HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_002753835.1)

Select a Genome:
BAKTA Annotations for GCA_002753835.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
2 2951033 2495 12 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5133 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 5133 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 PEKN01000001.1 GCA002753835_01727 gene open 2008813-2009898
3502 PEKN01000001.1 GCA002753835_01728 gene open 2009919-2010689
3503 PEKN01000001.1 GCA002753835_01729 gene open 2010712-2011260
3504 PEKN01000001.1 GCA002753835_01730 gene open 2011523-2012623
3505 PEKN01000001.1 GCA002753835_01731 gene open 2013142-2013909
3506 PEKN01000001.1 GCA002753835_01732 gene open 2014113-2016128
3507 PEKN01000001.1 GCA002753835_01733 gene open 2016186-2016623
3508 PEKN01000001.1 GCA002753835_01734 gene open 2016759-2018198 pyk
3509 PEKN01000001.1 GCA002753835_01735 gene open 2018215-2018496
3510 PEKN01000001.1 GCA002753835_01736 gene open 2018501-2019286
3511 PEKN01000001.1 GCA002753835_01737 gene open 2019305-2019397
3512 PEKN01000001.1 GCA002753835_01738 gene open 2019927-2020910
3513 PEKN01000001.1 GCA002753835_01739 gene open 2020894-2021496
3514 PEKN01000001.1 GCA002753835_01740 gene open 2021637-2021843
3515 PEKN01000001.1 GCA002753835_01743 gene open 2022291-2022581
3516 PEKN01000001.1 GCA002753835_01744 gene open 2022578-2023231
3517 PEKN01000001.1 GCA002753835_01745 gene open 2023320-2023421
3518 PEKN01000001.1 GCA002753835_01746 gene open 2023418-2024104
3519 PEKN01000001.1 GCA002753835_01747 gene open 2024088-2024738
3520 PEKN01000001.1 GCA002753835_01748 gene open 2024767-2026122
3521 PEKN01000001.1 GCA002753835_01749 gene open 2026137-2026715
3522 PEKN01000001.1 GCA002753835_01750 gene open 2027293-2028252 ywqK
3523 PEKN01000001.1 GCA002753835_01751 gene open 2028429-2029700
3524 PEKN01000001.1 GCA002753835_01752 gene open 2029741-2029950
3525 PEKN01000001.1 GCA002753835_01753 gene open 2030050-2030961 eamA
3526 PEKN01000001.1 GCA002753835_01754 gene open 2031090-2032094
3527 PEKN01000001.1 GCA002753835_01755 gene open 2032111-2033124
3528 PEKN01000001.1 GCA002753835_01756 gene open 2033231-2033410 xseB
3529 PEKN01000001.1 GCA002753835_01757 gene open 2033429-2034727 xseA
3530 PEKN01000001.1 GCA002753835_01758 gene open 2035323-2037290
3531 PEKN01000001.1 GCA002753835_01759 gene open 2037519-2038406 dapA
3532 PEKN01000001.1 GCA002753835_01760 gene open 2038444-2039493
3533 PEKN01000001.1 GCA002753835_01761 gene open 2039888-2040664
3534 PEKN01000001.1 GCA002753835_01762 gene open 2040738-2042585 glmS
3535 PEKN01000001.1 GCA002753835_01763 gene open 2042612-2044501
3536 PEKN01000001.1 GCA002753835_01764 gene open 2044538-2045614
3537 PEKN01000001.1 GCA002753835_01765 gene open 2045614-2048838 carB
3538 PEKN01000001.1 GCA002753835_01766 gene open 2049081-2049839
3539 PEKN01000001.1 GCA002753835_01767 gene open 2050028-2050384
3540 PEKN01000001.1 GCA002753835_01768 gene open 2050497-2050688
3541 PEKN01000001.1 GCA002753835_01769 gene open 2051010-2052419 mtaB
3542 PEKN01000001.1 GCA002753835_01770 gene open 2052416-2053417
3543 PEKN01000001.1 GCA002753835_01771 gene open 2053574-2054380 gldB
3544 PEKN01000001.1 GCA002753835_01775 gene open 2055174-2055701
3545 PEKN01000001.1 GCA002753835_01776 gene open 2055729-2056685
3546 PEKN01000001.1 GCA002753835_01777 gene open 2056777-2057802
3547 PEKN01000001.1 GCA002753835_01778 gene open 2057835-2058497
3548 PEKN01000001.1 GCA002753835_01779 gene open 2058570-2060660
3549 PEKN01000001.1 GCA002753835_01780 gene open 2060693-2061139
3550 PEKN01000001.1 GCA002753835_01781 gene open 2061120-2062787
3551 PEKN01000001.1 GCA002753835_01782 gene open 2062866-2063399
3552 PEKN01000001.1 GCA002753835_01783 gene open 2063635-2064906
3553 PEKN01000001.1 GCA002753835_01784 gene open 2065152-2065442
3554 PEKN01000001.1 GCA002753835_01785 gene open 2065435-2066550 recF
3555 PEKN01000001.1 GCA002753835_01786 gene open 2066681-2066977
3556 PEKN01000001.1 GCA002753835_01787 gene open 2066989-2067222
3557 PEKN01000001.1 GCA002753835_01789 gene open 2067503-2067880 secG
3558 PEKN01000001.1 GCA002753835_01790 gene open 2067889-2068659
3559 PEKN01000001.1 GCA002753835_01791 gene open 2068696-2069226
3560 PEKN01000001.1 GCA002753835_01792 gene open 2069207-2070451
3561 PEKN01000001.1 GCA002753835_01794 gene open 2070941-2071159
3562 PEKN01000001.1 GCA002753835_01795 gene open 2071159-2072712
3563 PEKN01000001.1 GCA002753835_01796 gene open 2072826-2073623
3564 PEKN01000001.1 GCA002753835_01797 gene open 2073670-2075211 guaA
3565 PEKN01000001.1 GCA002753835_01798 gene open 2075247-2075567
3566 PEKN01000001.1 GCA002753835_01799 gene open 2075622-2076002 mscL
3567 PEKN01000001.1 GCA002753835_01800 gene open 2076227-2077246 gap
3568 PEKN01000001.1 GCA002753835_01801 gene open 2077340-2078260 miaA
3569 PEKN01000001.1 GCA002753835_01802 gene open 2078287-2079225
3570 PEKN01000001.1 GCA002753835_01803 gene open 2079703-2081100
3571 PEKN01000001.1 GCA002753835_01804 gene open 2081153-2082412
3572 PEKN01000001.1 GCA002753835_01805 gene open 2082442-2084385
3573 PEKN01000001.1 GCA002753835_01806 gene open 2084937-2086337
3574 PEKN01000001.1 GCA002753835_01807 gene open 2086422-2088188
3575 PEKN01000001.1 GCA002753835_01808 gene open 2088268-2089143
3576 PEKN01000001.1 GCA002753835_01809 gene open 2089396-2092548 prtT
3577 PEKN01000001.1 GCA002753835_01810 gene open 2093053-2093847
3578 PEKN01000001.1 GCA002753835_01811 gene open 2093937-2094575
3579 PEKN01000001.1 GCA002753835_01812 gene open 2094608-2095525 ychK
3580 PEKN01000001.1 GCA002753835_01813 gene open 2095541-2096320
3581 PEKN01000001.1 GCA002753835_01814 gene open 2097157-2098494
3582 PEKN01000001.1 GCA002753835_01815 gene open 2098501-2098638
3583 PEKN01000001.1 GCA002753835_01816 gene open 2098641-2098886
3584 PEKN01000001.1 GCA002753835_01817 gene open 2098997-2099470
