence protein ComEC/Rec2
103 NPOT01000001.1 GCA002266485_00035 CDS open 36792-37229 _na     145_aa dksA RNA polymerase-binding protein DksA
104 NPOT01000001.1 GCA002266485_00036 CDS open 37346-38812 _na     488_aa pcnB Poly(A) polymerase I
105 NPOT01000001.1 GCA002266485_00037 CDS open 38805-39305 _na     166_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
106 NPOT01000001.1 GCA002266485_00038 CDS open 39351-39737 _na     128_aa Cupin
107 NPOT01000001.1 GCA002266485_00039 CDS open 40083-42218 _na     711_aa pta phosphate acetyltransferase
108 NPOT01000001.1 GCA002266485_00040 CDS open 42288-43490 _na     400_aa ackA Acetate kinase
109 NPOT01000001.1 GCA002266485_00041 CDS open 43758-44201 _na     147_aa yfbV terminus macrodomain insulation protein YfbV
110 NPOT01000001.1 GCA002266485_00042 CDS open 44380-44922 _na     180_aa cvpA CvpA family protein
111 NPOT01000001.1 GCA002266485_00043 CDS open 45067-47142 _na     691_aa malQ 4-alpha-glucanotransferase
112 NPOT01000001.1 GCA002266485_00044 CDS open 47287-49677 _na     796_aa malP maltodextrin phosphorylase
113 NPOT01000001.1 GCA002266485_00045 CDS open 49846-52560 _na     904_aa malT HTH-type transcriptional regulator MalT
114 NPOT01000001.1 GCA002266485_00046 CDS open 52713-53573 _na     286_aa tehB SAM-dependent methyltransferase TehB
115 NPOT01000001.1 GCA002266485_00047 CDS open 53967-56624 _na     885_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
116 NPOT01000001.1 GCA002266485_00048 CDS open 56662-58323 _na     553_aa Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex
117 NPOT01000001.1 GCA002266485_00049 CDS open 58417-59841 _na     474_aa lpdA dihydrolipoyl dehydrogenase
118 NPOT01000001.1 GCA002266485_00050 CDS open 60271-60825 _na     184_aa nfnB NAD(P)H nitroreductase
119 NPOT01000001.1 GCA002266485_00051 CDS open 60949-62829 _na     626_aa sppA signal peptide peptidase SppA
120 NPOT01000001.1 GCA002266485_00052 CDS open 62870-63367 _na     165_aa chorismate mutase
121 NPOT01000001.1 GCA002266485_00053 CDS open 63376-63996 _na     206_aa Chorismate mutase I
122 NPOT01000001.1 GCA002266485_00054 CDS open 64077-64700 _na     207_aa L-threonylcarbamoyladenylate synthase
123 NPOT01000001.1 GCA002266485_00055 CDS open 64755-65723 _na     322_aa rluB 23S rRNA pseudouridine(2605) synthase RluB
124 NPOT01000001.1 GCA002266485_00056 CDS open 65754-66725 _na     323_aa cysB HTH-type transcriptional regulator CysB
125 NPOT01000001.1 GCA002266485_00057 CDS open 66810-67637 _na     275_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
126 NPOT01000001.1 GCA002266485_00058 CDS open 67752-68072 _na     106_aa yciU HI1450 family dsDNA-mimic protein
127 NPOT01000001.1 GCA002266485_00059 CDS open 68543-69541 _na     332_aa purR HTH-type transcriptional repressor PurR
128 NPOT01000001.1 GCA002266485_00060 CDS open 69847-70950 _na     367_aa mET2 homoserine O-acetyltransferase
129 NPOT01000001.1 GCA002266485_00061 CDS open 71143-71856 _na     237_aa sanA Vancomycin high temperature exclusion protein
130 NPOT01000001.1 GCA002266485_00062 CDS open 71840-72826 _na     328_aa cra catabolite repressor/activator
131 NPOT01000001.1 GCA002266485_00063 CDS open 73357-75417 _na     686_aa Type IV secretion protein Rhs
132 NPOT01000001.1 GCA002266485_00064 CDS open 75404-75649 _na     81_aa hypothetical protein
133 NPOT01000001.1 GCA002266485_00065 CDS open 75634-76536 _na     300_aa Immunity protein 26 of polymorphic toxin system
134 NPOT01000001.1 GCA002266485_00066 CDS open 76508-76639 _na     43_aa hypothetical protein
135 NPOT01000001.1 GCA002266485_00067 CDS open 77052-77816 _na     254_aa hypothetical protein
136 NPOT01000001.1 GCA002266485_00068 CDS open 77773-78480 _na     235_aa SH3b domain-containing protein
137 NPOT01000001.1 GCA002266485_00069 CDS open 78802-79608 _na     268_aa SH3 domain-containing protein
138 NPOT01000001.1 GCA002266485_00070 CDS open 79721-80629 _na     302_aa glycoside hydrolase family 19
139 NPOT01000001.1 GCA002266485_00071 CDS open 80622-80858 _na     78_aa Glycoside hydrolase family 19
140 NPOT01000001.1 GCA002266485_00072 CDS open 81209-81958 _na     249_aa SH3 domain-containing protein
141 NPOT01000001.1 GCA002266485_00073 CDS open 82416-82985 _na     189_aa 4-alpha-glucanotransferase
142 NPOT01000001.1 GCA002266485_00074 CDS open 82973-85168 _na     731_aa glgB 1%2C4-alpha-glucan branching protein GlgB
143 NPOT01000001.1 GCA002266485_00075 CDS open 85165-87174 _na     669_aa glgX glycogen debranching protein GlgX
144 NPOT01000001.1 GCA002266485_00076 CDS open 87201-88511 _na     436_aa glgC glucose-1-phosphate adenylyltransferase
145 NPOT01000001.1 GCA002266485_00077 CDS open 88713-90152 _na     479_aa glgA glycogen synthase GlgA
146 NPOT01000001.1 GCA002266485_00078 CDS open 90276-92741 _na     821_aa glgP Alpha-1%2C4 glucan phosphorylase
147 NPOT01000001.1 GCA002266485_00079 CDS open 92860-93465 _na     201_aa dedA DedA family protein
148 NPOT01000001.1 GCA002266485_00080 CDS open 93679-93966 _na     95_aa rplY 50S ribosomal protein L25
149 NPOT01000001.1 GCA002266485_00081 CDS open 94114-94722 _na     202_aa hlpB Lipoprotein HlpB
150 NPOT01000001.1 GCA002266485_00082 CDS open 94870-95751 _na     293_aa dacC DacC protein
151 NPOT01000001.1 GCA002266485_00083 CDS open 95929-97257 _na     442_aa mukF chromosome partition protein MukF
152 NPOT01000001.1 GCA002266485_00084 CDS open 97285-97422 _na     45_aa hypothetical protein
153 NPOT01000001.1 GCA002266485_00086 CDS open 97437-100898 _na     1153_aa fucP acyl-[ACP]--phospholipid O-acyltransferase
