HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_002794335.1)

Select a Genome:
BAKTA Annotations for GCA_002794335.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
3 2798400 2404 12 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4949 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4949 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 PGGD01000001.1 GCA002794335_01552 gene open 1737468-1737865 ssrA
2 PGGD01000001.1 GCA002794335_01552 tmRNA open 1737468-1737865 ssrA transfer-messenger RNA%2C SsrA
3 PGGD01000001.1 rep_origin open 1128659-1129146
4 PGGD01000001.1 GCA002794335_00263 gene open 282518-282706 Bacteroidales-1
5 PGGD01000001.1 GCA002794335_00374 gene open 401807-401913 Bacteroidales_small_SRP
6 PGGD01000001.1 GCA002794335_00375 gene open 401808-401906 Bacteria_small_SRP
7 PGGD01000001.1 GCA002794335_00555 gene open 595514-595896 RNaseP_bact_a
8 PGGD01000001.1 GCA002794335_00813 gene open 860051-860163 rrf
9 PGGD01000001.1 GCA002794335_00814 gene open 860273-863178 rrl
10 PGGD01000001.1 GCA002794335_00817 gene open 863687-865219 rrs
11 PGGD01000001.1 GCA002794335_01197 gene open 1293017-1294549 rrs
12 PGGD01000001.1 GCA002794335_01198 gene open 1294902-1297806 rrl
13 PGGD01000001.1 GCA002794335_01199 gene open 1297916-1298028 rrf
14 PGGD01000001.1 GCA002794335_01432 gene open 1589637-1591169 rrs
15 PGGD01000001.1 GCA002794335_01433 gene open 1591522-1594427 rrl
16 PGGD01000001.1 GCA002794335_01434 gene open 1594537-1594649 rrf
17 PGGD01000001.1 GCA002794335_00263 ncRNA open 282518-282706 Bacteroidales-1 6S-Bacteroidales RNA suggested
18 PGGD01000001.1 GCA002794335_00374 ncRNA open 401807-401913 Bacteroidales small SRP
19 PGGD01000001.1 GCA002794335_00375 ncRNA open 401808-401906 Bacterial small signal recognition particle RNA
20 PGGD01000001.1 GCA002794335_00555 ncRNA open 595514-595896 Bacterial RNase P class A
21 PGGD01000001.1 regulatory_region open 1522750-1522825 L13-Bacteroidia ribosomal protein leader
22 PGGD01000001.1 regulatory_region open 1545439-1545622 Cobalamin riboswitch aptamer
23 PGGD01000001.1 regulatory_region open 1645050-1645149 engA RNA
24 PGGD01000001.1 regulatory_region open 1871707-1871805 TPP riboswitch aptamer (THI element)
25 PGGD01000001.1 GCA002794335_00813 rRNA open 860051-860163 rrf 5S ribosomal RNA
26 PGGD01000001.1 GCA002794335_00814 rRNA open 860273-863178 rrl 23S ribosomal RNA
27 PGGD01000001.1 GCA002794335_00817 rRNA open 863687-865219 rrs 16S ribosomal RNA
28 PGGD01000001.1 GCA002794335_01197 rRNA open 1293017-1294549 rrs 16S ribosomal RNA
29 PGGD01000001.1 GCA002794335_01198 rRNA open 1294902-1297806 rrl 23S ribosomal RNA
30 PGGD01000001.1 GCA002794335_01199 rRNA open 1297916-1298028 rrf 5S ribosomal RNA
31 PGGD01000001.1 GCA002794335_01432 rRNA open 1589637-1591169 rrs 16S ribosomal RNA
32 PGGD01000001.1 GCA002794335_01433 rRNA open 1591522-1594427 rrl 23S ribosomal RNA
33 PGGD01000001.1 GCA002794335_01434 rRNA open 1594537-1594649 rrf 5S ribosomal RNA
34 PGGD01000001.1 repeat_region open 1474887-1476712 CRISPR array with 24 repeats of length 47%2C consensus sequence GTTGTGATTAGCTTTAAAATTAGTATCTTTGCATTGGTAAATACAAC and spacer length 29
35 PGGD01000001.1 GCA002794335_00001 CDS open 765-1328 _na     187_aa IS982 family transposase
36 PGGD01000001.1 GCA002794335_00002 CDS open 1333-1665 _na     110_aa Partial transposase in ISPi1
37 PGGD01000001.1 GCA002794335_00003 CDS open 1931-4651 _na     906_aa ppdK pyruvate%2C phosphate dikinase
38 PGGD01000001.1 GCA002794335_00004 CDS open 5296-5589 _na     97_aa DUF3618 domain-containing protein
39 PGGD01000001.1 GCA002794335_00005 CDS open 5597-5950 _na     117_aa Phage holin family protein
40 PGGD01000001.1 GCA002794335_00006 CDS open 5960-6175 _na     71_aa YtxH-like protein
41 PGGD01000001.1 GCA002794335_00007 CDS open 6406-6906 _na     166_aa Cell division protein
42 PGGD01000001.1 GCA002794335_00008 CDS open 6906-7325 _na     139_aa ruvX Holliday junction resolvase RuvX
43 PGGD01000001.1 GCA002794335_00009 CDS open 7382-7945 _na     187_aa def peptide deformylase
44 PGGD01000001.1 GCA002794335_00010 CDS open 7949-8557 _na     202_aa Tetratricopeptide repeat protein
45 PGGD01000001.1 GCA002794335_00011 CDS open 8764-10713 _na     649_aa thrS threonine--tRNA ligase
46 PGGD01000001.1 GCA002794335_00012 CDS open 11036-12622 _na     528_aa Fibronectin type-III domain-containing protein
47 PGGD01000001.1 GCA002794335_00013 CDS open 12851-13360 _na     169_aa Lipoprotein
48 PGGD01000001.1 GCA002794335_00014 CDS open 13375-15891 _na     838_aa peptidoglycan glycosyltransferase
49 PGGD01000001.1 GCA002794335_00015 CDS open 15954-16853 _na     299_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
50 PGGD01000001.1 GCA002794335_00016 CDS open 16860-17630 _na     256_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
51 PGGD01000001.1 GCA002794335_00017 CDS open 17639-19027 _na     462_aa bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase
52 PGGD01000001.1 GCA002794335_00018 CDS open 19033-20073 _na     346_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
53 PGGD01000001.1 GCA002794335_00019 CDS open 20125-21345 _na     406_aa HD/PDEase domain-containing protein
54 PGGD01000001.1 GCA002794335_00020 CDS open 21365-22192 _na     275_aa pyrF orotidine-5'-phosphate decarboxylase
55 PGGD01000001.1 GCA002794335_00021 CDS open 22438-23550 _na     370_aa prfA peptide chain release factor 1
56 PGGD01000001.1 GCA002794335_00022 CDS open 23571-24716 _na     381_aa Phosphoribosylformylglycinamidine cyclo-ligase
57 PGGD01000001.1 GCA002794335_00023 CDS open 24756-25508 _na     250_aa Shikimate dehydrogenase (NADP(+))
58 PGGD01000001.1 GCA002794335_00024 CDS open 25522-26256 _na     244_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
59 PGGD01000001.1 GCA002794335_00025 CDS open 26300-27250 _na     316_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
60 PGGD01000001.1 GCA002794335_00026 CDS open 27263-28222 _na     319_aa PhoH-like protein
61 PGGD01000001.1 GCA002794335_00027 CDS open 28339-29028 _na     229_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
62 PGGD01000001.1 GCA002794335_00028 CDS open 29051-31486 _na     811_aa DNA 3'-5' helicase
63 PGGD01000001.1 GCA002794335_00029 CDS open 31819-34692 _na     957_aa PD-(D/E)XK endonuclease-like domain-containing protein
64 PGGD01000001.1 GCA002794335_00030 CDS open 34698-38189 _na     1163_aa DNA 3'-5' helicase
65 PGGD01000001.1 GCA002794335_00031 CDS open 38869-38997 _na     42_aa hypothetical protein
66 PGGD01000001.1 GCA002794335_00032 CDS open 39309-39539 _na     76_aa HTH cro/C1-type domain-containing protein
67 PGGD01000001.1 GCA002794335_00033 CDS open 39543-40229 _na     228_aa YgjP-like metallopeptidase domain-containing protein
