HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_002913085.1)

Select a Genome:
BAKTA Annotations for GCA_002913085.1
Genome Selected: Campylobacter concisus clade-575
ContigsBases CDSrRNA tmRNAtRNA
55 1784251 1762 6 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3627 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3627 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 PPAK01000038.1 GCA002913085_01362 CDS open 201138-202388 _na     416_aa purA adenylosuccinate synthase
2502 PPAK01000038.1 GCA002913085_01363 CDS open 202385-202807 _na     140_aa fliJ Flagellar FliJ protein
2503 PPAK01000038.1 GCA002913085_01364 CDS open 202807-203370 _na     187_aa mgtE Magnesium transporter MgtE intracellular domain-containing protein
2504 PPAK01000038.1 GCA002913085_01365 CDS open 203491-204492 _na     333_aa terC Membrane protein%2C TerC family
2505 PPAK01000038.1 GCA002913085_01366 CDS open 204510-205709 _na     399_aa Molybdopterin molybdenumtransferase
2506 PPAK01000038.1 GCA002913085_01367 CDS open 205843-206901 _na     352_aa yedE YedE family putative selenium transporter
2507 PPAK01000038.1 GCA002913085_01368 CDS open 206931-207296 _na     121_aa ATP-binding cassette domain-containing protein
2508 PPAK01000038.1 GCA002913085_01369 CDS open 207433-208263 _na     276_aa surA SurA N-terminal domain-containing protein
2509 PPAK01000038.1 GCA002913085_01370 CDS open 208334-209713 _na     459_aa gltX glutamate--tRNA ligase
2510 PPAK01000038.1 GCA002913085_01371 CDS open 209710-210963 _na     417_aa Malate oxidoreductase
2511 PPAK01000038.1 GCA002913085_01372 CDS open 211048-211674 _na     208_aa upp uracil phosphoribosyltransferase
2512 PPAK01000038.1 GCA002913085_01373 CDS open 211684-212190 _na     168_aa Ribonuclease
2513 PPAK01000038.1 GCA002913085_01374 CDS open 212187-212459 _na     90_aa Barstar (barnase inhibitor) domain-containing protein
2514 PPAK01000038.1 GCA002913085_01375 CDS open 212456-213136 _na     226_aa Chorismate dehydratase
2515 PPAK01000038.1 GCA002913085_01376 CDS open 213181-213786 _na     201_aa Cytochrome oxidase biogenesis protein Surf12C
2516 PPAK01000038.1 GCA002913085_01377 CDS open 213918-214631 _na     237_aa Putative formate dehydrogenase-specific chaperone
2517 PPAK01000038.1 GCA002913085_01378 CDS open 214624-216297 _na     557_aa Iron-sulfur cluster-binding protein
2518 PPAK01000038.1 GCA002913085_01379 CDS open 216452-217777 _na     441_aa selA L-seryl-tRNA(Sec) selenium transferase
2519 PPAK01000038.1 GCA002913085_01380 CDS open 217774-219594 _na     606_aa selB selenocysteine-specific translation elongation factor
2520 PPAK01000038.1 GCA002913085_01381 CDS open 219648-220388 _na     246_aa Histidine kinase
2521 PPAK01000038.1 GCA002913085_01382 CDS open 220691-220897 _na     68_aa Formate dehydrogenase subunit or accessory protein
2522 PPAK01000038.1 GCA002913085_01383 CDS open 220909-221442 _na     177_aa Molybdopterin-dependent oxidoreductase
2523 PPAK01000038.1 GCA002913085_01384 CDS open 221464-223884 _na     806_aa Formate dehydrogenase N%2C alpha subunit%2C selenocysteine-containing
2524 PPAK01000038.1 GCA002913085_01385 CDS open 223896-224456 _na     186_aa fdh3B formate dehydrogenase FDH3 subunit beta
2525 PPAK01000038.1 GCA002913085_01386 CDS open 224725-226665 _na     646_aa Ferrirhodotorulic acid ABC transporter%2C inner membrane protein
2526 PPAK01000038.1 GCA002913085_01387 CDS open 226686-227207 _na     173_aa Ferrirhodotorulic acid ABC transporter%2C periplasmic binding protein
2527 PPAK01000038.1 GCA002913085_01388 CDS open 227258-228637 _na     459_aa Fe-S-containing protein
2528 PPAK01000038.1 GCA002913085_01389 CDS open 228634-229926 _na     430_aa ABC3 transporter permease C-terminal domain-containing protein
2529 PPAK01000038.1 GCA002913085_01390 CDS open 229913-231055 _na     380_aa ftsX Cell division protein FtsX
2530 PPAK01000038.1 GCA002913085_01391 CDS open 231057-231746 _na     229_aa Ferrirhodotorulic acid ABC transporter%2C ATP-binding protein
2531 PPAK01000038.1 GCA002913085_01392 CDS open 231736-232230 _na     164_aa Putative lipoprotein thioredoxin
2532 PPAK01000038.1 GCA002913085_01393 CDS open 232239-232817 _na     192_aa Lipoprotein
2533 PPAK01000038.1 GCA002913085_01394 CDS open 232847-234094 _na     415_aa DUF2920 domain-containing protein
2534 PPAK01000038.1 GCA002913085_01395 CDS open 234139-236511 _na     790_aa GTP pyrophosphokinase
2535 PPAK01000038.1 GCA002913085_01396 CDS open 236511-237755 _na     414_aa serS serine--tRNA ligase
2536 PPAK01000038.1 GCA002913085_01397 CDS open 237765-238205 _na     146_aa copD Copper resistance protein CopD
2537 PPAK01000038.1 GCA002913085_01398 CDS open 238219-239181 _na     320_aa trpS tryptophan--tRNA ligase
2538 PPAK01000038.1 GCA002913085_01399 CDS open 239574-240095 _na     173_aa Shikimate kinase
2539 PPAK01000038.1 GCA002913085_01400 CDS open 240079-241464 _na     461_aa der ribosome biogenesis GTPase Der
2540 PPAK01000038.1 GCA002913085_01401 CDS open 241617-242507 _na     296_aa eamA EamA domain-containing protein