154 NPOT01000001.1 GCA002266485_00087 CDS open 100919-101659 _na     246_aa mukE chromosome partition protein MukE
155 NPOT01000001.1 GCA002266485_00088 CDS open 101659-106149 _na     1496_aa mukB chromosome partition protein MukB
156 NPOT01000001.1 GCA002266485_00089 CDS open 106226-107098 _na     290_aa eamA EamA domain-containing protein
157 NPOT01000001.1 GCA002266485_00090 CDS open 107113-108537 _na     474_aa sbcB exodeoxyribonuclease I
158 NPOT01000001.1 GCA002266485_00092 CDS open 109437-109922 _na     161_aa ftnA non-heme ferritin
159 NPOT01000001.1 GCA002266485_00093 CDS open 109938-110435 _na     165_aa ftnA non-heme ferritin
160 NPOT01000001.1 GCA002266485_00094 CDS open 110497-110667 _na     56_aa hypothetical protein
161 NPOT01000001.1 GCA002266485_00095 CDS open 110776-111549 _na     257_aa fnr Anaerobic regulatory protein
162 NPOT01000001.1 GCA002266485_00096 CDS open 111667-112599 _na     310_aa uspE universal stress protein UspE
163 NPOT01000001.1 GCA002266485_00097 CDS open 112726-113562 _na     278_aa DUF4198 domain-containing protein
164 NPOT01000001.1 GCA002266485_00098 CDS open 113647-116253 _na     868_aa topA type I DNA topoisomerase
165 NPOT01000001.1 GCA002266485_00099 CDS open 116491-117327 _na     278_aa yciV PHP domain-containing protein
166 NPOT01000001.1 GCA002266485_00100 CDS open 117341-118360 _na     339_aa pyrD quinone-dependent dihydroorotate dehydrogenase
167 NPOT01000001.1 GCA002266485_00101 CDS open 118432-121041 _na     869_aa pepN aminopeptidase N
168 NPOT01000001.1 GCA002266485_00102 CDS open 121463-122653 _na     396_aa tyrB Aminotransferase
169 NPOT01000001.1 GCA002266485_00103 CDS open 122704-123267 _na     187_aa acrR AcrR family transcriptional regulator
170 NPOT01000001.1 GCA002266485_00104 CDS open 123415-124395 _na     326_aa emrA HlyD family efflux transporter periplasmic adaptor subunit
171 NPOT01000001.1 GCA002266485_00105 CDS open 124398-127142 _na     914_aa rbbA ribosome-associated ATPase/putative transporter RbbA
172 NPOT01000001.1 GCA002266485_00106 CDS open 127144-128271 _na     375_aa yadH ABC transporter permease
173 NPOT01000001.1 GCA002266485_00107 CDS open 128291-129709 _na     472_aa tolC TolC family protein
174 NPOT01000001.1 GCA002266485_00108 CDS open 129876-130229 _na     117_aa hypothetical protein
175 NPOT01000001.1 GCA002266485_00109 CDS open 130396-130884 _na     162_aa nlpC Endopeptidase
176 NPOT01000001.1 GCA002266485_00110 CDS open 130936-131232 _na     98_aa hupA integration host factor subunit alpha
177 NPOT01000001.1 GCA002266485_00111 CDS open 131236-133626 _na     796_aa pheT phenylalanine--tRNA ligase subunit beta
178 NPOT01000001.1 GCA002266485_00112 CDS open 133646-134635 _na     329_aa pheS phenylalanine--tRNA ligase subunit alpha
179 NPOT01000001.1 GCA002266485_00114 CDS open 134975-135850 _na     291_aa htpX protease HtpX
180 NPOT01000001.1 GCA002266485_00116 CDS open 136532-137467 _na     311_aa gutQ Arabinose 5-phosphate isomerase
181 NPOT01000001.1 GCA002266485_00117 CDS open 137467-138021 _na     184_aa kdsC 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC
182 NPOT01000001.1 GCA002266485_00118 CDS open 138187-139734 _na     515_aa trpE anthranilate synthase component 1
183 NPOT01000001.1 GCA002266485_00119 CDS open 139745-140335 _na     196_aa pabA anthranilate synthase
184 NPOT01000001.1 GCA002266485_00120 CDS open 140409-140801 _na     130_aa Tautomerase enzyme
185 NPOT01000001.1 GCA002266485_00121 CDS open 140813-141526 _na     237_aa anthranilate phosphoribosyltransferase
186 NPOT01000001.1 GCA002266485_00122 CDS open 141725-142003 _na     92_aa higB Killer protein
187 NPOT01000001.1 GCA002266485_00123 CDS open 142013-142291 _na     92_aa higA HigA family addiction module antitoxin
188 NPOT01000001.1 GCA002266485_00124 CDS open 142300-143730 _na     476_aa trpF bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF
189 NPOT01000001.1 GCA002266485_00125 CDS open 143869-144156 _na     95_aa hypothetical protein
190 NPOT01000001.1 GCA002266485_00126 CDS open 144186-144461 _na     91_aa hybG hydrogenase maturation factor HybG
191 NPOT01000001.1 GCA002266485_00127 CDS open 144582-144959 _na     125_aa DUF2335 domain-containing protein
192 NPOT01000001.1 GCA002266485_00128 CDS open 144934-145125 _na     63_aa hypothetical protein
193 NPOT01000001.1 GCA002266485_00129 CDS open 145486-145752 _na     88_aa oadG putative oxaloacetate decarboxylase gamma chain
194 NPOT01000001.1 GCA002266485_00130 CDS open 145768-147564 _na     598_aa oadA sodium-extruding oxaloacetate decarboxylase subunit alpha
195 NPOT01000001.1 GCA002266485_00131 CDS open 147575-148879 _na     434_aa oadB Oxaloacetate decarboxylase beta chain
196 NPOT01000001.1 GCA002266485_00132 CDS open 149283-150251 _na     322_aa TonB-dependent receptor domain-containing protein
197 NPOT01000001.1 GCA002266485_00133 CDS open 150220-151728 _na     502_aa lactoferrin/transferrin family TonB-dependent receptor
198 NPOT01000001.1 GCA002266485_00134 CDS open 152234-152485 _na     83_aa hypothetical protein
199 NPOT01000001.1 GCA002266485_00135 CDS open 152517-153197 _na     226_aa ydfG Malonic semialdehyde reductase
200 NPOT01000001.1 GCA002266485_00136 CDS open 153207-154400 _na     397_aa trpB tryptophan synthase subunit beta
201 NPOT01000001.1 GCA002266485_00137 CDS open 154403-155209 _na     268_aa Tryptophan synthase alpha chain
202 NPOT01000001.1 GCA002266485_00138 CDS open 155479-157164 _na     561_aa nrdA ribonucleoside-diphosphate reductase subunit alpha
203 NPOT01000001.1 GCA002266485_00139 CDS open 157295-158284 _na     329_aa nrdB ribonucleoside-diphosphate reductase