3585 PEKN01000001.1 GCA002753835_01818 gene open 2099474-2101168
3586 PEKN01000001.1 GCA002753835_01819 gene open 2101353-2102240 fabD
3587 PEKN01000001.1 GCA002753835_01820 gene open 2102291-2102389
3588 PEKN01000001.1 GCA002753835_01821 gene open 2102576-2103349 truA
3589 PEKN01000001.1 GCA002753835_01822 gene open 2103374-2104927
3590 PEKN01000001.1 GCA002753835_01823 gene open 2105463-2107148
3591 PEKN01000001.1 GCA002753835_01824 gene open 2107250-2108497 lolE
3592 PEKN01000001.1 GCA002753835_01825 gene open 2109221-2110120
3593 PEKN01000001.1 GCA002753835_01826 gene open 2110205-2110393
3594 PEKN01000001.1 GCA002753835_01827 gene open 2110522-2111178
3595 PEKN01000001.1 GCA002753835_01828 gene open 2111184-2111630
3596 PEKN01000001.1 GCA002753835_01829 gene open 2111684-2112211
3597 PEKN01000001.1 GCA002753835_01830 gene open 2112967-2113431
3598 PEKN01000001.1 GCA002753835_01831 gene open 2113691-2113882
3599 PEKN01000001.1 GCA002753835_01832 gene open 2113890-2115206
3600 PEKN01000001.1 GCA002753835_01833 gene open 2115862-2116344
3601 PEKN01000001.1 GCA002753835_01834 gene open 2116380-2117051
3602 PEKN01000001.1 GCA002753835_01835 gene open 2117104-2118684
3603 PEKN01000001.1 GCA002753835_01836 gene open 2118700-2119260
3604 PEKN01000001.1 GCA002753835_01837 gene open 2119677-2121209
3605 PEKN01000001.1 GCA002753835_01838 gene open 2121254-2122105
3606 PEKN01000001.1 GCA002753835_01839 gene open 2122119-2123450 lytB
3607 PEKN01000001.1 GCA002753835_01840 gene open 2123495-2124772
3608 PEKN01000001.1 GCA002753835_01841 gene open 2124880-2126130
3609 PEKN01000001.1 GCA002753835_00019 gene open 21414-21486 trnK
3610 PEKN01000001.1 GCA002753835_00071 gene open 87797-87867 trnC
3611 PEKN01000001.1 GCA002753835_00143 gene open 161226-161300 trnV
3612 PEKN01000001.1 GCA002753835_00144 gene open 161349-161423 trnV
3613 PEKN01000001.1 GCA002753835_00265 gene open 279150-279222 trnW
3614 PEKN01000001.1 GCA002753835_00267 gene open 280534-280605 trnT
3615 PEKN01000001.1 GCA002753835_00268 gene open 280613-280685 trnG
3616 PEKN01000001.1 GCA002753835_00269 gene open 280754-280835 trnY
3617 PEKN01000001.1 GCA002753835_00270 gene open 280856-280929 trnT
3618 PEKN01000001.1 GCA002753835_00366 gene open 384141-384214 trnA
3619 PEKN01000001.1 GCA002753835_00367 gene open 384236-384309 trnI
3620 PEKN01000001.1 GCA002753835_00399 gene open 426118-426188 trnQ
3621 PEKN01000001.1 GCA002753835_00415 gene open 445265-445336 trnR
3622 PEKN01000001.1 GCA002753835_00424 gene open 459883-459964 trnL
3623 PEKN01000001.1 GCA002753835_00558 gene open 616550-616635 trnL
3624 PEKN01000001.1 GCA002753835_00679 gene open 756439-756512 trnI
3625 PEKN01000001.1 GCA002753835_00747 gene open 842261-842333 trnP
3626 PEKN01000001.1 GCA002753835_00763 gene open 862179-862252 trnN
3627 PEKN01000001.1 GCA002753835_00817 gene open 937449-937520 trnE
3628 PEKN01000001.1 GCA002753835_01011 gene open 1198379-1198449 trnQ
3629 PEKN01000001.1 GCA002753835_01024 gene open 1215587-1215668 trnL
3630 PEKN01000001.1 GCA002753835_01050 gene open 1248456-1248529 trnM
3631 PEKN01000001.1 GCA002753835_01087 gene open 1299498-1299572 trnP
3632 PEKN01000001.1 GCA002753835_01283 gene open 1521108-1521180 trnF
3633 PEKN01000001.1 GCA002753835_01453 gene open 1718353-1718426 trnP
3634 PEKN01000001.1 GCA002753835_01454 gene open 1718459-1718531 trnG
3635 PEKN01000001.1 GCA002753835_01455 gene open 1718578-1718657 trnL
3636 PEKN01000001.1 GCA002753835_01456 gene open 1718683-1718766 trnL
3637 PEKN01000001.1 GCA002753835_01457 gene open 1718794-1718866 trnG
3638 PEKN01000001.1 GCA002753835_01514 gene open 1779812-1779885 trnD
3639 PEKN01000001.1 GCA002753835_01515 gene open 1779914-1779987 trnD
3640 PEKN01000001.1 GCA002753835_01714 gene open 1997290-1997363 trnR
3641 PEKN01000001.1 GCA002753835_01741 gene open 2022088-2022165 trnV
3642 PEKN01000001.1 GCA002753835_01742 gene open 2022168-2022252 trnY
3643 PEKN01000001.1 GCA002753835_01772 gene open 2054844-2054917 trnT
3644 PEKN01000001.1 GCA002753835_01788 gene open 2067337-2067410 trnH
3645 PEKN01000001.1 GCA002753835_00019 tRNA open 21414-21486 trnK tRNA-Lys(ttt)
3646 PEKN01000001.1 GCA002753835_00071 tRNA open 87797-87867 trnC tRNA-Cys(gca)
3647 PEKN01000001.1 GCA002753835_00143 tRNA open 161226-161300 trnV tRNA-Val(tac)
3648 PEKN01000001.1 GCA002753835_00144 tRNA open 161349-161423 trnV tRNA-Val(tac)
3649 PEKN01000001.1 GCA002753835_00265 tRNA open 279150-279222 trnW tRNA-Trp(cca)
3650 PEKN01000001.1 GCA002753835_00267 tRNA open 280534-280605 trnT tRNA-Thr(ggt)
3651 PEKN01000001.1 GCA002753835_00268 tRNA open 280613-280685 trnG tRNA-Gly(tcc)
3652 PEKN01000001.1 GCA002753835_00269 tRNA open 280754-280835 trnY tRNA-Tyr(gta)
3653 PEKN01000001.1 GCA002753835_00270 tRNA open 280856-280929 trnT tRNA-Thr(tgt)
3654 PEKN01000001.1 GCA002753835_00366 tRNA open 384141-384214 trnA tRNA-Ala(tgc)
3655 PEKN01000001.1 GCA002753835_00367 tRNA open 384236-384309 trnI tRNA-Ile(gat)
3656 PEKN01000001.1 GCA002753835_00399 tRNA open 426118-426188 trnQ tRNA-Gln(ttg)
3657 PEKN01000001.1 GCA002753835_00415 tRNA open 445265-445336 trnR tRNA-Arg(cct)
3658 PEKN01000001.1 GCA002753835_00424 tRNA open 459883-459964 trnL tRNA-Leu(caa)
3659 PEKN01000001.1 GCA002753835_00558 tRNA open 616550-616635 trnL tRNA-Leu(taa)
3660 PEKN01000001.1 GCA002753835_00679 tRNA open 756439-756512 trnI tRNA-Ile2(cat)
3661 PEKN01000001.1 GCA002753835_00747 tRNA open 842261-842333 trnP tRNA-Pro(cgg)
3662 PEKN01000001.1 GCA002753835_00763 tRNA open 862179-862252 trnN tRNA-Asn(gtt)
3663 PEKN01000001.1 GCA002753835_00817 tRNA open 937449-937520 trnE tRNA-Glu(ttc)
3664 PEKN01000001.1 GCA002753835_01011 tRNA open 1198379-1198449 trnQ tRNA-Gln(ctg)
3665 PEKN01000001.1 GCA002753835_01024 tRNA open 1215587-1215668 trnL tRNA-Leu(tag)
3666 PEKN01000001.1 GCA002753835_01050 tRNA open 1248456-1248529 trnM tRNA-Met(cat)
3667 PEKN01000001.1 GCA002753835_01087 tRNA open 1299498-1299572 trnP tRNA-Pro(ggg)