2541 PPAK01000038.1 GCA002913085_01402 CDS open 242517-243566 _na     349_aa hypothetical protein
2542 PPAK01000038.1 GCA002913085_01403 CDS open 243577-244383 _na     268_aa kdsA 3-deoxy-8-phosphooctulonate synthase
2543 PPAK01000038.1 GCA002913085_01404 CDS open 244373-244702 _na     109_aa emrE Multidrug efflux system protein%2C EmrE family
2544 PPAK01000038.1 GCA002913085_01405 CDS open 244699-245022 _na     107_aa Multidrug transporter
2545 PPAK01000038.1 GCA002913085_01406 CDS open 245033-245503 _na     156_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
2546 PPAK01000038.1 GCA002913085_01407 CDS open 245505-245900 _na     131_aa nusB transcription antitermination factor NusB
2547 PPAK01000038.1 GCA002913085_01408 CDS open 245897-246577 _na     226_aa pyrF orotidine-5'-phosphate decarboxylase
2548 PPAK01000038.1 GCA002913085_01149 gene open 79-2352 metE
2549 PPAK01000038.1 GCA002913085_01150 gene open 2378-2836
2550 PPAK01000038.1 GCA002913085_01151 gene open 2841-3725
2551 PPAK01000038.1 GCA002913085_01152 gene open 4137-4556
2552 PPAK01000038.1 GCA002913085_01153 gene open 4617-4757
2553 PPAK01000038.1 GCA002913085_01154 gene open 4757-5458
2554 PPAK01000038.1 GCA002913085_01155 gene open 5455-5892
2555 PPAK01000038.1 GCA002913085_01156 gene open 6042-7571
2556 PPAK01000038.1 GCA002913085_01157 gene open 7740-8252
2557 PPAK01000038.1 GCA002913085_01158 gene open 8404-9690 arsS
2558 PPAK01000038.1 GCA002913085_01161 gene open 10020-11453
2559 PPAK01000038.1 GCA002913085_01162 gene open 12068-13252
2560 PPAK01000038.1 GCA002913085_01163 gene open 13263-13790
2561 PPAK01000038.1 GCA002913085_01164 gene open 13871-14164
2562 PPAK01000038.1 GCA002913085_01165 gene open 14166-14858 ung
2563 PPAK01000038.1 GCA002913085_01166 gene open 14923-15489
2564 PPAK01000038.1 GCA002913085_01167 gene open 15839-17659 thrS
2565 PPAK01000038.1 GCA002913085_01168 gene open 17656-18174 infC
2566 PPAK01000038.1 GCA002913085_01169 gene open 19518-20876 gdhA
2567 PPAK01000038.1 GCA002913085_01170 gene open 21074-21562
2568 PPAK01000038.1 GCA002913085_01171 gene open 22169-23608
2569 PPAK01000038.1 GCA002913085_01172 gene open 23725-24270
2570 PPAK01000038.1 GCA002913085_01173 gene open 24280-24714
2571 PPAK01000038.1 GCA002913085_01174 gene open 24724-25086
2572 PPAK01000038.1 GCA002913085_01175 gene open 25076-25528 lspA
2573 PPAK01000038.1 GCA002913085_01176 gene open 25521-26861 glmM
2574 PPAK01000038.1 GCA002913085_01177 gene open 27019-27288 rpsT
2575 PPAK01000038.1 GCA002913085_01178 gene open 27302-28369 prfA
2576 PPAK01000038.1 GCA002913085_01179 gene open 28714-29133 modE
2577 PPAK01000038.1 GCA002913085_01180 gene open 29497-31062
2578 PPAK01000038.1 GCA002913085_01181 gene open 31089-31316
2579 PPAK01000038.1 GCA002913085_01182 gene open 31318-31683
2580 PPAK01000038.1 GCA002913085_01183 gene open 31737-32495
2581 PPAK01000038.1 GCA002913085_01184 gene open 32499-34919
2582 PPAK01000038.1 GCA002913085_01185 gene open 34909-35781
2583 PPAK01000038.1 GCA002913085_01186 gene open 35922-36350
2584 PPAK01000038.1 GCA002913085_01187 gene open 36603-37934
2585 PPAK01000038.1 GCA002913085_01188 gene open 37915-38721
2586 PPAK01000038.1 GCA002913085_01189 gene open 38723-39508
2587 PPAK01000038.1 GCA002913085_01190 gene open 39505-41010
2588 PPAK01000038.1 GCA002913085_01191 gene open 41014-41949
2589 PPAK01000038.1 GCA002913085_01192 gene open 42097-42456
2590 PPAK01000038.1 GCA002913085_01193 gene open 42447-42839
2591 PPAK01000038.1 GCA002913085_01194 gene open 42886-43611
2592 PPAK01000038.1 GCA002913085_01195 gene open 43608-44489 eamA
2593 PPAK01000038.1 GCA002913085_01196 gene open 44486-45235
2594 PPAK01000038.1 GCA002913085_01197 gene open 45345-45905 mntP
2595 PPAK01000038.1 GCA002913085_01199 gene open 46132-46602
2596 PPAK01000038.1 GCA002913085_01200 gene open 46599-47450 nfo
2597 PPAK01000038.1 GCA002913085_01201 gene open 47447-48673
2598 PPAK01000038.1 GCA002913085_01202 gene open 48686-50362
2599 PPAK01000038.1 GCA002913085_01203 gene open 50362-52095
2600 PPAK01000038.1 GCA002913085_01204 gene open 52877-54184 fliI
2601 PPAK01000038.1 GCA002913085_01205 gene open 54181-54753 folE
2602 PPAK01000038.1 GCA002913085_01206 gene open 54891-56222 tig
2603 PPAK01000038.1 GCA002913085_01207 gene open 56222-56812 clpP
2604 PPAK01000038.1 GCA002913085_01208 gene open 56821-57843
2605 PPAK01000038.1 GCA002913085_01209 gene open 57858-58376 def
2606 PPAK01000038.1 GCA002913085_01210 gene open 58373-59878
2607 PPAK01000038.1 GCA002913085_01211 gene open 59881-61284
2608 PPAK01000038.1 GCA002913085_01212 gene open 61266-61853 purN
2609 PPAK01000038.1 GCA002913085_01213 gene open 61846-62568 terC
2610 PPAK01000038.1 GCA002913085_01225 gene open 64779-67193
2611 PPAK01000038.1 GCA002913085_01226 gene open 67177-68667 nuoN
2612 PPAK01000038.1 GCA002913085_01227 gene open 68664-70175
2613 PPAK01000038.1 GCA002913085_01228 gene open 70175-72013 nuoL
2614 PPAK01000038.1 GCA002913085_01229 gene open 72017-72319 nuoK
2615 PPAK01000038.1 GCA002913085_01230 gene open 72316-72852
2616 PPAK01000038.1 GCA002913085_01231 gene open 72876-73493 nuoI
