HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-575 (GCA_002914355.1)

Select a Genome:
BAKTA Annotations for GCA_002914355.1
Genome Selected: Campylobacter concisus clade-575
ContigsBases CDSrRNA tmRNAtRNA
73 1800093 1779 3 1 33
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3642 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3642 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 PPCD01000001.1 GCA002914355_00001 CDS open 31-588 _na     185_aa hypothetical protein
2 PPCD01000001.1 GCA002914355_00001 gene open 31-588
3 PPCD01000002.1 GCA002914355_00002 CDS open 1307-2665 _na     452_aa gdhA NADP-specific glutamate dehydrogenase
4 PPCD01000002.1 GCA002914355_00003 CDS open 2863-3351 _na     162_aa SMI1/KNR4 family protein
5 PPCD01000002.1 GCA002914355_00004 CDS open 3958-5397 _na     479_aa acetyl-CoA carboxylase subunit A
6 PPCD01000002.1 GCA002914355_00005 CDS open 5514-6059 _na     181_aa Periplasmic protein
7 PPCD01000002.1 GCA002914355_00006 CDS open 6069-6503 _na     144_aa Protoporphyrinogen IX oxidase
8 PPCD01000002.1 GCA002914355_00007 CDS open 6513-6875 _na     120_aa TM2 domain-containing protein
9 PPCD01000002.1 GCA002914355_00008 CDS open 6865-7317 _na     150_aa lspA signal peptidase II
10 PPCD01000002.1 GCA002914355_00009 CDS open 7310-8650 _na     446_aa glmM phosphoglucosamine mutase
11 PPCD01000002.1 GCA002914355_00010 CDS open 8808-9077 _na     89_aa rpsT 30S ribosomal protein S20
12 PPCD01000002.1 GCA002914355_00011 CDS open 9091-10158 _na     355_aa prfA peptide chain release factor 1
13 PPCD01000002.1 GCA002914355_00002 gene open 1307-2665 gdhA
14 PPCD01000002.1 GCA002914355_00003 gene open 2863-3351
15 PPCD01000002.1 GCA002914355_00004 gene open 3958-5397
16 PPCD01000002.1 GCA002914355_00005 gene open 5514-6059
17 PPCD01000002.1 GCA002914355_00006 gene open 6069-6503
18 PPCD01000002.1 GCA002914355_00007 gene open 6513-6875
19 PPCD01000002.1 GCA002914355_00008 gene open 6865-7317 lspA
20 PPCD01000002.1 GCA002914355_00009 gene open 7310-8650 glmM
21 PPCD01000002.1 GCA002914355_00010 gene open 8808-9077 rpsT
22 PPCD01000002.1 GCA002914355_00011 gene open 9091-10158 prfA
23 PPCD01000003.1 GCA002914355_00012 CDS open 77-1981 _na     634_aa hypothetical protein
24 PPCD01000003.1 GCA002914355_00012 gene open 77-1981
25 PPCD01000004.1 GCA002914355_00013 CDS open 77-775 _na     232_aa fumarate reductase cytochrome b subunit
26 PPCD01000004.1 GCA002914355_00014 CDS open 790-2808 _na     672_aa fumarate reductase flavoprotein subunit
27 PPCD01000004.1 GCA002914355_00015 CDS open 2801-3520 _na     239_aa fumarate reductase iron-sulfur subunit
28 PPCD01000004.1 GCA002914355_00016 CDS open 3883-4782 _na     299_aa Mrr restriction system protein
29 PPCD01000004.1 GCA002914355_00017 CDS open 4992-5723 _na     243_aa Phosphatidate cytidylyltransferase
30 PPCD01000004.1 GCA002914355_00018 CDS open 5705-6814 _na     369_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
31 PPCD01000004.1 GCA002914355_00019 CDS open 6801-8036 _na     411_aa Xanthine/uracil permease
32 PPCD01000004.1 GCA002914355_00020 CDS open 8036-9328 _na     430_aa Peptidoglycan LD-carboxypeptidase
33 PPCD01000004.1 GCA002914355_00021 CDS open 9325-10332 _na     335_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
34 PPCD01000004.1 GCA002914355_00022 CDS open 10428-12515 _na     695_aa GTP-binding protein (Dynamin domain)
35 PPCD01000004.1 GCA002914355_00023 CDS open 12508-14340 _na     610_aa ATP-binding protein
36 PPCD01000004.1 GCA002914355_00024 CDS open 14389-16842 _na     817_aa Trimethylamine-N-oxide reductase
37 PPCD01000004.1 GCA002914355_00025 CDS open 17003-17296 _na     97_aa Antibiotic biosynthesis monooxygenase
38 PPCD01000004.1 GCA002914355_00026 CDS open 17344-17550 _na     68_aa Nicotinate phosphoribosyltransferase
39 PPCD01000004.1 GCA002914355_00027 CDS open 17602-18489 _na     295_aa Large polyvalent protein-associated domain-containing protein
40 PPCD01000004.1 GCA002914355_00028 CDS open 18586-21324 _na     912_aa pqqL Zinc protease pqqL
41 PPCD01000004.1 GCA002914355_00029 CDS open 21399-22115 _na     238_aa Solute-binding protein family 3/N-terminal domain-containing protein
42 PPCD01000004.1 GCA002914355_00030 CDS open 22310-24262 _na     650_aa DNA polymerase III
43 PPCD01000004.1 GCA002914355_00013 gene open 77-775
44 PPCD01000004.1 GCA002914355_00014 gene open 790-2808
45 PPCD01000004.1 GCA002914355_00015 gene open 2801-3520
46 PPCD01000004.1 GCA002914355_00016 gene open 3883-4782
47 PPCD01000004.1 GCA002914355_00017 gene open 4992-5723
48 PPCD01000004.1 GCA002914355_00018 gene open 5705-6814 dxr
49 PPCD01000004.1 GCA002914355_00019 gene open 6801-8036
50 PPCD01000004.1 GCA002914355_00020 gene open 8036-9328
51 PPCD01000004.1 GCA002914355_00021 gene open 9325-10332 tsaD
52 PPCD01000004.1 GCA002914355_00022 gene open 10428-12515
53 PPCD01000004.1 GCA002914355_00023 gene open 12508-14340
54 PPCD01000004.1 GCA002914355_00024 gene open 14389-16842
55 PPCD01000004.1 GCA002914355_00025 gene open 17003-17296
56 PPCD01000004.1 GCA002914355_00026 gene open 17344-17550
57 PPCD01000004.1 GCA002914355_00027 gene open 17602-18489
58 PPCD01000004.1 GCA002914355_00028 gene open 18586-21324 pqqL
59 PPCD01000004.1 GCA002914355_00029 gene open 21399-22115
60 PPCD01000004.1 GCA002914355_00030 gene open 22310-24262
61 PPCD01000005.1 GCA002914355_00031 CDS open 121-822 _na     233_aa Periplasmic ATP
62 PPCD01000005.1 GCA002914355_00032 CDS open 823-2040 _na     405_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
