HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria subflava (GCA_003044665.1)

Select a Genome:
BAKTA Annotations for GCA_003044665.1
Genome Selected: Neisseria subflava
ContigsBases CDSrRNA tmRNAtRNA
36 2156548 2015 3 1 55
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4176 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4176 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 POXO01000004.1 GCA003044665_01031 CDS open 67552-69138 _na     528_aa lldP L-lactate permease
2002 POXO01000004.1 GCA003044665_01032 CDS open 69436-69798 _na     120_aa Adhesin
2003 POXO01000004.1 GCA003044665_01033 CDS open 69936-71039 _na     367_aa dnaN DNA polymerase III subunit beta
2004 POXO01000004.1 GCA003044665_01034 CDS open 71146-72714 _na     522_aa dnaA chromosomal replication initiator protein DnaA
2005 POXO01000004.1 GCA003044665_01035 CDS open 73034-73168 _na     44_aa rpmH 50S ribosomal protein L34
2006 POXO01000004.1 GCA003044665_01036 CDS open 73237-73512 _na     91_aa rnpA ribonuclease P protein component
2007 POXO01000004.1 GCA003044665_01037 CDS open 73509-73730 _na     73_aa yidD membrane protein insertion efficiency factor YidD
2008 POXO01000004.1 GCA003044665_01038 CDS open 73849-75495 _na     548_aa yidC membrane protein insertase YidC
2009 POXO01000004.1 GCA003044665_01039 CDS open 75590-76300 _na     236_aa rsmI Putative S-adenosylmethionine-dependent methyltransferase%2C YraL family
2010 POXO01000004.1 GCA003044665_01040 CDS open 76355-76963 _na     202_aa 7-methyl-GTP pyrophosphatase
2011 POXO01000004.1 GCA003044665_01041 CDS open 77001-77504 _na     167_aa yceD Large ribosomal RNA subunit accumulation protein YceD
2012 POXO01000004.1 GCA003044665_01042 CDS open 77538-77717 _na     59_aa rpmF 50S ribosomal protein L32
2013 POXO01000004.1 GCA003044665_01043 CDS open 77810-78334 _na     174_aa hpt1 Phosphoribosyltransferase domain-containing protein
2014 POXO01000004.1 GCA003044665_01044 CDS open 78456-79526 _na     356_aa plsX phosphate acyltransferase PlsX
2015 POXO01000004.1 GCA003044665_01045 CDS open 79680-80642 _na     320_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
2016 POXO01000004.1 GCA003044665_01046 CDS open 80694-81041 _na     115_aa Cold-shock DNA-binding domain protein
2017 POXO01000004.1 GCA003044665_01047 CDS open 81051-81977 _na     308_aa fabD ACP S-malonyltransferase
2018 POXO01000004.1 GCA003044665_01048 CDS open 82051-83052 _na     333_aa Glycosyltransferase
2019 POXO01000004.1 GCA003044665_01049 CDS open 83045-84178 _na     377_aa Capsular biosynthesis protein
2020 POXO01000004.1 GCA003044665_01050 CDS open 84171-85208 _na     345_aa Glycosyltransferase family 8 protein
2021 POXO01000004.1 GCA003044665_01051 CDS open 85253-85999 _na     248_aa fabG 3-oxoacyl-ACP reductase FabG
2022 POXO01000004.1 GCA003044665_01052 CDS open 86268-88250 _na     660_aa kefC Glutathione-regulated potassium-efflux system protein KefC
2023 POXO01000004.1 GCA003044665_01057 CDS open 89020-90432 _na     470_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
2024 POXO01000004.1 GCA003044665_01058 CDS open 90503-92041 _na     512_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
2025 POXO01000004.1 GCA003044665_01059 CDS open 92067-92633 _na     188_aa ssuE NAD(P)H dehydrogenase (Quinone)
2026 POXO01000004.1 GCA003044665_01060 CDS open 92779-93456 _na     225_aa Response regulator receiver domain protein
2027 POXO01000004.1 GCA003044665_01061 CDS open 93486-94799 _na     437_aa histidine kinase