2617 PPAK01000038.1 GCA002913085_01232 gene open 73502-74497 nuoH
2618 PPAK01000038.1 GCA002913085_01233 gene open 74490-76790
2619 PPAK01000038.1 GCA002913085_01234 gene open 76787-77497
2620 PPAK01000038.1 GCA002913085_01235 gene open 77494-77724
2621 PPAK01000038.1 GCA002913085_01236 gene open 77721-78950 nuoD
2622 PPAK01000038.1 GCA002913085_01237 gene open 78947-79711
2623 PPAK01000038.1 GCA002913085_01238 gene open 79708-80220 nuoB
2624 PPAK01000038.1 GCA002913085_01239 gene open 80202-80591
2625 PPAK01000038.1 GCA002913085_01240 gene open 80697-82331
2626 PPAK01000038.1 GCA002913085_01241 gene open 82331-83695
2627 PPAK01000038.1 GCA002913085_01242 gene open 84081-84389
2628 PPAK01000038.1 GCA002913085_01243 gene open 84410-84793
2629 PPAK01000038.1 GCA002913085_01244 gene open 84887-85678
2630 PPAK01000038.1 GCA002913085_01245 gene open 85937-86434 yajQ
2631 PPAK01000038.1 GCA002913085_01246 gene open 86451-87209
2632 PPAK01000038.1 GCA002913085_01247 gene open 87209-88144
2633 PPAK01000038.1 GCA002913085_01248 gene open 88147-89328
2634 PPAK01000038.1 GCA002913085_01249 gene open 89332-89949
2635 PPAK01000038.1 GCA002913085_01250 gene open 89946-90578
2636 PPAK01000038.1 GCA002913085_01251 gene open 90682-90894 rpsU
2637 PPAK01000038.1 GCA002913085_01252 gene open 91033-92358 ccoG
2638 PPAK01000038.1 GCA002913085_01253 gene open 92389-93015 cmeR
2639 PPAK01000038.1 GCA002913085_01254 gene open 93124-94284 cmeA
2640 PPAK01000038.1 GCA002913085_01255 gene open 94295-97420 cmeB
2641 PPAK01000038.1 GCA002913085_01256 gene open 97410-98792
2642 PPAK01000038.1 GCA002913085_01257 gene open 98814-99038
2643 PPAK01000038.1 GCA002913085_01258 gene open 99066-99785
2644 PPAK01000038.1 GCA002913085_01259 gene open 100066-100728
2645 PPAK01000038.1 GCA002913085_01260 gene open 100729-104265
2646 PPAK01000038.1 GCA002913085_01261 gene open 104290-108051
2647 PPAK01000038.1 GCA002913085_01262 gene open 108055-109395
2648 PPAK01000038.1 GCA002913085_01263 gene open 109414-109740
2649 PPAK01000038.1 GCA002913085_01264 gene open 109731-110414
2650 PPAK01000038.1 GCA002913085_01265 gene open 110418-111776
2651 PPAK01000038.1 GCA002913085_01266 gene open 111859-111966
2652 PPAK01000038.1 GCA002913085_01267 gene open 112190-113380 nifS
2653 PPAK01000038.1 GCA002913085_01268 gene open 113399-114391 nifU
2654 PPAK01000038.1 GCA002913085_01269 gene open 114420-115295 miaA
2655 PPAK01000038.1 GCA002913085_01270 gene open 115298-116512
2656 PPAK01000038.1 GCA002913085_01271 gene open 116618-117478 mqnP
2657 PPAK01000038.1 GCA002913085_01272 gene open 117475-117996
2658 PPAK01000038.1 GCA002913085_01273 gene open 118007-118513
2659 PPAK01000038.1 GCA002913085_01274 gene open 118652-119620 moaA
2660 PPAK01000038.1 GCA002913085_01275 gene open 119620-120375
2661 PPAK01000038.1 GCA002913085_01276 gene open 120375-120956
2662 PPAK01000038.1 GCA002913085_01277 gene open 120956-121159
2663 PPAK01000038.1 GCA002913085_01278 gene open 121156-121557
2664 PPAK01000038.1 GCA002913085_01279 gene open 121558-122214
2665 PPAK01000038.1 GCA002913085_01280 gene open 122298-122498 rpmE
2666 PPAK01000038.1 GCA002913085_01281 gene open 122502-123317 rsmI
2667 PPAK01000038.1 GCA002913085_01282 gene open 123429-124109 rlmB
2668 PPAK01000038.1 GCA002913085_01283 gene open 124102-125043
2669 PPAK01000038.1 GCA002913085_01284 gene open 125037-125819
2670 PPAK01000038.1 GCA002913085_01285 gene open 125829-127037
2671 PPAK01000038.1 GCA002913085_01286 gene open 127034-128296
2672 PPAK01000038.1 GCA002913085_01287 gene open 128298-128639 yraN
2673 PPAK01000038.1 GCA002913085_01288 gene open 128712-129026 trxA
2674 PPAK01000038.1 GCA002913085_01289 gene open 129026-129472 fliL
2675 PPAK01000038.1 GCA002913085_01290 gene open 129482-130420
2676 PPAK01000038.1 GCA002913085_01291 gene open 130568-131338 dapB
2677 PPAK01000038.1 GCA002913085_01292 gene open 131331-131639
2678 PPAK01000038.1 GCA002913085_01293 gene open 131649-132986 purF
2679 PPAK01000038.1 GCA002913085_01294 gene open 132983-133645
2680 PPAK01000038.1 GCA002913085_01295 gene open 133767-134318
2681 PPAK01000038.1 GCA002913085_01296 gene open 134318-134869
2682 PPAK01000038.1 GCA002913085_01297 gene open 134832-135572 hisIE
2683 PPAK01000038.1 GCA002913085_01298 gene open 135575-136693
2684 PPAK01000038.1 GCA002913085_01299 gene open 136711-137625
2685 PPAK01000038.1 GCA002913085_01300 gene open 137730-138371 dsbA
2686 PPAK01000038.1 GCA002913085_01301 gene open 138381-138878 bcp
2687 PPAK01000038.1 GCA002913085_01302 gene open 138875-139078
2688 PPAK01000038.1 GCA002913085_01303 gene open 139194-139598
2689 PPAK01000038.1 GCA002913085_01304 gene open 139595-142903
2690 PPAK01000038.1 GCA002913085_01305 gene open 143075-144607
2691 PPAK01000038.1 GCA002913085_01306 gene open 144620-145558
2692 PPAK01000038.1 GCA002913085_01307 gene open 145555-146355
2693 PPAK01000038.1 GCA002913085_01308 gene open 146352-147032
2694 PPAK01000038.1 GCA002913085_01309 gene open 147029-147778
2695 PPAK01000038.1 GCA002913085_01310 gene open 147806-148879 queH