204 NPOT01000001.1 GCA002266485_00140 CDS open 158531-159976 _na     481_aa pyk pyruvate kinase
205 NPOT01000001.1 GCA002266485_00141 CDS open 160080-160382 _na     100_aa lsrG (4S)-4-hydroxy-5-phosphonooxypentane-2%2C3-dione isomerase
206 NPOT01000001.1 GCA002266485_00142 CDS open 160415-161293 _na     292_aa lsrF 3-hydroxy-5-phosphonooxypentane-2%2C4-dione thiolase
207 NPOT01000001.1 GCA002266485_00143 CDS open 161312-162409 _na     365_aa lsrB autoinducer 2 ABC transporter substrate-binding protein LsrB
208 NPOT01000001.1 GCA002266485_00145 CDS open 162434-163438 _na     334_aa lsrD autoinducer 2 ABC transporter permease LsrD
209 NPOT01000001.1 GCA002266485_00146 CDS open 163452-164483 _na     343_aa lsrC autoinducer 2 ABC transporter permease LsrC
210 NPOT01000001.1 GCA002266485_00147 CDS open 164492-166009 _na     505_aa lsrA autoinducer 2 ABC transporter ATP-binding protein LsrA
211 NPOT01000001.1 GCA002266485_00148 CDS open 166252-167217 _na     321_aa lsrR transcriptional regulator LsrR
212 NPOT01000001.1 GCA002266485_00149 CDS open 167266-168840 _na     524_aa lsrK autoinducer-2 kinase
213 NPOT01000001.1 GCA002266485_00150 CDS open 168930-169658 _na     242_aa bioD dethiobiotin synthase
214 NPOT01000001.1 GCA002266485_00151 CDS open 169735-170964 _na     409_aa nagC NagC family transcriptional regulator
215 NPOT01000001.1 GCA002266485_00152 CDS open 171160-172563 _na     467_aa asnS asparagine--tRNA ligase
216 NPOT01000001.1 GCA002266485_00153 CDS open 172726-173187 _na     153_aa sspB ClpXP protease specificity-enhancing factor
217 NPOT01000001.1 GCA002266485_00154 CDS open 173199-173840 _na     213_aa sspA stringent starvation protein SspA
218 NPOT01000001.1 GCA002266485_00155 CDS open 174040-174495 _na     151_aa moaE molybdopterin synthase catalytic subunit MoaE
219 NPOT01000001.1 GCA002266485_00156 CDS open 174496-174741 _na     81_aa moaD molybdopterin synthase sulfur carrier subunit
220 NPOT01000001.1 GCA002266485_00157 CDS open 174741-175181 _na     146_aa moaC cyclic pyranopterin monophosphate synthase MoaC
221 NPOT01000001.1 GCA002266485_00158 CDS open 175276-176289 _na     337_aa moaA GTP 3'%2C8-cyclase MoaA
222 NPOT01000001.1 GCA002266485_00159 CDS open 176647-177615 _na     322_aa cofD Putative gluconeogenesis factor
223 NPOT01000001.1 GCA002266485_00160 CDS open 177773-178564 _na     263_aa tnp IS5 family transposase
224 NPOT01000001.1 GCA002266485_00161 CDS open 178561-178716 _na     51_aa hypothetical protein
225 NPOT01000001.1 GCA002266485_00162 CDS open 178765-179280 _na     171_aa phage tail protein
226 NPOT01000001.1 GCA002266485_00163 CDS open 179325-179528 _na     67_aa hypothetical protein
227 NPOT01000001.1 GCA002266485_00164 CDS open 179528-179944 _na     138_aa hypothetical protein
228 NPOT01000001.1 GCA002266485_00165 CDS open 180127-180777 _na     216_aa hypothetical protein
229 NPOT01000001.1 GCA002266485_00166 CDS open 181187-181870 _na     227_aa XRE family transcriptional regulator
230 NPOT01000001.1 GCA002266485_00167 CDS open 181994-182176 _na     60_aa hypothetical protein
231 NPOT01000001.1 GCA002266485_00168 CDS open 182269-182469 _na     66_aa hypothetical protein
232 NPOT01000001.1 GCA002266485_00169 CDS open 182869-183231 _na     120_aa hypothetical protein
233 NPOT01000001.1 GCA002266485_00170 CDS open 183171-184184 _na     337_aa replication endonuclease
234 NPOT01000001.1 GCA002266485_00171 CDS open 184197-184985 _na     262_aa replication endonuclease
235 NPOT01000001.1 GCA002266485_00172 CDS open 185095-185502 _na     135_aa site-specific DNA-methyltransferase
236 NPOT01000001.1 GCA002266485_00173 CDS open 185506-185859 _na     117_aa MazG-like family protein
237 NPOT01000001.1 GCA002266485_00174 CDS open 185887-186654 _na     255_aa tnp IS5 family ISAac2 transposase
238 NPOT01000001.1 GCA002266485_00175 CDS open 186691-186954 _na     87_aa Phage tail protein
239 NPOT01000001.1 GCA002266485_00176 CDS open 187154-187849 _na     231_aa WD40 repeat domain-containing protein
240 NPOT01000001.1 GCA002266485_00178 CDS open 188062-189048 _na     328_aa fepD Iron ABC transporter permease
241 NPOT01000001.1 GCA002266485_00179 CDS open 189048-189842 _na     264_aa fepC ABC transporter ATP-binding protein
242 NPOT01000001.1 GCA002266485_00180 CDS open 189855-190889 _na     344_aa fepB ABC transporter substrate-binding protein
243 NPOT01000001.1 GCA002266485_00181 CDS open 190972-191181 _na     69_aa mopI Molybdenum-pterin-binding protein II
244 NPOT01000001.1 GCA002266485_00182 CDS open 191301-193697 _na     798_aa tonB TonB dependent outer membrane siderophore receptor protein
245 NPOT01000001.1 GCA002266485_00183 CDS open 193792-194541 _na     249_aa fepC ABC transporter ATP-binding protein
246 NPOT01000001.1 GCA002266485_00184 CDS open 194538-195551 _na     337_aa fepD Iron ABC transporter permease
247 NPOT01000001.1 GCA002266485_00185 CDS open 195551-196552 _na     333_aa fepB Iron ABC transporter substrate-binding protein
248 NPOT01000001.1 GCA002266485_00186 CDS open 196763-197260 _na     165_aa Chemotaxis protein
249 NPOT01000001.1 GCA002266485_00187 CDS open 197262-199274 _na     670_aa TonB-dependent receptor
250 NPOT01000001.1 GCA002266485_00188 CDS open 199364-199780 _na     138_aa doxX DoxX family protein
251 NPOT01000001.1 GCA002266485_00189 CDS open 199957-200886 _na     309_aa ttcA tRNA 2-thiocytidine(32) synthetase TtcA
252 NPOT01000001.1 GCA002266485_00190 CDS open 200903-201403 _na     166_aa yncB Chromosome partitioning protein ParB
253 NPOT01000001.1 GCA002266485_00191 CDS open 201409-202605 _na     398_aa csdA cysteine desulfurase