2028 POXO01000004.1 GCA003044665_01062 CDS open 94952-96031 _na     359_aa aroB 3-dehydroquinate synthase
2029 POXO01000004.1 GCA003044665_01063 CDS open 96053-96574 _na     173_aa Shikimate kinase
2030 POXO01000004.1 GCA003044665_01064 CDS open 96698-98830 _na     710_aa pilQ Type IV pilus biogenesis and competence protein PilQ
2031 POXO01000004.1 GCA003044665_01065 CDS open 98851-99393 _na     180_aa pilP Pilus assembly protein PilP
2032 POXO01000004.1 GCA003044665_01066 CDS open 99409-100080 _na     223_aa pilO Type 4a pilus biogenesis protein PilO
2033 POXO01000004.1 GCA003044665_01067 CDS open 100080-100703 _na     207_aa pilN Fimbrial assembly protein PilN
2034 POXO01000004.1 GCA003044665_01068 CDS open 100708-101799 _na     363_aa pilM Type IV pilus assembly protein PilM
2035 POXO01000004.1 GCA003044665_01069 CDS open 101953-104340 _na     795_aa mrcA Penicillin-binding protein 1A
2036 POXO01000004.1 GCA003044665_01070 CDS open 104401-105237 _na     278_aa Polymerase/histidinol phosphatase N-terminal domain-containing protein
2037 POXO01000004.1 GCA003044665_01071 CDS open 105404-106843 _na     479_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
2038 POXO01000004.1 GCA003044665_01072 CDS open 106950-107690 _na     246_aa Slam-dependent surface lipoprotein
2039 POXO01000004.1 GCA003044665_01073 CDS open 107974-108816 _na     280_aa yafJ Class II glutamine amidotransferase
2040 POXO01000004.1 GCA003044665_01074 CDS open 109015-109467 _na     150_aa nrdR transcriptional regulator NrdR
2041 POXO01000004.1 GCA003044665_01075 CDS open 109482-110585 _na     367_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
2042 POXO01000004.1 GCA003044665_01076 CDS open 111158-112465 _na     435_aa wecC UDP-N-acetyl-D-mannosamine dehydrogenase
2043 POXO01000004.1 GCA003044665_01077 CDS open 112635-114062 _na     475_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2044 POXO01000004.1 GCA003044665_01078 CDS open 114105-115415 _na     436_aa O-antigen ligase domain-containing protein
2045 POXO01000004.1 GCA003044665_01079 CDS open 115412-116482 _na     356_aa Glycosyl transferase
2046 POXO01000004.1 GCA003044665_01080 CDS open 116496-117668 _na     390_aa wbuB Glycosyltransferase WbuB
2047 POXO01000004.1 GCA003044665_01081 CDS open 117661-118278 _na     205_aa Bacterial sugar transferase
2048 POXO01000004.1 GCA003044665_01082 CDS open 118265-119239 _na     324_aa ATP-grasp domain protein
2049 POXO01000004.1 GCA003044665_01083 CDS open 119232-119924 _na     230_aa yjjG Pyrimidine 5'-nucleotidase YjjG
2050 POXO01000004.1 GCA003044665_01084 CDS open 119938-120717 _na     259_aa Formyl transferase
2051 POXO01000004.1 GCA003044665_01085 CDS open 120710-121885 _na     391_aa wecE Putative 8-amino-7-oxononanoate synthase
2052 POXO01000004.1 GCA003044665_01086 CDS open 121995-123896 _na     633_aa UDP-N-acetyl-alpha-D-glucosamine C6 dehydratase
2053 POXO01000004.1 GCA003044665_01087 CDS open 123940-125067 _na     375_aa Polysaccharide biosynthesis/export protein
2054 POXO01000004.1 GCA003044665_01088 CDS open 125239-125688 _na     149_aa protein-tyrosine-phosphatase
2055 POXO01000004.1 GCA003044665_01089 CDS open 125715-127874 _na     719_aa Tyrosine-protein kinase wzc
2056 POXO01000004.1 GCA003044665_01090 CDS open 128010-128999 _na     329_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
2057 POXO01000004.1 GCA003044665_01091 CDS open 129041-129397 _na     118_aa BZIP transcription factor