3668 PEKN01000001.1 GCA002753835_01283 tRNA open 1521108-1521180 trnF tRNA-Phe(gaa)
3669 PEKN01000001.1 GCA002753835_01453 tRNA open 1718353-1718426 trnP tRNA-Pro(tgg)
3670 PEKN01000001.1 GCA002753835_01454 tRNA open 1718459-1718531 trnG tRNA-Gly(gcc)
3671 PEKN01000001.1 GCA002753835_01455 tRNA open 1718578-1718657 trnL tRNA-Leu(cag)
3672 PEKN01000001.1 GCA002753835_01456 tRNA open 1718683-1718766 trnL tRNA-Leu(gag)
3673 PEKN01000001.1 GCA002753835_01457 tRNA open 1718794-1718866 trnG tRNA-Gly(gcc)
3674 PEKN01000001.1 GCA002753835_01514 tRNA open 1779812-1779885 trnD tRNA-Asp(gtc)
3675 PEKN01000001.1 GCA002753835_01515 tRNA open 1779914-1779987 trnD tRNA-Asp(gtc)
3676 PEKN01000001.1 GCA002753835_01714 tRNA open 1997290-1997363 trnR tRNA-Arg(acg)
3677 PEKN01000001.1 GCA002753835_01741 tRNA open 2022088-2022165 trnV tRNA-Val(tac)
3678 PEKN01000001.1 GCA002753835_01742 tRNA open 2022168-2022252 trnY tRNA-Tyr(gta)
3679 PEKN01000001.1 GCA002753835_01772 tRNA open 2054844-2054917 trnT tRNA-Thr(tgt)
3680 PEKN01000001.1 GCA002753835_01788 tRNA open 2067337-2067410 trnH tRNA-His(gtg)
3681 PEKN01000002.1 GCA002753835_02248 gene open 474231-475763 rrs
3682 PEKN01000002.1 GCA002753835_02251 gene open 476278-479184 rrl
3683 PEKN01000002.1 GCA002753835_02252 gene open 479292-479404 rrf
3684 PEKN01000002.1 regulatory_region open 66874-67056 Cobalamin riboswitch aptamer
3685 PEKN01000002.1 regulatory_region open 292695-292760 DUF805 RNA
3686 PEKN01000002.1 regulatory_region open 295166-295231 DUF805 RNA
3687 PEKN01000002.1 GCA002753835_02248 rRNA open 474231-475763 rrs 16S ribosomal RNA
3688 PEKN01000002.1 GCA002753835_02251 rRNA open 476278-479184 rrl 23S ribosomal RNA
3689 PEKN01000002.1 GCA002753835_02252 rRNA open 479292-479404 rrf 5S ribosomal RNA
3690 PEKN01000002.1 repeat_region open 466598-467716 CRISPR array with 9 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATGCAAC and spacer length 29
3691 PEKN01000002.1 repeat_region open 467190-467763 CRISPR array with 9 repeats of length 33%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATGC and spacer length 32
3692 PEKN01000002.1 GCA002753835_01842 CDS open 171-737 _na     188_aa yopX YopX protein domain-containing protein
3693 PEKN01000002.1 GCA002753835_01843 CDS open 742-1095 _na     117_aa DUF551 domain-containing protein
3694 PEKN01000002.1 GCA002753835_01844 CDS open 1102-1431 _na     109_aa hypothetical protein
3695 PEKN01000002.1 GCA002753835_01845 CDS open 1448-1606 _na     52_aa hypothetical protein
3696 PEKN01000002.1 GCA002753835_01846 CDS open 1603-1965 _na     120_aa hypothetical protein
3697 PEKN01000002.1 GCA002753835_01847 CDS open 1962-2312 _na     116_aa hypothetical protein
3698 PEKN01000002.1 GCA002753835_01848 CDS open 2335-2934 _na     199_aa ATP-binding protein
3699 PEKN01000002.1 GCA002753835_01849 CDS open 2966-3700 _na     244_aa Lin1244/Lin1753-like N-terminal domain-containing protein
3700 PEKN01000002.1 GCA002753835_01850 CDS open 3693-4106 _na     137_aa Nuclease
3701 PEKN01000002.1 GCA002753835_01851 CDS open 4103-4423 _na     106_aa hypothetical protein
3702 PEKN01000002.1 GCA002753835_01853 CDS open 4603-5049 _na     148_aa Phage tail protein
3703 PEKN01000002.1 GCA002753835_01854 CDS open 5049-5198 _na     49_aa hypothetical protein
3704 PEKN01000002.1 GCA002753835_01855 CDS open 5235-5414 _na     59_aa Transmembrane Fragile-X-F protein
3705 PEKN01000002.1 GCA002753835_01856 CDS open 5433-6149 _na     238_aa MBL fold hydrolase
3706 PEKN01000002.1 GCA002753835_01857 CDS open 6170-7117 _na     315_aa recT Recombinase RecT
3707 PEKN01000002.1 GCA002753835_01858 CDS open 7129-9111 _na     660_aa Rad50/SbcC-type AAA domain-containing protein
3708 PEKN01000002.1 GCA002753835_01859 CDS open 9115-10755 _na     546_aa Leucine-rich repeat domain-containing protein
3709 PEKN01000002.1 GCA002753835_01860 CDS open 11716-11985 _na     89_aa DNA-binding protein
3710 PEKN01000002.1 GCA002753835_01861 CDS open 11989-12198 _na     69_aa hypothetical protein
3711 PEKN01000002.1 GCA002753835_01862 CDS open 12261-12497 _na     78_aa DRBM domain-containing protein
3712 PEKN01000002.1 GCA002753835_01863 CDS open 12584-13354 _na     256_aa Phage antirepressor Ant
3713 PEKN01000002.1 GCA002753835_01864 CDS open 13358-13531 _na     57_aa helix-turn-helix domain-containing protein
3714 PEKN01000002.1 GCA002753835_01865 CDS open 13693-14340 _na     215_aa HTH cro/C1-type domain-containing protein
3715 PEKN01000002.1 GCA002753835_01866 CDS open 14436-14675 _na     79_aa hypothetical protein
3716 PEKN01000002.1 GCA002753835_01867 CDS open 14678-15232 _na     184_aa hypothetical protein
3717 PEKN01000002.1 GCA002753835_01868 CDS open 15248-15475 _na     75_aa Nuclease
3718 PEKN01000002.1 GCA002753835_01869 CDS open 15621-15758 _na     45_aa hypothetical protein
3719 PEKN01000002.1 GCA002753835_01870 CDS open 16465-18240 _na     591_aa rpsA 30S ribosomal protein S1
3720 PEKN01000002.1 GCA002753835_01871 CDS open 18807-19736 _na     309_aa Peptidoglycan hydrolase
3721 PEKN01000002.1 GCA002753835_01872 CDS open 19793-20188 _na     131_aa EVE domain-containing protein
3722 PEKN01000002.1 GCA002753835_01873 CDS open 20832-21248 _na     138_aa glmS methylaspartate mutase subunit S
3723 PEKN01000002.1 GCA002753835_01874 CDS open 21252-22637 _na     461_aa glmL methylaspartate mutase accessory protein GlmL
3724 PEKN01000002.1 GCA002753835_01875 CDS open 22665-24122 _na     485_aa methylaspartate mutase subunit E
3725 PEKN01000002.1 GCA002753835_01876 CDS open 24250-25488 _na     412_aa methylaspartate ammonia-lyase
3726 PEKN01000002.1 GCA002753835_01877 CDS open 25533-26909 _na     458_aa 3-methylaspartate ammonia-lyase
3727 PEKN01000002.1 GCA002753835_01878 CDS open 26934-27254 _na     106_aa Acyl-CoA synthetase
3728 PEKN01000002.1 GCA002753835_01879 CDS open 27399-28343 _na     314_aa Lantibiotic ABC transporter
