HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_002913155.1)

Select a Genome:
BAKTA Annotations for GCA_002913155.1
Genome Selected: Campylobacter concisus clade-575
ContigsBases CDSrRNA tmRNAtRNA
62 1744650 1730 3 1 38
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3554 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3554 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 PPAV01000001.1 GCA002913155_00001 CDS open 175-1857 _na     560_aa AAA family ATPase
2 PPAV01000001.1 GCA002913155_00002 CDS open 2210-2500 _na     96_aa hypothetical protein
3 PPAV01000001.1 GCA002913155_00003 CDS open 2525-2749 _na     74_aa hypothetical protein
4 PPAV01000001.1 GCA002913155_00004 CDS open 2759-3184 _na     141_aa yopX YopX protein domain-containing protein
5 PPAV01000001.1 GCA002913155_00005 CDS open 3165-3566 _na     133_aa yopX YopX family protein
6 PPAV01000001.1 GCA002913155_00006 CDS open 3567-3773 _na     68_aa hypothetical protein
7 PPAV01000001.1 GCA002913155_00007 CDS open 3799-4476 _na     225_aa hypothetical protein
8 PPAV01000001.1 GCA002913155_00008 CDS open 4660-4941 _na     93_aa Phage protein
9 PPAV01000001.1 GCA002913155_00009 CDS open 4954-5196 _na     80_aa hypothetical protein
10 PPAV01000001.1 GCA002913155_00010 CDS open 5209-6813 _na     534_aa DUF4942 domain-containing protein
11 PPAV01000001.1 GCA002913155_00011 CDS open 6828-7298 _na     156_aa hypothetical protein
12 PPAV01000001.1 GCA002913155_00012 CDS open 7265-7471 _na     68_aa hypothetical protein
13 PPAV01000001.1 GCA002913155_00001 gene open 175-1857
14 PPAV01000001.1 GCA002913155_00002 gene open 2210-2500
15 PPAV01000001.1 GCA002913155_00003 gene open 2525-2749
16 PPAV01000001.1 GCA002913155_00004 gene open 2759-3184 yopX
17 PPAV01000001.1 GCA002913155_00005 gene open 3165-3566 yopX
18 PPAV01000001.1 GCA002913155_00006 gene open 3567-3773
19 PPAV01000001.1 GCA002913155_00007 gene open 3799-4476
20 PPAV01000001.1 GCA002913155_00008 gene open 4660-4941
21 PPAV01000001.1 GCA002913155_00009 gene open 4954-5196
22 PPAV01000001.1 GCA002913155_00010 gene open 5209-6813
23 PPAV01000001.1 GCA002913155_00011 gene open 6828-7298
24 PPAV01000001.1 GCA002913155_00012 gene open 7265-7471
25 PPAV01000002.1 GCA002913155_00013 CDS open 42-2870 _na     942_aa uvrA excinuclease ABC subunit UvrA
26 PPAV01000002.1 GCA002913155_00014 CDS open 2929-4101 _na     390_aa O-antigen ligase-related domain-containing protein
27 PPAV01000002.1 GCA002913155_00015 CDS open 4189-5217 _na     342_aa Glycosyltransferase 2-like domain-containing protein
28 PPAV01000002.1 GCA002913155_00016 CDS open 5221-6270 _na     349_aa Glycosyltransferase
29 PPAV01000002.1 GCA002913155_00017 CDS open 6267-7025 _na     252_aa Xylanase
30 PPAV01000002.1 GCA002913155_00018 CDS open 7034-7819 _na     261_aa Beta-1%2C4-galactosyltransferase
31 PPAV01000002.1 GCA002913155_00019 CDS open 7812-8318 _na     168_aa AAA domain protein
32 PPAV01000002.1 GCA002913155_00020 CDS open 8318-9115 _na     265_aa NodB-like y domain-containing protein
33 PPAV01000002.1 GCA002913155_00021 CDS open 9112-10185 _na     357_aa Glycosyltransferase%2C family 1
34 PPAV01000002.1 GCA002913155_00022 CDS open 10190-11251 _na     353_aa rfaQ putative lipopolysaccharide heptosyltransferase III
35 PPAV01000002.1 GCA002913155_00023 CDS open 11248-11952 _na     234_aa Glycosyltransferase 2-like domain-containing protein
36 PPAV01000002.1 GCA002913155_00024 CDS open 11946-12839 _na     297_aa lipid A biosynthesis lauroyl acyltransferase
37 PPAV01000002.1 GCA002913155_00025 CDS open 12832-13806 _na     324_aa waaC lipopolysaccharide heptosyltransferase I
38 PPAV01000002.1 GCA002913155_00026 CDS open 13870-14901 _na     343_aa Putative polysaccharide biosynthesis protein
39 PPAV01000002.1 GCA002913155_00013 gene open 42-2870 uvrA
40 PPAV01000002.1 GCA002913155_00014 gene open 2929-4101
41 PPAV01000002.1 GCA002913155_00015 gene open 4189-5217
42 PPAV01000002.1 GCA002913155_00016 gene open 5221-6270
43 PPAV01000002.1 GCA002913155_00017 gene open 6267-7025
44 PPAV01000002.1 GCA002913155_00018 gene open 7034-7819
45 PPAV01000002.1 GCA002913155_00019 gene open 7812-8318
46 PPAV01000002.1 GCA002913155_00020 gene open 8318-9115
47 PPAV01000002.1 GCA002913155_00021 gene open 9112-10185
48 PPAV01000002.1 GCA002913155_00022 gene open 10190-11251 rfaQ
49 PPAV01000002.1 GCA002913155_00023 gene open 11248-11952
50 PPAV01000002.1 GCA002913155_00024 gene open 11946-12839
51 PPAV01000002.1 GCA002913155_00025 gene open 12832-13806 waaC
52 PPAV01000002.1 GCA002913155_00026 gene open 13870-14901
53 PPAV01000003.1 GCA002913155_00027 CDS open 126-425 _na     99_aa hypothetical protein
54 PPAV01000003.1 GCA002913155_00027 gene open 126-425
55 PPAV01000004.1 GCA002913155_00028 CDS open 295-1287 _na     330_aa dctP TRAP dicarboxylate transporter DctPQM%2C solute-binding protein DctP
56 PPAV01000004.1 GCA002913155_00029 CDS open 1287-1829 _na     180_aa dctQ TRAP dicarboxylate transporter DctPQM%2C permease subunit DctQ
57 PPAV01000004.1 GCA002913155_00030 CDS open 1841-3124 _na     427_aa dctM TRAP dicarboxylate transporter DctPQM%2C permease subunit DctM
58 PPAV01000004.1 GCA002913155_00031 CDS open 3150-4202 _na     350_aa GGDEF domain-containing protein