2058 POXO01000004.1 GCA003044665_01092 CDS open 129409-129711 _na     100_aa zapA Cell division protein ZapA
2059 POXO01000004.1 GCA003044665_01094 CDS open 130079-130510 _na     143_aa rplM 50S ribosomal protein L13
2060 POXO01000004.1 GCA003044665_01095 CDS open 130523-130915 _na     130_aa rpsI 30S ribosomal protein S9
2061 POXO01000004.1 GCA003044665_01096 CDS open 131000-131509 _na     169_aa Soluble secreted antigen MPT53
2062 POXO01000004.1 GCA003044665_01097 CDS open 131853-132290 _na     145_aa hpaR homoprotocatechuate degradation operon regulator HpaR
2063 POXO01000004.1 GCA003044665_01098 CDS open 132346-132804 _na     152_aa hpaC 4-hydroxyphenylacetate 3-monooxygenase%2C reductase component
2064 POXO01000004.1 GCA003044665_01099 CDS open 132887-133582 _na     231_aa murU N-acetylmuramate alpha-1-phosphate uridylyltransferase MurU
2065 POXO01000004.1 GCA003044665_01100 CDS open 133676-134578 _na     300_aa rarD EamA family transporter RarD
2066 POXO01000004.1 GCA003044665_01101 CDS open 134723-135187 _na     154_aa asnC Transcriptional regulator%2C AsnC family
2067 POXO01000004.1 GCA003044665_01102 CDS open 135308-136378 _na     356_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
2068 POXO01000004.1 GCA003044665_01103 CDS open 136478-137665 _na     395_aa ccsB c-type cytochrome biogenesis protein CcsB
2069 POXO01000004.1 GCA003044665_01104 CDS open 137658-139673 _na     671_aa ccsB Cytochrome c biogenesis protein CcsB
2070 POXO01000004.1 GCA003044665_01105 CDS open 139876-140499 _na     207_aa Cytochrome C
2071 POXO01000004.1 GCA003044665_01106 CDS open 140715-141356 _na     213_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
2072 POXO01000004.1 GCA003044665_01107 CDS open 141700-142161 _na     153_aa Peptidase propeptide and YPEB domain protein
2073 POXO01000004.1 GCA003044665_01108 CDS open 142262-142480 _na     72_aa Oxidoreductase-like domain-containing protein
2074 POXO01000004.1 GCA003044665_01109 CDS open 142458-142691 _na     77_aa ybcJ RNA-binding protein
2075 POXO01000004.1 GCA003044665_01110 CDS open 142857-146291 _na     1144_aa dnaE DNA polymerase III subunit alpha
2076 POXO01000004.1 GCA003044665_01111 CDS open 146419-146775 _na     118_aa hypothetical protein
2077 POXO01000004.1 GCA003044665_01112 CDS open 146885-147220 _na     111_aa Threonine dehydratase
2078 POXO01000004.1 GCA003044665_01113 CDS open 147508-148002 _na     164_aa Restriction endonuclease
2079 POXO01000004.1 GCA003044665_01114 CDS open 148024-148887 _na     287_aa mscS Mechanosensitive ion channel MscS domain-containing protein
2080 POXO01000004.1 GCA003044665_01115 CDS open 148955-149821 _na     288_aa Glycosyltransferase 2-like domain-containing protein
2081 POXO01000004.1 GCA003044665_01116 CDS open 149943-151979 _na     678_aa oligopeptidase A
2082 POXO01000004.1 GCA003044665_01117 CDS open 152336-152599 _na     87_aa hypothetical protein
2083 POXO01000004.1 GCA003044665_01118 CDS open 152834-153253 _na     139_aa Protoporphyrinogen IX oxidase
2084 POXO01000004.1 GCA003044665_01119 CDS open 153292-153762 _na     156_aa Inorganic triphosphatase
2085 POXO01000004.1 GCA003044665_01120 CDS open 153914-154627 _na     237_aa ubiG bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG
2086 POXO01000004.1 GCA003044665_01121 CDS open 154790-155323 _na     177_aa Cytochrome C
2087 POXO01000004.1 GCA003044665_01122 CDS open 155511-155693 _na     60_aa pilS PilS cassette
2088 POXO01000004.1 GCA003044665_01123 CDS open 155735-156058 _na     107_aa GIY-YIG domain-containing protein