68 PGGD01000001.1 GCA002794335_00034 CDS open 40234-43515 _na     1093_aa Type I restriction enzyme endonuclease subunit
69 PGGD01000001.1 GCA002794335_00035 CDS open 43537-45966 _na     809_aa type I restriction-modification system subunit M
70 PGGD01000001.1 GCA002794335_00036 CDS open 45980-47113 _na     377_aa DUF1016 domain-containing protein
71 PGGD01000001.1 GCA002794335_00037 CDS open 47110-48972 _na     620_aa Restriction endonuclease subunit S
72 PGGD01000001.1 GCA002794335_00038 CDS open 48956-49237 _na     93_aa DNA-binding protein
73 PGGD01000001.1 GCA002794335_00039 CDS open 49240-49710 _na     156_aa lapA LapA family protein
74 PGGD01000001.1 GCA002794335_00040 CDS open 49726-50292 _na     188_aa abiH Bacteriophage abortive infection AbiH
75 PGGD01000001.1 GCA002794335_00041 CDS open 50280-50849 _na     189_aa transposase
76 PGGD01000001.1 GCA002794335_00042 CDS open 51283-51537 _na     84_aa Transposase
77 PGGD01000001.1 GCA002794335_00043 CDS open 51646-51978 _na     110_aa Partial transposase in ISPi1
78 PGGD01000001.1 GCA002794335_00044 CDS open 51983-52546 _na     187_aa IS982 family transposase
79 PGGD01000001.1 GCA002794335_00045 CDS open 53067-53510 _na     147_aa B box-type domain-containing protein
80 PGGD01000001.1 GCA002794335_00046 CDS open 53627-53986 _na     119_aa hypothetical protein
81 PGGD01000001.1 GCA002794335_00047 CDS open 54021-54251 _na     76_aa hypothetical protein
82 PGGD01000001.1 GCA002794335_00048 CDS open 54303-54797 _na     164_aa hlyD HlyD family secretion protein
83 PGGD01000001.1 GCA002794335_00049 CDS open 54799-57009 _na     736_aa ABC transporter ATP-binding protein
84 PGGD01000001.1 GCA002794335_00050 CDS open 57041-59404 _na     787_aa Outer membrane protein beta-barrel domain-containing protein
85 PGGD01000001.1 GCA002794335_00051 CDS open 59401-60732 _na     443_aa Radical SAM core domain-containing protein
86 PGGD01000001.1 GCA002794335_00052 CDS open 60807-60998 _na     63_aa Natural product%2C GG-Bacteroidales family
87 PGGD01000001.1 GCA002794335_00053 CDS open 61175-62308 _na     377_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein
88 PGGD01000001.1 GCA002794335_00054 CDS open 62305-62919 _na     204_aa TetR/AcrR family transcriptional regulator
89 PGGD01000001.1 GCA002794335_00055 CDS open 63061-64026 _na     321_aa IS30 family transposase
90 PGGD01000001.1 GCA002794335_00056 CDS open 64410-64784 _na     124_aa Transposase
91 PGGD01000001.1 GCA002794335_00057 CDS open 65218-65787 _na     189_aa transposase
92 PGGD01000001.1 GCA002794335_00058 CDS open 65841-66059 _na     72_aa Transposase
93 PGGD01000001.1 GCA002794335_00059 CDS open 66072-66362 _na     96_aa Trasnmembrane protein found in conjugate transposon
94 PGGD01000001.1 GCA002794335_00060 CDS open 67243-68250 _na     335_aa Agmatine deiminase
95 PGGD01000001.1 GCA002794335_00061 CDS open 68302-69186 _na     294_aa Para-aminobenzoate synthase
96 PGGD01000001.1 GCA002794335_00062 CDS open 69200-69709 _na     169_aa N-acetyltransferase domain-containing protein
97 PGGD01000001.1 GCA002794335_00063 CDS open 69706-70266 _na     186_aa Acetyltransferase
98 PGGD01000001.1 GCA002794335_00064 CDS open 70436-71290 _na     284_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
99 PGGD01000001.1 GCA002794335_00065 CDS open 71295-71447 _na     50_aa hypothetical protein
100 PGGD01000001.1 GCA002794335_00066 CDS open 71797-72450 _na     217_aa J domain-containing protein
101 PGGD01000001.1 GCA002794335_00067 CDS open 72428-72526 _na     32_aa hypothetical protein
102 PGGD01000001.1 GCA002794335_00068 CDS open 72568-73731 _na     387_aa nspC carboxynorspermidine decarboxylase
103 PGGD01000001.1 GCA002794335_00069 CDS open 73800-74411 _na     203_aa Thiamine phosphate pyrophosphorylase
104 PGGD01000001.1 GCA002794335_00070 CDS open 74446-75384 _na     312_aa prsA Ribose-phosphate pyrophosphokinase
105 PGGD01000001.1 GCA002794335_00071 CDS open 75606-75983 _na     125_aa DUF2141 domain-containing protein
106 PGGD01000001.1 GCA002794335_00072 CDS open 76049-78160 _na     703_aa Outer membrane protein beta-barrel domain-containing protein
107 PGGD01000001.1 GCA002794335_00073 CDS open 78157-78777 _na     206_aa terC Tellurium resistance protein TerC
108 PGGD01000001.1 GCA002794335_00074 CDS open 78767-79069 _na     100_aa Winged helix DNA-binding domain-containing protein
109 PGGD01000001.1 GCA002794335_00075 CDS open 79083-80411 _na     442_aa Tail specific protease domain-containing protein
110 PGGD01000001.1 GCA002794335_00076 CDS open 80555-80824 _na     89_aa hypothetical protein
111 PGGD01000001.1 GCA002794335_00077 CDS open 81031-81528 _na     165_aa Ferric uptake regulation protein
112 PGGD01000001.1 GCA002794335_00078 CDS open 81515-82792 _na     425_aa adenylosuccinate synthase
113 PGGD01000001.1 GCA002794335_00079 CDS open 82798-84171 _na     457_aa hisS histidine--tRNA ligase
114 PGGD01000001.1 GCA002794335_00080 CDS open 84340-84561 _na     73_aa hypothetical protein
115 PGGD01000001.1 GCA002794335_00081 CDS open 84678-85331 _na     217_aa nth endonuclease III
116 PGGD01000001.1 GCA002794335_00082 CDS open 85338-86048 _na     236_aa TIGR02453 family protein
117 PGGD01000001.1 GCA002794335_00083 CDS open 86039-86242 _na     67_aa hypothetical protein
118 PGGD01000001.1 GCA002794335_00084 CDS open 86452-87264 _na     270_aa hypothetical protein
119 PGGD01000001.1 GCA002794335_00085 CDS open 87302-88366 _na     354_aa Transcriptional regulator
120 PGGD01000001.1 GCA002794335_00086 CDS open 88472-92092 _na     1206_aa histidine kinase
121 PGGD01000001.1 GCA002794335_00087 CDS open 92099-92824 _na     241_aa Response regulatory domain-containing protein
122 PGGD01000001.1 GCA002794335_00088 CDS open 92814-93449 _na     211_aa ABC transporter permease
123 PGGD01000001.1 GCA002794335_00089 CDS open 93960-94109 _na     49_aa hypothetical protein
124 PGGD01000001.1 GCA002794335_00095 CDS open 94680-95216 _na     178_aa Phage protein
125 PGGD01000001.1 GCA002794335_00096 CDS open 95252-95662 _na     136_aa Single-stranded DNA-binding protein
126 PGGD01000001.1 GCA002794335_00097 CDS open 95663-96976 _na     437_aa gldE Gliding motility-associated protein GldE
127 PGGD01000001.1 GCA002794335_00098 CDS open 96966-97478 _na     170_aa 4'-phosphopantetheinyl transferase domain-containing protein
128 PGGD01000001.1 GCA002794335_00099 CDS open 97587-98663 _na     358_aa hypothetical protein
129 PGGD01000001.1 GCA002794335_00100 CDS open 98676-100745 _na     689_aa 1%2C4-alpha-glucan branching enzyme
130 PGGD01000001.1 GCA002794335_00101 CDS open 100772-101716 _na     314_aa DUF6057 domain-containing protein
131 PGGD01000001.1 GCA002794335_00102 CDS open 101716-102837 _na     373_aa Glycerate kinase
132 PGGD01000001.1 GCA002794335_00103 CDS open 103408-104442 _na     344_aa Endolytic murein transglycosylase