63 PPCD01000005.1 GCA002914355_00033 CDS open 2050-2490 _na     146_aa Phosphoribosyltransferase domain-containing protein
64 PPCD01000005.1 GCA002914355_00034 CDS open 2503-3795 _na     430_aa Xanthine
65 PPCD01000005.1 GCA002914355_00035 CDS open 3807-4868 _na     353_aa mqnE aminofutalosine synthase MqnE
66 PPCD01000005.1 GCA002914355_00036 CDS open 4982-7477 _na     831_aa [protein-PII] uridylyltransferase
67 PPCD01000005.1 GCA002914355_00037 CDS open 7481-9292 _na     603_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
68 PPCD01000005.1 GCA002914355_00038 CDS open 9667-10161 _na     164_aa DJ-1/PfpI domain-containing protein
69 PPCD01000005.1 GCA002914355_00039 CDS open 10173-11372 _na     399_aa Tetrahydrodipicolinate succinylase
70 PPCD01000005.1 GCA002914355_00040 CDS open 11534-12130 _na     198_aa DUF1440 domain-containing protein
71 PPCD01000005.1 GCA002914355_00041 CDS open 12295-12747 _na     150_aa DUF2262 domain-containing protein
72 PPCD01000005.1 GCA002914355_00042 CDS open 12905-13594 _na     229_aa Cytochrome-c oxidase
73 PPCD01000005.1 GCA002914355_00043 CDS open 13697-15034 _na     445_aa UPF0210 protein Ccon26_06850
74 PPCD01000005.1 GCA002914355_00044 CDS open 15044-15310 _na     88_aa ACT domain-containing protein
75 PPCD01000005.1 GCA002914355_00045 CDS open 15455-16555 _na     366_aa Iron-sulfur cluster carrier protein
76 PPCD01000005.1 GCA002914355_00046 CDS open 16549-17847 _na     432_aa thiC phosphomethylpyrimidine synthase ThiC
77 PPCD01000005.1 GCA002914355_00047 CDS open 17995-19113 _na     372_aa ispDF bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
78 PPCD01000005.1 GCA002914355_00048 CDS open 19110-20000 _na     296_aa Response regulatory domain-containing protein
79 PPCD01000005.1 GCA002914355_00049 CDS open 19978-21159 _na     393_aa Sulfate adenylyltransferase
80 PPCD01000005.1 GCA002914355_00050 CDS open 21168-21635 _na     155_aa Phosphatidylglycerophosphatase A
81 PPCD01000005.1 GCA002914355_00051 CDS open 21690-22151 _na     153_aa Response regulator
82 PPCD01000005.1 GCA002914355_00052 CDS open 22202-23155 _na     317_aa hemH ferrochelatase
83 PPCD01000005.1 GCA002914355_00053 CDS open 23155-24024 _na     289_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
84 PPCD01000005.1 GCA002914355_00054 CDS open 24192-26750 _na     852_aa alaS alanine--tRNA ligase
85 PPCD01000005.1 GCA002914355_00055 CDS open 26747-27247 _na     166_aa 3-isopropylmalate dehydratase small subunit
86 PPCD01000005.1 GCA002914355_00056 CDS open 27244-27786 _na     180_aa maf septum formation inhibitor Maf
87 PPCD01000005.1 GCA002914355_00057 CDS open 27783-29711 _na     642_aa peptidoglycan glycosyltransferase
88 PPCD01000005.1 GCA002914355_00058 CDS open 29721-30047 _na     108_aa Late competence protein ComEA%2C DNA receptor
89 PPCD01000005.1 GCA002914355_00059 CDS open 30084-30716 _na     210_aa DUF1705 domain-containing protein
90 PPCD01000005.1 GCA002914355_00060 CDS open 30786-31655 _na     289_aa phosphoethanolamine transferase
91 PPCD01000005.1 GCA002914355_00061 CDS open 31714-33732 _na     672_aa Glycine--tRNA ligase beta subunit
92 PPCD01000005.1 GCA002914355_00062 CDS open 33729-33881 _na     50_aa Small hydrophobic protein
93 PPCD01000005.1 GCA002914355_00063 CDS open 33885-35288 _na     467_aa Endonuclease/exonuclease/phosphatase domain-containing protein
94 PPCD01000005.1 GCA002914355_00064 CDS open 35285-35764 _na     159_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
95 PPCD01000005.1 GCA002914355_00065 CDS open 35839-37026 _na     395_aa Multifunctional tRNA nucleotidyl transferase / 2'3'-cyclic phosphodiesterase / 2' nucleotidase/phosphatase
96 PPCD01000005.1 GCA002914355_00066 CDS open 36986-37402 _na     138_aa Campylobacter invasion antigen D C-terminal domain-containing protein
97 PPCD01000005.1 GCA002914355_00067 CDS open 37399-37644 _na     81_aa Tetratricopeptide repeat protein
98 PPCD01000005.1 GCA002914355_00068 CDS open 37641-38708 _na     355_aa leuB 3-isopropylmalate dehydrogenase
99 PPCD01000005.1 GCA002914355_00069 CDS open 38712-39191 _na     159_aa 3-isopropylmalate dehydratase small subunit
100 PPCD01000005.1 GCA002914355_00070 CDS open 39316-39498 _na     60_aa Thiol:disulfide interchange protein
101 PPCD01000005.1 GCA002914355_00071 CDS open 39504-39665 _na     53_aa DUF2892 domain-containing protein
102 PPCD01000005.1 GCA002914355_00072 CDS open 39676-41013 _na     445_aa FAD/NAD(P)-binding domain-containing protein
103 PPCD01000005.1 GCA002914355_00073 CDS open 41098-41742 _na     214_aa HTH crp-type domain-containing protein
104 PPCD01000005.1 GCA002914355_00074 CDS open 41826-42785 _na     319_aa C4-dicarboxylate ABC transporter
105 PPCD01000005.1 GCA002914355_00075 CDS open 42806-43657 _na     283_aa Sugar-binding protein
106 PPCD01000005.1 GCA002914355_00076 CDS open 43847-44743 _na     298_aa DUF4299 domain-containing protein
107 PPCD01000005.1 GCA002914355_00077 CDS open 44763-45122 _na     119_aa drsE Putative DrsE domain protein
108 PPCD01000005.1 GCA002914355_00078 CDS open 45197-45796 _na     199_aa Putative threonine efflux protein
109 PPCD01000005.1 GCA002914355_00079 CDS open 45905-46951 _na     348_aa Asparaginase II
110 PPCD01000005.1 GCA002914355_00080 CDS open 47037-47372 _na     111_aa azlD Branched-chain amino acid transporter AzlD
111 PPCD01000005.1 GCA002914355_00081 CDS open 47369-48031 _na     220_aa Branched-chain amino acid transport protein
112 PPCD01000005.1 GCA002914355_00082 CDS open 48135-48584 _na     149_aa beta-lactamase