2089 POXO01000004.1 GCA003044665_01124 CDS open 156055-156945 _na     296_aa lysR LysR substrate binding domain protein
2090 POXO01000004.1 GCA003044665_01125 CDS open 157066-157722 _na     218_aa ywnB Histidine kinase
2091 POXO01000004.1 GCA003044665_01126 CDS open 158155-158694 _na     179_aa DUF924 domain-containing protein
2092 POXO01000004.1 GCA003044665_01127 CDS open 158807-160171 _na     454_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2093 POXO01000004.1 GCA003044665_01128 CDS open 160256-160363 _na     35_aa hypothetical protein
2094 POXO01000004.1 GCA003044665_01129 CDS open 160406-160510 _na     34_aa hypothetical protein
2095 POXO01000004.1 GCA003044665_01130 CDS open 160598-160705 _na     35_aa hypothetical protein
2096 POXO01000004.1 GCA003044665_01131 CDS open 161199-163001 _na     600_aa rmuC Recombinase RmuC
2097 POXO01000004.1 GCA003044665_01132 CDS open 163040-163834 _na     264_aa Glycosyltransferase family 8 protein
2098 POXO01000004.1 GCA003044665_01133 CDS open 164024-164845 _na     273_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2099 POXO01000004.1 GCA003044665_01134 CDS open 165108-165866 _na     252_aa aat leucyl/phenylalanyl-tRNA--protein transferase
2100 POXO01000004.1 GCA003044665_01135 CDS open 165932-166366 _na     144_aa fur ferric iron uptake transcriptional regulator
2101 POXO01000004.1 GCA003044665_01136 CDS open 166539-166976 _na     145_aa bamE Outer membrane protein assembly factor BamE
2102 POXO01000004.1 GCA003044665_01137 CDS open 166986-167795 _na     269_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2103 POXO01000004.1 GCA003044665_01138 CDS open 167885-168772 _na     295_aa prmA 50S ribosomal protein L11 methyltransferase
2104 POXO01000004.1 GCA003044665_01139 CDS open 168967-171357 _na     796_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2105 POXO01000004.1 GCA003044665_01140 CDS open 171565-172593 _na     342_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2106 POXO01000004.1 GCA003044665_01141 CDS open 172949-173410 _na     153_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
2107 POXO01000004.1 GCA003044665_01142 CDS open 173482-173676 _na     64_aa YqaE/Pmp3 family membrane protein
2108 POXO01000004.1 GCA003044665_01143 CDS open 173705-175066 _na     453_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
2109 POXO01000004.1 GCA003044665_01144 CDS open 175371-176885 _na     504_aa katA catalase KatA
2110 POXO01000004.1 GCA003044665_01145 CDS open 177181-178815 _na     544_aa groL chaperonin GroEL
2111 POXO01000004.1 GCA003044665_01146 CDS open 178914-179201 _na     95_aa groES Co-chaperonin GroES
2112 POXO01000004.1 GCA003044665_01147 CDS open 179618-181663 _na     681_aa TonB-dependent siderophore receptor
2113 POXO01000004.1 GCA003044665_01148 CDS open 181779-182741 _na     320_aa ceuA Periplasmic binding protein
2114 POXO01000004.1 GCA003044665_01149 CDS open 182972-183940 _na     322_aa feuB Iron-uptake system permease protein FeuB
2115 POXO01000004.1 GCA003044665_01150 CDS open 183930-184901 _na     323_aa ceuC ABC transporter permease%2C enterobactin
2116 POXO01000004.1 GCA003044665_01151 CDS open 184990-185616 _na     208_aa Formylmethanofuran dehydrogenase subunit E domain-containing protein
2117 POXO01000004.1 GCA003044665_01152 CDS open 185697-186455 _na     252_aa ABC transporter%2C ATP-binding protein
2118 POXO01000004.1 GCA003044665_01153 CDS open 186524-187816 _na     430_aa avtA valine--pyruvate transaminase