133 PGGD01000001.1 GCA002794335_00104 CDS open 104758-106302 _na     514_aa histidine kinase
134 PGGD01000001.1 GCA002794335_00105 CDS open 106339-107046 _na     235_aa ompR Transcriptional regulatory protein RprY
135 PGGD01000001.1 GCA002794335_00106 CDS open 107108-107299 _na     63_aa Transporter
136 PGGD01000001.1 GCA002794335_00107 CDS open 107388-107732 _na     114_aa rpsF 30S ribosomal protein S6
137 PGGD01000001.1 GCA002794335_00108 CDS open 107735-108007 _na     90_aa rpsR 30S ribosomal protein S18
138 PGGD01000001.1 GCA002794335_00109 CDS open 108025-108561 _na     178_aa rplI 50S ribosomal protein L9
139 PGGD01000001.1 GCA002794335_00110 CDS open 108660-109733 _na     357_aa NadR/Ttd14 AAA domain-containing protein
140 PGGD01000001.1 GCA002794335_00111 CDS open 109895-110584 _na     229_aa infC translation initiation factor IF-3
141 PGGD01000001.1 GCA002794335_00112 CDS open 110697-110894 _na     65_aa rpmI 50S ribosomal protein L35
142 PGGD01000001.1 GCA002794335_00113 CDS open 110932-111276 _na     114_aa rplT 50S ribosomal protein L20
143 PGGD01000001.1 GCA002794335_00114 CDS open 111366-113519 _na     717_aa Putative RNA-binding protein with Tex and S1 domain
144 PGGD01000001.1 GCA002794335_00115 CDS open 114073-116040 _na     655_aa abc-f ribosomal protection-like ABC-F family protein
145 PGGD01000001.1 GCA002794335_00116 CDS open 116164-118197 _na     677_aa Peptidase M13
146 PGGD01000001.1 GCA002794335_00117 CDS open 118676-118855 _na     59_aa hypothetical protein
147 PGGD01000001.1 GCA002794335_00118 CDS open 118870-120444 _na     524_aa Fimbrillin family protein
148 PGGD01000001.1 GCA002794335_00119 CDS open 120798-121220 _na     140_aa Viral histone-like protein
149 PGGD01000001.1 GCA002794335_00120 CDS open 121420-123042 _na     540_aa ABC transporter domain-containing protein
150 PGGD01000001.1 GCA002794335_00121 CDS open 123152-123754 _na     200_aa grpE Protein GrpE
151 PGGD01000001.1 GCA002794335_00122 CDS open 123825-124982 _na     385_aa dnaJ molecular chaperone DnaJ
152 PGGD01000001.1 GCA002794335_00123 CDS open 125009-126292 _na     427_aa tetrahydrofolate synthase
153 PGGD01000001.1 GCA002794335_00124 CDS open 126437-127750 _na     437_aa Major facilitator superfamily (MFS) profile domain-containing protein
154 PGGD01000001.1 GCA002794335_00125 CDS open 128182-128379 _na     65_aa hypothetical protein
155 PGGD01000001.1 GCA002794335_00126 CDS open 128384-128953 _na     189_aa L-threonylcarbamoyladenylate synthase
156 PGGD01000001.1 GCA002794335_00127 CDS open 129008-130804 _na     598_aa CBS domain-containing protein
157 PGGD01000001.1 GCA002794335_00128 CDS open 130841-131863 _na     340_aa fmt methionyl-tRNA formyltransferase
158 PGGD01000001.1 GCA002794335_00129 CDS open 131977-133893 _na     638_aa Polysaccharide biosynthesis protein CapD-like domain-containing protein
159 PGGD01000001.1 GCA002794335_00130 CDS open 133974-135101 _na     375_aa Nucleotidyltransferase family protein
160 PGGD01000001.1 GCA002794335_00131 CDS open 135105-136073 _na     322_aa Glycosyltransferase 2-like domain-containing protein
161 PGGD01000001.1 GCA002794335_00132 CDS open 136086-137000 _na     304_aa NAD-dependent epimerase/dehydratase domain-containing protein
162 PGGD01000001.1 GCA002794335_00133 CDS open 137002-138144 _na     380_aa Glycosyl transferase family 1 domain-containing protein
163 PGGD01000001.1 GCA002794335_00134 CDS open 138158-139270 _na     370_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
164 PGGD01000001.1 GCA002794335_00135 CDS open 139275-140201 _na     308_aa DUF377 domain-containing protein
165 PGGD01000001.1 GCA002794335_00136 CDS open 140254-140436 _na     60_aa hypothetical protein
166 PGGD01000001.1 GCA002794335_00137 CDS open 140558-141442 _na     294_aa Glycosyltransferase family 2 protein
167 PGGD01000001.1 GCA002794335_00138 CDS open 141457-142503 _na     348_aa Acyltransferase 3 domain-containing protein
168 PGGD01000001.1 GCA002794335_00139 CDS open 142506-143648 _na     380_aa epsG EpsG family protein
169 PGGD01000001.1 GCA002794335_00140 CDS open 143693-144880 _na     395_aa Spore protein YkvP/CgeB glycosyl transferase-like domain-containing protein
170 PGGD01000001.1 GCA002794335_00141 CDS open 145083-146045 _na     320_aa Hyaluronan synthase
171 PGGD01000001.1 GCA002794335_00142 CDS open 146045-147346 _na     433_aa tuaD UDP-glucose 6-dehydrogenase tuaD
172 PGGD01000001.1 GCA002794335_00143 CDS open 147350-149149 _na     599_aa Arylsulfatase
173 PGGD01000001.1 GCA002794335_00144 CDS open 149325-150473 _na     382_aa 4-alpha-L-fucosyltransferase
174 PGGD01000001.1 GCA002794335_00145 CDS open 150466-151974 _na     502_aa Flippase
175 PGGD01000001.1 GCA002794335_00146 CDS open 152092-152544 _na     150_aa GNAT family N-acetyltransferase
176 PGGD01000001.1 GCA002794335_00147 CDS open 152538-153728 _na     396_aa ATP-grasp domain-containing protein
177 PGGD01000001.1 GCA002794335_00148 CDS open 153743-154852 _na     369_aa Aminotransferase
178 PGGD01000001.1 GCA002794335_00149 CDS open 154881-155069 _na     62_aa Toxin PIN
179 PGGD01000001.1 GCA002794335_00150 CDS open 155099-156343 _na     414_aa T9SS C-terminal target domain-containing protein
180 PGGD01000001.1 GCA002794335_00151 CDS open 156355-157563 _na     402_aa GDP-L-fucose synthase
181 PGGD01000001.1 GCA002794335_00152 CDS open 157820-158044 _na     74_aa hypothetical protein
182 PGGD01000001.1 GCA002794335_00153 CDS open 158167-158676 _na     169_aa Lipoprotein
183 PGGD01000001.1 GCA002794335_00154 CDS open 159299-159769 _na     156_aa MBD domain-containing protein
184 PGGD01000001.1 GCA002794335_00155 CDS open 159884-160654 _na     256_aa DUF5715 domain-containing protein
185 PGGD01000001.1 GCA002794335_00156 CDS open 160729-161370 _na     213_aa Lipoprotein
186 PGGD01000001.1 GCA002794335_00157 CDS open 161656-162060 _na     134_aa Rhodanese domain-containing protein
187 PGGD01000001.1 GCA002794335_00158 CDS open 162513-162923 _na     136_aa protein-tyrosine-phosphatase
188 PGGD01000001.1 GCA002794335_00159 CDS open 162936-163721 _na     261_aa UPF0246 protein PI172_1144
189 PGGD01000001.1 GCA002794335_00162 CDS open 164057-164560 _na     167_aa Spermidine N1-acetyltransferase
190 PGGD01000001.1 GCA002794335_00163 CDS open 164566-165762 _na     398_aa Glycosyl transferase family 2
191 PGGD01000001.1 GCA002794335_00164 CDS open 165759-166220 _na     153_aa DUF1648 domain-containing protein
192 PGGD01000001.1 GCA002794335_00165 CDS open 166228-166836 _na     202_aa recR recombination mediator RecR
193 PGGD01000001.1 GCA002794335_00166 CDS open 166860-167354 _na     164_aa Outer membrane protein beta-barrel domain-containing protein
194 PGGD01000001.1 GCA002794335_00167 CDS open 167397-169202 _na     601_aa Glycosyl hydrolase-like 10 domain-containing protein