254 NPOT01000001.1 GCA002266485_00192 CDS open 202602-202982 _na     126_aa sufE SufE family protein
255 NPOT01000001.1 GCA002266485_00193 CDS open 203024-204454 _na     476_aa hldE bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE
256 NPOT01000001.1 GCA002266485_00194 CDS open 204568-205503 _na     311_aa lpxP Lipid A biosynthesis acyltransferase
257 NPOT01000001.1 GCA002266485_00195 CDS open 205561-206124 _na     187_aa torD Molecular chaperone
258 NPOT01000001.1 GCA002266485_00196 CDS open 206124-206735 _na     203_aa mdaB NAD(P)H oxidoreductase
259 NPOT01000001.1 GCA002266485_00197 CDS open 206744-207190 _na     148_aa ybbJ Regulator of membrane protease activity
260 NPOT01000001.1 GCA002266485_00198 CDS open 207214-208140 _na     308_aa hflC Protein QmcA
261 NPOT01000001.1 GCA002266485_00199 CDS open 208662-209483 _na     273_aa ega3 putative glucanotransferase
262 NPOT01000001.1 GCA002266485_00200 CDS open 209692-210183 _na     163_aa DUF302 domain-containing protein
263 NPOT01000001.1 GCA002266485_00201 CDS open 210256-210678 _na     140_aa ykgB DUF417 domain-containing protein
264 NPOT01000001.1 GCA002266485_00202 CDS open 210735-210944 _na     69_aa hypothetical protein
265 NPOT01000001.1 GCA002266485_00203 CDS open 211285-212667 _na     460_aa mauG Quinol peroxidase
266 NPOT01000001.1 GCA002266485_00204 CDS open 212755-213912 _na     385_aa rnd ribonuclease D
267 NPOT01000001.1 GCA002266485_00205 CDS open 213979-215061 _na     360_aa Long-chain-fatty-acid--CoA ligase
268 NPOT01000001.1 GCA002266485_00206 CDS open 215062-215610 _na     182_aa AMP-dependent synthetase/ligase domain-containing protein
269 NPOT01000001.1 GCA002266485_00207 CDS open 215653-216210 _na     185_aa slp Slp family lipoprotein
270 NPOT01000001.1 GCA002266485_00208 CDS open 216242-216964 _na     240_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
271 NPOT01000001.1 GCA002266485_00209 CDS open 216967-218904 _na     645_aa dinG DNA 5'-3' helicase
272 NPOT01000001.1 GCA002266485_00210 CDS open 218980-219798 _na     272_aa yeaD Putative glucose-6-phosphate 1-epimerase
273 NPOT01000001.1 GCA002266485_00211 CDS open 220082-220984 _na     300_aa malM maltose operon protein MalM
274 NPOT01000001.1 GCA002266485_00212 CDS open 221070-222353 _na     427_aa Maltoporin
275 NPOT01000001.1 GCA002266485_00213 CDS open 222430-223548 _na     372_aa malK maltose/maltodextrin ABC transporter ATP-binding protein MalK
276 NPOT01000001.1 GCA002266485_00214 CDS open 224004-225194 _na     396_aa malE maltose/maltodextrin ABC transporter substrate-binding protein MalE
277 NPOT01000001.1 GCA002266485_00215 CDS open 225318-226856 _na     512_aa malF maltose ABC transporter permease MalF
278 NPOT01000001.1 GCA002266485_00216 CDS open 226878-227768 _na     296_aa malG maltose ABC transporter permease MalG
279 NPOT01000001.1 GCA002266485_00217 CDS open 227862-229913 _na     683_aa amyA alpha-amylase
280 NPOT01000001.1 GCA002266485_00218 CDS open 229973-231013 _na     346_aa potA ATP-binding cassette domain-containing protein
281 NPOT01000001.1 GCA002266485_00219 CDS open 230997-233027 _na     676_aa fbpB Iron ABC transporter permease
282 NPOT01000001.1 GCA002266485_00220 CDS open 233079-234107 _na     342_aa afuA ABC transporter substrate-binding protein
283 NPOT01000001.1 GCA002266485_00221 CDS open 234381-235853 _na     490_aa But not for modification
284 NPOT01000001.1 GCA002266485_00222 CDS open 236156-238426 _na     756_aa nrdA class 1a ribonucleoside-diphosphate reductase subunit alpha
285 NPOT01000001.1 GCA002266485_00223 CDS open 238526-238966 _na     146_aa Pyruvate kinase
286 NPOT01000001.1 GCA002266485_00224 CDS open 239069-240199 _na     376_aa nrdB class Ia ribonucleoside-diphosphate reductase subunit beta
287 NPOT01000001.1 GCA002266485_00225 CDS open 240559-240807 _na     82_aa yfaE class I ribonucleotide reductase maintenance protein YfaE
288 NPOT01000001.1 GCA002266485_00227 CDS open 240974-241786 _na     270_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
289 NPOT01000001.1 GCA002266485_00228 CDS open 241808-242431 _na     207_aa rhtB Threonine efflux protein
290 NPOT01000001.1 GCA002266485_00229 CDS open 242440-242931 _na     163_aa pgpA Phosphatidylglycerophosphatase A
291 NPOT01000001.1 GCA002266485_00230 CDS open 242941-243924 _na     327_aa thiL thiamine-phosphate kinase
292 NPOT01000001.1 GCA002266485_00231 CDS open 243943-244368 _na     141_aa nusB transcription antitermination factor NusB
293 NPOT01000001.1 GCA002266485_00232 CDS open 244375-244848 _na     157_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
294 NPOT01000001.1 GCA002266485_00233 CDS open 245091-245975 _na     294_aa DUF1311 domain-containing protein
295 NPOT01000001.1 GCA002266485_00234 CDS open 246296-247945 _na     549_aa pgi glucose-6-phosphate isomerase
296 NPOT01000001.1 GCA002266485_00235 CDS open 247961-249043 _na     360_aa alr alanine racemase
297 NPOT01000001.1 GCA002266485_00236 CDS open 249067-250473 _na     468_aa dnaB replicative DNA helicase
298 NPOT01000001.1 GCA002266485_00237 CDS open 250619-251698 _na     359_aa aroG 3-deoxy-7-phosphoheptulonate synthase AroG
299 NPOT01000001.1 GCA002266485_00238 CDS open 251799-253049 _na     416_aa lolE lipoprotein-releasing ABC transporter permease subunit LolE
300 NPOT01000001.1 GCA002266485_00239 CDS open 253049-253735 _na     228_aa lolD lipoprotein-releasing ABC transporter ATP-binding protein LolD
301 NPOT01000001.1 GCA002266485_00240 CDS open 253750-254934 _na     394_aa lolE lipoprotein-releasing ABC transporter permease subunit
302 NPOT01000001.1 GCA002266485_00241 CDS open 255501-256673 _na     390_aa hypothetical protein