2119 POXO01000004.1 GCA003044665_01154 CDS open 187957-188115 _na     52_aa UPF0391 membrane protein NEISUBOT_05459
2120 POXO01000004.1 GCA003044665_01155 CDS open 188188-188382 _na     64_aa CsbD-like domain-containing protein
2121 POXO01000004.1 GCA003044665_01156 CDS open 188684-188983 _na     99_aa Porin domain-containing protein
2122 POXO01000004.1 GCA003044665_01157 CDS open 189079-189909 _na     276_aa 2-oxoglutaramate amidase
2123 POXO01000004.1 GCA003044665_01158 CDS open 189919-190464 _na     181_aa ruvC crossover junction endodeoxyribonuclease RuvC
2124 POXO01000004.1 GCA003044665_01159 CDS open 190558-191427 _na     289_aa lipid A biosynthesis lauroyl acyltransferase
2125 POXO01000004.1 GCA003044665_01160 CDS open 192199-192993 _na     264_aa putative 3'-5' exonuclease PolB-like domain-containing protein
2126 POXO01000004.1 GCA003044665_01161 CDS open 193078-193890 _na     270_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2127 POXO01000004.1 GCA003044665_01162 CDS open 193880-194341 _na     153_aa Protein-(Glutamine-N5) methyltransferase
2128 POXO01000004.1 GCA003044665_01163 CDS open 194395-195837 _na     480_aa tldD metalloprotease TldD
2129 POXO01000004.1 GCA003044665_01165 CDS open 196405-197247 _na     280_aa Sporulation and cell division repeat protein
2130 POXO01000004.1 GCA003044665_01166 CDS open 197263-199023 _na     586_aa bifunctional biotin--[acetyl-CoA-carboxylase] ligase/type III pantothenate kinase
2131 POXO01000004.1 GCA003044665_01167 CDS open 199020-199523 _na     167_aa D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase
2132 POXO01000004.1 GCA003044665_01171 CDS open 200254-201105 _na     283_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
2133 POXO01000004.1 GCA003044665_01172 CDS open 201190-202263 _na     357_aa ATP synthase F0%2C A subunit
2134 POXO01000004.1 GCA003044665_01173 CDS open 202393-203634 _na     413_aa sdaC Aromatic amino acid permease
2135 POXO01000004.1 GCA003044665_01174 CDS open 203728-204180 _na     150_aa Cell surface protein
2136 POXO01000004.1 GCA003044665_01175 CDS open 204192-204770 _na     192_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
2137 POXO01000004.1 GCA003044665_01176 CDS open 204842-205573 _na     243_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
2138 POXO01000004.1 GCA003044665_01177 CDS open 205612-206334 _na     240_aa YgjP-like metallopeptidase domain-containing protein
2139 POXO01000004.1 GCA003044665_01178 CDS open 206506-206877 _na     123_aa PepSY domain-containing protein
2140 POXO01000004.1 GCA003044665_01179 CDS open 207034-208509 _na     491_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
2141 POXO01000004.1 GCA003044665_01180 CDS open 208796-210295 _na     499_aa subtype B tannase
2142 POXO01000004.1 GCA003044665_01181 CDS open 210588-211631 _na     347_aa aroG 3-deoxy-7-phosphoheptulonate synthase AroG
2143 POXO01000004.1 GCA003044665_01182 CDS open 211790-212407 _na     205_aa NAD dependent epimerase/dehydratase family protein
2144 POXO01000004.1 GCA003044665_01183 CDS open 212500-214320 _na     606_aa hutW heme anaerobic degradation radical SAM methyltransferase ChuW/HutW
2145 POXO01000004.1 GCA003044665_01184 CDS open 214595-215320 _na     241_aa ABC transporter ATP-binding protein
2146 POXO01000004.1 GCA003044665_01185 CDS open 215366-216307 _na     313_aa ABC transporter permease%2C enterobactin
2147 POXO01000004.1 GCA003044665_01186 CDS open 216450-217241 _na     263_aa hmuT Hemin-binding periplasmic protein hmuT