195 PGGD01000001.1 GCA002794335_00168 CDS open 169301-169798 _na     165_aa Lrp/AsnC family transcriptional regulator
196 PGGD01000001.1 GCA002794335_00169 CDS open 170275-171705 _na     476_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
197 PGGD01000001.1 GCA002794335_00170 CDS open 172006-173106 _na     366_aa Porin
198 PGGD01000001.1 GCA002794335_00171 CDS open 173381-174463 _na     360_aa ATP-grasp domain-containing protein
199 PGGD01000001.1 GCA002794335_00172 CDS open 174679-175863 _na     394_aa AAA domain-containing protein
200 PGGD01000001.1 GCA002794335_00173 CDS open 175992-179558 _na     1188_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
201 PGGD01000001.1 GCA002794335_00174 CDS open 180303-183182 _na     959_aa histidine kinase
202 PGGD01000001.1 GCA002794335_00175 CDS open 183253-183405 _na     50_aa hypothetical protein
203 PGGD01000001.1 GCA002794335_00176 CDS open 183461-183574 _na     37_aa hypothetical protein
204 PGGD01000001.1 GCA002794335_00177 CDS open 183614-183922 _na     102_aa hypothetical protein
205 PGGD01000001.1 GCA002794335_00178 CDS open 184585-185397 _na     270_aa ribonuclease Z
206 PGGD01000001.1 GCA002794335_00179 CDS open 185502-186059 _na     185_aa Lipocalin-like domain-containing protein
207 PGGD01000001.1 GCA002794335_00180 CDS open 186079-186975 _na     298_aa mazG nucleoside triphosphate pyrophosphohydrolase
208 PGGD01000001.1 GCA002794335_00181 CDS open 187107-189800 _na     897_aa valine--tRNA ligase
209 PGGD01000001.1 GCA002794335_00182 CDS open 189931-191556 _na     541_aa groL chaperonin GroEL
210 PGGD01000001.1 GCA002794335_00183 CDS open 191679-191948 _na     89_aa groES Co-chaperonin GroES
211 PGGD01000001.1 GCA002794335_00184 CDS open 192434-194350 _na     638_aa recQ ATP-dependent DNA helicase RecQ
212 PGGD01000001.1 GCA002794335_00185 CDS open 194383-196107 _na     574_aa recJ single-stranded-DNA-specific exonuclease RecJ
213 PGGD01000001.1 GCA002794335_00186 CDS open 196244-197449 _na     401_aa Aminopeptidase
214 PGGD01000001.1 GCA002794335_00187 CDS open 197544-198953 _na     469_aa Xaa-Pro aminopeptidase
215 PGGD01000001.1 GCA002794335_00188 CDS open 199030-199905 _na     291_aa Serine protease
216 PGGD01000001.1 GCA002794335_00189 CDS open 199909-200583 _na     224_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
217 PGGD01000001.1 GCA002794335_00190 CDS open 200684-201433 _na     249_aa DUF5020 domain-containing protein
218 PGGD01000001.1 GCA002794335_00191 CDS open 201852-202007 _na     51_aa hypothetical protein
219 PGGD01000001.1 GCA002794335_00192 CDS open 202139-204166 _na     675_aa bspA BspA family leucine-rich repeat surface protein
220 PGGD01000001.1 GCA002794335_00193 CDS open 204514-206031 _na     505_aa Glycosyl hydrolase-like 10 domain-containing protein
221 PGGD01000001.1 GCA002794335_00194 CDS open 206098-206514 _na     138_aa Periplasmic heavy metal sensor
222 PGGD01000001.1 GCA002794335_00195 CDS open 206547-206954 _na     135_aa traM Conjugative transposon protein TraM
223 PGGD01000001.1 GCA002794335_00196 CDS open 207037-207588 _na     183_aa RNA polymerase sigma factor
224 PGGD01000001.1 GCA002794335_00197 CDS open 207624-207959 _na     111_aa Secretion system C-terminal sorting domain-containing protein
225 PGGD01000001.1 GCA002794335_00198 CDS open 208518-209498 _na     326_aa Glucokinase
226 PGGD01000001.1 GCA002794335_00199 CDS open 209623-210297 _na     224_aa lysE Lysine transporter LysE
227 PGGD01000001.1 GCA002794335_00200 CDS open 210314-210919 _na     201_aa DUF4924 domain-containing protein
228 PGGD01000001.1 GCA002794335_00201 CDS open 210945-211826 _na     293_aa rfbD dTDP-4-dehydrorhamnose reductase
229 PGGD01000001.1 GCA002794335_00202 CDS open 211868-213436 _na     522_aa prfC peptide chain release factor 3
230 PGGD01000001.1 GCA002794335_00203 CDS open 213561-213653 _na     30_aa hypothetical protein
231 PGGD01000001.1 GCA002794335_00204 CDS open 213993-214232 _na     79_aa mscS Mechanosensitive ion channel protein MscS
232 PGGD01000001.1 GCA002794335_00205 CDS open 214229-216604 _na     791_aa Porin
233 PGGD01000001.1 GCA002794335_00206 CDS open 216617-217573 _na     318_aa menA 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase
234 PGGD01000001.1 GCA002794335_00207 CDS open 217583-218236 _na     217_aa HD domain-containing protein
235 PGGD01000001.1 GCA002794335_00208 CDS open 218277-218744 _na     155_aa Guanine deaminase
236 PGGD01000001.1 GCA002794335_00209 CDS open 219284-222145 _na     953_aa uvrA excinuclease ABC subunit UvrA
237 PGGD01000001.1 GCA002794335_00210 CDS open 222330-222995 _na     221_aa WG repeat-containing protein
238 PGGD01000001.1 GCA002794335_00211 CDS open 223537-224376 _na     279_aa 2%2C5-diketo-D-gluconic acid reductase
239 PGGD01000001.1 GCA002794335_00212 CDS open 224510-225373 _na     287_aa araC Putative transcriptional regulator AraC family
240 PGGD01000001.1 GCA002794335_00213 CDS open 225983-227173 _na     396_aa spt serine palmitoyltransferase
241 PGGD01000001.1 GCA002794335_00214 CDS open 227362-228390 _na     342_aa DAGKc domain-containing protein
242 PGGD01000001.1 GCA002794335_00215 CDS open 228391-229083 _na     230_aa tRNA1(Val) (adenine(37)-N6)-methyltransferase
243 PGGD01000001.1 GCA002794335_00216 CDS open 229486-231936 _na     816_aa lon endopeptidase La
244 PGGD01000001.1 GCA002794335_00217 CDS open 231926-233053 _na     375_aa tgt tRNA guanosine(34) transglycosylase Tgt
245 PGGD01000001.1 GCA002794335_00218 CDS open 233062-234288 _na     408_aa YjgP/YjgQ family permease
246 PGGD01000001.1 GCA002794335_00219 CDS open 234345-236084 _na     579_aa DEAD/DEAH box helicase
247 PGGD01000001.1 GCA002794335_00220 CDS open 236353-237918 _na     521_aa mmdA putative propionyl-CoA carboxylase beta chain 5
248 PGGD01000001.1 GCA002794335_00221 CDS open 237951-238100 _na     49_aa NHR domain-containing protein
249 PGGD01000001.1 GCA002794335_00222 CDS open 238107-238535 _na     142_aa Lipoyl-binding domain-containing protein
250 PGGD01000001.1 GCA002794335_00223 CDS open 239154-240443 _na     429_aa serS serine--tRNA ligase
251 PGGD01000001.1 GCA002794335_00224 CDS open 240607-242961 _na     784_aa bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase
252 PGGD01000001.1 GCA002794335_00225 CDS open 243287-244252 _na     321_aa IS30 family transposase
253 PGGD01000001.1 GCA002794335_00226 CDS open 244392-245264 _na     290_aa Uridine phosphorylase
254 PGGD01000001.1 GCA002794335_00227 CDS open 245409-246812 _na     467_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
255 PGGD01000001.1 GCA002794335_00228 CDS open 246896-247588 _na     230_aa Uracil-DNA glycosylase-like domain-containing protein