3729 PEKN01000002.1 GCA002753835_01880 CDS open 28344-29186 _na     280_aa fumarate hydratase
3730 PEKN01000002.1 GCA002753835_01881 CDS open 29212-29766 _na     184_aa Fe-S-containing hydro-lyase
3731 PEKN01000002.1 GCA002753835_01882 CDS open 29692-30087 _na     131_aa hypothetical protein
3732 PEKN01000002.1 GCA002753835_01883 CDS open 30568-32691 _na     707_aa Dipeptidyl-peptidase
3733 PEKN01000002.1 GCA002753835_01884 CDS open 32731-34224 _na     497_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3734 PEKN01000002.1 GCA002753835_01885 CDS open 34241-35506 _na     421_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
3735 PEKN01000002.1 GCA002753835_01886 CDS open 36109-37044 _na     311_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3736 PEKN01000002.1 GCA002753835_01887 CDS open 37248-38516 _na     422_aa Phosphoribosylamine--glycine ligase
3737 PEKN01000002.1 GCA002753835_01888 CDS open 38584-40788 _na     734_aa Dipeptidyl peptidase IV
3738 PEKN01000002.1 GCA002753835_01889 CDS open 40778-42325 _na     515_aa THUMP domain-containing protein
3739 PEKN01000002.1 GCA002753835_01890 CDS open 42619-43491 _na     290_aa rpoD RNA polymerase sigma-70 domain-containing protein
3740 PEKN01000002.1 GCA002753835_01891 CDS open 44141-45409 _na     422_aa nqrF NADH:ubiquinone reductase (Na(+)-transporting) subunit F
3741 PEKN01000002.1 GCA002753835_01892 CDS open 45418-46044 _na     208_aa nqrE NADH:ubiquinone reductase (Na(+)-transporting) subunit E
3742 PEKN01000002.1 GCA002753835_01893 CDS open 46047-46676 _na     209_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit D
3743 PEKN01000002.1 GCA002753835_01894 CDS open 46712-47422 _na     236_aa nqrC NADH:ubiquinone reductase (Na(+)-transporting) subunit C
3744 PEKN01000002.1 GCA002753835_01895 CDS open 47438-48592 _na     384_aa NADH:ubiquinone reductase (Na(+)-transporting) subunit B
3745 PEKN01000002.1 GCA002753835_01896 CDS open 48641-49924 _na     427_aa Na(+)-translocating NADH-quinone reductase subunit A
3746 PEKN01000002.1 GCA002753835_01897 CDS open 50116-54558 _na     1480_aa DUF490 domain-containing protein
3747 PEKN01000002.1 GCA002753835_01898 CDS open 55109-56389 _na     426_aa Serine hydroxymethyltransferase
3748 PEKN01000002.1 GCA002753835_01899 CDS open 56681-57142 _na     153_aa Aspartate carbamoyltransferase regulatory chain
3749 PEKN01000002.1 GCA002753835_01900 CDS open 57150-58097 _na     315_aa pyrB aspartate carbamoyltransferase
3750 PEKN01000002.1 GCA002753835_01901 CDS open 58272-60575 _na     767_aa peptidoglycan glycosyltransferase
3751 PEKN01000002.1 GCA002753835_01902 CDS open 60639-61574 _na     311_aa DUF4412 domain-containing protein
3752 PEKN01000002.1 GCA002753835_01903 CDS open 62372-62968 _na     198_aa ompH OmpH family outer membrane protein
3753 PEKN01000002.1 GCA002753835_01904 CDS open 63002-63196 _na     64_aa hypothetical protein
3754 PEKN01000002.1 GCA002753835_01905 CDS open 63282-64724 _na     480_aa Peptidase M20 dimerisation domain-containing protein
3755 PEKN01000002.1 GCA002753835_01906 CDS open 64755-64847 _na     30_aa hypothetical protein
3756 PEKN01000002.1 GCA002753835_01907 CDS open 64944-65546 _na     200_aa Outer membrane protein beta-barrel domain-containing protein
3757 PEKN01000002.1 GCA002753835_01908 CDS open 67331-67480 _na     49_aa hypothetical protein
3758 PEKN01000002.1 GCA002753835_01909 CDS open 68046-69620 _na     524_aa Hemerythrin-like domain-containing protein
3759 PEKN01000002.1 GCA002753835_01910 CDS open 70109-71314 _na     401_aa ATPase
3760 PEKN01000002.1 GCA002753835_01911 CDS open 71987-73426 _na     479_aa Leucine-rich repeat domain-containing protein
3761 PEKN01000002.1 GCA002753835_01912 CDS open 74500-75363 _na     287_aa map type I methionyl aminopeptidase
3762 PEKN01000002.1 GCA002753835_01913 CDS open 75455-76489 _na     344_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3763 PEKN01000002.1 GCA002753835_01914 CDS open 76502-77050 _na     182_aa cinA C-terminal domain of CinA type S
3764 PEKN01000002.1 GCA002753835_01915 CDS open 77626-78159 _na     177_aa hypothetical protein
3765 PEKN01000002.1 GCA002753835_01916 CDS open 78199-78363 _na     54_aa rubredoxin
3766 PEKN01000002.1 GCA002753835_01917 CDS open 78472-80859 _na     795_aa Ferric aerobactin receptor
3767 PEKN01000002.1 GCA002753835_01918 CDS open 81076-81714 _na     212_aa DUF4827 domain-containing protein
3768 PEKN01000002.1 GCA002753835_01919 CDS open 81781-83172 _na     463_aa glmM phosphoglucosamine mutase
3769 PEKN01000002.1 GCA002753835_01920 CDS open 83183-83797 _na     204_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
3770 PEKN01000002.1 GCA002753835_01921 CDS open 83801-85582 _na     593_aa abc-f ribosomal protection-like ABC-F family protein
3771 PEKN01000002.1 GCA002753835_01922 CDS open 86004-87383 _na     459_aa radA DNA repair protein RadA
3772 PEKN01000002.1 GCA002753835_01923 CDS open 87450-88349 _na     299_aa SsuA/THI5-like domain-containing protein
3773 PEKN01000002.1 GCA002753835_01924 CDS open 88439-90601 _na     720_aa Tetratricopeptide repeat protein
3774 PEKN01000002.1 GCA002753835_01925 CDS open 90590-90901 _na     103_aa hypothetical protein
3775 PEKN01000002.1 GCA002753835_01926 CDS open 90978-91781 _na     267_aa MBL fold metallo-hydrolase
3776 PEKN01000002.1 GCA002753835_01927 CDS open 91904-94177 _na     757_aa Bacterial surface antigen (D15) domain-containing protein
3777 PEKN01000002.1 GCA002753835_01928 CDS open 94214-95014 _na     266_aa Putative tRNA/rRNA methyltransferase (SpoU)
3778 PEKN01000002.1 GCA002753835_01929 CDS open 95050-95625 _na     191_aa hypothetical protein
3779 PEKN01000002.1 GCA002753835_01930 CDS open 96004-97485 _na     493_aa proS proline--tRNA ligase
3780 PEKN01000002.1 GCA002753835_01931 CDS open 97756-98436 _na     226_aa OmpA-like domain-containing protein
3781 PEKN01000002.1 GCA002753835_01932 CDS open 98928-99965 _na     345_aa Membrane protein