303 NPOT01000001.1 GCA002266485_00242 CDS open 256691-259606 _na     971_aa vasX toxin VasX
304 NPOT01000001.1 GCA002266485_00243 CDS open 259617-260903 _na     428_aa DUF4123 domain-containing protein
305 NPOT01000001.1 GCA002266485_00244 CDS open 261653-262054 _na     133_aa ycgN YcgN family cysteine cluster protein
306 NPOT01000001.1 GCA002266485_00245 CDS open 262126-263796 _na     556_aa glnS glutamine--tRNA ligase
307 NPOT01000001.1 GCA002266485_00246 CDS open 264018-265202 _na     394_aa macA Putative MacA
308 NPOT01000001.1 GCA002266485_00247 CDS open 265222-267156 _na     644_aa macB Macrolide export ATP-binding/permease protein MacB
309 NPOT01000001.1 GCA002266485_00248 CDS open 267233-268606 _na     457_aa tdeA toxin/drug exporter TdeA
310 NPOT01000001.1 GCA002266485_00249 CDS open 268861-270402 _na     513_aa subtype B tannase
311 NPOT01000001.1 GCA002266485_00250 CDS open 270519-270842 _na     107_aa Alkylphosphonate utilization protein
312 NPOT01000001.1 GCA002266485_00251 CDS open 270925-271788 _na     287_aa rhaT Putative membrane protein
313 NPOT01000001.1 GCA002266485_00252 CDS open 271833-272519 _na     228_aa rluA Pseudouridine synthase
314 NPOT01000001.1 GCA002266485_00253 CDS open 272641-273558 _na     305_aa lysO Lysine exporter LysO family protein
315 NPOT01000001.1 GCA002266485_00254 CDS open 273572-275029 _na     485_aa cls cardiolipin synthase
316 NPOT01000001.1 GCA002266485_00255 CDS open 275091-275732 _na     213_aa phoE phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
317 NPOT01000001.1 GCA002266485_00256 CDS open 275789-277135 _na     448_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
318 NPOT01000001.1 GCA002266485_00257 CDS open 277158-278054 _na     298_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
319 NPOT01000001.1 GCA002266485_00258 CDS open 278280-278525 _na     81_aa xseB exodeoxyribonuclease VII small subunit
320 NPOT01000001.1 GCA002266485_00259 CDS open 278536-279426 _na     296_aa ispA (2E%2C6E)-farnesyl diphosphate synthase
321 NPOT01000001.1 GCA002266485_00260 CDS open 279511-281361 _na     616_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
322 NPOT01000001.1 GCA002266485_00261 CDS open 281481-282239 _na     252_aa glpR Transcriptional regulator
323 NPOT01000001.1 GCA002266485_00262 CDS open 282306-283286 _na     326_aa gatD galactitol-1-phosphate 5-dehydrogenase
324 NPOT01000001.1 GCA002266485_00263 CDS open 283309-283545 _na     78_aa PTS galactitol transporter subunit IIC
325 NPOT01000001.1 GCA002266485_00264 CDS open 283542-285509 _na     655_aa gatZ tagatose-bisphosphate aldolase subunit GatZ
326 NPOT01000001.1 GCA002266485_00265 CDS open 285524-286477 _na     317_aa lacD tagatose-bisphosphate aldolase
327 NPOT01000001.1 GCA002266485_00266 CDS open 287454-287807 _na     117_aa rplT 50S ribosomal protein L20
328 NPOT01000001.1 GCA002266485_00267 CDS open 287861-288058 _na     65_aa rpmI 50S ribosomal protein L35
329 NPOT01000001.1 GCA002266485_00268 CDS open 288283-288747 _na     154_aa infC translation initiation factor IF-3
330 NPOT01000001.1 GCA002266485_00269 CDS open 289138-289917 _na     259_aa fpr ferredoxin--NADP(+) reductase
331 NPOT01000001.1 GCA002266485_00270 CDS open 290089-290463 _na     124_aa Transposase
332 NPOT01000001.1 GCA002266485_00271 CDS open 290505-291266 _na     253_aa insO IS3 family transposase
333 NPOT01000001.1 GCA002266485_00272 CDS open 291353-292387 _na     344_aa dinB DNA polymerase IV
334 NPOT01000001.1 GCA002266485_00273 CDS open 292557-293384 _na     275_aa folP dihydropteroate synthase
335 NPOT01000001.1 GCA002266485_00274 CDS open 293412-294749 _na     445_aa glmM phosphoglucosamine mutase
336 NPOT01000001.1 GCA002266485_00275 CDS open 294762-295229 _na     155_aa sixA phosphohistidine phosphatase SixA
337 NPOT01000001.1 GCA002266485_00276 CDS open 295453-295998 _na     181_aa Histone
338 NPOT01000001.1 GCA002266485_00277 CDS open 296020-296682 _na     220_aa minC septum site-determining protein MinC
339 NPOT01000001.1 GCA002266485_00278 CDS open 296766-297017 _na     83_aa ycgL YcgL domain-containing protein ACT75-10365
340 NPOT01000001.1 GCA002266485_00279 CDS open 297061-297342 _na     93_aa hypothetical protein
341 NPOT01000001.1 GCA002266485_00280 CDS open 297415-297924 _na     169_aa nlpC NlpC/P60 domain-containing protein
342 NPOT01000001.1 GCA002266485_00281 CDS open 298104-298958 _na     284_aa kdsA 3-deoxy-8-phosphooctulonate synthase
343 NPOT01000001.1 GCA002266485_00282 CDS open 298968-299867 _na     299_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
344 NPOT01000001.1 GCA002266485_00283 CDS open 299907-300989 _na     360_aa prfA peptide chain release factor 1
345 NPOT01000001.1 GCA002266485_00284 CDS open 301130-301585 _na     151_aa slyB Glycine zipper 2TM domain-containing protein
346 NPOT01000001.1 GCA002266485_00285 CDS open 301736-302215 _na     159_aa yecM VOC family protein
347 NPOT01000001.1 GCA002266485_00286 CDS open 302312-304045 _na     577_aa argS arginine--tRNA ligase
348 NPOT01000001.1 GCA002266485_00288 CDS open 304642-305622 _na     326_aa oxidoreductase
349 NPOT01000001.1 GCA002266485_00289 CDS open 305683-306162 _na     159_aa ybaK Cys-tRNA(Pro) deacylase
350 NPOT01000001.1 GCA002266485_00291 CDS open 306466-307863 _na     465_aa norM Multidrug-efflux transporter
351 NPOT01000001.1 GCA002266485_00292 CDS open 307890-308504 _na     204_aa ribC riboflavin synthase subunit alpha
352 NPOT01000001.1 GCA002266485_00293 CDS open 308537-308833 _na     98_aa pA5055 Addiction module antitoxin