256 PGGD01000001.1 GCA002794335_00229 CDS open 247820-248428 _na     202_aa UbiE/COQ5 methyltransferase
257 PGGD01000001.1 GCA002794335_00230 CDS open 249041-249424 _na     127_aa Glyoxalase/bleomycin resistance/extradiol dioxygenase family protein
258 PGGD01000001.1 GCA002794335_00231 CDS open 249662-251305 _na     547_aa hcp hydroxylamine reductase
259 PGGD01000001.1 GCA002794335_00232 CDS open 251399-252067 _na     222_aa HTH crp-type domain-containing protein
260 PGGD01000001.1 GCA002794335_00233 CDS open 252340-252783 _na     147_aa Histidinol phosphate phosphatase
261 PGGD01000001.1 GCA002794335_00234 CDS open 252978-253775 _na     265_aa Cytochrome c assembly protein domain-containing protein
262 PGGD01000001.1 GCA002794335_00235 CDS open 253772-255079 _na     435_aa ResB-like domain-containing protein
263 PGGD01000001.1 GCA002794335_00236 CDS open 255127-256623 _na     498_aa nrfA ammonia-forming cytochrome c nitrite reductase
264 PGGD01000001.1 GCA002794335_00237 CDS open 256636-257241 _na     201_aa nrfH cytochrome c nitrite reductase small subunit
265 PGGD01000001.1 GCA002794335_00238 CDS open 257399-258937 _na     512_aa Peptidase
266 PGGD01000001.1 GCA002794335_00239 CDS open 258921-259289 _na     122_aa DUF488 domain-containing protein
267 PGGD01000001.1 GCA002794335_00240 CDS open 259221-259403 _na     60_aa hypothetical protein
268 PGGD01000001.1 GCA002794335_00241 CDS open 259750-260070 _na     106_aa Cupin domain-containing protein
269 PGGD01000001.1 GCA002794335_00242 CDS open 260240-261277 _na     345_aa Winged helix DNA-binding domain-containing protein
270 PGGD01000001.1 GCA002794335_00243 CDS open 261293-262048 _na     251_aa Hydrolase
271 PGGD01000001.1 GCA002794335_00244 CDS open 262045-262293 _na     82_aa hypothetical protein
272 PGGD01000001.1 GCA002794335_00245 CDS open 262295-262558 _na     87_aa GlsB/YeaQ/YmgE family stress response membrane protein
273 PGGD01000001.1 GCA002794335_00246 CDS open 262631-263194 _na     187_aa Putative flavoredoxin
274 PGGD01000001.1 GCA002794335_00247 CDS open 263290-263502 _na     70_aa hypothetical protein
275 PGGD01000001.1 GCA002794335_00248 CDS open 263672-264952 _na     426_aa DUF6383 domain-containing protein
276 PGGD01000001.1 GCA002794335_00249 CDS open 265761-267482 _na     573_aa glutamine--tRNA ligase/YqeY domain fusion protein
277 PGGD01000001.1 GCA002794335_00250 CDS open 267489-268718 _na     409_aa Tetratricopeptide repeat protein
278 PGGD01000001.1 GCA002794335_00251 CDS open 268748-269437 _na     229_aa RNA polymerase sigma-70 domain-containing protein
279 PGGD01000001.1 GCA002794335_00252 CDS open 269457-270581 _na     374_aa Phytase-like domain-containing protein
280 PGGD01000001.1 GCA002794335_00253 CDS open 270913-271998 _na     361_aa gmd GDP-mannose 4%2C6-dehydratase
281 PGGD01000001.1 GCA002794335_00254 CDS open 272053-273120 _na     355_aa Mannose-1-phosphate guanylyltransferase
282 PGGD01000001.1 GCA002794335_00255 CDS open 273214-273543 _na     109_aa DNA-binding protein
283 PGGD01000001.1 GCA002794335_00256 CDS open 273601-273882 _na     93_aa Winged helix-turn-helix domain-containing protein
284 PGGD01000001.1 GCA002794335_00257 CDS open 274055-275815 _na     586_aa aspS aspartate--tRNA ligase
285 PGGD01000001.1 GCA002794335_00258 CDS open 276491-278926 _na     811_aa Colicin I receptor
286 PGGD01000001.1 GCA002794335_00259 CDS open 278954-280195 _na     413_aa Lipoprotein
287 PGGD01000001.1 GCA002794335_00260 CDS open 280237-280854 _na     205_aa HTH tetR-type domain-containing protein
288 PGGD01000001.1 GCA002794335_00261 CDS open 281187-281648 _na     153_aa tonB TonB C-terminal domain-containing protein
289 PGGD01000001.1 GCA002794335_00262 CDS open 281798-282403 _na     201_aa riboflavin synthase
290 PGGD01000001.1 GCA002794335_00264 CDS open 282767-284125 _na     452_aa lpdA dihydrolipoyl dehydrogenase
291 PGGD01000001.1 GCA002794335_00265 CDS open 284146-285624 _na     492_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
292 PGGD01000001.1 GCA002794335_00266 CDS open 285674-286984 _na     436_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
293 PGGD01000001.1 GCA002794335_00267 CDS open 287100-287480 _na     126_aa gcvH glycine cleavage system protein GcvH
294 PGGD01000001.1 GCA002794335_00268 CDS open 287568-288653 _na     361_aa gcvT glycine cleavage system aminomethyltransferase GcvT
295 PGGD01000001.1 GCA002794335_00269 CDS open 288849-289172 _na     107_aa hypothetical protein
296 PGGD01000001.1 GCA002794335_00270 CDS open 289239-289796 _na     185_aa 30S ribosomal protein S16
297 PGGD01000001.1 GCA002794335_00271 CDS open 289944-291227 _na     427_aa DZANK-type domain-containing protein
298 PGGD01000001.1 GCA002794335_00272 CDS open 291291-291980 _na     229_aa Lysozyme
299 PGGD01000001.1 GCA002794335_00273 CDS open 292316-293188 _na     290_aa DUF3300 domain-containing protein
300 PGGD01000001.1 GCA002794335_00274 CDS open 293797-294321 _na     174_aa Histidine phosphatase family protein
301 PGGD01000001.1 GCA002794335_00275 CDS open 294459-295115 _na     218_aa DUF308 domain-containing protein
302 PGGD01000001.1 GCA002794335_00276 CDS open 295296-295928 _na     210_aa udk uridine kinase
303 PGGD01000001.1 GCA002794335_00277 CDS open 295931-296512 _na     193_aa DNA glycosylase
304 PGGD01000001.1 GCA002794335_00278 CDS open 296513-297535 _na     340_aa Endonuclease/exonuclease/phosphatase domain-containing protein
305 PGGD01000001.1 GCA002794335_00279 CDS open 297572-297748 _na     58_aa hypothetical protein
306 PGGD01000001.1 GCA002794335_00280 CDS open 297767-300349 _na     860_aa TonB-dependent receptor-like beta-barrel domain-containing protein
307 PGGD01000001.1 GCA002794335_00281 CDS open 300362-301690 _na     442_aa DUF5689 domain-containing protein
308 PGGD01000001.1 GCA002794335_00282 CDS open 301728-302708 _na     326_aa DNA-binding protein
309 PGGD01000001.1 GCA002794335_00283 CDS open 302848-303099 _na     83_aa type B 50S ribosomal protein L31
310 PGGD01000001.1 GCA002794335_00284 CDS open 303223-304161 _na     312_aa Endonuclease
311 PGGD01000001.1 GCA002794335_00285 CDS open 304521-305342 _na     273_aa Lipoprotein
312 PGGD01000001.1 GCA002794335_00286 CDS open 305687-307651 _na     654_aa Hemin-binding protein
313 PGGD01000001.1 GCA002794335_00287 CDS open 307900-308454 _na     184_aa Glutathione peroxidase
314 PGGD01000001.1 GCA002794335_00288 CDS open 308877-310295 _na     472_aa Sodium-solute symporter
315 PGGD01000001.1 GCA002794335_00289 CDS open 310494-311327 _na     277_aa coaW type II pantothenate kinase
316 PGGD01000001.1 GCA002794335_00290 CDS open 311510-311788 _na     92_aa DNA-binding protein HU
317 PGGD01000001.1 GCA002794335_00291 CDS open 311827-311916 _na     29_aa Mitochondrial mRNA-processing protein COX24 C-terminal domain-containing protein