113 PPCD01000005.1 GCA002914355_00083 CDS open 48712-48825 _na     37_aa Phosphohydrolase
114 PPCD01000005.1 GCA002914355_00084 CDS open 48831-49616 _na     261_aa flgG flagellar basal-body rod protein FlgG
115 PPCD01000005.1 GCA002914355_00085 CDS open 49635-50444 _na     269_aa Flagellar basal body rod protein
116 PPCD01000005.1 GCA002914355_00086 CDS open 50634-53600 _na     988_aa Outer membrane receptor protein%2C mostly Fe transport
117 PPCD01000005.1 GCA002914355_00087 CDS open 53753-55609 _na     618_aa rpoD RNA polymerase sigma factor RpoD
118 PPCD01000005.1 GCA002914355_00088 CDS open 55900-56418 _na     172_aa Flavodoxin
119 PPCD01000005.1 GCA002914355_00089 CDS open 56415-57632 _na     405_aa Putative radical SAM family enzyme
120 PPCD01000005.1 GCA002914355_00090 CDS open 57641-58450 _na     269_aa ABC transporter substrate-binding protein
121 PPCD01000005.1 GCA002914355_00091 CDS open 58470-59237 _na     255_aa Hemin uptake system ATP-binding protein
122 PPCD01000005.1 GCA002914355_00092 CDS open 59234-60217 _na     327_aa Hemin uptake system permease protein
123 PPCD01000005.1 GCA002914355_00093 CDS open 60453-61187 _na     244_aa hugZ HugZ family heme oxygenase
124 PPCD01000005.1 GCA002914355_00094 CDS open 61470-62225 _na     251_aa Flagellin N-terminal domain-containing protein
125 PPCD01000005.1 GCA002914355_00095 CDS open 62310-63602 _na     430_aa Histidinol dehydrogenase
126 PPCD01000005.1 GCA002914355_00096 CDS open 63599-64450 _na     283_aa 1-aminocyclopropane-1-carboxylate deaminase
127 PPCD01000005.1 GCA002914355_00097 CDS open 64443-65534 _na     363_aa OmpA-like domain-containing protein
128 PPCD01000005.1 GCA002914355_00098 CDS open 65531-66844 _na     437_aa Membrane protein
129 PPCD01000005.1 GCA002914355_00099 CDS open 66849-67913 _na     354_aa fbaA class II fructose-bisphosphate aldolase
130 PPCD01000005.1 GCA002914355_00100 CDS open 67929-68747 _na     272_aa peptidylprolyl isomerase
131 PPCD01000005.1 GCA002914355_00101 CDS open 68843-69475 _na     210_aa nth endonuclease III
132 PPCD01000005.1 GCA002914355_00102 CDS open 69468-71198 _na     576_aa dsbD Thiol:disulfide interchange protein DsbD
133 PPCD01000005.1 GCA002914355_00103 CDS open 71304-72113 _na     269_aa ppk2 polyphosphate kinase 2
134 PPCD01000005.1 GCA002914355_00104 CDS open 72165-72596 _na     143_aa Trehalose-6-phosphate synthase
135 PPCD01000005.1 GCA002914355_00105 CDS open 72722-74596 _na     624_aa dnaK molecular chaperone DnaK
136 PPCD01000005.1 GCA002914355_00106 CDS open 74632-75174 _na     180_aa grpE nucleotide exchange factor GrpE
137 PPCD01000005.1 GCA002914355_00107 CDS open 75171-75965 _na     264_aa hrcA HrcA family transcriptional regulator
138 PPCD01000005.1 GCA002914355_00031 gene open 121-822
139 PPCD01000005.1 GCA002914355_00032 gene open 823-2040
140 PPCD01000005.1 GCA002914355_00033 gene open 2050-2490
141 PPCD01000005.1 GCA002914355_00034 gene open 2503-3795
142 PPCD01000005.1 GCA002914355_00035 gene open 3807-4868 mqnE
143 PPCD01000005.1 GCA002914355_00036 gene open 4982-7477
144 PPCD01000005.1 GCA002914355_00037 gene open 7481-9292 glmS
145 PPCD01000005.1 GCA002914355_00038 gene open 9667-10161
146 PPCD01000005.1 GCA002914355_00039 gene open 10173-11372
147 PPCD01000005.1 GCA002914355_00040 gene open 11534-12130
148 PPCD01000005.1 GCA002914355_00041 gene open 12295-12747
149 PPCD01000005.1 GCA002914355_00042 gene open 12905-13594
150 PPCD01000005.1 GCA002914355_00043 gene open 13697-15034
151 PPCD01000005.1 GCA002914355_00044 gene open 15044-15310
152 PPCD01000005.1 GCA002914355_00045 gene open 15455-16555
153 PPCD01000005.1 GCA002914355_00046 gene open 16549-17847 thiC
154 PPCD01000005.1 GCA002914355_00047 gene open 17995-19113 ispDF
155 PPCD01000005.1 GCA002914355_00048 gene open 19110-20000
156 PPCD01000005.1 GCA002914355_00049 gene open 19978-21159
157 PPCD01000005.1 GCA002914355_00050 gene open 21168-21635
158 PPCD01000005.1 GCA002914355_00051 gene open 21690-22151
159 PPCD01000005.1 GCA002914355_00052 gene open 22202-23155 hemH
160 PPCD01000005.1 GCA002914355_00053 gene open 23155-24024
161 PPCD01000005.1 GCA002914355_00054 gene open 24192-26750 alaS
162 PPCD01000005.1 GCA002914355_00055 gene open 26747-27247
163 PPCD01000005.1 GCA002914355_00056 gene open 27244-27786 maf
164 PPCD01000005.1 GCA002914355_00057 gene open 27783-29711
165 PPCD01000005.1 GCA002914355_00058 gene open 29721-30047
166 PPCD01000005.1 GCA002914355_00059 gene open 30084-30716
167 PPCD01000005.1 GCA002914355_00060 gene open 30786-31655
168 PPCD01000005.1 GCA002914355_00061 gene open 31714-33732
169 PPCD01000005.1 GCA002914355_00062 gene open 33729-33881
170 PPCD01000005.1 GCA002914355_00063 gene open 33885-35288
171 PPCD01000005.1 GCA002914355_00064 gene open 35285-35764
172 PPCD01000005.1 GCA002914355_00065 gene open 35839-37026
173 PPCD01000005.1 GCA002914355_00066 gene open 36986-37402
174 PPCD01000005.1 GCA002914355_00067 gene open 37399-37644
175 PPCD01000005.1 GCA002914355_00068 gene open 37641-38708 leuB
176 PPCD01000005.1 GCA002914355_00069 gene open 38712-39191
177 PPCD01000005.1 GCA002914355_00070 gene open 39316-39498
178 PPCD01000005.1 GCA002914355_00071 gene open 39504-39665
179 PPCD01000005.1 GCA002914355_00072 gene open 39676-41013
180 PPCD01000005.1 GCA002914355_00073 gene open 41098-41742
181 PPCD01000005.1 GCA002914355_00074 gene open 41826-42785
182 PPCD01000005.1 GCA002914355_00075 gene open 42806-43657
183 PPCD01000005.1 GCA002914355_00076 gene open 43847-44743
184 PPCD01000005.1 GCA002914355_00077 gene open 44763-45122 drsE