353 NPOT01000001.1 GCA002266485_00294 CDS open 308830-309129 _na     99_aa Type II toxin-antitoxin system RelE/ParE family toxin
354 NPOT01000001.1 GCA002266485_00295 CDS open 309297-309599 _na     100_aa yhbY ribosome assembly RNA-binding protein YhbY
355 NPOT01000001.1 GCA002266485_00296 CDS open 309675-310151 _na     158_aa greA transcription elongation factor GreA
356 NPOT01000001.1 GCA002266485_00298 CDS open 310311-311753 _na     480_aa dacB serine-type D-Ala-D-Ala carboxypeptidase
357 NPOT01000001.1 GCA002266485_00299 CDS open 311852-312508 _na     218_aa folE GTP cyclohydrolase I FolE
358 NPOT01000001.1 GCA002266485_00300 CDS open 312637-313851 _na     404_aa moeA molybdopterin molybdotransferase MoeA
359 NPOT01000001.1 GCA002266485_00301 CDS open 313867-314598 _na     243_aa moeB molybdopterin-synthase adenylyltransferase MoeB
360 NPOT01000001.1 GCA002266485_00302 CDS open 314598-314777 _na     59_aa hypothetical protein
361 NPOT01000001.1 GCA002266485_00303 CDS open 314995-315099 _na     34_aa DUF4372 domain-containing protein
362 NPOT01000001.1 GCA002266485_00304 CDS open 315318-316175 _na     285_aa cnoX Co-chaperone YbbN
363 NPOT01000001.1 GCA002266485_00305 CDS open 316235-317188 _na     317_aa trxB thioredoxin-disulfide reductase
364 NPOT01000001.1 GCA002266485_00306 CDS open 317222-319057 _na     611_aa cydD heme ABC transporter permease/ATP-binding protein CydD
365 NPOT01000001.1 GCA002266485_00307 CDS open 319057-320790 _na     577_aa cydC heme ABC transporter ATP-binding protein/permease CydC
366 NPOT01000001.1 GCA002266485_00309 CDS open 321041-321907 _na     288_aa tesB acyl-CoA thioesterase II
367 NPOT01000001.1 GCA002266485_00310 CDS open 322056-322184 _na     42_aa Lipoprotein
368 NPOT01000001.1 GCA002266485_00311 CDS open 322181-322921 _na     246_aa bud32 Protein kinase family protein
369 NPOT01000001.1 GCA002266485_00312 CDS open 322987-323622 _na     211_aa Lipoprotein
370 NPOT01000001.1 GCA002266485_00313 CDS open 323710-324294 _na     194_aa Outer-membrane lipoprotein carrier protein
371 NPOT01000001.1 GCA002266485_00314 CDS open 324351-325265 _na     304_aa nagK N-acetylglucosamine kinase
372 NPOT01000001.1 GCA002266485_00315 CDS open 325316-326077 _na     253_aa undecaprenyl-diphosphate phosphatase
373 NPOT01000001.1 GCA002266485_00316 CDS open 326133-326786 _na     217_aa ribA GTP cyclohydrolase-2
374 NPOT01000001.1 GCA002266485_00317 CDS open 327061-327801 _na     246_aa Orf14 protein
375 NPOT01000001.1 GCA002266485_00318 CDS open 327963-328991 _na     342_aa rfbB dTDP-glucose 4%2C6-dehydratase
376 NPOT01000001.1 GCA002266485_00319 CDS open 329016-329810 _na     264_aa TIGR01619 family protein
377 NPOT01000001.1 GCA002266485_00320 CDS open 329810-330613 _na     267_aa xthA exodeoxyribonuclease III
378 NPOT01000001.1 GCA002266485_00321 CDS open 331155-332573 _na     472_aa wcaJ Galactosyltransferase
379 NPOT01000001.1 GCA002266485_00322 CDS open 332536-333492 _na     318_aa bcsA Rhamnosyltransferase
380 NPOT01000001.1 GCA002266485_00323 CDS open 333502-334371 _na     289_aa wcaA Glycosyltransferase
381 NPOT01000001.1 GCA002266485_00324 CDS open 334364-334744 _na     126_aa DUF2304 domain-containing protein
382 NPOT01000001.1 GCA002266485_00325 CDS open 334744-335448 _na     234_aa wcaA Putative glycosyltransferase
383 NPOT01000001.1 GCA002266485_00326 CDS open 335457-335849 _na     130_aa dTDP-glucose-4-keto-6-deoxy-D-glucose reductase
384 NPOT01000001.1 GCA002266485_00327 CDS open 335833-337962 _na     709_aa yfhO YfhO family protein
385 NPOT01000001.1 GCA002266485_00328 CDS open 337973-339154 _na     393_aa Putative glycosyltransferase
386 NPOT01000001.1 GCA002266485_00329 CDS open 339166-339906 _na     246_aa Teichoic acid ABC transporter ATP-binding protein
387 NPOT01000001.1 GCA002266485_00330 CDS open 339916-340701 _na     261_aa Transport permease protein
388 NPOT01000001.1 GCA002266485_00331 CDS open 340801-341343 _na     180_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
389 NPOT01000001.1 GCA002266485_00332 CDS open 341346-342224 _na     292_aa rfbD dTDP-4-dehydrorhamnose reductase
390 NPOT01000001.1 GCA002266485_00333 CDS open 342226-343098 _na     290_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
391 NPOT01000001.1 GCA002266485_00334 CDS open 343176-344243 _na     355_aa rffG dTDP-glucose 4%2C6-dehydratase
392 NPOT01000001.1 GCA002266485_00335 CDS open 344313-345443 _na     376_aa mltB Transglycosylase SLT domain-containing protein
393 NPOT01000001.1 GCA002266485_00336 CDS open 345445-346254 _na     269_aa wcaA Putative UDP-galactose--lipooligosaccharide galactosyltransferase
394 NPOT01000001.1 GCA002266485_00337 CDS open 346323-347204 _na     293_aa wcaA Putative glycosyltransferase
395 NPOT01000001.1 GCA002266485_00338 CDS open 347204-348394 _na     396_aa Serotype b-specific antigen synthesis gene cluster
396 NPOT01000001.1 GCA002266485_00339 CDS open 348403-349173 _na     256_aa Glycosyltransferase family 25 protein
397 NPOT01000001.1 GCA002266485_00340 CDS open 349310-350833 _na     507_aa rfbX Polysaccharide biosynthesis protein
398 NPOT01000001.1 GCA002266485_00341 CDS open 350830-351786 _na     318_aa epsI Polysaccharide pyruvyl transferase
399 NPOT01000001.1 GCA002266485_00342 CDS open 351895-352146 _na     83_aa stbD Antitoxin
400 NPOT01000001.1 GCA002266485_00343 CDS open 352143-352397 _na     84_aa Txe/YoeB family addiction module toxin
401 NPOT01000001.1 GCA002266485_00344 CDS open 352410-353153 _na     247_aa elyC Molybdate ABC transporter permease
402 NPOT01000001.1 GCA002266485_00345 CDS open 353330-354157 _na     275_aa cDC9 DNA ligase