59 PPAV01000004.1 GCA002913155_00032 CDS open 4195-5274 _na     359_aa Diguanylate cyclase
60 PPAV01000004.1 GCA002913155_00033 CDS open 5321-5479 _na     52_aa Highly acidic protein
61 PPAV01000004.1 GCA002913155_00034 CDS open 5490-7334 _na     614_aa Mechanosensitive ion channel family protein
62 PPAV01000004.1 GCA002913155_00035 CDS open 7327-7971 _na     214_aa Carbonic anhydrase
63 PPAV01000004.1 GCA002913155_00036 CDS open 8142-8840 _na     232_aa BAX inhibitor (BI)-1 like protein (UPF0005 domain)
64 PPAV01000004.1 GCA002913155_00037 CDS open 8833-9216 _na     127_aa thiD2 ThiD2 domain-containing protein
65 PPAV01000004.1 GCA002913155_00038 CDS open 9283-9612 _na     109_aa secG preprotein translocase subunit SecG
66 PPAV01000004.1 GCA002913155_00039 CDS open 9615-10574 _na     319_aa NodB-like y domain-containing protein
67 PPAV01000004.1 GCA002913155_00040 CDS open 10564-11121 _na     185_aa frr ribosome recycling factor
68 PPAV01000004.1 GCA002913155_00041 CDS open 11637-11798 _na     53_aa hypothetical protein
69 PPAV01000004.1 GCA002913155_00042 CDS open 12097-12504 _na     135_aa vapC type II toxin-antitoxin system VapC family toxin
70 PPAV01000004.1 GCA002913155_00043 CDS open 12504-12755 _na     83_aa hypothetical protein
71 PPAV01000004.1 GCA002913155_00044 CDS open 13952-14908 _na     318_aa DUF3644 domain-containing protein
72 PPAV01000004.1 GCA002913155_00045 CDS open 15703-17121 _na     472_aa Mobilization protein
73 PPAV01000004.1 GCA002913155_00046 CDS open 17959-18921 _na     320_aa ABC transporter substrate-binding protein
74 PPAV01000004.1 GCA002913155_00047 CDS open 18954-20003 _na     349_aa ABC transporter substrate-binding protein
75 PPAV01000004.1 GCA002913155_00048 CDS open 19996-20997 _na     333_aa Iron ABC transporter permease
76 PPAV01000004.1 GCA002913155_00049 CDS open 20997-21731 _na     244_aa ABC transporter ATP-binding protein
77 PPAV01000004.1 GCA002913155_00050 CDS open 21728-22522 _na     264_aa Class I SAM-dependent methyltransferase
78 PPAV01000004.1 GCA002913155_00028 gene open 295-1287 dctP
79 PPAV01000004.1 GCA002913155_00029 gene open 1287-1829 dctQ
80 PPAV01000004.1 GCA002913155_00030 gene open 1841-3124 dctM
81 PPAV01000004.1 GCA002913155_00031 gene open 3150-4202
82 PPAV01000004.1 GCA002913155_00032 gene open 4195-5274
83 PPAV01000004.1 GCA002913155_00033 gene open 5321-5479
84 PPAV01000004.1 GCA002913155_00034 gene open 5490-7334
85 PPAV01000004.1 GCA002913155_00035 gene open 7327-7971
86 PPAV01000004.1 GCA002913155_00036 gene open 8142-8840
87 PPAV01000004.1 GCA002913155_00037 gene open 8833-9216 thiD2
88 PPAV01000004.1 GCA002913155_00038 gene open 9283-9612 secG
89 PPAV01000004.1 GCA002913155_00039 gene open 9615-10574
90 PPAV01000004.1 GCA002913155_00040 gene open 10564-11121 frr
91 PPAV01000004.1 GCA002913155_00041 gene open 11637-11798
92 PPAV01000004.1 GCA002913155_00042 gene open 12097-12504 vapC
93 PPAV01000004.1 GCA002913155_00043 gene open 12504-12755
94 PPAV01000004.1 GCA002913155_00044 gene open 13952-14908
95 PPAV01000004.1 GCA002913155_00045 gene open 15703-17121
96 PPAV01000004.1 GCA002913155_00046 gene open 17959-18921
97 PPAV01000004.1 GCA002913155_00047 gene open 18954-20003
98 PPAV01000004.1 GCA002913155_00048 gene open 19996-20997
99 PPAV01000004.1 GCA002913155_00049 gene open 20997-21731
100 PPAV01000004.1 GCA002913155_00050 gene open 21728-22522
101 PPAV01000005.1 GCA002913155_00051 CDS open 202-798 _na     198_aa hypothetical protein
102 PPAV01000005.1 GCA002913155_00052 CDS open 1063-1446 _na     127_aa hypothetical protein
103 PPAV01000005.1 GCA002913155_00053 CDS open 1447-2133 _na     228_aa hypothetical protein
104 PPAV01000005.1 GCA002913155_00054 CDS open 2136-2336 _na     66_aa hypothetical protein
105 PPAV01000005.1 GCA002913155_00055 CDS open 2354-2806 _na     150_aa SET domain-containing protein
106 PPAV01000005.1 GCA002913155_00056 CDS open 2844-3734 _na     296_aa Integrase-recombinase protein XERCD family
107 PPAV01000005.1 GCA002913155_00057 CDS open 3868-4290 _na     140_aa hypothetical protein
108 PPAV01000005.1 GCA002913155_00058 CDS open 4284-5261 _na     325_aa Transcriptional regulator
109 PPAV01000005.1 GCA002913155_00051 gene open 202-798
110 PPAV01000005.1 GCA002913155_00052 gene open 1063-1446
111 PPAV01000005.1 GCA002913155_00053 gene open 1447-2133
112 PPAV01000005.1 GCA002913155_00054 gene open 2136-2336
113 PPAV01000005.1 GCA002913155_00055 gene open 2354-2806
114 PPAV01000005.1 GCA002913155_00056 gene open 2844-3734
115 PPAV01000005.1 GCA002913155_00057 gene open 3868-4290
116 PPAV01000005.1 GCA002913155_00058 gene open 4284-5261
117 PPAV01000006.1 GCA002913155_00060 gene open 1022-1140 rrf
118 PPAV01000006.1 GCA002913155_00061 gene open 1273-4176 rrl
119 PPAV01000006.1 GCA002913155_00064 gene open 4763-6273 rrs
120 PPAV01000006.1 GCA002913155_00060 rRNA open 1022-1140 rrf 5S ribosomal RNA
121 PPAV01000006.1 GCA002913155_00061 rRNA open 1273-4176 rrl 23S ribosomal RNA
122 PPAV01000006.1 GCA002913155_00064 rRNA open 4763-6273 rrs 16S ribosomal RNA
123 PPAV01000006.1 GCA002913155_00059 CDS open 354-800 _na     148_aa Competence protein ComEA helix-hairpin-helix region