2148 POXO01000004.1 GCA003044665_01187 CDS open 217314-219512 _na     732_aa Hemoglobin receptor
2149 POXO01000004.1 GCA003044665_01188 CDS open 219657-221834 _na     725_aa fhuE FhuE receptor
2150 POXO01000004.1 GCA003044665_01189 CDS open 222046-222651 _na     201_aa wrbA NAD(P)H:quinone oxidoreductase
2151 POXO01000004.1 GCA003044665_01190 CDS open 222751-223953 _na     400_aa UPF0761 membrane protein HMPREF2560_01870
2152 POXO01000004.1 GCA003044665_01191 CDS open 224053-225834 _na     593_aa ABC transporter%2C substrate-binding protein%2C family 5
2153 POXO01000004.1 GCA003044665_01192 CDS open 226249-226527 _na     92_aa arsR Transcriptional regulator%2C ArsR family
2154 POXO01000004.1 GCA003044665_01193 CDS open 226695-227465 _na     256_aa xth exodeoxyribonuclease III
2155 POXO01000004.1 GCA003044665_01194 CDS open 228000-228629 _na     209_aa hypothetical protein
2156 POXO01000004.1 GCA003044665_01195 CDS open 228673-230700 _na     675_aa uvrB excinuclease ABC subunit UvrB
2157 POXO01000004.1 GCA003044665_01196 CDS open 230924-231418 _na     164_aa type IV pilin protein
2158 POXO01000004.1 GCA003044665_00965 gene open 155-391
2159 POXO01000004.1 GCA003044665_00966 gene open 632-928
2160 POXO01000004.1 GCA003044665_00967 gene open 948-3506 glnD
2161 POXO01000004.1 GCA003044665_00968 gene open 4300-4731
2162 POXO01000004.1 GCA003044665_00969 gene open 4825-5298
2163 POXO01000004.1 GCA003044665_00970 gene open 5287-5472
2164 POXO01000004.1 GCA003044665_00971 gene open 5701-6183
2165 POXO01000004.1 GCA003044665_00972 gene open 6301-6897
2166 POXO01000004.1 GCA003044665_00973 gene open 6912-7271
2167 POXO01000004.1 GCA003044665_00974 gene open 7714-9132
2168 POXO01000004.1 GCA003044665_00975 gene open 9470-10813 nqrA
2169 POXO01000004.1 GCA003044665_00976 gene open 10816-12048 nqrB
2170 POXO01000004.1 GCA003044665_00977 gene open 12041-12817 nqrC
2171 POXO01000004.1 GCA003044665_00978 gene open 12817-13443 nqrD
2172 POXO01000004.1 GCA003044665_00979 gene open 13447-14040 nqrE
2173 POXO01000004.1 GCA003044665_00980 gene open 14054-15271 nqrF
2174 POXO01000004.1 GCA003044665_00981 gene open 15404-16474
2175 POXO01000004.1 GCA003044665_00982 gene open 16492-16713 nqrM
2176 POXO01000004.1 GCA003044665_00983 gene open 16941-17096 rpmG
2177 POXO01000004.1 GCA003044665_00984 gene open 17127-17360 rpmB
2178 POXO01000004.1 GCA003044665_00985 gene open 17612-18940 brnQ
2179 POXO01000004.1 GCA003044665_00986 gene open 18942-19838
2180 POXO01000004.1 GCA003044665_00987 gene open 19931-20398
2181 POXO01000004.1 GCA003044665_00988 gene open 20412-21188 tcdA
2182 POXO01000004.1 GCA003044665_00989 gene open 21375-21839 uspA
2183 POXO01000004.1 GCA003044665_00990 gene open 21918-23201 hemL
2184 POXO01000004.1 GCA003044665_00991 gene open 23399-23794
2185 POXO01000004.1 GCA003044665_00992 gene open 23867-25189 miaB
2186 POXO01000004.1 GCA003044665_00993 gene open 25416-26726 nCS2
2187 POXO01000004.1 GCA003044665_00994 gene open 26810-27367
2188 POXO01000004.1 GCA003044665_00997 gene open 28057-29415
2189 POXO01000004.1 GCA003044665_00998 gene open 29472-30731 rho
2190 POXO01000004.1 GCA003044665_00999 gene open 30976-31878 rhaT
2191 POXO01000004.1 GCA003044665_01000 gene open 31962-33650 glnS
2192 POXO01000004.1 GCA003044665_01001 gene open 33756-34535
2193 POXO01000004.1 GCA003044665_01002 gene open 34608-35321 gntR
2194 POXO01000004.1 GCA003044665_01003 gene open 35582-35971 osmC
2195 POXO01000004.1 GCA003044665_01004 gene open 36113-36922