2696 PPAK01000038.1 GCA002913085_01311 gene open 149029-149475 fabZ
2697 PPAK01000038.1 GCA002913085_01312 gene open 149496-150284 lpxA
2698 PPAK01000038.1 GCA002913085_01313 gene open 150284-151516 clpX
2699 PPAK01000038.1 GCA002913085_01314 gene open 151526-152563 mreB
2700 PPAK01000038.1 GCA002913085_01315 gene open 152553-153308 mreC
2701 PPAK01000038.1 GCA002913085_01316 gene open 153308-156568 carB
2702 PPAK01000038.1 GCA002913085_01317 gene open 156732-157172
2703 PPAK01000038.1 GCA002913085_01318 gene open 157222-157773
2704 PPAK01000038.1 GCA002913085_01319 gene open 157773-158891
2705 PPAK01000038.1 GCA002913085_01320 gene open 158893-159558
2706 PPAK01000038.1 GCA002913085_01321 gene open 159639-160322
2707 PPAK01000038.1 GCA002913085_01322 gene open 160415-161902 ccoN
2708 PPAK01000038.1 GCA002913085_01323 gene open 161902-162567 ccoO
2709 PPAK01000038.1 GCA002913085_01324 gene open 162577-162786 ccoQ
2710 PPAK01000038.1 GCA002913085_01325 gene open 162774-163637
2711 PPAK01000038.1 GCA002913085_01326 gene open 163637-163849
2712 PPAK01000038.1 GCA002913085_01327 gene open 163852-163953
2713 PPAK01000038.1 GCA002913085_01328 gene open 163908-164525
2714 PPAK01000038.1 GCA002913085_01329 gene open 164518-164988
2715 PPAK01000038.1 GCA002913085_01330 gene open 165112-165699
2716 PPAK01000038.1 GCA002913085_01331 gene open 165850-168195 addB
2717 PPAK01000038.1 GCA002913085_01332 gene open 168192-171011
2718 PPAK01000038.1 GCA002913085_01333 gene open 171092-171520 rplM
2719 PPAK01000038.1 GCA002913085_01334 gene open 171523-171912 rpsI
2720 PPAK01000038.1 GCA002913085_01335 gene open 172066-173082
2721 PPAK01000038.1 GCA002913085_01336 gene open 173157-173795
2722 PPAK01000038.1 GCA002913085_01337 gene open 174043-175179
2723 PPAK01000038.1 GCA002913085_01338 gene open 175176-176477
2724 PPAK01000038.1 GCA002913085_01339 gene open 176591-177235
2725 PPAK01000038.1 GCA002913085_01340 gene open 177337-178413
2726 PPAK01000038.1 GCA002913085_01341 gene open 178410-178874
2727 PPAK01000038.1 GCA002913085_01342 gene open 178981-179703
2728 PPAK01000038.1 GCA002913085_01343 gene open 179797-181011
2729 PPAK01000038.1 GCA002913085_01344 gene open 181127-181237
2730 PPAK01000038.1 GCA002913085_01345 gene open 181535-182701
2731 PPAK01000038.1 GCA002913085_01346 gene open 183171-183716
2732 PPAK01000038.1 GCA002913085_01347 gene open 183828-184934 nnrS
2733 PPAK01000038.1 GCA002913085_01348 gene open 184927-185616
2734 PPAK01000038.1 GCA002913085_01349 gene open 185616-186413
2735 PPAK01000038.1 GCA002913085_01350 gene open 186410-187375
2736 PPAK01000038.1 GCA002913085_01351 gene open 187387-189237
2737 PPAK01000038.1 GCA002913085_01352 gene open 189477-189938
2738 PPAK01000038.1 GCA002913085_01353 gene open 189950-190384
2739 PPAK01000038.1 GCA002913085_01354 gene open 190386-190607
2740 PPAK01000038.1 GCA002913085_01355 gene open 190691-191830 nspC
2741 PPAK01000038.1 GCA002913085_01356 gene open 192593-193540
2742 PPAK01000038.1 GCA002913085_01357 gene open 193691-194290 yedF
2743 PPAK01000038.1 GCA002913085_01358 gene open 194497-195309
2744 PPAK01000038.1 GCA002913085_01359 gene open 195403-196032
2745 PPAK01000038.1 GCA002913085_01360 gene open 196178-200269
2746 PPAK01000038.1 GCA002913085_01361 gene open 200269-201135
2747 PPAK01000038.1 GCA002913085_01362 gene open 201138-202388 purA
2748 PPAK01000038.1 GCA002913085_01363 gene open 202385-202807 fliJ
2749 PPAK01000038.1 GCA002913085_01364 gene open 202807-203370 mgtE
2750 PPAK01000038.1 GCA002913085_01365 gene open 203491-204492 terC
2751 PPAK01000038.1 GCA002913085_01366 gene open 204510-205709
2752 PPAK01000038.1 GCA002913085_01367 gene open 205843-206901 yedE
2753 PPAK01000038.1 GCA002913085_01368 gene open 206931-207296
2754 PPAK01000038.1 GCA002913085_01369 gene open 207433-208263 surA
2755 PPAK01000038.1 GCA002913085_01370 gene open 208334-209713 gltX
2756 PPAK01000038.1 GCA002913085_01371 gene open 209710-210963
2757 PPAK01000038.1 GCA002913085_01372 gene open 211048-211674 upp
2758 PPAK01000038.1 GCA002913085_01373 gene open 211684-212190
2759 PPAK01000038.1 GCA002913085_01374 gene open 212187-212459
2760 PPAK01000038.1 GCA002913085_01375 gene open 212456-213136
2761 PPAK01000038.1 GCA002913085_01376 gene open 213181-213786
2762 PPAK01000038.1 GCA002913085_01377 gene open 213918-214631
2763 PPAK01000038.1 GCA002913085_01378 gene open 214624-216297
2764 PPAK01000038.1 GCA002913085_01379 gene open 216452-217777 selA
2765 PPAK01000038.1 GCA002913085_01380 gene open 217774-219594 selB
2766 PPAK01000038.1 GCA002913085_01381 gene open 219648-220388
2767 PPAK01000038.1 GCA002913085_01382 gene open 220691-220897
2768 PPAK01000038.1 GCA002913085_01383 gene open 220909-221442
2769 PPAK01000038.1 GCA002913085_01384 gene open 221464-223884
2770 PPAK01000038.1 GCA002913085_01385 gene open 223896-224456 fdh3B
2771 PPAK01000038.1 GCA002913085_01386 gene open 224725-226665
2772 PPAK01000038.1 GCA002913085_01387 gene open 226686-227207
2773 PPAK01000038.1 GCA002913085_01388 gene open 227258-228637
2774 PPAK01000038.1 GCA002913085_01389 gene open 228634-229926