124 PPAV01000006.1 GCA002913155_00059 gene open 354-800
125 PPAV01000006.1 GCA002913155_00062 gene open 4504-4579 trnA
126 PPAV01000006.1 GCA002913155_00063 gene open 4592-4668 trnI
127 PPAV01000006.1 GCA002913155_00062 tRNA open 4504-4579 trnA tRNA-Ala(tgc)
128 PPAV01000006.1 GCA002913155_00063 tRNA open 4592-4668 trnI tRNA-Ile(gat)
129 PPAV01000007.1 GCA002913155_00126 gene open 52458-52816 ssrA
130 PPAV01000007.1 GCA002913155_00126 tmRNA open 52458-52816 ssrA transfer-messenger RNA%2C SsrA
131 PPAV01000007.1 GCA002913155_00065 CDS open 106-351 _na     81_aa HTH cro/C1-type domain-containing protein
132 PPAV01000007.1 GCA002913155_00066 CDS open 352-525 _na     57_aa hypothetical protein
133 PPAV01000007.1 GCA002913155_00067 CDS open 631-1344 _na     237_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
134 PPAV01000007.1 GCA002913155_00068 CDS open 1341-2804 _na     487_aa thrC threonine synthase
135 PPAV01000007.1 GCA002913155_00069 CDS open 2801-3103 _na     100_aa cutA Divalent-cation tolerance protein CutA
136 PPAV01000007.1 GCA002913155_00070 CDS open 3166-4086 _na     306_aa tetraacyldisaccharide 4'-kinase
137 PPAV01000007.1 GCA002913155_00071 CDS open 4079-5209 _na     376_aa UDP-4-keto-6-deoxy-N-acetylglucosamine 4-aminotransferase
138 PPAV01000007.1 GCA002913155_00072 CDS open 5220-5957 _na     245_aa NAD+ synthase
139 PPAV01000007.1 GCA002913155_00073 CDS open 6078-6680 _na     200_aa Metallo-beta-lactamase family protein
140 PPAV01000007.1 GCA002913155_00074 CDS open 6855-8105 _na     416_aa Major outer membrane protein
141 PPAV01000007.1 GCA002913155_00075 CDS open 8293-8826 _na     177_aa Thioesterase domain-containing protein
142 PPAV01000007.1 GCA002913155_00076 CDS open 8835-9764 _na     309_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
143 PPAV01000007.1 GCA002913155_00077 CDS open 9967-11046 _na     359_aa Transglutaminase-like domain-containing protein
144 PPAV01000007.1 GCA002913155_00078 CDS open 11043-11366 _na     107_aa Aryl sulfotransferase
145 PPAV01000007.1 GCA002913155_00079 CDS open 11359-11616 _na     85_aa Cation transporter
146 PPAV01000007.1 GCA002913155_00080 CDS open 11633-12922 _na     429_aa Aminoacyl-histidine dipeptidase
147 PPAV01000007.1 GCA002913155_00081 CDS open 13011-14288 _na     425_aa Dihydroorotase
148 PPAV01000007.1 GCA002913155_00082 CDS open 14291-15220 _na     309_aa pyrB aspartate carbamoyltransferase catalytic subunit
149 PPAV01000007.1 GCA002913155_00083 CDS open 15237-15647 _na     136_aa beta-lactamase
150 PPAV01000007.1 GCA002913155_00084 CDS open 15657-15884 _na     75_aa Cell division protein
151 PPAV01000007.1 GCA002913155_00085 CDS open 15881-16906 _na     341_aa DHHA1 domain-containing protein
152 PPAV01000007.1 GCA002913155_00086 CDS open 16916-19111 _na     731_aa flhA flagellar biosynthesis protein FlhA
153 PPAV01000007.1 GCA002913155_00087 CDS open 19114-19518 _na     134_aa Rrf2 family transcriptional regulator
154 PPAV01000007.1 GCA002913155_00088 CDS open 19665-19937 _na     90_aa rpsO 30S ribosomal protein S15
155 PPAV01000007.1 GCA002913155_00089 CDS open 20336-20758 _na     140_aa 4Fe-4S Mo/W bis-MGD-type domain-containing protein
156 PPAV01000007.1 GCA002913155_00090 CDS open 20855-22612 _na     585_aa fdhF formate dehydrogenase subunit alpha
157 PPAV01000007.1 GCA002913155_00091 CDS open 22760-23464 _na     234_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
158 PPAV01000007.1 GCA002913155_00092 CDS open 23461-24354 _na     297_aa bifunctional riboflavin kinase/FAD synthetase
159 PPAV01000007.1 GCA002913155_00093 CDS open 24320-25033 _na     237_aa 16S/23S rRNA (Cytidine-2'-O)-methyltransferase
160 PPAV01000007.1 GCA002913155_00094 CDS open 25023-26966 _na     647_aa ligA NAD-dependent DNA ligase LigA
161 PPAV01000007.1 GCA002913155_00095 CDS open 27008-27868 _na     286_aa NADAR domain-containing protein
162 PPAV01000007.1 GCA002913155_00096 CDS open 27893-29032 _na     379_aa folP dihydropteroate synthase
163 PPAV01000007.1 GCA002913155_00097 CDS open 29029-29649 _na     206_aa DNA polymerase III subunit delta'
164 PPAV01000007.1 GCA002913155_00098 CDS open 29650-30192 _na     180_aa DnaA-binding chromosome replication initiation factor
165 PPAV01000007.1 GCA002913155_00099 CDS open 30192-31394 _na     400_aa aspartate kinase
166 PPAV01000007.1 GCA002913155_00100 CDS open 31394-31858 _na     154_aa RNA pyrophosphohydrolase
167 PPAV01000007.1 GCA002913155_00101 CDS open 31923-33020 _na     365_aa PepSY domain-containing protein
168 PPAV01000007.1 GCA002913155_00102 CDS open 33022-35037 _na     671_aa TonB-dependent receptor
169 PPAV01000007.1 GCA002913155_00103 CDS open 35076-35960 _na     294_aa HTH araC/xylS-type domain-containing protein
170 PPAV01000007.1 GCA002913155_00104 CDS open 36016-37062 _na     348_aa hemW radical SAM family heme chaperone HemW
171 PPAV01000007.1 GCA002913155_00105 CDS open 37130-37528 _na     132_aa tatB Sec-independent protein translocase protein TatB
172 PPAV01000007.1 GCA002913155_00106 CDS open 37528-38286 _na     252_aa tatC twin-arginine translocase subunit TatC
173 PPAV01000007.1 GCA002913155_00107 CDS open 38279-39301 _na     340_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