318 PGGD01000001.1 GCA002794335_00292 CDS open 312060-313631 _na     523_aa S1 motif domain-containing protein
319 PGGD01000001.1 GCA002794335_00293 CDS open 313981-316470 _na     829_aa TonB-dependent receptor
320 PGGD01000001.1 GCA002794335_00294 CDS open 316958-318094 _na     378_aa Zinc ribbon domain-containing protein
321 PGGD01000001.1 GCA002794335_00295 CDS open 318102-320036 _na     644_aa Peptidase U32 collagenase domain-containing protein
322 PGGD01000001.1 GCA002794335_00296 CDS open 320293-320493 _na     66_aa 2TM domain-containing protein
323 PGGD01000001.1 GCA002794335_00298 CDS open 321059-322684 _na     541_aa Hemin receptor
324 PGGD01000001.1 GCA002794335_00299 CDS open 322745-323773 _na     342_aa Vitellogenin II
325 PGGD01000001.1 GCA002794335_00300 CDS open 324014-325372 _na     452_aa Alpha-L-fucosidase
326 PGGD01000001.1 GCA002794335_00301 CDS open 325378-326055 _na     225_aa cutC PF03932 family protein CutC
327 PGGD01000001.1 GCA002794335_00302 CDS open 326151-326495 _na     114_aa Secreted protein
328 PGGD01000001.1 GCA002794335_00303 CDS open 326727-329042 _na     771_aa Transglutaminase-like domain-containing protein
329 PGGD01000001.1 GCA002794335_00304 CDS open 329291-329614 _na     107_aa hypothetical protein
330 PGGD01000001.1 GCA002794335_00305 CDS open 329940-330635 _na     231_aa hypothetical protein
331 PGGD01000001.1 GCA002794335_00306 CDS open 331162-332031 _na     289_aa prmA 50S ribosomal protein L11 methyltransferase
332 PGGD01000001.1 GCA002794335_00307 CDS open 331958-332830 _na     290_aa Glycosyl hydrolase family 25
333 PGGD01000001.1 GCA002794335_00308 CDS open 332860-334518 _na     552_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
334 PGGD01000001.1 GCA002794335_00309 CDS open 334722-334994 _na     90_aa rteC RteC protein
335 PGGD01000001.1 GCA002794335_00310 CDS open 334996-335556 _na     186_aa Phospholipid/glycerol acyltransferase domain-containing protein
336 PGGD01000001.1 GCA002794335_00311 CDS open 335556-338150 _na     864_aa Fibronectin type-III domain-containing protein
337 PGGD01000001.1 GCA002794335_00312 CDS open 338196-338540 _na     114_aa hypothetical protein
338 PGGD01000001.1 GCA002794335_00313 CDS open 338858-340804 _na     648_aa ygiQ YgiQ family radical SAM protein
339 PGGD01000001.1 GCA002794335_00314 CDS open 340867-341511 _na     214_aa Phosphoglycolate phosphatase
340 PGGD01000001.1 GCA002794335_00315 CDS open 341719-341940 _na     73_aa hypothetical protein
341 PGGD01000001.1 GCA002794335_00316 CDS open 341958-342770 _na     270_aa RNA polymerase subunit sigma
342 PGGD01000001.1 GCA002794335_00317 CDS open 342945-344219 _na     424_aa rarA Recombination factor protein RarA
343 PGGD01000001.1 GCA002794335_00318 CDS open 344225-345181 _na     318_aa 2-hydroxyacid dehydrogenase HI_1556
344 PGGD01000001.1 GCA002794335_00319 CDS open 345212-345847 _na     211_aa Glycine transporter domain-containing protein
345 PGGD01000001.1 GCA002794335_00321 CDS open 346364-346657 _na     97_aa hypothetical protein
346 PGGD01000001.1 GCA002794335_00322 CDS open 346746-348122 _na     458_aa Aromatic amino acid beta-eliminating lyase/threonine aldolase domain-containing protein
347 PGGD01000001.1 GCA002794335_00323 CDS open 348412-349794 _na     460_aa nhaD sodium:proton antiporter NhaD
348 PGGD01000001.1 GCA002794335_00324 CDS open 349961-350356 _na     131_aa 8-oxo-dGTP diphosphatase
349 PGGD01000001.1 GCA002794335_00325 CDS open 350347-351012 _na     221_aa B3/B4 tRNA-binding domain-containing protein
350 PGGD01000001.1 GCA002794335_00326 CDS open 351022-352995 _na     657_aa ligA NAD-dependent DNA ligase LigA
351 PGGD01000001.1 GCA002794335_00327 CDS open 353047-353151 _na     34_aa hypothetical protein
352 PGGD01000001.1 GCA002794335_00328 CDS open 353577-354479 _na     300_aa GYF domain-containing protein
353 PGGD01000001.1 GCA002794335_00329 CDS open 354603-356048 _na     481_aa ffh signal recognition particle protein
354 PGGD01000001.1 GCA002794335_00330 CDS open 356089-356973 _na     294_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
355 PGGD01000001.1 GCA002794335_00331 CDS open 357055-357237 _na     60_aa Tetratricopeptide repeat protein
356 PGGD01000001.1 GCA002794335_00332 CDS open 357251-357484 _na     77_aa Ferredoxin%2C 4Fe-4S
357 PGGD01000001.1 GCA002794335_00333 CDS open 357488-358573 _na     361_aa 3-methyl-2-oxobutanoate dehydrogenase (Ferredoxin)
358 PGGD01000001.1 GCA002794335_00334 CDS open 358594-359364 _na     256_aa Thiamine pyrophosphate enzyme TPP-binding domain-containing protein
359 PGGD01000001.1 GCA002794335_00335 CDS open 359387-359935 _na     182_aa Pyruvate/ketoisovalerate oxidoreductase catalytic domain-containing protein
360 PGGD01000001.1 GCA002794335_00336 CDS open 360198-361298 _na     366_aa OmpA-like domain-containing protein
361 PGGD01000001.1 GCA002794335_00337 CDS open 361815-362582 _na     255_aa Acyl-ACP thioesterase
362 PGGD01000001.1 GCA002794335_00338 CDS open 362786-364801 _na     671_aa Transketolase
363 PGGD01000001.1 GCA002794335_00339 CDS open 364859-365296 _na     145_aa Ribose 5-phosphate isomerase B
364 PGGD01000001.1 GCA002794335_00340 CDS open 365433-366872 _na     479_aa pyk pyruvate kinase
365 PGGD01000001.1 GCA002794335_00341 CDS open 366889-367170 _na     93_aa Zinc ribbon domain-containing protein
366 PGGD01000001.1 GCA002794335_00342 CDS open 367175-367960 _na     261_aa Zinc ribbon domain-containing protein
367 PGGD01000001.1 GCA002794335_00343 CDS open 368601-369584 _na     327_aa aminodeoxychorismate synthase component I
368 PGGD01000001.1 GCA002794335_00344 CDS open 369568-370170 _na     200_aa Chorismate-binding protein
369 PGGD01000001.1 GCA002794335_00347 CDS open 370504-370794 _na     96_aa Transcriptional regulator
370 PGGD01000001.1 GCA002794335_00348 CDS open 370791-371444 _na     217_aa DUF2157 domain-containing protein
371 PGGD01000001.1 GCA002794335_00349 CDS open 371631-372317 _na     228_aa DUF4230 domain-containing protein
372 PGGD01000001.1 GCA002794335_00350 CDS open 372301-372951 _na     216_aa DUF4230 domain-containing protein
373 PGGD01000001.1 GCA002794335_00351 CDS open 372980-374335 _na     451_aa Multidrug-efflux transporter
374 PGGD01000001.1 GCA002794335_00352 CDS open 374350-374928 _na     192_aa DUF4738 domain-containing protein
375 PGGD01000001.1 GCA002794335_00353 CDS open 375503-376729 _na     408_aa ywqK Toxin-antitoxin system YwqK family antitoxin
376 PGGD01000001.1 GCA002794335_00354 CDS open 376828-377712 _na     294_aa eamA EamA domain-containing protein
377 PGGD01000001.1 GCA002794335_00355 CDS open 377813-378826 _na     337_aa branched-chain amino acid aminotransferase
378 PGGD01000001.1 GCA002794335_00356 CDS open 378933-379112 _na     59_aa xseB exodeoxyribonuclease VII small subunit