2775 PPAK01000038.1 GCA002913085_01390 gene open 229913-231055 ftsX
2776 PPAK01000038.1 GCA002913085_01391 gene open 231057-231746
2777 PPAK01000038.1 GCA002913085_01392 gene open 231736-232230
2778 PPAK01000038.1 GCA002913085_01393 gene open 232239-232817
2779 PPAK01000038.1 GCA002913085_01394 gene open 232847-234094
2780 PPAK01000038.1 GCA002913085_01395 gene open 234139-236511
2781 PPAK01000038.1 GCA002913085_01396 gene open 236511-237755 serS
2782 PPAK01000038.1 GCA002913085_01397 gene open 237765-238205 copD
2783 PPAK01000038.1 GCA002913085_01398 gene open 238219-239181 trpS
2784 PPAK01000038.1 GCA002913085_01399 gene open 239574-240095
2785 PPAK01000038.1 GCA002913085_01400 gene open 240079-241464 der
2786 PPAK01000038.1 GCA002913085_01401 gene open 241617-242507 eamA
2787 PPAK01000038.1 GCA002913085_01402 gene open 242517-243566
2788 PPAK01000038.1 GCA002913085_01403 gene open 243577-244383 kdsA
2789 PPAK01000038.1 GCA002913085_01404 gene open 244373-244702 emrE
2790 PPAK01000038.1 GCA002913085_01405 gene open 244699-245022
2791 PPAK01000038.1 GCA002913085_01406 gene open 245033-245503 ribH
2792 PPAK01000038.1 GCA002913085_01407 gene open 245505-245900 nusB
2793 PPAK01000038.1 GCA002913085_01408 gene open 245897-246577 pyrF
2794 PPAK01000038.1 GCA002913085_01159 gene open 9870-9945 trnV
2795 PPAK01000038.1 GCA002913085_01198 gene open 45989-46063 trnE
2796 PPAK01000038.1 GCA002913085_01214 gene open 62996-63073 trnP
2797 PPAK01000038.1 GCA002913085_01215 gene open 63083-63159 trnH
2798 PPAK01000038.1 GCA002913085_01216 gene open 63166-63242 trnR
2799 PPAK01000038.1 GCA002913085_01217 gene open 63258-63334 trnR
2800 PPAK01000038.1 GCA002913085_01218 gene open 63350-63434 trnL
2801 PPAK01000038.1 GCA002913085_01219 gene open 63574-63649 trnK
2802 PPAK01000038.1 GCA002913085_01220 gene open 63663-63738 trnE
2803 PPAK01000038.1 GCA002913085_01221 gene open 63757-63832 trnV
2804 PPAK01000038.1 GCA002913085_01222 gene open 63841-63917 trnD
2805 PPAK01000038.1 GCA002913085_01223 gene open 64039-64114 trnK
2806 PPAK01000038.1 GCA002913085_01224 gene open 64123-64197 trnE
2807 PPAK01000038.1 GCA002913085_01409 gene open 247049-247139 trnS
2808 PPAK01000038.1 GCA002913085_01159 tRNA open 9870-9945 trnV tRNA-Val(gac)
2809 PPAK01000038.1 GCA002913085_01198 tRNA open 45989-46063 trnE tRNA-Glu(ttc)
2810 PPAK01000038.1 GCA002913085_01214 tRNA open 62996-63073 trnP tRNA-Pro(tgg)
2811 PPAK01000038.1 GCA002913085_01215 tRNA open 63083-63159 trnH tRNA-His(gtg)
2812 PPAK01000038.1 GCA002913085_01216 tRNA open 63166-63242 trnR tRNA-Arg(tcg)
2813 PPAK01000038.1 GCA002913085_01217 tRNA open 63258-63334 trnR tRNA-Arg(tct)
2814 PPAK01000038.1 GCA002913085_01218 tRNA open 63350-63434 trnL tRNA-Leu(tag)
2815 PPAK01000038.1 GCA002913085_01219 tRNA open 63574-63649 trnK tRNA-Lys(ttt)
2816 PPAK01000038.1 GCA002913085_01220 tRNA open 63663-63738 trnE tRNA-Glu(ctc)
2817 PPAK01000038.1 GCA002913085_01221 tRNA open 63757-63832 trnV tRNA-Val(tac)
2818 PPAK01000038.1 GCA002913085_01222 tRNA open 63841-63917 trnD tRNA-Asp(gtc)
2819 PPAK01000038.1 GCA002913085_01223 tRNA open 64039-64114 trnK tRNA-Lys(ctt)
2820 PPAK01000038.1 GCA002913085_01224 tRNA open 64123-64197 trnE tRNA-Glu(ctc)
2821 PPAK01000038.1 GCA002913085_01409 tRNA open 247049-247139 trnS tRNA-Ser(gct)
2822 PPAK01000039.1 GCA002913085_01410 CDS open 880-1353 _na     157_aa hypothetical protein
2823 PPAK01000039.1 GCA002913085_01410 gene open 880-1353
2824 PPAK01000040.1 repeat_region open 23355-24802 CRISPR array with 20 repeats of length 21%2C consensus sequence ATTTAAACAAATTTGACCCGA and spacer length 53
2825 PPAK01000040.1 repeat_region open 31743-32050 CRISPR array with 4 repeats of length 38%2C consensus sequence ATTTAAACAAATTTGACCCGATCAAGGGGATTGAAACA and spacer length 38
2826 PPAK01000040.1 GCA002913085_01411 CDS open 232-321 _na     29_aa hypothetical protein
2827 PPAK01000040.1 GCA002913085_01412 CDS open 350-793 _na     147_aa DUF2809 domain-containing protein
2828 PPAK01000040.1 GCA002913085_01413 CDS open 869-3505 _na     878_aa polA DNA polymerase I
2829 PPAK01000040.1 GCA002913085_01414 CDS open 3625-4668 _na     347_aa Glycosyltransferase%2C family 1
2830 PPAK01000040.1 GCA002913085_01415 CDS open 4665-5609 _na     314_aa waaF lipopolysaccharide heptosyltransferase II
2831 PPAK01000040.1 GCA002913085_01416 CDS open 5748-6176 _na     142_aa exbB TonB-system energizer ExbB
2832 PPAK01000040.1 GCA002913085_01417 CDS open 6163-6546 _na     127_aa exbD TonB system transport protein ExbD
2833 PPAK01000040.1 GCA002913085_01418 CDS open 6521-7297 _na     258_aa tonB Energy transduction protein TonB
2834 PPAK01000040.1 GCA002913085_01420 CDS open 7768-8073 _na     101_aa hypothetical protein
2835 PPAK01000040.1 GCA002913085_01421 CDS open 8073-9506 _na     477_aa relaxase/mobilization nuclease domain-containing protein
2836 PPAK01000040.1 GCA002913085_01422 CDS open 9508-9816 _na     102_aa plasmid mobilization protein
2837 PPAK01000040.1 GCA002913085_01423 CDS open 9821-10018 _na     65_aa helix-turn-helix domain-containing protein