174 PPAV01000007.1 GCA002913155_00108 CDS open 39298-40098 _na     266_aa Response regulatory domain-containing protein
175 PPAV01000007.1 GCA002913155_00109 CDS open 40120-40503 _na     127_aa ruvX Holliday junction resolvase RuvX
176 PPAV01000007.1 GCA002913155_00110 CDS open 40500-41270 _na     256_aa dprA DNA protecting protein DprA
177 PPAV01000007.1 GCA002913155_00111 CDS open 41267-42658 _na     463_aa Divergent polysaccharide deacetylase
178 PPAV01000007.1 GCA002913155_00112 CDS open 42662-43684 _na     340_aa ilvC ketol-acid reductoisomerase
179 PPAV01000007.1 GCA002913155_00113 CDS open 43827-44645 _na     272_aa HDOD domain-containing protein
180 PPAV01000007.1 GCA002913155_00114 CDS open 44642-46561 _na     639_aa exoribonuclease II
181 PPAV01000007.1 GCA002913155_00115 CDS open 46554-47552 _na     332_aa holA DNA polymerase III subunit delta
182 PPAV01000007.1 GCA002913155_00116 CDS open 47630-48049 _na     139_aa rpsF 30S ribosomal protein S6
183 PPAV01000007.1 GCA002913155_00117 CDS open 48063-48620 _na     185_aa single-stranded DNA-binding protein
184 PPAV01000007.1 GCA002913155_00118 CDS open 48636-48896 _na     86_aa rpsR 30S ribosomal protein S18
185 PPAV01000007.1 GCA002913155_00123 CDS open 50074-51093 _na     339_aa bifunctional 3%2C4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II
186 PPAV01000007.1 GCA002913155_00124 CDS open 51131-51940 _na     269_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
187 PPAV01000007.1 GCA002913155_00125 CDS open 52027-52431 _na     134_aa HPt domain-containing protein
188 PPAV01000007.1 GCA002913155_00127 CDS open 52861-53748 _na     295_aa Double Cache domain-containing protein
189 PPAV01000007.1 GCA002913155_00128 CDS open 53741-54112 _na     123_aa HIT family protein
190 PPAV01000007.1 GCA002913155_00129 CDS open 54127-55167 _na     346_aa Acid membrane antigen A
191 PPAV01000007.1 GCA002913155_00130 CDS open 55370-56449 _na     359_aa Cytochrome C
192 PPAV01000007.1 GCA002913155_00131 CDS open 56473-57483 _na     336_aa ruvB Holliday junction branch migration DNA helicase RuvB
193 PPAV01000007.1 GCA002913155_00132 CDS open 57533-58639 _na     368_aa histidine kinase
194 PPAV01000007.1 GCA002913155_00133 CDS open 58623-59291 _na     222_aa Two-component system response regulator
195 PPAV01000007.1 GCA002913155_00134 CDS open 59382-60317 _na     311_aa nrfD Polysulfide reductase NrfD
196 PPAV01000007.1 GCA002913155_00135 CDS open 60310-60873 _na     187_aa Putative thiosulfate/polysulfide reductase%2C 4Fe-4S iron-sulfur binding domain-containing subunit
197 PPAV01000007.1 GCA002913155_00136 CDS open 60883-63156 _na     757_aa phsA thiosulfate reductase PhsA
198 PPAV01000007.1 GCA002913155_00065 gene open 106-351
199 PPAV01000007.1 GCA002913155_00066 gene open 352-525
200 PPAV01000007.1 GCA002913155_00067 gene open 631-1344 kdsB
201 PPAV01000007.1 GCA002913155_00068 gene open 1341-2804 thrC
202 PPAV01000007.1 GCA002913155_00069 gene open 2801-3103 cutA
203 PPAV01000007.1 GCA002913155_00070 gene open 3166-4086
204 PPAV01000007.1 GCA002913155_00071 gene open 4079-5209
205 PPAV01000007.1 GCA002913155_00072 gene open 5220-5957
206 PPAV01000007.1 GCA002913155_00073 gene open 6078-6680
207 PPAV01000007.1 GCA002913155_00074 gene open 6855-8105
208 PPAV01000007.1 GCA002913155_00075 gene open 8293-8826
209 PPAV01000007.1 GCA002913155_00076 gene open 8835-9764 cmoB
210 PPAV01000007.1 GCA002913155_00077 gene open 9967-11046
211 PPAV01000007.1 GCA002913155_00078 gene open 11043-11366
212 PPAV01000007.1 GCA002913155_00079 gene open 11359-11616
213 PPAV01000007.1 GCA002913155_00080 gene open 11633-12922
214 PPAV01000007.1 GCA002913155_00081 gene open 13011-14288
215 PPAV01000007.1 GCA002913155_00082 gene open 14291-15220 pyrB
216 PPAV01000007.1 GCA002913155_00083 gene open 15237-15647
217 PPAV01000007.1 GCA002913155_00084 gene open 15657-15884
218 PPAV01000007.1 GCA002913155_00085 gene open 15881-16906
219 PPAV01000007.1 GCA002913155_00086 gene open 16916-19111 flhA
220 PPAV01000007.1 GCA002913155_00087 gene open 19114-19518
221 PPAV01000007.1 GCA002913155_00088 gene open 19665-19937 rpsO
222 PPAV01000007.1 GCA002913155_00089 gene open 20336-20758
223 PPAV01000007.1 GCA002913155_00090 gene open 20855-22612 fdhF
224 PPAV01000007.1 GCA002913155_00091 gene open 22760-23464 cmoA
225 PPAV01000007.1 GCA002913155_00092 gene open 23461-24354
226 PPAV01000007.1 GCA002913155_00093 gene open 24320-25033
227 PPAV01000007.1 GCA002913155_00094 gene open 25023-26966 ligA
228 PPAV01000007.1 GCA002913155_00095 gene open 27008-27868
229 PPAV01000007.1 GCA002913155_00096 gene open 27893-29032 folP
230 PPAV01000007.1 GCA002913155_00097 gene open 29029-29649
231 PPAV01000007.1 GCA002913155_00098 gene open 29650-30192
232 PPAV01000007.1 GCA002913155_00099 gene open 30192-31394
233 PPAV01000007.1 GCA002913155_00100 gene open 31394-31858
234 PPAV01000007.1 GCA002913155_00101 gene open 31923-33020
235 PPAV01000007.1 GCA002913155_00102 gene open 33022-35037
236 PPAV01000007.1 GCA002913155_00103 gene open 35076-35960
237 PPAV01000007.1 GCA002913155_00104 gene open 36016-37062 hemW