379 PGGD01000001.1 GCA002794335_00357 CDS open 379131-380429 _na     432_aa xseA exodeoxyribonuclease VII large subunit
380 PGGD01000001.1 GCA002794335_00358 CDS open 381024-382991 _na     655_aa Sulfatase N-terminal domain-containing protein
381 PGGD01000001.1 GCA002794335_00359 CDS open 383220-384107 _na     295_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
382 PGGD01000001.1 GCA002794335_00360 CDS open 384146-385195 _na     349_aa asparaginase
383 PGGD01000001.1 GCA002794335_00361 CDS open 385613-386365 _na     250_aa Polysaccharide export outer membrane protein
384 PGGD01000001.1 GCA002794335_00362 CDS open 386441-388288 _na     615_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
385 PGGD01000001.1 GCA002794335_00363 CDS open 388315-390204 _na     629_aa Amidophosphoribosyltransferase
386 PGGD01000001.1 GCA002794335_00364 CDS open 390241-391317 _na     358_aa carbamoyl phosphate synthase small subunit
387 PGGD01000001.1 GCA002794335_00365 CDS open 391317-394541 _na     1074_aa carB carbamoyl-phosphate synthase large subunit
388 PGGD01000001.1 GCA002794335_00366 CDS open 394784-395542 _na     252_aa Lipocalin-like domain-containing protein
389 PGGD01000001.1 GCA002794335_00367 CDS open 395732-396088 _na     118_aa hypothetical protein
390 PGGD01000001.1 GCA002794335_00368 CDS open 396201-396392 _na     63_aa Entericidin
391 PGGD01000001.1 GCA002794335_00369 CDS open 396876-398123 _na     415_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
392 PGGD01000001.1 GCA002794335_00370 CDS open 398120-399121 _na     333_aa Glycosyltransferase family 2
393 PGGD01000001.1 GCA002794335_00371 CDS open 399355-400320 _na     321_aa IS30 family transposase
394 PGGD01000001.1 GCA002794335_00372 CDS open 400461-401267 _na     268_aa gldB Gliding motility protein GldB
395 PGGD01000001.1 GCA002794335_00376 CDS open 402062-402589 _na     175_aa DUF4199 domain-containing protein
396 PGGD01000001.1 GCA002794335_00377 CDS open 402617-403573 _na     318_aa Glycosyltransferase 2-like domain-containing protein
397 PGGD01000001.1 GCA002794335_00378 CDS open 403594-404691 _na     365_aa FAD:protein FMN transferase
398 PGGD01000001.1 GCA002794335_00379 CDS open 404724-405386 _na     220_aa Putative transcription regulator
399 PGGD01000001.1 GCA002794335_00380 CDS open 405459-407549 _na     696_aa Peptidase M3A/M3B catalytic domain-containing protein
400 PGGD01000001.1 GCA002794335_00381 CDS open 407582-408028 _na     148_aa CMP/dCMP-type deaminase domain-containing protein
401 PGGD01000001.1 GCA002794335_00382 CDS open 408009-409676 _na     555_aa Peptidase S41
402 PGGD01000001.1 GCA002794335_00383 CDS open 409755-410288 _na     177_aa 5-formyltetrahydrofolate cyclo-ligase
403 PGGD01000001.1 GCA002794335_00384 CDS open 410208-410456 _na     82_aa hypothetical protein
404 PGGD01000001.1 GCA002794335_00385 CDS open 410610-410900 _na     96_aa DUF721 domain-containing protein
405 PGGD01000001.1 GCA002794335_00386 CDS open 410893-412008 _na     371_aa recF DNA replication/repair protein RecF
406 PGGD01000001.1 GCA002794335_00387 CDS open 412139-412435 _na     98_aa Glutaredoxin-related protein
407 PGGD01000001.1 GCA002794335_00388 CDS open 412447-412680 _na     77_aa DUF2492 domain-containing protein
408 PGGD01000001.1 GCA002794335_00390 CDS open 412961-413338 _na     125_aa secG preprotein translocase subunit SecG
409 PGGD01000001.1 GCA002794335_00391 CDS open 413347-414117 _na     256_aa Tetratricopeptide repeat protein
410 PGGD01000001.1 GCA002794335_00392 CDS open 414154-414684 _na     176_aa Lipopolysaccharide-assembly
411 PGGD01000001.1 GCA002794335_00393 CDS open 414665-415909 _na     414_aa Sigma-54 factor interaction domain-containing protein
412 PGGD01000001.1 GCA002794335_00394 CDS open 416452-417681 _na     409_aa Tyr recombinase domain-containing protein
413 PGGD01000001.1 GCA002794335_00395 CDS open 417710-418969 _na     419_aa Integrase
414 PGGD01000001.1 GCA002794335_00396 CDS open 419040-419138 _na     32_aa hypothetical protein
415 PGGD01000001.1 GCA002794335_00397 CDS open 419188-419508 _na     106_aa hypothetical protein
416 PGGD01000001.1 GCA002794335_00398 CDS open 419741-420124 _na     127_aa hypothetical protein
417 PGGD01000001.1 GCA002794335_00399 CDS open 420108-420581 _na     157_aa hypothetical protein
418 PGGD01000001.1 GCA002794335_00400 CDS open 420592-421485 _na     297_aa Tubulin/FtsZ GTPase domain-containing protein
419 PGGD01000001.1 GCA002794335_00401 CDS open 421630-423279 _na     549_aa DUF262 domain-containing protein
420 PGGD01000001.1 GCA002794335_00402 CDS open 423272-425581 _na     769_aa GmrSD restriction endonucleases N-terminal domain-containing protein
421 PGGD01000001.1 GCA002794335_00403 CDS open 425586-426152 _na     188_aa Serine/threonine protein phosphatase
422 PGGD01000001.1 GCA002794335_00404 CDS open 426166-426849 _na     227_aa hypothetical protein
423 PGGD01000001.1 GCA002794335_00405 CDS open 426862-427836 _na     324_aa Histidine kinase
424 PGGD01000001.1 GCA002794335_00406 CDS open 428057-428668 _na     203_aa Lipoprotein
425 PGGD01000001.1 GCA002794335_00407 CDS open 428680-429003 _na     107_aa hypothetical protein
426 PGGD01000001.1 GCA002794335_00408 CDS open 429006-429362 _na     118_aa hypothetical protein
427 PGGD01000001.1 GCA002794335_00409 CDS open 429385-430074 _na     229_aa hypothetical protein
428 PGGD01000001.1 GCA002794335_00410 CDS open 430216-431178 _na     320_aa WYL domain-containing protein
429 PGGD01000001.1 GCA002794335_00411 CDS open 431181-431732 _na     183_aa Putative DNA polymerase III%2C epsilon subunit
430 PGGD01000001.1 GCA002794335_00412 CDS open 431875-432165 _na     96_aa DNA-binding protein
431 PGGD01000001.1 GCA002794335_00413 CDS open 432177-432464 _na     95_aa Multidrug DMT transporter permease
432 PGGD01000001.1 GCA002794335_00414 CDS open 432975-433064 _na     29_aa hypothetical protein
433 PGGD01000001.1 GCA002794335_00415 CDS open 433090-434370 _na     426_aa Virulence-associated protein E
434 PGGD01000001.1 GCA002794335_00416 CDS open 434590-435570 _na     326_aa Zinc finger CHC2-type domain-containing protein
435 PGGD01000001.1 GCA002794335_00417 CDS open 435575-436039 _na     154_aa DUF3408 domain-containing protein
436 PGGD01000001.1 GCA002794335_00418 CDS open 436401-436832 _na     143_aa copG Ribbon-helix-helix protein%2C CopG family
437 PGGD01000001.1 GCA002794335_00419 CDS open 436816-437877 _na     353_aa Relaxase/mobilization nuclease family protein
438 PGGD01000001.1 GCA002794335_00420 CDS open 438327-438545 _na     72_aa Transporter
439 PGGD01000001.1 GCA002794335_00421 CDS open 438545-440089 _na     514_aa Phosphotransferase
440 PGGD01000001.1 GCA002794335_00422 CDS open 440212-441009 _na     265_aa Putative nucleotidyl transferase