185 PPCD01000005.1 GCA002914355_00078 gene open 45197-45796
186 PPCD01000005.1 GCA002914355_00079 gene open 45905-46951
187 PPCD01000005.1 GCA002914355_00080 gene open 47037-47372 azlD
188 PPCD01000005.1 GCA002914355_00081 gene open 47369-48031
189 PPCD01000005.1 GCA002914355_00082 gene open 48135-48584
190 PPCD01000005.1 GCA002914355_00083 gene open 48712-48825
191 PPCD01000005.1 GCA002914355_00084 gene open 48831-49616 flgG
192 PPCD01000005.1 GCA002914355_00085 gene open 49635-50444
193 PPCD01000005.1 GCA002914355_00086 gene open 50634-53600
194 PPCD01000005.1 GCA002914355_00087 gene open 53753-55609 rpoD
195 PPCD01000005.1 GCA002914355_00088 gene open 55900-56418
196 PPCD01000005.1 GCA002914355_00089 gene open 56415-57632
197 PPCD01000005.1 GCA002914355_00090 gene open 57641-58450
198 PPCD01000005.1 GCA002914355_00091 gene open 58470-59237
199 PPCD01000005.1 GCA002914355_00092 gene open 59234-60217
200 PPCD01000005.1 GCA002914355_00093 gene open 60453-61187 hugZ
201 PPCD01000005.1 GCA002914355_00094 gene open 61470-62225
202 PPCD01000005.1 GCA002914355_00095 gene open 62310-63602
203 PPCD01000005.1 GCA002914355_00096 gene open 63599-64450
204 PPCD01000005.1 GCA002914355_00097 gene open 64443-65534
205 PPCD01000005.1 GCA002914355_00098 gene open 65531-66844
206 PPCD01000005.1 GCA002914355_00099 gene open 66849-67913 fbaA
207 PPCD01000005.1 GCA002914355_00100 gene open 67929-68747
208 PPCD01000005.1 GCA002914355_00101 gene open 68843-69475 nth
209 PPCD01000005.1 GCA002914355_00102 gene open 69468-71198 dsbD
210 PPCD01000005.1 GCA002914355_00103 gene open 71304-72113 ppk2
211 PPCD01000005.1 GCA002914355_00104 gene open 72165-72596
212 PPCD01000005.1 GCA002914355_00105 gene open 72722-74596 dnaK
213 PPCD01000005.1 GCA002914355_00106 gene open 74632-75174 grpE
214 PPCD01000005.1 GCA002914355_00107 gene open 75171-75965 hrcA
215 PPCD01000006.1 repeat_region open 44604-46051 CRISPR array with 20 repeats of length 21%2C consensus sequence ATTTAAACAAATTTGACCCGA and spacer length 53
216 PPCD01000006.1 GCA002914355_00108 CDS open 105-719 _na     204_aa hypothetical protein
217 PPCD01000006.1 GCA002914355_00109 CDS open 722-1144 _na     140_aa Acyl-CoA thioesterase
218 PPCD01000006.1 GCA002914355_00110 CDS open 1141-1659 _na     172_aa lolA Outer membrane lipoprotein carrier protein LolA
219 PPCD01000006.1 GCA002914355_00111 CDS open 1656-3884 _na     742_aa Membrane protein%2C exporter
220 PPCD01000006.1 GCA002914355_00112 CDS open 4555-5652 _na     365_aa Competence/damage-inducible domain protein
221 PPCD01000006.1 GCA002914355_00113 CDS open 5748-8504 _na     918_aa ileS isoleucine--tRNA ligase
222 PPCD01000006.1 GCA002914355_00114 CDS open 8604-9962 _na     452_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
223 PPCD01000006.1 GCA002914355_00115 CDS open 9967-11415 _na     482_aa guaB IMP dehydrogenase
224 PPCD01000006.1 GCA002914355_00116 CDS open 11415-12521 _na     368_aa homoserine O-acetyltransferase
225 PPCD01000006.1 GCA002914355_00117 CDS open 12525-12716 _na     63_aa xseB exodeoxyribonuclease VII small subunit
226 PPCD01000006.1 GCA002914355_00118 CDS open 12709-13503 _na     264_aa CN hydrolase domain-containing protein
227 PPCD01000006.1 GCA002914355_00119 CDS open 13578-13931 _na     117_aa DNA-binding protein%2C MmcQ/YjbR family
228 PPCD01000006.1 GCA002914355_00120 CDS open 13996-15324 _na     442_aa murC UDP-N-acetylmuramate--L-alanine ligase
229 PPCD01000006.1 GCA002914355_00121 CDS open 15324-15641 _na     105_aa hypothetical protein
230 PPCD01000006.1 GCA002914355_00122 CDS open 15635-15979 _na     114_aa Integral membrane protein
231 PPCD01000006.1 GCA002914355_00123 CDS open 15976-18180 _na     734_aa mutS2 endonuclease MutS2
232 PPCD01000006.1 GCA002914355_00124 CDS open 18256-20169 _na     637_aa Diguanylate cyclase/phosphodiesterase
233 PPCD01000006.1 GCA002914355_00125 CDS open 20178-21266 _na     362_aa dapE succinyl-diaminopimelate desuccinylase
234 PPCD01000006.1 GCA002914355_00126 CDS open 21481-21570 _na     29_aa hypothetical protein
235 PPCD01000006.1 GCA002914355_00127 CDS open 21599-22042 _na     147_aa DUF2809 domain-containing protein
236 PPCD01000006.1 GCA002914355_00128 CDS open 22118-24754 _na     878_aa polA DNA polymerase I
237 PPCD01000006.1 GCA002914355_00129 CDS open 24874-25917 _na     347_aa Glycosyltransferase%2C family 1
238 PPCD01000006.1 GCA002914355_00130 CDS open 25914-26858 _na     314_aa waaF lipopolysaccharide heptosyltransferase II
239 PPCD01000006.1 GCA002914355_00131 CDS open 26997-27425 _na     142_aa exbB TonB-system energizer ExbB
240 PPCD01000006.1 GCA002914355_00132 CDS open 27412-27795 _na     127_aa exbD TonB system transport protein ExbD
241 PPCD01000006.1 GCA002914355_00133 CDS open 27770-28546 _na     258_aa tonB Energy transduction protein TonB
242 PPCD01000006.1 GCA002914355_00135 CDS open 29017-29322 _na     101_aa hypothetical protein
243 PPCD01000006.1 GCA002914355_00136 CDS open 29322-30755 _na     477_aa relaxase/mobilization nuclease domain-containing protein
244 PPCD01000006.1 GCA002914355_00137 CDS open 30757-31065 _na     102_aa plasmid mobilization protein
245 PPCD01000006.1 GCA002914355_00138 CDS open 31070-31267 _na     65_aa helix-turn-helix domain-containing protein
246 PPCD01000006.1 GCA002914355_00139 CDS open 31364-32101 _na     245_aa hypothetical protein
247 PPCD01000006.1 GCA002914355_00140 CDS open 32091-33233 _na     380_aa Site-specific integrase
248 PPCD01000006.1 GCA002914355_00141 CDS open 33237-34451 _na     404_aa AAA+ ATPase domain-containing protein