238 PPAV01000007.1 GCA002913155_00105 gene open 37130-37528 tatB
239 PPAV01000007.1 GCA002913155_00106 gene open 37528-38286 tatC
240 PPAV01000007.1 GCA002913155_00107 gene open 38279-39301 queA
241 PPAV01000007.1 GCA002913155_00108 gene open 39298-40098
242 PPAV01000007.1 GCA002913155_00109 gene open 40120-40503 ruvX
243 PPAV01000007.1 GCA002913155_00110 gene open 40500-41270 dprA
244 PPAV01000007.1 GCA002913155_00111 gene open 41267-42658
245 PPAV01000007.1 GCA002913155_00112 gene open 42662-43684 ilvC
246 PPAV01000007.1 GCA002913155_00113 gene open 43827-44645
247 PPAV01000007.1 GCA002913155_00114 gene open 44642-46561
248 PPAV01000007.1 GCA002913155_00115 gene open 46554-47552 holA
249 PPAV01000007.1 GCA002913155_00116 gene open 47630-48049 rpsF
250 PPAV01000007.1 GCA002913155_00117 gene open 48063-48620
251 PPAV01000007.1 GCA002913155_00118 gene open 48636-48896 rpsR
252 PPAV01000007.1 GCA002913155_00123 gene open 50074-51093
253 PPAV01000007.1 GCA002913155_00124 gene open 51131-51940 panB
254 PPAV01000007.1 GCA002913155_00125 gene open 52027-52431
255 PPAV01000007.1 GCA002913155_00127 gene open 52861-53748
256 PPAV01000007.1 GCA002913155_00128 gene open 53741-54112
257 PPAV01000007.1 GCA002913155_00129 gene open 54127-55167
258 PPAV01000007.1 GCA002913155_00130 gene open 55370-56449
259 PPAV01000007.1 GCA002913155_00131 gene open 56473-57483 ruvB
260 PPAV01000007.1 GCA002913155_00132 gene open 57533-58639
261 PPAV01000007.1 GCA002913155_00133 gene open 58623-59291
262 PPAV01000007.1 GCA002913155_00134 gene open 59382-60317 nrfD
263 PPAV01000007.1 GCA002913155_00135 gene open 60310-60873
264 PPAV01000007.1 GCA002913155_00136 gene open 60883-63156 phsA
265 PPAV01000007.1 GCA002913155_00119 gene open 49464-49539 trnK
266 PPAV01000007.1 GCA002913155_00120 gene open 49553-49628 trnE
267 PPAV01000007.1 GCA002913155_00121 gene open 49647-49722 trnV
268 PPAV01000007.1 GCA002913155_00122 gene open 49732-49808 trnD
269 PPAV01000007.1 GCA002913155_00119 tRNA open 49464-49539 trnK tRNA-Lys(ttt)
270 PPAV01000007.1 GCA002913155_00120 tRNA open 49553-49628 trnE tRNA-Glu(ctc)
271 PPAV01000007.1 GCA002913155_00121 tRNA open 49647-49722 trnV tRNA-Val(tac)
272 PPAV01000007.1 GCA002913155_00122 tRNA open 49732-49808 trnD tRNA-Asp(gtc)
273 PPAV01000008.1 GCA002913155_00137 CDS open 77-442 _na     121_aa iroE IroE protein
274 PPAV01000008.1 GCA002913155_00138 CDS open 460-927 _na     155_aa single-stranded DNA-binding protein
275 PPAV01000008.1 GCA002913155_00139 CDS open 938-1639 _na     233_aa hypothetical protein
276 PPAV01000008.1 GCA002913155_00140 CDS open 1817-2224 _na     135_aa yopX YopX protein domain-containing protein
277 PPAV01000008.1 GCA002913155_00141 CDS open 2239-2646 _na     135_aa yopX YopX protein domain-containing protein
278 PPAV01000008.1 GCA002913155_00142 CDS open 2756-3385 _na     209_aa Phage protein
279 PPAV01000008.1 GCA002913155_00143 CDS open 3378-3611 _na     77_aa hypothetical protein
280 PPAV01000008.1 GCA002913155_00144 CDS open 3623-4075 _na     150_aa yopX YopX family protein
281 PPAV01000008.1 GCA002913155_00145 CDS open 4072-4278 _na     68_aa DUF2197 domain-containing protein
282 PPAV01000008.1 GCA002913155_00146 CDS open 4302-4739 _na     145_aa hypothetical protein
283 PPAV01000008.1 GCA002913155_00147 CDS open 4769-4972 _na     67_aa hypothetical protein
284 PPAV01000008.1 GCA002913155_00148 CDS open 4965-5309 _na     114_aa hypothetical protein
285 PPAV01000008.1 GCA002913155_00149 CDS open 5329-5577 _na     82_aa hypothetical protein
286 PPAV01000008.1 GCA002913155_00150 CDS open 5558-5782 _na     74_aa hypothetical protein
287 PPAV01000008.1 GCA002913155_00151 CDS open 5805-6098 _na     97_aa hypothetical protein
288 PPAV01000008.1 GCA002913155_00152 CDS open 6469-6651 _na     60_aa hypothetical protein
289 PPAV01000008.1 GCA002913155_00153 CDS open 6653-7306 _na     217_aa hypothetical protein
290 PPAV01000008.1 GCA002913155_00154 CDS open 7349-7579 _na     76_aa helix-turn-helix transcriptional regulator
291 PPAV01000008.1 GCA002913155_00155 CDS open 7586-8008 _na     140_aa hypothetical protein
292 PPAV01000008.1 GCA002913155_00156 CDS open 8034-8504 _na     156_aa hypothetical protein
293 PPAV01000008.1 GCA002913155_00157 CDS open 8515-8745 _na     76_aa hypothetical protein
294 PPAV01000008.1 GCA002913155_00158 CDS open 8749-9036 _na     95_aa hypothetical protein
295 PPAV01000008.1 GCA002913155_00159 CDS open 9046-9489 _na     147_aa hypothetical protein
296 PPAV01000008.1 GCA002913155_00160 CDS open 9580-10248 _na     222_aa Beta-carotene 15%2C15'-monooxygenase
297 PPAV01000008.1 GCA002913155_00161 CDS open 10250-11110 _na     286_aa DUF3822 domain-containing protein
298 PPAV01000008.1 GCA002913155_00162 CDS open 11200-11490 _na     96_aa hypothetical protein
299 PPAV01000008.1 GCA002913155_00163 CDS open 11505-11960 _na     151_aa hypothetical protein
300 PPAV01000008.1 GCA002913155_00164 CDS open 11955-12317 _na     120_aa hypothetical protein
301 PPAV01000008.1 GCA002913155_00165 CDS open 12447-12596 _na     49_aa hypothetical protein
302 PPAV01000008.1 GCA002913155_00166 CDS open 12610-13200 _na     196_aa yubB YubB ferredoxin-like domain-containing protein