2196 POXO01000004.1 GCA003044665_01005 gene open 37147-39999 gcvP
2197 POXO01000004.1 GCA003044665_01006 gene open 40055-40606 tag
2198 POXO01000004.1 GCA003044665_01007 gene open 40714-41145 gcvH
2199 POXO01000004.1 GCA003044665_01008 gene open 41260-42360 gcvT
2200 POXO01000004.1 GCA003044665_01009 gene open 42876-44387 ubiB
2201 POXO01000004.1 GCA003044665_01010 gene open 44463-45836 clcA
2202 POXO01000004.1 GCA003044665_01011 gene open 45911-47131 argJ
2203 POXO01000004.1 GCA003044665_01012 gene open 47175-47873
2204 POXO01000004.1 GCA003044665_01013 gene open 47873-48217 lrgA
2205 POXO01000004.1 GCA003044665_01014 gene open 48404-49153
2206 POXO01000004.1 GCA003044665_01015 gene open 49200-49664
2207 POXO01000004.1 GCA003044665_01016 gene open 49852-52554 ppc
2208 POXO01000004.1 GCA003044665_01017 gene open 52908-53297
2209 POXO01000004.1 GCA003044665_01018 gene open 53422-54513 ychF
2210 POXO01000004.1 GCA003044665_01019 gene open 54993-56852 oatA
2211 POXO01000004.1 GCA003044665_01020 gene open 56928-58223 tyrS
2212 POXO01000004.1 GCA003044665_01021 gene open 58387-59283 hslO
2213 POXO01000004.1 GCA003044665_01022 gene open 59544-60173
2214 POXO01000004.1 GCA003044665_01023 gene open 60182-60403
2215 POXO01000004.1 GCA003044665_01024 gene open 60484-61884
2216 POXO01000004.1 GCA003044665_01025 gene open 61920-62930
2217 POXO01000004.1 GCA003044665_01026 gene open 62966-64855 dxs
2218 POXO01000004.1 GCA003044665_01027 gene open 64989-65546 orn
2219 POXO01000004.1 GCA003044665_01028 gene open 65610-66032 queD
2220 POXO01000004.1 GCA003044665_01029 gene open 66106-66477
2221 POXO01000004.1 GCA003044665_01030 gene open 66584-67219
2222 POXO01000004.1 GCA003044665_01031 gene open 67552-69138 lldP
2223 POXO01000004.1 GCA003044665_01032 gene open 69436-69798
2224 POXO01000004.1 GCA003044665_01033 gene open 69936-71039 dnaN
2225 POXO01000004.1 GCA003044665_01034 gene open 71146-72714 dnaA
2226 POXO01000004.1 GCA003044665_01035 gene open 73034-73168 rpmH
2227 POXO01000004.1 GCA003044665_01036 gene open 73237-73512 rnpA
2228 POXO01000004.1 GCA003044665_01037 gene open 73509-73730 yidD
2229 POXO01000004.1 GCA003044665_01038 gene open 73849-75495 yidC
2230 POXO01000004.1 GCA003044665_01039 gene open 75590-76300 rsmI
2231 POXO01000004.1 GCA003044665_01040 gene open 76355-76963
2232 POXO01000004.1 GCA003044665_01041 gene open 77001-77504 yceD
2233 POXO01000004.1 GCA003044665_01042 gene open 77538-77717 rpmF
2234 POXO01000004.1 GCA003044665_01043 gene open 77810-78334 hpt1
2235 POXO01000004.1 GCA003044665_01044 gene open 78456-79526 plsX
2236 POXO01000004.1 GCA003044665_01045 gene open 79680-80642 fabH
2237 POXO01000004.1 GCA003044665_01046 gene open 80694-81041
2238 POXO01000004.1 GCA003044665_01047 gene open 81051-81977 fabD
2239 POXO01000004.1 GCA003044665_01048 gene open 82051-83052
2240 POXO01000004.1 GCA003044665_01049 gene open 83045-84178
2241 POXO01000004.1 GCA003044665_01050 gene open 84171-85208
2242 POXO01000004.1 GCA003044665_01051 gene open 85253-85999 fabG
2243 POXO01000004.1 GCA003044665_01052 gene open 86268-88250 kefC
2244 POXO01000004.1 GCA003044665_01057 gene open 89020-90432 dacB
2245 POXO01000004.1 GCA003044665_01058 gene open 90503-92041 araJ
2246 POXO01000004.1 GCA003044665_01059 gene open 92067-92633 ssuE
2247 POXO01000004.1 GCA003044665_01060 gene open 92779-93456
2248 POXO01000004.1 GCA003044665_01061 gene open 93486-94799
2249 POXO01000004.1 GCA003044665_01062 gene open 94952-96031 aroB