403 NPOT01000001.1 GCA002266485_00347 CDS open 354290-356464 _na     724_aa uvrD DNA helicase II
404 NPOT01000001.1 GCA002266485_00348 CDS open 356638-357987 _na     449_aa gntT Inner membrane permease ygbN
405 NPOT01000001.1 GCA002266485_00349 CDS open 358205-358723 _na     172_aa gntK Gluconokinase
406 NPOT01000001.1 GCA002266485_00350 CDS open 358793-359791 _na     332_aa gntR gluconate operon transcriptional repressor GntR
407 NPOT01000001.1 GCA002266485_00351 CDS open 359840-360664 _na     274_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
408 NPOT01000001.1 GCA002266485_00352 CDS open 360740-360919 _na     59_aa hypothetical protein
409 NPOT01000001.1 GCA002266485_00353 CDS open 360906-363995 _na     1029_aa fdnG formate dehydrogenase-N subunit alpha
410 NPOT01000001.1 GCA002266485_00354 CDS open 363997-364923 _na     308_aa fdxH formate dehydrogenase subunit beta
411 NPOT01000001.1 GCA002266485_00355 CDS open 364880-365629 _na     249_aa fdnI formate dehydrogenase subunit gamma
412 NPOT01000001.1 GCA002266485_00356 CDS open 366196-368481 _na     761_aa hypF carbamoyltransferase HypF
413 NPOT01000001.1 GCA002266485_00357 CDS open 368774-369373 _na     199_aa hycB Formate hydrogenlyase subunit 2 (Fhl subunit 2) (Hydrogenase-3 component b)
414 NPOT01000001.1 GCA002266485_00358 CDS open 369407-371428 _na     673_aa hyfB hydrogenase 4 subunit B
415 NPOT01000001.1 GCA002266485_00359 CDS open 371439-372401 _na     320_aa hyfC Hydrogenase-4 component C
416 NPOT01000001.1 GCA002266485_00360 CDS open 372414-373859 _na     481_aa nuoL hydrogenase 4 subunit D
417 NPOT01000001.1 GCA002266485_00361 CDS open 373870-374508 _na     212_aa hyfE hydrogenase 4 membrane subunit
418 NPOT01000001.1 GCA002266485_00362 CDS open 374513-376051 _na     512_aa hyfB hydrogenase 4 subunit F
419 NPOT01000001.1 GCA002266485_00363 CDS open 376071-377801 _na     576_aa hycE1 Respiratory-chain NADH dehydrogenase%2C 30 Kd subunit
420 NPOT01000001.1 GCA002266485_00364 CDS open 377815-378462 _na     215_aa nuoI 4Fe-4S binding domain protein
421 NPOT01000001.1 GCA002266485_00365 CDS open 378459-379235 _na     258_aa hycG Hydrogenase
422 NPOT01000001.1 GCA002266485_00366 CDS open 379370-379774 _na     134_aa hycH Formate hydrogenlyase maturation protein HycH
423 NPOT01000001.1 GCA002266485_00367 CDS open 379803-380225 _na     140_aa hycI hydrogenase maturation peptidase HycI
424 NPOT01000001.1 GCA002266485_00368 CDS open 380413-381525 _na     370_aa protein adenylyltransferase
425 NPOT01000001.1 GCA002266485_00369 CDS open 381721-382146 _na     141_aa Molybdopterin oxidoreductase Fe4S4 domain protein
426 NPOT01000001.1 GCA002266485_00370 CDS open 382195-383880 _na     561_aa fdhF formate dehydrogenase subunit alpha
427 NPOT01000001.1 GCA002266485_00371 CDS open 384090-384413 _na     107_aa C-type lysozyme inhibitor domain-containing protein
428 NPOT01000001.1 GCA002266485_00372 CDS open 384576-384920 _na     114_aa Lipoprotein
429 NPOT01000001.1 GCA002266485_00373 CDS open 384922-385731 _na     269_aa hypothetical protein
430 NPOT01000001.1 GCA002266485_00374 CDS open 385728-386210 _na     160_aa hypothetical protein
431 NPOT01000001.1 GCA002266485_00375 CDS open 386243-387115 _na     290_aa sucD succinate--CoA ligase subunit alpha
432 NPOT01000001.1 GCA002266485_00376 CDS open 387126-388295 _na     389_aa sucC ADP-forming succinate--CoA ligase subunit beta
433 NPOT01000001.1 GCA002266485_00377 CDS open 388481-389704 _na     407_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
434 NPOT01000001.1 GCA002266485_00378 CDS open 389830-392637 _na     935_aa sucA 2-oxoglutarate dehydrogenase E1 component
435 NPOT01000001.1 GCA002266485_00379 CDS open 392916-393554 _na     212_aa Carboxy-protease
436 NPOT01000001.1 GCA002266485_00380 CDS open 393631-394191 _na     186_aa ycbK DUF882 domain-containing protein
437 NPOT01000001.1 GCA002266485_00381 CDS open 394256-395722 _na     488_aa ycbB L%2CD-transpeptidase
438 NPOT01000001.1 GCA002266485_00382 CDS open 395842-397899 _na     685_aa prc carboxy terminal-processing peptidase
439 NPOT01000001.1 GCA002266485_00383 CDS open 397973-398584 _na     203_aa proQ RNA chaperone ProQ
440 NPOT01000001.1 GCA002266485_00384 CDS open 398802-400085 _na     427_aa Paraquat-inducible protein A
441 NPOT01000001.1 GCA002266485_00385 CDS open 400048-402705 _na     885_aa pqiB MCE family protein
442 NPOT01000001.1 GCA002266485_00386 CDS open 402780-404024 _na     414_aa pepT peptidase T
443 NPOT01000001.1 GCA002266485_00387 CDS open 404288-405406 _na     372_aa potA spermidine/putrescine ABC transporter ATP-binding protein PotA
444 NPOT01000001.1 GCA002266485_00388 CDS open 405390-406250 _na     286_aa potB spermidine/putrescine ABC transporter permease PotB
445 NPOT01000001.1 GCA002266485_00389 CDS open 406250-407023 _na     257_aa potC spermidine/putrescine ABC transporter permease PotC
446 NPOT01000001.1 GCA002266485_00390 CDS open 407154-408251 _na     365_aa potD Putrescine-binding periplasmic protein
447 NPOT01000001.1 GCA002266485_00391 CDS open 408375-409271 _na     298_aa cdd cytidine deaminase
448 NPOT01000001.1 GCA002266485_00392 CDS open 409351-410667 _na     438_aa serS serine--tRNA ligase
449 NPOT01000001.1 GCA002266485_00393 CDS open 410974-412614 _na     546_aa dcuA Transporter%2C anaerobic C4-dicarboxylate uptake (Dcu) family
450 NPOT01000001.1 GCA002266485_00395 CDS open 413111-414451 _na     446_aa rarA Replication-associated recombination protein A
451 NPOT01000001.1 GCA002266485_00396 CDS open 414464-415108 _na     214_aa lolA outer membrane lipoprotein chaperone LolA