303 PPAV01000008.1 GCA002913155_00167 CDS open 13296-13514 _na     72_aa WGR domain-containing protein
304 PPAV01000008.1 GCA002913155_00168 CDS open 13709-14683 _na     324_aa hypothetical protein
305 PPAV01000008.1 GCA002913155_00169 CDS open 14707-15150 _na     147_aa hypothetical protein
306 PPAV01000008.1 GCA002913155_00170 CDS open 15179-15802 _na     207_aa hypothetical protein
307 PPAV01000008.1 GCA002913155_00171 CDS open 16200-16937 _na     245_aa hypothetical protein
308 PPAV01000008.1 GCA002913155_00172 CDS open 16958-20713 _na     1251_aa sbcC Exonuclease SbcC
309 PPAV01000008.1 GCA002913155_00173 CDS open 20713-21816 _na     367_aa hypothetical protein
310 PPAV01000008.1 GCA002913155_00174 CDS open 21813-22739 _na     308_aa hypothetical protein
311 PPAV01000008.1 GCA002913155_00175 CDS open 22739-23848 _na     369_aa ParB/Sulfiredoxin domain-containing protein
312 PPAV01000008.1 GCA002913155_00176 CDS open 23859-25277 _na     472_aa putative AAA domain-containing protein ycf46
313 PPAV01000008.1 GCA002913155_00177 CDS open 25277-32653 _na     2458_aa DNA-directed RNA polymerase%2C omega subunit family protein
314 PPAV01000008.1 GCA002913155_00178 CDS open 32805-34937 _na     710_aa ATP-dependent helicase
315 PPAV01000008.1 GCA002913155_00179 CDS open 34962-36137 _na     391_aa DUF1173 domain-containing protein
316 PPAV01000008.1 GCA002913155_00180 CDS open 36138-36644 _na     168_aa hypothetical protein
317 PPAV01000008.1 GCA002913155_00181 CDS open 36641-36820 _na     59_aa hypothetical protein
318 PPAV01000008.1 GCA002913155_00182 CDS open 36879-37136 _na     85_aa Phage protein
319 PPAV01000008.1 GCA002913155_00137 gene open 77-442 iroE
320 PPAV01000008.1 GCA002913155_00138 gene open 460-927
321 PPAV01000008.1 GCA002913155_00139 gene open 938-1639
322 PPAV01000008.1 GCA002913155_00140 gene open 1817-2224 yopX
323 PPAV01000008.1 GCA002913155_00141 gene open 2239-2646 yopX
324 PPAV01000008.1 GCA002913155_00142 gene open 2756-3385
325 PPAV01000008.1 GCA002913155_00143 gene open 3378-3611
326 PPAV01000008.1 GCA002913155_00144 gene open 3623-4075 yopX
327 PPAV01000008.1 GCA002913155_00145 gene open 4072-4278
328 PPAV01000008.1 GCA002913155_00146 gene open 4302-4739
329 PPAV01000008.1 GCA002913155_00147 gene open 4769-4972
330 PPAV01000008.1 GCA002913155_00148 gene open 4965-5309
331 PPAV01000008.1 GCA002913155_00149 gene open 5329-5577
332 PPAV01000008.1 GCA002913155_00150 gene open 5558-5782
333 PPAV01000008.1 GCA002913155_00151 gene open 5805-6098
334 PPAV01000008.1 GCA002913155_00152 gene open 6469-6651
335 PPAV01000008.1 GCA002913155_00153 gene open 6653-7306
336 PPAV01000008.1 GCA002913155_00154 gene open 7349-7579
337 PPAV01000008.1 GCA002913155_00155 gene open 7586-8008
338 PPAV01000008.1 GCA002913155_00156 gene open 8034-8504
339 PPAV01000008.1 GCA002913155_00157 gene open 8515-8745
340 PPAV01000008.1 GCA002913155_00158 gene open 8749-9036
341 PPAV01000008.1 GCA002913155_00159 gene open 9046-9489
342 PPAV01000008.1 GCA002913155_00160 gene open 9580-10248
343 PPAV01000008.1 GCA002913155_00161 gene open 10250-11110
344 PPAV01000008.1 GCA002913155_00162 gene open 11200-11490
345 PPAV01000008.1 GCA002913155_00163 gene open 11505-11960
346 PPAV01000008.1 GCA002913155_00164 gene open 11955-12317
347 PPAV01000008.1 GCA002913155_00165 gene open 12447-12596
348 PPAV01000008.1 GCA002913155_00166 gene open 12610-13200 yubB
349 PPAV01000008.1 GCA002913155_00167 gene open 13296-13514
350 PPAV01000008.1 GCA002913155_00168 gene open 13709-14683
351 PPAV01000008.1 GCA002913155_00169 gene open 14707-15150
352 PPAV01000008.1 GCA002913155_00170 gene open 15179-15802
353 PPAV01000008.1 GCA002913155_00171 gene open 16200-16937
354 PPAV01000008.1 GCA002913155_00172 gene open 16958-20713 sbcC
355 PPAV01000008.1 GCA002913155_00173 gene open 20713-21816
356 PPAV01000008.1 GCA002913155_00174 gene open 21813-22739
357 PPAV01000008.1 GCA002913155_00175 gene open 22739-23848
358 PPAV01000008.1 GCA002913155_00176 gene open 23859-25277
359 PPAV01000008.1 GCA002913155_00177 gene open 25277-32653
360 PPAV01000008.1 GCA002913155_00178 gene open 32805-34937
361 PPAV01000008.1 GCA002913155_00179 gene open 34962-36137
362 PPAV01000008.1 GCA002913155_00180 gene open 36138-36644
363 PPAV01000008.1 GCA002913155_00181 gene open 36641-36820
364 PPAV01000008.1 GCA002913155_00182 gene open 36879-37136
365 PPAV01000009.1 GCA002913155_00183 CDS open 507-986 _na     159_aa hypothetical protein
366 PPAV01000009.1 GCA002913155_00184 CDS open 1405-1944 _na     179_aa DNA helicase
367 PPAV01000009.1 GCA002913155_00185 CDS open 2156-3778 _na     540_aa Core-binding (CB) domain-containing protein
368 PPAV01000009.1 GCA002913155_00186 CDS open 3841-5103 _na     420_aa Integrase
369 PPAV01000009.1 GCA002913155_00188 CDS open 5409-5564 _na     51_aa Lipoprotein
370 PPAV01000009.1 GCA002913155_00193 CDS open 6220-7440 _na     406_aa Tyr recombinase domain-containing protein
371 PPAV01000009.1 GCA002913155_00194 CDS open 7448-8110 _na     220_aa hypothetical protein
372 PPAV01000009.1 GCA002913155_00195 CDS open 8372-8581 _na     69_aa flhA Flagellar biosynthesis protein FlhA
373 PPAV01000009.1 GCA002913155_00196 CDS open 8578-8844 _na     88_aa hypothetical protein