3782 PEKN01000002.1 GCA002753835_01933 CDS open 100252-102726 _na     824_aa feoB ferrous iron transport protein B
3783 PEKN01000002.1 GCA002753835_01934 CDS open 102844-103986 _na     380_aa Penicillin-binding protein 2
3784 PEKN01000002.1 GCA002753835_01935 CDS open 104227-104781 _na     184_aa Patatin family protein
3785 PEKN01000002.1 GCA002753835_01936 CDS open 104785-105075 _na     96_aa hypothetical protein
3786 PEKN01000002.1 GCA002753835_01937 CDS open 104963-105199 _na     78_aa hypothetical protein
3787 PEKN01000002.1 GCA002753835_01938 CDS open 105476-107575 _na     699_aa nrdD anaerobic ribonucleoside-triphosphate reductase
3788 PEKN01000002.1 GCA002753835_01939 CDS open 107697-108164 _na     155_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
3789 PEKN01000002.1 GCA002753835_01940 CDS open 108075-108254 _na     59_aa hypothetical protein
3790 PEKN01000002.1 GCA002753835_01941 CDS open 108526-109551 _na     341_aa DUF4143 domain-containing protein
3791 PEKN01000002.1 GCA002753835_01942 CDS open 109606-109818 _na     70_aa hypothetical protein
3792 PEKN01000002.1 GCA002753835_01943 CDS open 110501-111154 _na     217_aa rbr rubrerythrin
3793 PEKN01000002.1 GCA002753835_01944 CDS open 111739-111855 _na     38_aa transposase
3794 PEKN01000002.1 GCA002753835_01945 CDS open 111856-112383 _na     175_aa Mutator family transposase
3795 PEKN01000002.1 GCA002753835_01946 CDS open 113092-113292 _na     66_aa hypothetical protein
3796 PEKN01000002.1 GCA002753835_01947 CDS open 113296-114024 _na     242_aa GIY-YIG domain-containing protein
3797 PEKN01000002.1 GCA002753835_01948 CDS open 114036-114131 _na     31_aa hypothetical protein
3798 PEKN01000002.1 GCA002753835_01949 CDS open 114162-114305 _na     47_aa hypothetical protein
3799 PEKN01000002.1 GCA002753835_01950 CDS open 114755-116080 _na     441_aa Restriction endonuclease
3800 PEKN01000002.1 GCA002753835_01951 CDS open 116070-118799 _na     909_aa Endonuclease
3801 PEKN01000002.1 GCA002753835_01952 CDS open 119635-120027 _na     130_aa Polyketide cyclase
3802 PEKN01000002.1 GCA002753835_01953 CDS open 120046-120663 _na     205_aa DNA alkylation repair enzyme
3803 PEKN01000002.1 GCA002753835_01954 CDS open 120837-121181 _na     114_aa panD aspartate 1-decarboxylase
3804 PEKN01000002.1 GCA002753835_01955 CDS open 121187-122065 _na     292_aa panC pantoate--beta-alanine ligase
3805 PEKN01000002.1 GCA002753835_01956 CDS open 122206-123018 _na     270_aa starch synthase
3806 PEKN01000002.1 GCA002753835_01957 CDS open 123015-124472 _na     485_aa DUF4270 domain-containing protein
3807 PEKN01000002.1 GCA002753835_01958 CDS open 124722-127247 _na     841_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
3808 PEKN01000002.1 GCA002753835_01959 CDS open 128066-131083 _na     1005_aa Bacterial repeat domain-containing protein
3809 PEKN01000002.1 GCA002753835_01960 CDS open 131280-131393 _na     37_aa Secreted protein
3810 PEKN01000002.1 GCA002753835_01961 CDS open 131581-133143 _na     520_aa AAA family ATPase
3811 PEKN01000002.1 GCA002753835_01962 CDS open 133261-135366 _na     701_aa prolyl oligopeptidase
3812 PEKN01000002.1 GCA002753835_01963 CDS open 136320-139019 _na     899_aa DNA 3'-5' helicase
3813 PEKN01000002.1 GCA002753835_01964 CDS open 139255-141477 _na     740_aa Halomucin
3814 PEKN01000002.1 GCA002753835_01965 CDS open 141513-142604 _na     363_aa hypothetical protein
3815 PEKN01000002.1 GCA002753835_01966 CDS open 143641-146229 _na     862_aa Interpain A
3816 PEKN01000002.1 GCA002753835_01967 CDS open 146317-150783 _na     1488_aa Cleaved adhesin domain-containing protein
3817 PEKN01000002.1 GCA002753835_01968 CDS open 151184-151468 _na     94_aa Secreted protein
3818 PEKN01000002.1 GCA002753835_01969 CDS open 151545-152921 _na     458_aa TIGR00341 family protein
3819 PEKN01000002.1 GCA002753835_01970 CDS open 153048-155114 _na     688_aa T9SS C-terminal target domain-containing protein
3820 PEKN01000002.1 GCA002753835_01971 CDS open 155779-157479 _na     566_aa araC AraC family transcriptional regulator
3821 PEKN01000002.1 GCA002753835_01972 CDS open 157592-159169 _na     525_aa Secretion system C-terminal sorting domain-containing protein
3822 PEKN01000002.1 GCA002753835_01973 CDS open 159189-162395 _na     1068_aa T9SS C-terminal target domain-containing protein
3823 PEKN01000002.1 GCA002753835_01974 CDS open 162969-164198 _na     409_aa Tyr recombinase domain-containing protein
3824 PEKN01000002.1 GCA002753835_01975 CDS open 164227-165525 _na     432_aa Integrase
3825 PEKN01000002.1 GCA002753835_01976 CDS open 165632-166921 _na     429_aa Tyr recombinase domain-containing protein
3826 PEKN01000002.1 GCA002753835_01977 CDS open 166934-168208 _na     424_aa yhcG YhcG PDDEXK nuclease domain-containing protein
3827 PEKN01000002.1 GCA002753835_01978 CDS open 168321-169496 _na     391_aa hypothetical protein
3828 PEKN01000002.1 GCA002753835_01979 CDS open 169392-169598 _na     68_aa hypothetical protein
3829 PEKN01000002.1 GCA002753835_01980 CDS open 169859-170518 _na     219_aa Mobilization protein
3830 PEKN01000002.1 GCA002753835_01981 CDS open 170540-171466 _na     308_aa MobA/VirD2-like nuclease domain-containing protein
3831 PEKN01000002.1 GCA002753835_01982 CDS open 171463-171810 _na     115_aa Mobilization protein
3832 PEKN01000002.1 GCA002753835_01983 CDS open 171912-172802 _na     296_aa Zinc finger CHC2-type domain-containing protein
3833 PEKN01000002.1 GCA002753835_01984 CDS open 172985-174037 _na     350_aa Mobilization protein
3834 PEKN01000002.1 GCA002753835_01985 CDS open 174034-174342 _na     102_aa DUF3853 domain-containing protein
3835 PEKN01000002.1 GCA002753835_01986 CDS open 174925-176763 _na     612_aa KAP NTPase domain-containing protein
3836 PEKN01000002.1 GCA002753835_01987 CDS open 176763-177617 _na     284_aa hypothetical protein
3837 PEKN01000002.1 GCA002753835_01988 CDS open 177614-178912 _na     432_aa qatC Qat anti-phage system QueC-like protein QatC