249 PPCD01000006.1 GCA002914355_00142 CDS open 34546-35586 _na     346_aa RAMP superfamily CRISPR-associated protein
250 PPCD01000006.1 GCA002914355_00143 CDS open 35579-36463 _na     294_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
251 PPCD01000006.1 GCA002914355_00144 CDS open 36463-37101 _na     212_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
252 PPCD01000006.1 GCA002914355_00145 CDS open 37111-37518 _na     135_aa CRISPR system Cms protein Csm2
253 PPCD01000006.1 GCA002914355_00146 CDS open 37515-39023 _na     502_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
254 PPCD01000006.1 GCA002914355_00147 CDS open 39010-39846 _na     278_aa CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6
255 PPCD01000006.1 GCA002914355_00148 CDS open 39843-40235 _na     130_aa csx20 CRISPR-associated protein Csx20
256 PPCD01000006.1 GCA002914355_00149 CDS open 40416-41648 _na     410_aa csx2 TIGR02221 family CRISPR-associated protein
257 PPCD01000006.1 GCA002914355_00150 CDS open 41650-43884 _na     744_aa cas1 CRISPR-associated endonuclease Cas1
258 PPCD01000006.1 GCA002914355_00151 CDS open 43884-44159 _na     91_aa cas2 CRISPR-associated endonuclease Cas2
259 PPCD01000006.1 GCA002914355_00152 CDS open 46457-46690 _na     77_aa hypothetical protein
260 PPCD01000006.1 GCA002914355_00153 CDS open 46695-46835 _na     46_aa hypothetical protein
261 PPCD01000006.1 GCA002914355_00154 CDS open 46861-47088 _na     75_aa hypothetical protein
262 PPCD01000006.1 GCA002914355_00155 CDS open 47108-47569 _na     153_aa hypothetical protein
263 PPCD01000006.1 GCA002914355_00156 CDS open 47819-47932 _na     37_aa hypothetical protein
264 PPCD01000006.1 GCA002914355_00157 CDS open 47934-48035 _na     33_aa hypothetical protein
265 PPCD01000006.1 GCA002914355_00158 CDS open 48255-49217 _na     320_aa WYL domain-containing protein
266 PPCD01000006.1 GCA002914355_00159 CDS open 49218-49901 _na     227_aa Macro domain-containing protein
267 PPCD01000006.1 GCA002914355_00160 CDS open 49910-50530 _na     206_aa DUF4433 domain-containing protein
268 PPCD01000006.1 GCA002914355_00161 CDS open 50600-51922 _na     440_aa CRISPR-associated DxTHG motif protein
269 PPCD01000006.1 GCA002914355_00162 CDS open 52019-52393 _na     124_aa csx20 CRISPR-associated protein Csx20
270 PPCD01000006.1 GCA002914355_00108 gene open 105-719
271 PPCD01000006.1 GCA002914355_00109 gene open 722-1144
272 PPCD01000006.1 GCA002914355_00110 gene open 1141-1659 lolA
273 PPCD01000006.1 GCA002914355_00111 gene open 1656-3884
274 PPCD01000006.1 GCA002914355_00112 gene open 4555-5652
275 PPCD01000006.1 GCA002914355_00113 gene open 5748-8504 ileS
276 PPCD01000006.1 GCA002914355_00114 gene open 8604-9962 gatA
277 PPCD01000006.1 GCA002914355_00115 gene open 9967-11415 guaB
278 PPCD01000006.1 GCA002914355_00116 gene open 11415-12521
279 PPCD01000006.1 GCA002914355_00117 gene open 12525-12716 xseB
280 PPCD01000006.1 GCA002914355_00118 gene open 12709-13503
281 PPCD01000006.1 GCA002914355_00119 gene open 13578-13931
282 PPCD01000006.1 GCA002914355_00120 gene open 13996-15324 murC
283 PPCD01000006.1 GCA002914355_00121 gene open 15324-15641
284 PPCD01000006.1 GCA002914355_00122 gene open 15635-15979
285 PPCD01000006.1 GCA002914355_00123 gene open 15976-18180 mutS2
286 PPCD01000006.1 GCA002914355_00124 gene open 18256-20169
287 PPCD01000006.1 GCA002914355_00125 gene open 20178-21266 dapE
288 PPCD01000006.1 GCA002914355_00126 gene open 21481-21570
289 PPCD01000006.1 GCA002914355_00127 gene open 21599-22042
290 PPCD01000006.1 GCA002914355_00128 gene open 22118-24754 polA
291 PPCD01000006.1 GCA002914355_00129 gene open 24874-25917
292 PPCD01000006.1 GCA002914355_00130 gene open 25914-26858 waaF
293 PPCD01000006.1 GCA002914355_00131 gene open 26997-27425 exbB
294 PPCD01000006.1 GCA002914355_00132 gene open 27412-27795 exbD
295 PPCD01000006.1 GCA002914355_00133 gene open 27770-28546 tonB
296 PPCD01000006.1 GCA002914355_00135 gene open 29017-29322
297 PPCD01000006.1 GCA002914355_00136 gene open 29322-30755
298 PPCD01000006.1 GCA002914355_00137 gene open 30757-31065
299 PPCD01000006.1 GCA002914355_00138 gene open 31070-31267
300 PPCD01000006.1 GCA002914355_00139 gene open 31364-32101
301 PPCD01000006.1 GCA002914355_00140 gene open 32091-33233
302 PPCD01000006.1 GCA002914355_00141 gene open 33237-34451
303 PPCD01000006.1 GCA002914355_00142 gene open 34546-35586
304 PPCD01000006.1 GCA002914355_00143 gene open 35579-36463 csm4
305 PPCD01000006.1 GCA002914355_00144 gene open 36463-37101 csm3
306 PPCD01000006.1 GCA002914355_00145 gene open 37111-37518
307 PPCD01000006.1 GCA002914355_00146 gene open 37515-39023 cas10
308 PPCD01000006.1 GCA002914355_00147 gene open 39010-39846
309 PPCD01000006.1 GCA002914355_00148 gene open 39843-40235 csx20
310 PPCD01000006.1 GCA002914355_00149 gene open 40416-41648 csx2
311 PPCD01000006.1 GCA002914355_00150 gene open 41650-43884 cas1
312 PPCD01000006.1 GCA002914355_00151 gene open 43884-44159 cas2
313 PPCD01000006.1 GCA002914355_00152 gene open 46457-46690
314 PPCD01000006.1 GCA002914355_00153 gene open 46695-46835
315 PPCD01000006.1 GCA002914355_00154 gene open 46861-47088
316 PPCD01000006.1 GCA002914355_00155 gene open 47108-47569
317 PPCD01000006.1 GCA002914355_00156 gene open 47819-47932
318 PPCD01000006.1 GCA002914355_00157 gene open 47934-48035
319 PPCD01000006.1 GCA002914355_00158 gene open 48255-49217
320 PPCD01000006.1 GCA002914355_00159 gene open 49218-49901
321 PPCD01000006.1 GCA002914355_00160 gene open 49910-50530
322 PPCD01000006.1 GCA002914355_00161 gene open 50600-51922