374 PPAV01000009.1 GCA002913155_00197 CDS open 8841-9077 _na     78_aa hypothetical protein
375 PPAV01000009.1 GCA002913155_00198 CDS open 9055-9885 _na     276_aa phage antirepressor KilAC domain-containing protein
376 PPAV01000009.1 GCA002913155_00199 CDS open 11172-11267 _na     31_aa hypothetical protein
377 PPAV01000009.1 GCA002913155_00200 CDS open 11586-11729 _na     47_aa hypothetical protein
378 PPAV01000009.1 GCA002913155_00201 CDS open 11815-12681 _na     288_aa TIGR01777 family protein
379 PPAV01000009.1 GCA002913155_00202 CDS open 12806-13027 _na     73_aa Acyl carrier protein
380 PPAV01000009.1 GCA002913155_00203 CDS open 13185-13415 _na     76_aa hypothetical protein
381 PPAV01000009.1 GCA002913155_00204 CDS open 13405-13743 _na     112_aa hypothetical protein
382 PPAV01000009.1 GCA002913155_00205 CDS open 13845-14159 _na     104_aa hrcA HrcA family transcriptional regulator
383 PPAV01000009.1 GCA002913155_00206 CDS open 14558-14782 _na     74_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
384 PPAV01000009.1 GCA002913155_00207 CDS open 14776-15042 _na     88_aa Toxin-antitoxin system%2C toxin component%2C RelE/ParE family
385 PPAV01000009.1 GCA002913155_00183 gene open 507-986
386 PPAV01000009.1 GCA002913155_00184 gene open 1405-1944
387 PPAV01000009.1 GCA002913155_00185 gene open 2156-3778
388 PPAV01000009.1 GCA002913155_00186 gene open 3841-5103
389 PPAV01000009.1 GCA002913155_00188 gene open 5409-5564
390 PPAV01000009.1 GCA002913155_00193 gene open 6220-7440
391 PPAV01000009.1 GCA002913155_00194 gene open 7448-8110
392 PPAV01000009.1 GCA002913155_00195 gene open 8372-8581 flhA
393 PPAV01000009.1 GCA002913155_00196 gene open 8578-8844
394 PPAV01000009.1 GCA002913155_00197 gene open 8841-9077
395 PPAV01000009.1 GCA002913155_00198 gene open 9055-9885
396 PPAV01000009.1 GCA002913155_00199 gene open 11172-11267
397 PPAV01000009.1 GCA002913155_00200 gene open 11586-11729
398 PPAV01000009.1 GCA002913155_00201 gene open 11815-12681
399 PPAV01000009.1 GCA002913155_00202 gene open 12806-13027
400 PPAV01000009.1 GCA002913155_00203 gene open 13185-13415
401 PPAV01000009.1 GCA002913155_00204 gene open 13405-13743
402 PPAV01000009.1 GCA002913155_00205 gene open 13845-14159 hrcA
403 PPAV01000009.1 GCA002913155_00206 gene open 14558-14782
404 PPAV01000009.1 GCA002913155_00207 gene open 14776-15042
405 PPAV01000009.1 GCA002913155_00187 gene open 5261-5350 trnS
406 PPAV01000009.1 GCA002913155_00189 gene open 5597-5670 trnC
407 PPAV01000009.1 GCA002913155_00190 gene open 5677-5763 trnL
408 PPAV01000009.1 GCA002913155_00191 gene open 5772-5846 trnG
409 PPAV01000009.1 GCA002913155_00192 gene open 5953-6028 trnA
410 PPAV01000009.1 GCA002913155_00187 tRNA open 5261-5350 trnS tRNA-Ser(tga)
411 PPAV01000009.1 GCA002913155_00189 tRNA open 5597-5670 trnC tRNA-Cys(gca)
412 PPAV01000009.1 GCA002913155_00190 tRNA open 5677-5763 trnL tRNA-Leu(taa)
413 PPAV01000009.1 GCA002913155_00191 tRNA open 5772-5846 trnG tRNA-Gly(gcc)
414 PPAV01000009.1 GCA002913155_00192 tRNA open 5953-6028 trnA tRNA-Ala(ggc)
415 PPAV01000010.1 GCA002913155_00208 CDS open 86-2188 _na     700_aa ribonucleoside triphosphate reductase
416 PPAV01000010.1 GCA002913155_00209 CDS open 2198-2368 _na     56_aa Anaerobic ribonucleoside triphosphate reductase (N-terminal region)
417 PPAV01000010.1 GCA002913155_00210 CDS open 2453-3127 _na     224_aa anaerobic ribonucleoside-triphosphate reductase activating protein
418 PPAV01000010.1 GCA002913155_00211 CDS open 3202-4347 _na     381_aa gldA Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
419 PPAV01000010.1 GCA002913155_00212 CDS open 4376-5017 _na     213_aa NAD(P)-binding domain-containing protein
420 PPAV01000010.1 GCA002913155_00213 CDS open 5014-5784 _na     256_aa Oxidoreductase
421 PPAV01000010.1 GCA002913155_00214 CDS open 5855-7291 _na     478_aa subtype B tannase
422 PPAV01000010.1 GCA002913155_00215 CDS open 7307-7987 _na     226_aa putative quinol monooxygenase
423 PPAV01000010.1 GCA002913155_00216 CDS open 7996-8136 _na     46_aa hypothetical protein
424 PPAV01000010.1 GCA002913155_00217 CDS open 8260-8820 _na     186_aa Flavodoxin-like fold domain-containing protein
425 PPAV01000010.1 GCA002913155_00218 CDS open 8817-9041 _na     74_aa DUF2798 domain-containing protein
426 PPAV01000010.1 GCA002913155_00219 CDS open 9135-9779 _na     214_aa Desulforubrerythrin
427 PPAV01000010.1 GCA002913155_00220 CDS open 9880-10170 _na     96_aa TonB-dependent receptor
428 PPAV01000010.1 GCA002913155_00221 CDS open 10200-11768 _na     522_aa rmuC DNA recombination protein RmuC
429 PPAV01000010.1 GCA002913155_00222 CDS open 11848-13521 _na     557_aa ilvD dihydroxy-acid dehydratase
430 PPAV01000010.1 GCA002913155_00223 CDS open 13765-13968 _na     67_aa hypothetical protein
431 PPAV01000010.1 GCA002913155_00224 CDS open 14043-14393 _na     116_aa DUF2802 domain-containing protein
432 PPAV01000010.1 GCA002913155_00225 CDS open 14429-16195 _na     588_aa Arylsulfate sulfotransferase
433 PPAV01000010.1 GCA002913155_00226 CDS open 16350-16451 _na     33_aa hypothetical protein
434 PPAV01000010.1 GCA002913155_00227 CDS open 16461-17585 _na     374_aa Cytochrome d ubiquinol oxidase subunit II