452 NPOT01000001.1 GCA002266485_00397 CDS open 415173-417917 _na     914_aa ftsK DNA translocase FtsK
453 NPOT01000001.1 GCA002266485_00398 CDS open 417921-418400 _na     159_aa lrp leucine-responsive transcriptional regulator Lrp
454 NPOT01000001.1 GCA002266485_00399 CDS open 419115-420119 _na     334_aa bioB biotin synthase BioB
455 NPOT01000001.1 GCA002266485_00400 CDS open 420165-420812 _na     215_aa thiQ thiamine ABC transporter ATP-binding protein
456 NPOT01000001.1 GCA002266485_00401 CDS open 420796-422424 _na     542_aa thiP thiamine/thiamine pyrophosphate ABC transporter permease ThiP
457 NPOT01000001.1 GCA002266485_00402 CDS open 422433-423437 _na     334_aa thiB thiamine ABC transporter substrate binding subunit
458 NPOT01000001.1 GCA002266485_00403 CDS open 423459-423839 _na     126_aa Phosphomethylpyrimidine kinase
459 NPOT01000001.1 GCA002266485_00404 CDS open 425008-425712 _na     234_aa hypothetical protein
460 NPOT01000001.1 GCA002266485_00405 CDS open 425778-426428 _na     216_aa cas4 CRISPR-associated protein Cas4
461 NPOT01000001.1 GCA002266485_00406 CDS open 426573-427439 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
462 NPOT01000001.1 GCA002266485_00407 CDS open 427452-429230 _na     592_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
463 NPOT01000001.1 GCA002266485_00408 CDS open 429227-429901 _na     224_aa cas5c type I-C CRISPR-associated protein Cas5c
464 NPOT01000001.1 GCA002266485_00409 CDS open 430016-431854 _na     612_aa PDDEXK nuclease domain-containing protein
465 NPOT01000001.1 GCA002266485_00410 CDS open 431918-432733 _na     271_aa DEAD/DEAH box helicase family protein
466 NPOT01000001.1 GCA002266485_00411 CDS open 432730-433764 _na     344_aa Cell filamentation protein Fic
467 NPOT01000001.1 GCA002266485_00412 CDS open 433748-433891 _na     47_aa hypothetical protein
468 NPOT01000001.1 GCA002266485_00413 CDS open 434000-435625 _na     541_aa site-specific DNA-methyltransferase
469 NPOT01000001.1 GCA002266485_00414 CDS open 435639-436580 _na     313_aa DUF4868 domain-containing protein
470 NPOT01000001.1 GCA002266485_00415 CDS open 436577-437158 _na     193_aa SLC26A/SulP transporter domain-containing protein
471 NPOT01000001.1 GCA002266485_00416 CDS open 437188-440064 _na     958_aa DEAD/DEAH box helicase
472 NPOT01000001.1 GCA002266485_00417 CDS open 440207-441994 _na     595_aa CRISPR-associated protein Cas3
473 NPOT01000001.1 GCA002266485_00418 CDS open 442025-442459 _na     144_aa CRISPR-associated endonuclease Cas3
474 NPOT01000001.1 GCA002266485_00419 CDS open 442775-443437 _na     220_aa ybhL BAX inhibitor protein
475 NPOT01000001.1 GCA002266485_00420 CDS open 443524-443853 _na     109_aa dsrC Sulfurtransferase
476 NPOT01000001.1 GCA002266485_00421 CDS open 443950-444831 _na     293_aa afeA iron ABC transporter substrate-binding protein AfeA
477 NPOT01000001.1 GCA002266485_00422 CDS open 444831-445721 _na     296_aa afeB ironABC transporter ATP-binding protein AfeB
478 NPOT01000001.1 GCA002266485_00423 CDS open 445721-446578 _na     285_aa afeC iron ABC transporter permease subunit AfeC
479 NPOT01000001.1 GCA002266485_00424 CDS open 446575-447423 _na     282_aa afeD iron ABC transporter permease subunit AfeD
480 NPOT01000001.1 GCA002266485_00425 CDS open 447398-447670 _na     90_aa acyP acylphosphatase
481 NPOT01000001.1 GCA002266485_00426 CDS open 447815-448495 _na     226_aa yccT curli polymerization inhibitor CsgI-related protein
482 NPOT01000001.1 GCA002266485_00427 CDS open 448558-449016 _na     152_aa mgsA methylglyoxal synthase
483 NPOT01000001.1 GCA002266485_00428 CDS open 449016-449489 _na     157_aa yccF YccF domain-containing protein
484 NPOT01000001.1 GCA002266485_00429 CDS open 449498-451639 _na     713_aa yccC TIGR01666 family membrane protein
485 NPOT01000001.1 GCA002266485_00430 CDS open 451636-452142 _na     168_aa smrB endonuclease SmrB
486 NPOT01000001.1 GCA002266485_00431 CDS open 452205-453155 _na     316_aa prmB 50S ribosomal protein L3 N(5)-glutamine methyltransferase
487 NPOT01000001.1 GCA002266485_00432 CDS open 453322-454266 _na     314_aa tktA2 1-deoxy-D-xylulose-5-phosphate synthase
488 NPOT01000001.1 GCA002266485_00433 CDS open 454256-455080 _na     274_aa tktA1 Transketolase
489 NPOT01000001.1 GCA002266485_00434 CDS open 455090-456445 _na     451_aa PTS ascorbate transporter subunit IIC
490 NPOT01000001.1 GCA002266485_00435 CDS open 456468-456737 _na     89_aa sgaB Ascorbate-specific phosphotransferase enzyme IIB component
491 NPOT01000001.1 GCA002266485_00436 CDS open 457305-457880 _na     191_aa SH3 domain-containing protein
492 NPOT01000001.1 GCA002266485_00437 CDS open 457877-458101 _na     74_aa hypothetical protein
493 NPOT01000001.1 GCA002266485_00438 CDS open 458513-458842 _na     109_aa glycoside hydrolase family 19
494 NPOT01000001.1 GCA002266485_00439 CDS open 458987-460330 _na     447_aa glycoside hydrolase family 19
495 NPOT01000001.1 GCA002266485_00440 CDS open 460371-462317 _na     648_aa uup ABC transporter ATP-binding protein
496 NPOT01000001.1 GCA002266485_00441 CDS open 462470-462772 _na     100_aa Type II toxin-antitoxin system RelE/ParE family toxin
497 NPOT01000001.1 GCA002266485_00442 CDS open 462774-463067 _na     97_aa Addiction module antitoxin
498 NPOT01000001.1 GCA002266485_00443 CDS open 463104-464456 _na     450_aa dgt anti-phage deoxyguanosine triphosphatase
499 NPOT01000001.1 GCA002266485_00444 CDS open 464458-465150 _na     230_aa lrgB CidB/LrgB family autolysis modulator
500 NPOT01000001.1 GCA002266485_00445 CDS open 465150-465560 _na     136_aa yohJ Putative effector of murein hydrolase LrgA%2C UPF0299 family