323 PPCD01000006.1 GCA002914355_00162 gene open 52019-52393 csx20
324 PPCD01000006.1 GCA002914355_00134 gene open 28709-28784 trnF
325 PPCD01000006.1 GCA002914355_00134 tRNA open 28709-28784 trnF tRNA-Phe(gaa)
326 PPCD01000007.1 GCA002914355_00163 CDS open 122-2458 _na     778_aa DUF3971 domain-containing protein
327 PPCD01000007.1 GCA002914355_00164 CDS open 2677-3018 _na     113_aa hypA hydrogenase maturation nickel metallochaperone HypA
328 PPCD01000007.1 GCA002914355_00165 CDS open 3018-4010 _na     330_aa hypE hydrogenase expression/formation protein HypE
329 PPCD01000007.1 GCA002914355_00166 CDS open 4019-5107 _na     362_aa hypD hydrogenase formation protein HypD
330 PPCD01000007.1 GCA002914355_00167 CDS open 5107-5346 _na     79_aa hypC Hydrogenase assembly chaperone HypC
331 PPCD01000007.1 GCA002914355_00168 CDS open 5346-6158 _na     270_aa hypB hydrogenase nickel incorporation protein HypB
332 PPCD01000007.1 GCA002914355_00169 CDS open 6327-6932 _na     201_aa Periplasmic protein
333 PPCD01000007.1 GCA002914355_00170 CDS open 6929-8188 _na     419_aa DUF2157 domain-containing protein
334 PPCD01000007.1 GCA002914355_00171 CDS open 8588-9001 _na     137_aa nikR nickel-responsive transcriptional regulator NikR
335 PPCD01000007.1 GCA002914355_00172 CDS open 9047-11272 _na     741_aa hypF carbamoyltransferase HypF
336 PPCD01000007.1 GCA002914355_00173 CDS open 11256-12728 _na     490_aa hydE Protein hydE
337 PPCD01000007.1 GCA002914355_00174 CDS open 12725-13267 _na     180_aa Hydrogenase maturation protease
338 PPCD01000007.1 GCA002914355_00175 CDS open 13267-13947 _na     226_aa cybH Ni/Fe-hydrogenase%2C b-type cytochrome subunit
339 PPCD01000007.1 GCA002914355_00176 CDS open 13957-15675 _na     572_aa [NiFe] hydrogenase%2C large subunit
340 PPCD01000007.1 GCA002914355_00177 CDS open 15685-16830 _na     381_aa [NiFe] hydrogenase%2C small subunit
341 PPCD01000007.1 GCA002914355_00163 gene open 122-2458
342 PPCD01000007.1 GCA002914355_00164 gene open 2677-3018 hypA
343 PPCD01000007.1 GCA002914355_00165 gene open 3018-4010 hypE
344 PPCD01000007.1 GCA002914355_00166 gene open 4019-5107 hypD
345 PPCD01000007.1 GCA002914355_00167 gene open 5107-5346 hypC
346 PPCD01000007.1 GCA002914355_00168 gene open 5346-6158 hypB
347 PPCD01000007.1 GCA002914355_00169 gene open 6327-6932
348 PPCD01000007.1 GCA002914355_00170 gene open 6929-8188
349 PPCD01000007.1 GCA002914355_00171 gene open 8588-9001 nikR
350 PPCD01000007.1 GCA002914355_00172 gene open 9047-11272 hypF
351 PPCD01000007.1 GCA002914355_00173 gene open 11256-12728 hydE
352 PPCD01000007.1 GCA002914355_00174 gene open 12725-13267
353 PPCD01000007.1 GCA002914355_00175 gene open 13267-13947 cybH
354 PPCD01000007.1 GCA002914355_00176 gene open 13957-15675
355 PPCD01000007.1 GCA002914355_00177 gene open 15685-16830
356 PPCD01000008.1 GCA002914355_00178 CDS open 46-645 _na     199_aa Alkyl hydroperoxide reductase protein%2C peroxidase component
357 PPCD01000008.1 GCA002914355_00179 CDS open 768-1850 _na     360_aa pilZ PilZ domain-containing protein
358 PPCD01000008.1 GCA002914355_00180 CDS open 1859-4147 _na     762_aa herA Helicase HerA central domain-containing protein
359 PPCD01000008.1 GCA002914355_00181 CDS open 4206-4817 _na     203_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
360 PPCD01000008.1 GCA002914355_00182 CDS open 4814-5140 _na     108_aa Dihydroneopterin aldolase
361 PPCD01000008.1 GCA002914355_00183 CDS open 5217-5888 _na     223_aa ompR Two-component system response regulator
362 PPCD01000008.1 GCA002914355_00184 CDS open 5867-7144 _na     425_aa histidine kinase
363 PPCD01000008.1 GCA002914355_00185 CDS open 7147-8595 _na     482_aa Guanosine-5'-triphosphate%2C 3'-diphosphate pyrophosphatase
364 PPCD01000008.1 GCA002914355_00186 CDS open 8656-9534 _na     292_aa Excinuclease ABC subunit A
365 PPCD01000008.1 GCA002914355_00187 CDS open 9531-9848 _na     105_aa fliN flagellar motor switch protein FliN
366 PPCD01000008.1 GCA002914355_00178 gene open 46-645
367 PPCD01000008.1 GCA002914355_00179 gene open 768-1850 pilZ
368 PPCD01000008.1 GCA002914355_00180 gene open 1859-4147 herA
369 PPCD01000008.1 GCA002914355_00181 gene open 4206-4817 plsY
370 PPCD01000008.1 GCA002914355_00182 gene open 4814-5140
371 PPCD01000008.1 GCA002914355_00183 gene open 5217-5888 ompR
372 PPCD01000008.1 GCA002914355_00184 gene open 5867-7144
373 PPCD01000008.1 GCA002914355_00185 gene open 7147-8595
374 PPCD01000008.1 GCA002914355_00186 gene open 8656-9534
375 PPCD01000008.1 GCA002914355_00187 gene open 9531-9848 fliN
376 PPCD01000009.1 GCA002914355_00188 CDS open 170-685 _na     171_aa hypothetical protein
377 PPCD01000009.1 GCA002914355_00189 CDS open 679-2496 _na     605_aa uvrC excinuclease ABC subunit UvrC
378 PPCD01000009.1 GCA002914355_00190 CDS open 2493-3248 _na     251_aa hypothetical protein
379 PPCD01000009.1 GCA002914355_00191 CDS open 3238-6108 _na     956_aa Response regulatory domain-containing protein
380 PPCD01000009.1 GCA002914355_00192 CDS open 6105-7376 _na     423_aa Anthranilate synthase component I
381 PPCD01000009.1 GCA002914355_00193 CDS open 7528-8268 _na     246_aa putative membrane transporter protein
382 PPCD01000009.1 GCA002914355_00194 CDS open 8299-9759 _na     486_aa SAM-dependent methyltransferase
383 PPCD01000009.1 GCA002914355_00195 CDS open 9759-10838 _na     359_aa serC phosphoserine transaminase
384 PPCD01000009.1 GCA002914355_00196 CDS open 10841-12007 _na     388_aa xseA exodeoxyribonuclease VII large subunit