435 PPAV01000010.1 GCA002913155_00228 CDS open 17578-19113 _na     511_aa Cytochrome d ubiquinol oxidase subunit 1
436 PPAV01000010.1 GCA002913155_00229 CDS open 19115-19330 _na     71_aa DUF4492 domain-containing protein
437 PPAV01000010.1 GCA002913155_00230 CDS open 19457-21091 _na     544_aa CTP synthase
438 PPAV01000010.1 GCA002913155_00231 CDS open 21157-21708 _na     183_aa Flavodoxin-like protein
439 PPAV01000010.1 GCA002913155_00232 CDS open 22040-23614 _na     524_aa recJ single-stranded-DNA-specific exonuclease RecJ
440 PPAV01000010.1 GCA002913155_00233 CDS open 23841-25838 _na     665_aa Putative TonB-dependent copper receptor
441 PPAV01000010.1 GCA002913155_00234 CDS open 26101-26685 _na     194_aa Outer membrane protein
442 PPAV01000010.1 GCA002913155_00235 CDS open 26722-27354 _na     210_aa protein-L-isoaspartate(D-aspartate) O-methyltransferase
443 PPAV01000010.1 GCA002913155_00236 CDS open 27415-28182 _na     255_aa CN hydrolase domain-containing protein
444 PPAV01000010.1 GCA002913155_00237 CDS open 28183-28677 _na     164_aa Lipoprotein
445 PPAV01000010.1 GCA002913155_00238 CDS open 28664-29686 _na     340_aa ribonucleotide-diphosphate reductase subunit beta
446 PPAV01000010.1 GCA002913155_00239 CDS open 29758-30882 _na     374_aa PepSY domain-containing protein
447 PPAV01000010.1 GCA002913155_00208 gene open 86-2188
448 PPAV01000010.1 GCA002913155_00209 gene open 2198-2368
449 PPAV01000010.1 GCA002913155_00210 gene open 2453-3127
450 PPAV01000010.1 GCA002913155_00211 gene open 3202-4347 gldA
451 PPAV01000010.1 GCA002913155_00212 gene open 4376-5017
452 PPAV01000010.1 GCA002913155_00213 gene open 5014-5784
453 PPAV01000010.1 GCA002913155_00214 gene open 5855-7291
454 PPAV01000010.1 GCA002913155_00215 gene open 7307-7987
455 PPAV01000010.1 GCA002913155_00216 gene open 7996-8136
456 PPAV01000010.1 GCA002913155_00217 gene open 8260-8820
457 PPAV01000010.1 GCA002913155_00218 gene open 8817-9041
458 PPAV01000010.1 GCA002913155_00219 gene open 9135-9779
459 PPAV01000010.1 GCA002913155_00220 gene open 9880-10170
460 PPAV01000010.1 GCA002913155_00221 gene open 10200-11768 rmuC
461 PPAV01000010.1 GCA002913155_00222 gene open 11848-13521 ilvD
462 PPAV01000010.1 GCA002913155_00223 gene open 13765-13968
463 PPAV01000010.1 GCA002913155_00224 gene open 14043-14393
464 PPAV01000010.1 GCA002913155_00225 gene open 14429-16195
465 PPAV01000010.1 GCA002913155_00226 gene open 16350-16451
466 PPAV01000010.1 GCA002913155_00227 gene open 16461-17585
467 PPAV01000010.1 GCA002913155_00228 gene open 17578-19113
468 PPAV01000010.1 GCA002913155_00229 gene open 19115-19330
469 PPAV01000010.1 GCA002913155_00230 gene open 19457-21091
470 PPAV01000010.1 GCA002913155_00231 gene open 21157-21708
471 PPAV01000010.1 GCA002913155_00232 gene open 22040-23614 recJ
472 PPAV01000010.1 GCA002913155_00233 gene open 23841-25838
473 PPAV01000010.1 GCA002913155_00234 gene open 26101-26685
474 PPAV01000010.1 GCA002913155_00235 gene open 26722-27354
475 PPAV01000010.1 GCA002913155_00236 gene open 27415-28182
476 PPAV01000010.1 GCA002913155_00237 gene open 28183-28677
477 PPAV01000010.1 GCA002913155_00238 gene open 28664-29686
478 PPAV01000010.1 GCA002913155_00239 gene open 29758-30882
479 PPAV01000011.1 repeat_region open 2456-2888 CRISPR array with 7 repeats of length 30%2C consensus sequence GTTCTAAACATCCACTACATTATTTAAAAC and spacer length 35
480 PPAV01000011.1 GCA002913155_00240 CDS open 353-928 _na     191_aa tyrosine-type recombinase/integrase
481 PPAV01000011.1 GCA002913155_00241 CDS open 3187-4197 _na     336_aa RAMP superfamily
482 PPAV01000011.1 GCA002913155_00242 CDS open 4215-4886 _na     223_aa hypothetical protein
483 PPAV01000011.1 GCA002913155_00243 CDS open 4887-6320 _na     477_aa CRISPR-associated protein
484 PPAV01000011.1 GCA002913155_00244 CDS open 6420-8249 _na     609_aa yoaA DinG family ATP-dependent helicase YoaA
485 PPAV01000011.1 GCA002913155_00245 CDS open 8246-9502 _na     418_aa HIPA protein
486 PPAV01000011.1 GCA002913155_00246 CDS open 9532-10176 _na     214_aa hypothetical protein
487 PPAV01000011.1 GCA002913155_00247 CDS open 10169-10546 _na     125_aa hypothetical protein
488 PPAV01000011.1 GCA002913155_00248 CDS open 10548-11084 _na     178_aa hypothetical protein
489 PPAV01000011.1 GCA002913155_00249 CDS open 11095-12504 _na     469_aa DNA 3'-5' helicase
490 PPAV01000011.1 GCA002913155_00250 CDS open 12833-15232 _na     799_aa traM TraD/TraG TraM recognition site domain-containing protein
491 PPAV01000011.1 GCA002913155_00251 CDS open 15232-15684 _na     150_aa hypothetical protein
492 PPAV01000011.1 GCA002913155_00252 CDS open 15697-18177 _na     826_aa hypothetical protein
493 PPAV01000011.1 GCA002913155_00253 CDS open 18174-18674 _na     166_aa hypothetical protein
494 PPAV01000011.1 GCA002913155_00240 gene open 353-928
495 PPAV01000011.1 GCA002913155_00241 gene open 3187-4197
496 PPAV01000011.1 GCA002913155_00242 gene open 4215-4886
497 PPAV01000011.1 GCA002913155_00243 gene open 4887-6320
498 PPAV01000011.1 GCA002913155_00244 gene open 6420-8249 yoaA
499 PPAV01000011.1 GCA002913155_00245 gene open 8246-9502
500 PPAV01000011.1 GCA002913155_00246 gene open 9532-10176