441 PGGD01000001.1 GCA002794335_00423 CDS open 441056-442597 _na     513_aa guaA glutamine-hydrolyzing GMP synthase
442 PGGD01000001.1 GCA002794335_00424 CDS open 442780-442953 _na     57_aa hypothetical protein
443 PGGD01000001.1 GCA002794335_00425 CDS open 443008-443388 _na     126_aa mscL large-conductance mechanosensitive channel protein MscL
444 PGGD01000001.1 GCA002794335_00426 CDS open 443613-444632 _na     339_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
445 PGGD01000001.1 GCA002794335_00427 CDS open 444678-445646 _na     322_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
446 PGGD01000001.1 GCA002794335_00428 CDS open 445673-446611 _na     312_aa DAGKc domain-containing protein
447 PGGD01000001.1 GCA002794335_00429 CDS open 447089-448486 _na     465_aa Glycoside hydrolase family 57 N-terminal domain-containing protein
448 PGGD01000001.1 GCA002794335_00430 CDS open 448539-449798 _na     419_aa Glycosyltransferase family 1 protein
449 PGGD01000001.1 GCA002794335_00431 CDS open 449828-451771 _na     647_aa 4-alpha-glucanotransferase
450 PGGD01000001.1 GCA002794335_00432 CDS open 452026-452199 _na     57_aa Secreted protein
451 PGGD01000001.1 GCA002794335_00433 CDS open 452322-453725 _na     467_aa Chitobiase
452 PGGD01000001.1 GCA002794335_00434 CDS open 453810-455576 _na     588_aa Peptidase M6-like domain-containing protein
453 PGGD01000001.1 GCA002794335_00435 CDS open 455656-456531 _na     291_aa 4Fe-4S ferredoxin-type domain-containing protein
454 PGGD01000001.1 GCA002794335_00436 CDS open 456782-459934 _na     1050_aa prtT putative thiol protease/trypsin like proteinase PrtT
455 PGGD01000001.1 GCA002794335_00437 CDS open 460439-461233 _na     264_aa Hydrolase HAD superfamily
456 PGGD01000001.1 GCA002794335_00438 CDS open 461323-461961 _na     212_aa Cation transporter
457 PGGD01000001.1 GCA002794335_00439 CDS open 461994-462911 _na     305_aa ychK Protein YchK
458 PGGD01000001.1 GCA002794335_00440 CDS open 462927-463706 _na     259_aa ZIP zinc transporter
459 PGGD01000001.1 GCA002794335_00441 CDS open 464543-465880 _na     445_aa DNA-damage-inducible protein F
460 PGGD01000001.1 GCA002794335_00442 CDS open 465887-466024 _na     45_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
461 PGGD01000001.1 GCA002794335_00443 CDS open 466027-466272 _na     81_aa Transposase
462 PGGD01000001.1 GCA002794335_00444 CDS open 466383-466856 _na     157_aa Threonyl/alanyl tRNA synthetase SAD domain-containing protein
463 PGGD01000001.1 GCA002794335_00445 CDS open 466860-468554 _na     564_aa Glycosyl hydrolase family 13 catalytic domain-containing protein
464 PGGD01000001.1 GCA002794335_00446 CDS open 468739-469626 _na     295_aa fabD ACP S-malonyltransferase
465 PGGD01000001.1 GCA002794335_00447 CDS open 469825-470388 _na     187_aa IS982 family transposase
466 PGGD01000001.1 GCA002794335_00448 CDS open 470393-470725 _na     110_aa Partial transposase in ISPi1
467 PGGD01000001.1 GCA002794335_00449 CDS open 470995-471768 _na     257_aa truA tRNA pseudouridine(38-40) synthase TruA
468 PGGD01000001.1 GCA002794335_00450 CDS open 471793-473346 _na     517_aa Competence protein
469 PGGD01000001.1 GCA002794335_00451 CDS open 473883-475544 _na     553_aa AMP-dependent synthetase/ligase domain-containing protein
470 PGGD01000001.1 GCA002794335_00452 CDS open 475670-476917 _na     415_aa ABC3 transporter permease protein domain-containing protein
471 PGGD01000001.1 GCA002794335_00453 CDS open 477297-477761 _na     154_aa HU domain-containing protein
472 PGGD01000001.1 GCA002794335_00454 CDS open 478011-478205 _na     64_aa Toxin PIN
473 PGGD01000001.1 GCA002794335_00455 CDS open 478220-481573 _na     1117_aa Leucine-rich repeat domain-containing protein
474 PGGD01000001.1 GCA002794335_00456 CDS open 481847-482818 _na     323_aa IS30 family transposase
475 PGGD01000001.1 GCA002794335_00457 CDS open 483137-483619 _na     160_aa Phage tail protein
476 PGGD01000001.1 GCA002794335_00458 CDS open 483655-484326 _na     223_aa Pyridoxal phosphate homeostasis protein
477 PGGD01000001.1 GCA002794335_00459 CDS open 484379-485959 _na     526_aa FAD-binding domain-containing protein
478 PGGD01000001.1 GCA002794335_00460 CDS open 485975-486529 _na     184_aa DNA-3-methyladenine glycosylase I
479 PGGD01000001.1 GCA002794335_00461 CDS open 486953-488485 _na     510_aa Glycosyltransferase 2-like domain-containing protein
480 PGGD01000001.1 GCA002794335_00462 CDS open 488530-489381 _na     283_aa DUF4922 domain-containing protein
481 PGGD01000001.1 GCA002794335_00463 CDS open 489395-490726 _na     443_aa lytB Sporulation stage II protein D amidase enhancer LytB N-terminal domain-containing protein
482 PGGD01000001.1 GCA002794335_00464 CDS open 490771-492048 _na     425_aa Major facilitator superfamily (MFS) profile domain-containing protein
483 PGGD01000001.1 GCA002794335_00465 CDS open 492156-493406 _na     416_aa UDP-glucose 6-dehydrogenase
484 PGGD01000001.1 GCA002794335_00466 CDS open 494143-496764 _na     873_aa gyrA DNA gyrase subunit A
485 PGGD01000001.1 GCA002794335_00467 CDS open 496859-498112 _na     417_aa TPR domain protein
486 PGGD01000001.1 GCA002794335_00468 CDS open 498269-499381 _na     370_aa Tetratricopeptide repeat protein
487 PGGD01000001.1 GCA002794335_00469 CDS open 499378-500589 _na     403_aa TPR domain protein
488 PGGD01000001.1 GCA002794335_00470 CDS open 500576-501892 _na     438_aa DEAD/DEAH box helicase
489 PGGD01000001.1 GCA002794335_00471 CDS open 502098-503168 _na     356_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
490 PGGD01000001.1 GCA002794335_00472 CDS open 503251-504168 _na     305_aa D-3-phosphoglycerate dehydrogenase
491 PGGD01000001.1 GCA002794335_00473 CDS open 504262-505509 _na     415_aa DUF1015 domain-containing protein
492 PGGD01000001.1 GCA002794335_00474 CDS open 505552-506142 _na     196_aa Thymidylate synthase
493 PGGD01000001.1 GCA002794335_00475 CDS open 506529-508013 _na     494_aa Phosphomannomutase/phosphoglucomutase
494 PGGD01000001.1 GCA002794335_00476 CDS open 508022-508594 _na     190_aa N-acetyltransferase domain-containing protein
495 PGGD01000001.1 GCA002794335_00477 CDS open 508718-510751 _na     677_aa TonB-dependent receptor plug domain-containing protein
496 PGGD01000001.1 GCA002794335_00478 CDS open 510770-511885 _na     371_aa 40-residue YVTN family beta-propeller
497 PGGD01000001.1 GCA002794335_00479 CDS open 511899-512912 _na     337_aa PKD domain-containing protein
498 PGGD01000001.1 GCA002794335_00481 CDS open 513594-514700 _na     368_aa Putative permease
499 PGGD01000001.1 GCA002794335_00482 CDS open 514737-515345 _na     202_aa thymidine kinase
500 PGGD01000001.1 GCA002794335_00483 CDS open 515406-516365 _na     319_aa manA mannose-6-phosphate isomerase%2C class I