3838 PEKN01000002.1 GCA002753835_01989 CDS open 178912-179610 _na     232_aa Hydrolase
3839 PEKN01000002.1 GCA002753835_01990 CDS open 179625-180167 _na     180_aa hypothetical protein
3840 PEKN01000002.1 GCA002753835_01991 CDS open 180249-180665 _na     138_aa Lipoprotein
3841 PEKN01000002.1 GCA002753835_01992 CDS open 180717-181115 _na     132_aa Helix-turn-helix domain-containing protein
3842 PEKN01000002.1 GCA002753835_01993 CDS open 181112-183175 _na     687_aa Toprim domain-containing protein
3843 PEKN01000002.1 GCA002753835_01994 CDS open 183163-183471 _na     102_aa Helix-turn-helix domain-containing protein
3844 PEKN01000002.1 GCA002753835_01995 CDS open 183847-184800 _na     317_aa abiF Abi-like protein
3845 PEKN01000002.1 GCA002753835_01996 CDS open 184842-191060 _na     2072_aa site-specific DNA-methyltransferase (adenine-specific)
3846 PEKN01000002.1 GCA002753835_01997 CDS open 191154-193238 _na     694_aa topA DNA topoisomerase
3847 PEKN01000002.1 GCA002753835_01998 CDS open 193260-194663 _na     467_aa DUF3945 domain-containing protein
3848 PEKN01000002.1 GCA002753835_01999 CDS open 194787-194924 _na     45_aa hypothetical protein
3849 PEKN01000002.1 GCA002753835_02000 CDS open 195096-195608 _na     170_aa Isoprenylcysteine carboxyl methyltransferase (ICMT) family protein
3850 PEKN01000002.1 GCA002753835_02001 CDS open 195716-197680 _na     654_aa 1-phosphatidylinositol phosphodiesterase
3851 PEKN01000002.1 GCA002753835_02002 CDS open 197914-198042 _na     42_aa hypothetical protein
3852 PEKN01000002.1 GCA002753835_02003 CDS open 198102-200534 _na     810_aa Fibrobacter succinogene major paralogous domain protein
3853 PEKN01000002.1 GCA002753835_02004 CDS open 200591-200764 _na     57_aa Bacteriocin
3854 PEKN01000002.1 GCA002753835_02005 CDS open 201730-202665 _na     311_aa DNA binding domain%2C excisionase family
3855 PEKN01000002.1 GCA002753835_02006 CDS open 202807-203889 _na     360_aa xerD Tyr recombinase domain-containing protein
3856 PEKN01000002.1 GCA002753835_02007 CDS open 204048-205628 _na     526_aa istA IS21 family transposase
3857 PEKN01000002.1 GCA002753835_02008 CDS open 205635-206423 _na     262_aa istB IS21-like element helper ATPase IstB
3858 PEKN01000002.1 GCA002753835_02009 CDS open 207110-209035 _na     641_aa tet(Q) tetracycline resistance ribosomal protection protein Tet(Q)
3859 PEKN01000002.1 GCA002753835_02010 CDS open 209035-210168 _na     377_aa histidine kinase
3860 PEKN01000002.1 GCA002753835_02011 CDS open 210332-211912 _na     526_aa istA IS21 family transposase
3861 PEKN01000002.1 GCA002753835_02012 CDS open 211919-212707 _na     262_aa istB IS21-like element helper ATPase IstB
3862 PEKN01000002.1 GCA002753835_02013 CDS open 212831-213088 _na     85_aa Mobilization protein
3863 PEKN01000002.1 GCA002753835_02014 CDS open 213181-214146 _na     321_aa cfxA CfxA family broad-spectrum class A beta-lactamase
3864 PEKN01000002.1 GCA002753835_02015 CDS open 214154-214327 _na     57_aa hypothetical protein
3865 PEKN01000002.1 GCA002753835_02016 CDS open 214357-216360 _na     667_aa virD4 YWFCY domain-containing protein
3866 PEKN01000002.1 GCA002753835_02017 CDS open 216437-217711 _na     424_aa Relaxase/mobilization nuclease
3867 PEKN01000002.1 GCA002753835_02018 CDS open 217718-218131 _na     137_aa mobA MobA protein
3868 PEKN01000002.1 GCA002753835_02019 CDS open 218721-219524 _na     267_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
3869 PEKN01000002.1 GCA002753835_02020 CDS open 219511-220029 _na     172_aa traC Conjugative transposon protein TraC
3870 PEKN01000002.1 GCA002753835_02021 CDS open 220029-220802 _na     257_aa Conjugal transfer protein
3871 PEKN01000002.1 GCA002753835_02022 CDS open 220954-221256 _na     100_aa traE Conjugative transposon protein TraE
3872 PEKN01000002.1 GCA002753835_02023 CDS open 221260-221592 _na     110_aa traF Conjugative transposon protein TraF
3873 PEKN01000002.1 GCA002753835_02024 CDS open 221592-224111 _na     839_aa virB4 AAA+ ATPase domain-containing protein
3874 PEKN01000002.1 GCA002753835_02025 CDS open 224160-224774 _na     204_aa traI Conjugative transposon protein TraI
3875 PEKN01000002.1 GCA002753835_02026 CDS open 224798-225835 _na     345_aa traJ conjugative transposon protein TraJ
3876 PEKN01000002.1 GCA002753835_02027 CDS open 225853-226476 _na     207_aa traK conjugative transposon protein TraK
3877 PEKN01000002.1 GCA002753835_02028 CDS open 226481-226771 _na     96_aa traL Conjugal transfer protein TraL
3878 PEKN01000002.1 GCA002753835_02029 CDS open 226764-228023 _na     419_aa traM conjugative transposon protein TraM
3879 PEKN01000002.1 GCA002753835_02030 CDS open 228035-229021 _na     328_aa traN conjugative transposon protein TraN
3880 PEKN01000002.1 GCA002753835_02031 CDS open 229015-229593 _na     192_aa traO Conjugative transposon protein TraO
3881 PEKN01000002.1 GCA002753835_02032 CDS open 229606-230067 _na     153_aa traQ Conjugative transposon protein TraQ
3882 PEKN01000002.1 GCA002753835_02033 CDS open 230079-230585 _na     168_aa Lysozyme
3883 PEKN01000002.1 GCA002753835_02034 CDS open 230708-231151 _na     147_aa hypothetical protein
3884 PEKN01000002.1 GCA002753835_02035 CDS open 231163-232281 _na     372_aa DUF6575 domain-containing protein
3885 PEKN01000002.1 GCA002753835_02036 CDS open 232357-232449 _na     30_aa hypothetical protein
3886 PEKN01000002.1 GCA002753835_02037 CDS open 232476-232694 _na     72_aa Helicase
3887 PEKN01000002.1 GCA002753835_02038 CDS open 232699-232980 _na     93_aa hypothetical protein
3888 PEKN01000002.1 GCA002753835_02039 CDS open 233012-233257 _na     81_aa DUF6926 domain-containing protein
3889 PEKN01000002.1 GCA002753835_02040 CDS open 233280-234551 _na     423_aa PcfJ-like protein
3890 PEKN01000002.1 GCA002753835_02041 CDS open 234556-234975 _na     139_aa PcfK-like protein