385 PPCD01000009.1 GCA002914355_00197 CDS open 12000-12722 _na     240_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
386 PPCD01000009.1 GCA002914355_00198 CDS open 12735-14141 _na     468_aa Adenylate cyclase
387 PPCD01000009.1 GCA002914355_00199 CDS open 14281-14691 _na     136_aa perR Peroxide stress transcriptional regulator PerR
388 PPCD01000009.1 GCA002914355_00200 CDS open 14764-16590 _na     608_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
389 PPCD01000009.1 GCA002914355_00201 CDS open 16583-17446 _na     287_aa fliH flagellar assembly protein FliH
390 PPCD01000009.1 GCA002914355_00202 CDS open 17443-18474 _na     343_aa fliG flagellar motor switch protein FliG
391 PPCD01000009.1 GCA002914355_00203 CDS open 18474-20171 _na     565_aa fliF flagellar basal-body MS-ring/collar protein FliF
392 PPCD01000009.1 GCA002914355_00204 CDS open 20176-21273 _na     365_aa hisC histidinol-phosphate transaminase
393 PPCD01000009.1 GCA002914355_00205 CDS open 21273-22352 _na     359_aa pheA prephenate dehydratase
394 PPCD01000009.1 GCA002914355_00206 CDS open 22330-23559 _na     409_aa lysA diaminopimelate decarboxylase
395 PPCD01000009.1 GCA002914355_00207 CDS open 23615-24679 _na     354_aa Permease YjgP/YjgQ family protein
396 PPCD01000009.1 GCA002914355_00208 CDS open 24676-25224 _na     182_aa pth aminoacyl-tRNA hydrolase
397 PPCD01000009.1 GCA002914355_00209 CDS open 25236-25772 _na     178_aa 50S ribosomal protein L25/general stress protein Ctc
398 PPCD01000009.1 GCA002914355_00210 CDS open 25891-26883 _na     330_aa transaldolase
399 PPCD01000009.1 GCA002914355_00211 CDS open 26890-27516 _na     208_aa serB phosphoserine phosphatase SerB
400 PPCD01000009.1 GCA002914355_00212 CDS open 27525-28022 _na     165_aa cheW Purine-binding chemotaxis protein CheW
401 PPCD01000009.1 GCA002914355_00213 CDS open 28032-30386 _na     784_aa histidine kinase
402 PPCD01000009.1 GCA002914355_00214 CDS open 30395-31348 _na     317_aa CheW-like domain-containing protein
403 PPCD01000009.1 GCA002914355_00215 CDS open 31348-32139 _na     263_aa Calcineurin-like phosphoesterase domain-containing protein
404 PPCD01000009.1 GCA002914355_00216 CDS open 32203-32688 _na     161_aa greA transcription elongation factor GreA
405 PPCD01000009.1 GCA002914355_00217 CDS open 32692-33726 _na     344_aa lpxB lipid-A-disaccharide synthase
406 PPCD01000009.1 GCA002914355_00218 CDS open 33829-34605 _na     258_aa surE 5'/3'-nucleotidase SurE
407 PPCD01000009.1 GCA002914355_00219 CDS open 34595-35245 _na     216_aa THIF-type NAD/FAD binding fold domain-containing protein
408 PPCD01000009.1 GCA002914355_00220 CDS open 35454-35792 _na     112_aa L-alanyl-D-glutamate peptidase
409 PPCD01000009.1 GCA002914355_00221 CDS open 35794-36093 _na     99_aa Holin
410 PPCD01000009.1 GCA002914355_00222 CDS open 36068-36325 _na     85_aa Lipoprotein
411 PPCD01000009.1 GCA002914355_00223 CDS open 36306-36683 _na     125_aa Septum formation initiator
412 PPCD01000009.1 GCA002914355_00224 CDS open 36692-37027 _na     111_aa Periplasmic protein
413 PPCD01000009.1 GCA002914355_00225 CDS open 37038-37385 _na     115_aa hypothetical protein
414 PPCD01000009.1 GCA002914355_00226 CDS open 37862-38254 _na     130_aa hypothetical protein
415 PPCD01000009.1 GCA002914355_00227 CDS open 38308-38667 _na     119_aa hypothetical protein
416 PPCD01000009.1 GCA002914355_00228 CDS open 38630-39439 _na     269_aa Lipoprotein
417 PPCD01000009.1 GCA002914355_00229 CDS open 39439-39654 _na     71_aa hypothetical protein
418 PPCD01000009.1 GCA002914355_00230 CDS open 39626-40390 _na     254_aa hypothetical protein
419 PPCD01000009.1 GCA002914355_00231 CDS open 40390-41586 _na     398_aa hypothetical protein
420 PPCD01000009.1 GCA002914355_00232 CDS open 41605-42441 _na     278_aa hypothetical protein
421 PPCD01000009.1 GCA002914355_00233 CDS open 42458-42757 _na     99_aa Methyltransferase
422 PPCD01000009.1 GCA002914355_00234 CDS open 42745-44175 _na     476_aa Replication initiation protein
423 PPCD01000009.1 GCA002914355_00235 CDS open 44260-44502 _na     80_aa hypothetical protein
424 PPCD01000009.1 GCA002914355_00236 CDS open 44527-44715 _na     62_aa hypothetical protein
425 PPCD01000009.1 GCA002914355_00237 CDS open 44718-44885 _na     55_aa hypothetical protein
426 PPCD01000009.1 GCA002914355_00238 CDS open 44885-45841 _na     318_aa IS110 family transposase
427 PPCD01000009.1 GCA002914355_00239 CDS open 46531-48045 _na     504_aa leuA 2-isopropylmalate synthase
428 PPCD01000009.1 GCA002914355_00240 CDS open 48190-48921 _na     243_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
429 PPCD01000009.1 GCA002914355_00241 CDS open 48914-49540 _na     208_aa Phosphatidylserine decarboxylase-related protein
430 PPCD01000009.1 GCA002914355_00242 CDS open 49543-51468 _na     641_aa ftsH ATP-dependent zinc metalloprotease FtsH
431 PPCD01000009.1 GCA002914355_00243 CDS open 51461-52294 _na     277_aa prmA 50S ribosomal protein L11 methyltransferase
432 PPCD01000009.1 GCA002914355_00244 CDS open 52294-52659 _na     121_aa cheY Chemotaxis regulator-transmits chemoreceptor signals to flagelllar motor components CheY
433 PPCD01000009.1 GCA002914355_00245 CDS open 52723-53433 _na     236_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
434 PPCD01000009.1 GCA002914355_00246 CDS open 53433-54044 _na     203_aa hisH imidazole glycerol phosphate synthase subunit HisH
435 PPCD01000009.1 GCA002914355_00247 CDS open 54041-54937 _na     298_aa pglG N-linked glycosylation glycosyltransferase PglG