2838 PPAK01000040.1 GCA002913085_01424 CDS open 10115-10852 _na     245_aa hypothetical protein
2839 PPAK01000040.1 GCA002913085_01425 CDS open 10842-11984 _na     380_aa Site-specific integrase
2840 PPAK01000040.1 GCA002913085_01426 CDS open 11988-13202 _na     404_aa AAA+ ATPase domain-containing protein
2841 PPAK01000040.1 GCA002913085_01427 CDS open 13297-14337 _na     346_aa RAMP superfamily CRISPR-associated protein
2842 PPAK01000040.1 GCA002913085_01428 CDS open 14330-15214 _na     294_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
2843 PPAK01000040.1 GCA002913085_01429 CDS open 15214-15852 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
2844 PPAK01000040.1 GCA002913085_01430 CDS open 15862-16269 _na     135_aa CRISPR system Cms protein Csm2
2845 PPAK01000040.1 GCA002913085_01431 CDS open 16266-17774 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
2846 PPAK01000040.1 GCA002913085_01432 CDS open 17761-18597 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
2847 PPAK01000040.1 GCA002913085_01433 CDS open 18594-18986 _na     130_aa csx20 CRISPR-associated protein Csx20
2848 PPAK01000040.1 GCA002913085_01434 CDS open 19167-20399 _na     410_aa csx2 TIGR02221 family CRISPR-associated protein
2849 PPAK01000040.1 GCA002913085_01435 CDS open 20401-22635 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
2850 PPAK01000040.1 GCA002913085_01436 CDS open 22635-22910 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
2851 PPAK01000040.1 GCA002913085_01437 CDS open 25208-25441 _na     77_aa hypothetical protein
2852 PPAK01000040.1 GCA002913085_01438 CDS open 25446-25586 _na     46_aa hypothetical protein
2853 PPAK01000040.1 GCA002913085_01439 CDS open 25612-25839 _na     75_aa hypothetical protein
2854 PPAK01000040.1 GCA002913085_01440 CDS open 25859-26320 _na     153_aa hypothetical protein
2855 PPAK01000040.1 GCA002913085_01441 CDS open 26570-26683 _na     37_aa hypothetical protein
2856 PPAK01000040.1 GCA002913085_01442 CDS open 26685-26786 _na     33_aa hypothetical protein
2857 PPAK01000040.1 GCA002913085_01443 CDS open 27006-27968 _na     320_aa WYL domain-containing protein
2858 PPAK01000040.1 GCA002913085_01444 CDS open 27969-28652 _na     227_aa Macro domain-containing protein
2859 PPAK01000040.1 GCA002913085_01445 CDS open 28661-29281 _na     206_aa DUF4433 domain-containing protein
2860 PPAK01000040.1 GCA002913085_01446 CDS open 29351-30673 _na     440_aa CRISPR-associated DxTHG motif protein
2861 PPAK01000040.1 GCA002913085_01447 CDS open 30770-31144 _na     124_aa csx20 CRISPR-associated protein Csx20
2862 PPAK01000040.1 GCA002913085_01411 gene open 232-321
2863 PPAK01000040.1 GCA002913085_01412 gene open 350-793
2864 PPAK01000040.1 GCA002913085_01413 gene open 869-3505 polA
2865 PPAK01000040.1 GCA002913085_01414 gene open 3625-4668
2866 PPAK01000040.1 GCA002913085_01415 gene open 4665-5609 waaF
2867 PPAK01000040.1 GCA002913085_01416 gene open 5748-6176 exbB
2868 PPAK01000040.1 GCA002913085_01417 gene open 6163-6546 exbD
2869 PPAK01000040.1 GCA002913085_01418 gene open 6521-7297 tonB
2870 PPAK01000040.1 GCA002913085_01420 gene open 7768-8073
2871 PPAK01000040.1 GCA002913085_01421 gene open 8073-9506
2872 PPAK01000040.1 GCA002913085_01422 gene open 9508-9816
2873 PPAK01000040.1 GCA002913085_01423 gene open 9821-10018
2874 PPAK01000040.1 GCA002913085_01424 gene open 10115-10852
2875 PPAK01000040.1 GCA002913085_01425 gene open 10842-11984
2876 PPAK01000040.1 GCA002913085_01426 gene open 11988-13202
2877 PPAK01000040.1 GCA002913085_01427 gene open 13297-14337
2878 PPAK01000040.1 GCA002913085_01428 gene open 14330-15214 csm4
2879 PPAK01000040.1 GCA002913085_01429 gene open 15214-15852 csm3
2880 PPAK01000040.1 GCA002913085_01430 gene open 15862-16269
2881 PPAK01000040.1 GCA002913085_01431 gene open 16266-17774 cas10
2882 PPAK01000040.1 GCA002913085_01432 gene open 17761-18597
2883 PPAK01000040.1 GCA002913085_01433 gene open 18594-18986 csx20
2884 PPAK01000040.1 GCA002913085_01434 gene open 19167-20399 csx2
2885 PPAK01000040.1 GCA002913085_01435 gene open 20401-22635 cas1
2886 PPAK01000040.1 GCA002913085_01436 gene open 22635-22910 cas2
2887 PPAK01000040.1 GCA002913085_01437 gene open 25208-25441
2888 PPAK01000040.1 GCA002913085_01438 gene open 25446-25586
2889 PPAK01000040.1 GCA002913085_01439 gene open 25612-25839
2890 PPAK01000040.1 GCA002913085_01440 gene open 25859-26320
2891 PPAK01000040.1 GCA002913085_01441 gene open 26570-26683
2892 PPAK01000040.1 GCA002913085_01442 gene open 26685-26786
2893 PPAK01000040.1 GCA002913085_01443 gene open 27006-27968
2894 PPAK01000040.1 GCA002913085_01444 gene open 27969-28652
2895 PPAK01000040.1 GCA002913085_01445 gene open 28661-29281
2896 PPAK01000040.1 GCA002913085_01446 gene open 29351-30673
2897 PPAK01000040.1 GCA002913085_01447 gene open 30770-31144 csx20
2898 PPAK01000040.1 GCA002913085_01419 gene open 7460-7535 trnF
2899 PPAK01000040.1 GCA002913085_01419 tRNA open 7460-7535 trnF tRNA-Phe(gaa)
2900 PPAK01000041.1 GCA002913085_01448 CDS open 539-727 _na     62_aa TrbC/VirB2 family protein
2901 PPAK01000041.1 GCA002913085_01448 gene open 539-727