3891 PEKN01000002.1 GCA002753835_02042 CDS open 234982-235413 _na     143_aa Molybdenum ABC transporter ATP-binding protein
3892 PEKN01000002.1 GCA002753835_02043 CDS open 235771-236118 _na     115_aa AI-2E family transporter
3893 PEKN01000002.1 GCA002753835_02044 CDS open 236258-236725 _na     155_aa DUF1896 domain-containing protein
3894 PEKN01000002.1 GCA002753835_02045 CDS open 236753-237985 _na     410_aa xerD Site-specific recombinase%2C phage integrase family
3895 PEKN01000002.1 GCA002753835_02046 CDS open 238894-239229 _na     111_aa HTH cro/C1-type domain-containing protein
3896 PEKN01000002.1 GCA002753835_02047 CDS open 239236-239610 _na     124_aa Helix-turn-helix domain-containing protein
3897 PEKN01000002.1 GCA002753835_02048 CDS open 239614-241674 _na     686_aa Toprim domain-containing protein
3898 PEKN01000002.1 GCA002753835_02049 CDS open 241662-241970 _na     102_aa Helix-turn-helix domain-containing protein
3899 PEKN01000002.1 GCA002753835_02050 CDS open 242040-242777 _na     245_aa AbiEi antitoxin C-terminal domain-containing protein
3900 PEKN01000002.1 GCA002753835_02051 CDS open 242774-243835 _na     353_aa Nucleotidyl transferase AbiEii/AbiGii toxin family protein
3901 PEKN01000002.1 GCA002753835_02052 CDS open 243915-250157 _na     2080_aa site-specific DNA-methyltransferase (adenine-specific)
3902 PEKN01000002.1 GCA002753835_02053 CDS open 250250-252325 _na     691_aa DNA topoisomerase
3903 PEKN01000002.1 GCA002753835_02054 CDS open 252346-253749 _na     467_aa DUF3945 domain-containing protein
3904 PEKN01000002.1 GCA002753835_02056 CDS open 253939-254967 _na     342_aa HTH luxR-type domain-containing protein
3905 PEKN01000002.1 GCA002753835_02057 CDS open 254979-255107 _na     42_aa hypothetical protein
3906 PEKN01000002.1 GCA002753835_02058 CDS open 255321-255587 _na     88_aa GIY-YIG nuclease family protein
3907 PEKN01000002.1 GCA002753835_02059 CDS open 255638-258244 _na     868_aa GLUG domain-containing protein
3908 PEKN01000002.1 GCA002753835_02060 CDS open 258244-258480 _na     78_aa hypothetical protein
3909 PEKN01000002.1 GCA002753835_02061 CDS open 258571-262167 _na     1198_aa Peptidase M26
3910 PEKN01000002.1 GCA002753835_02062 CDS open 262295-262501 _na     68_aa Toxin PIN
3911 PEKN01000002.1 GCA002753835_02063 CDS open 262692-264695 _na     667_aa virD4 YWFCY domain-containing protein
3912 PEKN01000002.1 GCA002753835_02064 CDS open 264779-266059 _na     426_aa MobA/VirD2-like nuclease domain-containing protein
3913 PEKN01000002.1 GCA002753835_02065 CDS open 266076-266462 _na     128_aa Bacterial mobilisation domain-containing protein
3914 PEKN01000002.1 GCA002753835_02066 CDS open 267053-267856 _na     267_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
3915 PEKN01000002.1 GCA002753835_02067 CDS open 267843-268316 _na     157_aa traC Conjugative transposon protein TraC
3916 PEKN01000002.1 GCA002753835_02068 CDS open 268323-268799 _na     158_aa DUF3408 domain-containing protein
3917 PEKN01000002.1 GCA002753835_02069 CDS open 268796-269608 _na     270_aa Conjugal transfer protein
3918 PEKN01000002.1 GCA002753835_02070 CDS open 269751-270050 _na     99_aa traE Conjugative transposon protein TraE
3919 PEKN01000002.1 GCA002753835_02071 CDS open 270055-270390 _na     111_aa traF Conjugative transposon protein TraF
3920 PEKN01000002.1 GCA002753835_02072 CDS open 270387-272900 _na     837_aa virB4 AAA+ ATPase domain-containing protein
3921 PEKN01000002.1 GCA002753835_02073 CDS open 273101-273733 _na     210_aa trbJ P-type conjugative transfer protein TrbJ
3922 PEKN01000002.1 GCA002753835_02074 CDS open 273776-274813 _na     345_aa traJ conjugative transposon protein TraJ
3923 PEKN01000002.1 GCA002753835_02075 CDS open 274866-275489 _na     207_aa traK conjugative transposon protein TraK
3924 PEKN01000002.1 GCA002753835_02076 CDS open 275494-275796 _na     100_aa hypothetical protein
3925 PEKN01000002.1 GCA002753835_02077 CDS open 275813-277057 _na     414_aa traM conjugative transposon protein TraM
3926 PEKN01000002.1 GCA002753835_02078 CDS open 277069-278055 _na     328_aa traN conjugative transposon protein TraN
3927 PEKN01000002.1 GCA002753835_02079 CDS open 278049-278639 _na     196_aa traO Conjugative transposon protein TraO
3928 PEKN01000002.1 GCA002753835_02080 CDS open 278652-279110 _na     152_aa traQ Conjugative transposon protein TraQ
3929 PEKN01000002.1 GCA002753835_02081 CDS open 279122-279631 _na     169_aa Lysozyme
3930 PEKN01000002.1 GCA002753835_02082 CDS open 279762-279875 _na     37_aa hypothetical protein
3931 PEKN01000002.1 GCA002753835_02083 CDS open 279893-280606 _na     237_aa Methylase involved in ubiquinone/menaquinone biosynthesis
3932 PEKN01000002.1 GCA002753835_02084 CDS open 281110-281325 _na     71_aa Helicase
3933 PEKN01000002.1 GCA002753835_02085 CDS open 281337-281591 _na     84_aa hypothetical protein
3934 PEKN01000002.1 GCA002753835_02086 CDS open 281619-282893 _na     424_aa PcfJ-like protein
3935 PEKN01000002.1 GCA002753835_02087 CDS open 282898-283317 _na     139_aa PcfK-like protein
3936 PEKN01000002.1 GCA002753835_02088 CDS open 283340-283771 _na     143_aa Molybdenum ABC transporter ATP-binding protein
3937 PEKN01000002.1 GCA002753835_02089 CDS open 284126-284473 _na     115_aa AI-2E family transporter
3938 PEKN01000002.1 GCA002753835_02090 CDS open 284613-285077 _na     154_aa DUF1896 domain-containing protein
3939 PEKN01000002.1 GCA002753835_02091 CDS open 285111-286337 _na     408_aa xerD Tyrosine recombinase XerD
3940 PEKN01000002.1 GCA002753835_02093 CDS open 287074-287865 _na     263_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3941 PEKN01000002.1 GCA002753835_02095 CDS open 288440-290089 _na     549_aa Bacteriocin
3942 PEKN01000002.1 GCA002753835_02096 CDS open 291027-292679 _na     550_aa Putative subtilisin/elastase
3943 PEKN01000002.1 GCA002753835_02097 CDS open 292916-293152 _na     78_aa Inhibitor I9 domain-containing protein