436 PPCD01000009.1 GCA002914355_00248 CDS open 54940-56721 _na     593_aa pglF UDP-N-acetylglucosamine 4%2C6-dehydratase (configuration-retaining)
437 PPCD01000009.1 GCA002914355_00249 CDS open 56722-57813 _na     363_aa pglE UDP-N-acetylbacillosamine transaminase
438 PPCD01000009.1 GCA002914355_00250 CDS open 57862-58452 _na     196_aa pglD UDP-N-acetylbacillosamine N-acetyltransferase
439 PPCD01000009.1 GCA002914355_00251 CDS open 58439-59044 _na     201_aa pglC undecaprenyl phosphate N%2CN'-diacetylbacillosamine 1-phosphate transferase
440 PPCD01000009.1 GCA002914355_00252 CDS open 59037-60152 _na     371_aa pglA N%2CN'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1%2C3-N-acetylgalactosaminyltransferase
441 PPCD01000009.1 GCA002914355_00253 CDS open 60155-62254 _na     699_aa Undecaprenyl-diphosphooligosaccharide--protein glycotransferase
442 PPCD01000009.1 GCA002914355_00254 CDS open 62247-63371 _na     374_aa N-acetylgalactosamine-N%2C N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase
443 PPCD01000009.1 GCA002914355_00255 CDS open 63368-64411 _na     347_aa GalNAc-alpha-(1%2C4)-GalNAc-alpha-(1%2C 3)-diNAcBac-PP-undecaprenol alpha-1%2C4-N-acetyl-D-galactosaminyltransferase
444 PPCD01000009.1 GCA002914355_00256 CDS open 64408-65466 _na     352_aa GalNAc-alpha-(1%2C4)-GalNAc-alpha-(1%2C 3)-diNAcBac-PP-undecaprenol alpha-1%2C4-N-acetyl-D-galactosaminyltransferase
445 PPCD01000009.1 GCA002914355_00257 CDS open 65463-66395 _na     310_aa GalNAc5-diNAcBac-PP-undecaprenol beta-1%2C3-glucosyltransferase
446 PPCD01000009.1 GCA002914355_00258 CDS open 66396-67157 _na     253_aa LPS biosynthesis glycosyltransferase
447 PPCD01000009.1 GCA002914355_00259 CDS open 67158-68675 _na     505_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
448 PPCD01000009.1 GCA002914355_00260 CDS open 68675-70801 _na     708_aa Glycosyltransferase
449 PPCD01000009.1 GCA002914355_00261 CDS open 70810-72042 _na     410_aa UDP-glucose/GDP-mannose dehydrogenase C-terminal domain-containing protein
450 PPCD01000009.1 GCA002914355_00262 CDS open 72039-72479 _na     146_aa Putative Ecotin domain protein
451 PPCD01000009.1 GCA002914355_00263 CDS open 72476-73798 _na     440_aa UDP-glucose 6-dehydrogenase
452 PPCD01000009.1 GCA002914355_00264 CDS open 73807-74790 _na     327_aa galE UDP-glucose 4-epimerase GalE
453 PPCD01000009.1 GCA002914355_00265 CDS open 74871-75722 _na     283_aa DNA ligase
454 PPCD01000009.1 GCA002914355_00266 CDS open 75719-76297 _na     192_aa DNA-3-methyladenine glycosylase I%2C constitutive
455 PPCD01000009.1 GCA002914355_00267 CDS open 76307-77365 _na     352_aa NAD dependent epimerase/dehydratase family protein
456 PPCD01000009.1 GCA002914355_00268 CDS open 77411-78124 _na     237_aa DUF4272 domain-containing protein
457 PPCD01000009.1 GCA002914355_00269 CDS open 78127-79473 _na     448_aa malate dehydrogenase (quinone)
458 PPCD01000009.1 GCA002914355_00270 CDS open 79602-81443 _na     613_aa vctA Enterobactin receptor VctA
459 PPCD01000009.1 GCA002914355_00188 gene open 170-685
460 PPCD01000009.1 GCA002914355_00189 gene open 679-2496 uvrC
461 PPCD01000009.1 GCA002914355_00190 gene open 2493-3248
462 PPCD01000009.1 GCA002914355_00191 gene open 3238-6108
463 PPCD01000009.1 GCA002914355_00192 gene open 6105-7376
464 PPCD01000009.1 GCA002914355_00193 gene open 7528-8268
465 PPCD01000009.1 GCA002914355_00194 gene open 8299-9759
466 PPCD01000009.1 GCA002914355_00195 gene open 9759-10838 serC
467 PPCD01000009.1 GCA002914355_00196 gene open 10841-12007 xseA
468 PPCD01000009.1 GCA002914355_00197 gene open 12000-12722 ubiE
469 PPCD01000009.1 GCA002914355_00198 gene open 12735-14141
470 PPCD01000009.1 GCA002914355_00199 gene open 14281-14691 perR
471 PPCD01000009.1 GCA002914355_00200 gene open 14764-16590 dxs
472 PPCD01000009.1 GCA002914355_00201 gene open 16583-17446 fliH
473 PPCD01000009.1 GCA002914355_00202 gene open 17443-18474 fliG
474 PPCD01000009.1 GCA002914355_00203 gene open 18474-20171 fliF
475 PPCD01000009.1 GCA002914355_00204 gene open 20176-21273 hisC
476 PPCD01000009.1 GCA002914355_00205 gene open 21273-22352 pheA
477 PPCD01000009.1 GCA002914355_00206 gene open 22330-23559 lysA
478 PPCD01000009.1 GCA002914355_00207 gene open 23615-24679
479 PPCD01000009.1 GCA002914355_00208 gene open 24676-25224 pth
480 PPCD01000009.1 GCA002914355_00209 gene open 25236-25772
481 PPCD01000009.1 GCA002914355_00210 gene open 25891-26883
482 PPCD01000009.1 GCA002914355_00211 gene open 26890-27516 serB
483 PPCD01000009.1 GCA002914355_00212 gene open 27525-28022 cheW
484 PPCD01000009.1 GCA002914355_00213 gene open 28032-30386
485 PPCD01000009.1 GCA002914355_00214 gene open 30395-31348
486 PPCD01000009.1 GCA002914355_00215 gene open 31348-32139
487 PPCD01000009.1 GCA002914355_00216 gene open 32203-32688 greA
488 PPCD01000009.1 GCA002914355_00217 gene open 32692-33726 lpxB
489 PPCD01000009.1 GCA002914355_00218 gene open 33829-34605 surE
490 PPCD01000009.1 GCA002914355_00219 gene open 34595-35245
491 PPCD01000009.1 GCA002914355_00220 gene open 35454-35792
492 PPCD01000009.1 GCA002914355_00221 gene open 35794-36093
493 PPCD01000009.1 GCA002914355_00222 gene open 36068-36325
494 PPCD01000009.1 GCA002914355_00223 gene open 36306-36683
495 PPCD01000009.1 GCA002914355_00224 gene open 36692-37027
496 PPCD01000009.1 GCA002914355_00225 gene open 37038-37385
497 PPCD01000009.1 GCA002914355_00226 gene open 37862-38254
498 PPCD01000009.1 GCA002914355_00227 gene open 38308-38667
499 PPCD01000009.1 GCA002914355_00228 gene open 38630-39439
500 PPCD01000009.1 GCA002914355_00229 gene open 39439-39654