2902 PPAK01000044.1 GCA002913085_01449 CDS open 278-3118 _na     946_aa Gp5/Type VI secretion system Vgr protein OB-fold domain-containing protein
2903 PPAK01000044.1 GCA002913085_01450 CDS open 3118-3669 _na     183_aa hypothetical protein
2904 PPAK01000044.1 GCA002913085_01451 CDS open 3666-4220 _na     184_aa Ankyrin repeat domain-containing protein
2905 PPAK01000044.1 GCA002913085_01452 CDS open 4334-4855 _na     173_aa Hcp family type VI secretion system effector
2906 PPAK01000044.1 GCA002913085_01453 CDS open 4921-5841 _na     306_aa Type VI secretion system protein
2907 PPAK01000044.1 GCA002913085_01454 CDS open 5851-9339 _na     1162_aa tssM type VI secretion system membrane subunit TssM
2908 PPAK01000044.1 GCA002913085_01449 gene open 278-3118
2909 PPAK01000044.1 GCA002913085_01450 gene open 3118-3669
2910 PPAK01000044.1 GCA002913085_01451 gene open 3666-4220
2911 PPAK01000044.1 GCA002913085_01452 gene open 4334-4855
2912 PPAK01000044.1 GCA002913085_01453 gene open 4921-5841
2913 PPAK01000044.1 GCA002913085_01454 gene open 5851-9339 tssM
2914 PPAK01000047.1 GCA002913085_01455 CDS open 285-806 _na     173_aa Prophage CP4-57 integrase
2915 PPAK01000047.1 GCA002913085_01455 gene open 285-806
2916 PPAK01000048.1 GCA002913085_01456 CDS open 300-800 _na     166_aa Lytic transglycosylase domain-containing protein
2917 PPAK01000048.1 GCA002913085_01457 CDS open 797-1801 _na     334_aa Toprim domain-containing protein
2918 PPAK01000048.1 GCA002913085_01458 CDS open 1798-1980 _na     60_aa copG CopG family transcriptional regulator
2919 PPAK01000048.1 GCA002913085_01456 gene open 300-800
2920 PPAK01000048.1 GCA002913085_01457 gene open 797-1801
2921 PPAK01000048.1 GCA002913085_01458 gene open 1798-1980 copG
2922 PPAK01000049.1 GCA002913085_01459 CDS open 317-553 _na     78_aa DNA-binding protein
2923 PPAK01000049.1 GCA002913085_01459 gene open 317-553
2924 PPAK01000050.1 GCA002913085_01460 CDS open 394-930 _na     178_aa replication protein
2925 PPAK01000050.1 GCA002913085_01460 gene open 394-930
2926 PPAK01000051.1 GCA002913085_01461 CDS open 16-450 _na     144_aa hypothetical protein
2927 PPAK01000051.1 GCA002913085_01461 gene open 16-450
2928 PPAK01000052.1 GCA002913085_01462 CDS open 358-582 _na     74_aa hypothetical protein
2929 PPAK01000052.1 GCA002913085_01463 CDS open 956-1774 _na     272_aa fabI enoyl-ACP reductase FabI
2930 PPAK01000052.1 GCA002913085_01464 CDS open 2080-2760 _na     226_aa triose-phosphate isomerase
2931 PPAK01000052.1 GCA002913085_01465 CDS open 2757-3959 _na     400_aa Phosphoglycerate kinase
2932 PPAK01000052.1 GCA002913085_01466 CDS open 3976-4974 _na     332_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2933 PPAK01000052.1 GCA002913085_01467 CDS open 5054-5935 _na     293_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
2934 PPAK01000052.1 GCA002913085_01468 CDS open 5919-6902 _na     327_aa madM Malonate/sodium symporter MadM subunit N-terminal domain-containing protein
2935 PPAK01000052.1 GCA002913085_01469 CDS open 7006-7941 _na     311_aa Sugar transferase
2936 PPAK01000052.1 GCA002913085_01470 CDS open 7947-8690 _na     247_aa glycosyltransferase family 2 protein
2937 PPAK01000052.1 GCA002913085_01471 CDS open 8687-10345 _na     552_aa Sulfatase N-terminal domain-containing protein
2938 PPAK01000052.1 GCA002913085_01472 CDS open 10320-11429 _na     369_aa Glycosyltransferase
2939 PPAK01000052.1 GCA002913085_01473 CDS open 11419-13338 _na     639_aa asnB asparagine synthase (glutamine-hydrolyzing)
2940 PPAK01000052.1 GCA002913085_01474 CDS open 13340-14803 _na     487_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2941 PPAK01000052.1 GCA002913085_01475 CDS open 14803-16251 _na     482_aa Capsule polysaccharide biosynthesis protein
2942 PPAK01000052.1 GCA002913085_01476 CDS open 16244-17347 _na     367_aa hypothetical protein
2943 PPAK01000052.1 GCA002913085_01477 CDS open 17334-18080 _na     248_aa RIO1 family regulatory kinase/ATPase
2944 PPAK01000052.1 GCA002913085_01478 CDS open 18115-19077 _na     320_aa Acyltransferase 3 domain-containing protein
2945 PPAK01000052.1 GCA002913085_01479 CDS open 19070-20248 _na     392_aa glycosyltransferase family 4 protein
2946 PPAK01000052.1 GCA002913085_01480 CDS open 20245-21345 _na     366_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
2947 PPAK01000052.1 GCA002913085_01481 CDS open 21348-22403 _na     351_aa GNAT family N-acetyltransferase
2948 PPAK01000052.1 GCA002913085_01482 CDS open 22400-23170 _na     256_aa oxidoreductase
2949 PPAK01000052.1 GCA002913085_01483 CDS open 23197-24504 _na     435_aa glutamate-1-semialdehyde 2%2C1-aminomutase
2950 PPAK01000052.1 GCA002913085_01484 CDS open 24528-26234 _na     568_aa NTP transferase domain-containing protein
2951 PPAK01000052.1 GCA002913085_01485 CDS open 26237-27157 _na     306_aa Gfo/Idh/MocA family oxidoreductase
2952 PPAK01000052.1 GCA002913085_01486 CDS open 27154-28212 _na     352_aa N-acetylneuraminate synthase
2953 PPAK01000052.1 GCA002913085_01487 CDS open 28190-29107 _na     305_aa Glycosyltransferase 2-like domain-containing protein