3944 PEKN01000002.1 GCA002753835_02098 CDS open 293244-295151 _na     635_aa Bacteriocin
3945 PEKN01000002.1 GCA002753835_02099 CDS open 296087-297337 _na     416_aa Lipocalin-like domain-containing protein
3946 PEKN01000002.1 GCA002753835_02100 CDS open 297350-297625 _na     91_aa DNA methylase
3947 PEKN01000002.1 GCA002753835_02101 CDS open 297881-298216 _na     111_aa DUF2149 domain-containing protein
3948 PEKN01000002.1 GCA002753835_02102 CDS open 298220-298816 _na     198_aa MotA/TolQ/ExbB proton channel domain-containing protein
3949 PEKN01000002.1 GCA002753835_02103 CDS open 298866-299564 _na     232_aa Sodium:proton antiporter
3950 PEKN01000002.1 GCA002753835_02104 CDS open 299572-303981 _na     1469_aa CobN/magnesium chelatase family protein
3951 PEKN01000002.1 GCA002753835_02105 CDS open 304141-306462 _na     773_aa TonB-dependent receptor
3952 PEKN01000002.1 GCA002753835_02106 CDS open 306583-307260 _na     225_aa hmuY Heme-binding protein HmuY
3953 PEKN01000002.1 GCA002753835_02107 CDS open 307737-309587 _na     616_aa Peptidase C25 gingipain C-terminal domain-containing protein
3954 PEKN01000002.1 GCA002753835_02108 CDS open 310321-311736 _na     471_aa Peptidase
3955 PEKN01000002.1 GCA002753835_02109 CDS open 312514-313905 _na     463_aa Peptidase
3956 PEKN01000002.1 GCA002753835_02110 CDS open 314614-317481 _na     955_aa Adhesin
3957 PEKN01000002.1 GCA002753835_02111 CDS open 317831-319156 _na     441_aa Secretion system C-terminal sorting domain-containing protein
3958 PEKN01000002.1 GCA002753835_02112 CDS open 319959-320780 _na     273_aa Peptidase
3959 PEKN01000002.1 GCA002753835_02113 CDS open 321211-322032 _na     273_aa Peptidase
3960 PEKN01000002.1 GCA002753835_02114 CDS open 322681-323928 _na     415_aa ATP-binding protein
3961 PEKN01000002.1 GCA002753835_02115 CDS open 324128-324367 _na     79_aa transposase
3962 PEKN01000002.1 GCA002753835_02116 CDS open 324383-324775 _na     130_aa hypothetical protein
3963 PEKN01000002.1 GCA002753835_02117 CDS open 325526-327514 _na     662_aa Restriction endonuclease
3964 PEKN01000002.1 GCA002753835_02118 CDS open 327547-328662 _na     371_aa DUF3800 domain-containing protein
3965 PEKN01000002.1 GCA002753835_02119 CDS open 328694-330814 _na     706_aa Helicase
3966 PEKN01000002.1 GCA002753835_02120 CDS open 330811-331650 _na     279_aa DUF1837 domain-containing protein
3967 PEKN01000002.1 GCA002753835_02121 CDS open 331791-332330 _na     179_aa Core-binding (CB) domain-containing protein
3968 PEKN01000002.1 GCA002753835_02122 CDS open 332856-333677 _na     273_aa Peptidase
3969 PEKN01000002.1 GCA002753835_02123 CDS open 334139-334663 _na     174_aa DUF3408 domain-containing protein
3970 PEKN01000002.1 GCA002753835_02124 CDS open 334816-335475 _na     219_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
3971 PEKN01000002.1 GCA002753835_02125 CDS open 335601-336281 _na     226_aa Beta-carotene 15%2C15'-monooxygenase
3972 PEKN01000002.1 GCA002753835_02126 CDS open 336372-336461 _na     29_aa hypothetical protein
3973 PEKN01000002.1 GCA002753835_02127 CDS open 336727-337437 _na     236_aa ABC transporter permease
3974 PEKN01000002.1 GCA002753835_02128 CDS open 338253-338438 _na     61_aa hypothetical protein
3975 PEKN01000002.1 GCA002753835_02129 CDS open 339108-339251 _na     47_aa hypothetical protein
3976 PEKN01000002.1 GCA002753835_02130 CDS open 340426-340590 _na     54_aa hypothetical protein
3977 PEKN01000002.1 GCA002753835_02131 CDS open 341013-341405 _na     130_aa hypothetical protein
3978 PEKN01000002.1 GCA002753835_02132 CDS open 341569-341820 _na     83_aa hypothetical protein
3979 PEKN01000002.1 GCA002753835_02133 CDS open 341982-342398 _na     138_aa hypothetical protein
3980 PEKN01000002.1 GCA002753835_02134 CDS open 342520-342894 _na     124_aa ridA RidA family protein
3981 PEKN01000002.1 GCA002753835_02135 CDS open 342964-343305 _na     113_aa Secreted protein
3982 PEKN01000002.1 GCA002753835_02136 CDS open 343292-343738 _na     148_aa hypothetical protein
3983 PEKN01000002.1 GCA002753835_02137 CDS open 344226-345404 _na     392_aa HTH araC/xylS-type domain-containing protein
3984 PEKN01000002.1 GCA002753835_02138 CDS open 345973-346527 _na     184_aa hypothetical protein
3985 PEKN01000002.1 GCA002753835_02139 CDS open 346426-349629 _na     1067_aa Type I restriction enzyme endonuclease subunit
3986 PEKN01000002.1 GCA002753835_02140 CDS open 349642-350838 _na     398_aa Restriction endonuclease subunit S
3987 PEKN01000002.1 GCA002753835_02141 CDS open 350850-352526 _na     558_aa hsdM site-specific DNA-methyltransferase (adenine-specific)
3988 PEKN01000002.1 GCA002753835_02142 CDS open 352738-353331 _na     197_aa nicotinamidase
3989 PEKN01000002.1 GCA002753835_02143 CDS open 353348-353491 _na     47_aa hypothetical protein
3990 PEKN01000002.1 GCA002753835_02144 CDS open 353937-354371 _na     144_aa Peptidase M15
3991 PEKN01000002.1 GCA002753835_02145 CDS open 354549-355019 _na     156_aa Viral histone-like protein
3992 PEKN01000002.1 GCA002753835_02146 CDS open 355124-355216 _na     30_aa Smalltalk protein
3993 PEKN01000002.1 GCA002753835_02147 CDS open 355824-356255 _na     143_aa putative transcriptional regulator Fur family
3994 PEKN01000002.1 GCA002753835_02148 CDS open 356546-356905 _na     119_aa HTH marR-type domain-containing protein
3995 PEKN01000002.1 GCA002753835_02149 CDS open 356925-357410 _na     161_aa trxA thioredoxin
3996 PEKN01000002.1 GCA002753835_02150 CDS open 357676-358623 _na     315_aa hipA Toxin HipA
3997 PEKN01000002.1 GCA002753835_02151 CDS open 358620-358955 _na     111_aa Phosphatidylinositol kinase
3998 PEKN01000002.1 GCA002753835_02152 CDS open 358961-359185 _na     74_aa Transcriptional regulator
3999 PEKN01000002.1 GCA002753835_02153 CDS open 359781-360188 _na     135_aa osmC Stress-induced protein OsmC
4000 PEKN01000002.1 GCA002753835_02154 CDS open 360508-361221 _na     237_aa DUF2975 domain-containing protein