2954 PPAK01000052.1 GCA002913085_01488 CDS open 29104-29763 _na     219_aa PIG-L family deacetylase
2955 PPAK01000052.1 GCA002913085_01489 CDS open 29764-30963 _na     399_aa GNAT family N-acetyltransferase
2956 PPAK01000052.1 GCA002913085_01490 CDS open 30960-31961 _na     333_aa neuB N-acetylneuraminate synthase
2957 PPAK01000052.1 GCA002913085_01491 CDS open 31986-32597 _na     203_aa Acetyltransferase
2958 PPAK01000052.1 GCA002913085_01492 CDS open 32600-33751 _na     383_aa Aminotransferase%2C DegT/DnrJ/EryC1/StrS family
2959 PPAK01000052.1 GCA002913085_01493 CDS open 33738-34925 _na     395_aa UDP-N-acetylglucosamine 4%2C6-dehydratase
2960 PPAK01000052.1 GCA002913085_01494 CDS open 34925-35191 _na     88_aa hypothetical protein
2961 PPAK01000052.1 GCA002913085_01495 CDS open 35188-35655 _na     155_aa Class I SAM-dependent methyltransferase
2962 PPAK01000052.1 GCA002913085_01496 CDS open 35657-37240 _na     527_aa argS arginine--tRNA ligase
2963 PPAK01000052.1 GCA002913085_01497 CDS open 37250-37471 _na     73_aa tatA Sec-independent protein translocase protein TatA
2964 PPAK01000052.1 GCA002913085_01498 CDS open 37522-38133 _na     203_aa gmk guanylate kinase
2965 PPAK01000052.1 GCA002913085_01499 CDS open 38134-39576 _na     480_aa Highly acidic protein
2966 PPAK01000052.1 GCA002913085_01500 CDS open 39634-40395 _na     253_aa fliR flagellar biosynthetic protein FliR
2967 PPAK01000052.1 GCA002913085_01501 CDS open 40400-41863 _na     487_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
2968 PPAK01000052.1 GCA002913085_01502 CDS open 41943-43007 _na     354_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
2969 PPAK01000052.1 GCA002913085_01503 CDS open 43016-44233 _na     405_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
2970 PPAK01000052.1 GCA002913085_01504 CDS open 44379-47939 _na     1186_aa Lytic enzyme
2971 PPAK01000052.1 GCA002913085_01505 CDS open 47932-48288 _na     118_aa Periplasmic protein
2972 PPAK01000052.1 GCA002913085_01506 CDS open 48379-48561 _na     60_aa Transposase
2973 PPAK01000052.1 GCA002913085_01507 CDS open 49815-50711 _na     298_aa hypothetical protein
2974 PPAK01000052.1 GCA002913085_01508 CDS open 50723-51520 _na     265_aa hypothetical protein
2975 PPAK01000052.1 GCA002913085_01509 CDS open 51504-51983 _na     159_aa hypothetical protein
2976 PPAK01000052.1 GCA002913085_01510 CDS open 51986-52282 _na     98_aa hypothetical protein
2977 PPAK01000052.1 GCA002913085_01511 CDS open 52254-52811 _na     185_aa Lipoprotein
2978 PPAK01000052.1 GCA002913085_01512 CDS open 53328-54359 _na     343_aa Putative polysaccharide biosynthesis protein
2979 PPAK01000052.1 GCA002913085_01513 CDS open 54423-55397 _na     324_aa waaC lipopolysaccharide heptosyltransferase I
2980 PPAK01000052.1 GCA002913085_01514 CDS open 55390-56283 _na     297_aa lipid A biosynthesis lauroyl acyltransferase
2981 PPAK01000052.1 GCA002913085_01515 CDS open 56277-56981 _na     234_aa Glycosyltransferase 2-like domain-containing protein
2982 PPAK01000052.1 GCA002913085_01516 CDS open 56978-58039 _na     353_aa rfaQ putative lipopolysaccharide heptosyltransferase III
2983 PPAK01000052.1 GCA002913085_01517 CDS open 58044-59117 _na     357_aa Glycosyltransferase%2C family 1
2984 PPAK01000052.1 GCA002913085_01518 CDS open 59114-59911 _na     265_aa NodB-like y domain-containing protein
2985 PPAK01000052.1 GCA002913085_01519 CDS open 59911-60051 _na     46_aa UDP-N-acetylglucosamine kinase
2986 PPAK01000052.1 GCA002913085_01520 CDS open 60171-60473 _na     100_aa Phosphoribulokinase/uridine kinase domain-containing protein
2987 PPAK01000052.1 GCA002913085_01521 CDS open 60433-61218 _na     261_aa Beta-1%2C4-galactosyltransferase
2988 PPAK01000052.1 GCA002913085_01522 CDS open 61228-61998 _na     256_aa NodB-like y domain-containing protein
2989 PPAK01000052.1 GCA002913085_01523 CDS open 61995-63044 _na     349_aa Glycosyltransferase
2990 PPAK01000052.1 GCA002913085_01524 CDS open 63048-64076 _na     342_aa Glycosyltransferase 2-like domain-containing protein
2991 PPAK01000052.1 GCA002913085_01525 CDS open 64163-65335 _na     390_aa O-antigen ligase-related domain-containing protein
2992 PPAK01000052.1 GCA002913085_01526 CDS open 65394-68222 _na     942_aa uvrA excinuclease ABC subunit UvrA
2993 PPAK01000052.1 GCA002913085_01527 CDS open 68397-68681 _na     94_aa 4Fe-4S binding protein
2994 PPAK01000052.1 GCA002913085_01528 CDS open 68784-69197 _na     137_aa ndk nucleoside-diphosphate kinase
2995 PPAK01000052.1 GCA002913085_01529 CDS open 69214-69573 _na     119_aa DNA-binding protein
2996 PPAK01000052.1 GCA002913085_01530 CDS open 69586-69732 _na     48_aa rpmF 50S ribosomal protein L32
2997 PPAK01000052.1 GCA002913085_01531 CDS open 69736-70725 _na     329_aa plsX phosphate acyltransferase PlsX
2998 PPAK01000052.1 GCA002913085_01532 CDS open 70729-71736 _na     335_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
2999 PPAK01000052.1 GCA002913085_01462 gene open 358-582
3000 PPAK01000052.1 GCA002913085_01463 gene open 956-1774 fabI