2250 POXO01000004.1 GCA003044665_01063 gene open 96053-96574
2251 POXO01000004.1 GCA003044665_01064 gene open 96698-98830 pilQ
2252 POXO01000004.1 GCA003044665_01065 gene open 98851-99393 pilP
2253 POXO01000004.1 GCA003044665_01066 gene open 99409-100080 pilO
2254 POXO01000004.1 GCA003044665_01067 gene open 100080-100703 pilN
2255 POXO01000004.1 GCA003044665_01068 gene open 100708-101799 pilM
2256 POXO01000004.1 GCA003044665_01069 gene open 101953-104340 mrcA
2257 POXO01000004.1 GCA003044665_01070 gene open 104401-105237
2258 POXO01000004.1 GCA003044665_01071 gene open 105404-106843
2259 POXO01000004.1 GCA003044665_01072 gene open 106950-107690
2260 POXO01000004.1 GCA003044665_01073 gene open 107974-108816 yafJ
2261 POXO01000004.1 GCA003044665_01074 gene open 109015-109467 nrdR
2262 POXO01000004.1 GCA003044665_01075 gene open 109482-110585 ribD
2263 POXO01000004.1 GCA003044665_01076 gene open 111158-112465 wecC
2264 POXO01000004.1 GCA003044665_01077 gene open 112635-114062
2265 POXO01000004.1 GCA003044665_01078 gene open 114105-115415
2266 POXO01000004.1 GCA003044665_01079 gene open 115412-116482
2267 POXO01000004.1 GCA003044665_01080 gene open 116496-117668 wbuB
2268 POXO01000004.1 GCA003044665_01081 gene open 117661-118278
2269 POXO01000004.1 GCA003044665_01082 gene open 118265-119239
2270 POXO01000004.1 GCA003044665_01083 gene open 119232-119924 yjjG
2271 POXO01000004.1 GCA003044665_01084 gene open 119938-120717
2272 POXO01000004.1 GCA003044665_01085 gene open 120710-121885 wecE
2273 POXO01000004.1 GCA003044665_01086 gene open 121995-123896
2274 POXO01000004.1 GCA003044665_01087 gene open 123940-125067
2275 POXO01000004.1 GCA003044665_01088 gene open 125239-125688
2276 POXO01000004.1 GCA003044665_01089 gene open 125715-127874
2277 POXO01000004.1 GCA003044665_01090 gene open 128010-128999
2278 POXO01000004.1 GCA003044665_01091 gene open 129041-129397
2279 POXO01000004.1 GCA003044665_01092 gene open 129409-129711 zapA
2280 POXO01000004.1 GCA003044665_01094 gene open 130079-130510 rplM
2281 POXO01000004.1 GCA003044665_01095 gene open 130523-130915 rpsI
2282 POXO01000004.1 GCA003044665_01096 gene open 131000-131509
2283 POXO01000004.1 GCA003044665_01097 gene open 131853-132290 hpaR
2284 POXO01000004.1 GCA003044665_01098 gene open 132346-132804 hpaC
2285 POXO01000004.1 GCA003044665_01099 gene open 132887-133582 murU
2286 POXO01000004.1 GCA003044665_01100 gene open 133676-134578 rarD
2287 POXO01000004.1 GCA003044665_01101 gene open 134723-135187 asnC
2288 POXO01000004.1 GCA003044665_01102 gene open 135308-136378 tsaD
2289 POXO01000004.1 GCA003044665_01103 gene open 136478-137665 ccsB
2290 POXO01000004.1 GCA003044665_01104 gene open 137658-139673 ccsB
2291 POXO01000004.1 GCA003044665_01105 gene open 139876-140499
2292 POXO01000004.1 GCA003044665_01106 gene open 140715-141356 yihA
2293 POXO01000004.1 GCA003044665_01107 gene open 141700-142161
2294 POXO01000004.1 GCA003044665_01108 gene open 142262-142480
2295 POXO01000004.1 GCA003044665_01109 gene open 142458-142691 ybcJ
2296 POXO01000004.1 GCA003044665_01110 gene open 142857-146291 dnaE
2297 POXO01000004.1 GCA003044665_01111 gene open 146419-146775
2298 POXO01000004.1 GCA003044665_01112 gene open 146885-147220
2299 POXO01000004.1 GCA003044665_01113 gene open 147508-148002
2300 POXO01000004.1 GCA003044665_01114 gene open 148024-148887 mscS
2301 POXO01000004.1 GCA003044665_01115 gene open 148955-149821
2302 POXO01000004.1 GCA003044665_01116 gene open 149943-151979
2303 POXO01000004.1 GCA003044665_01117 gene open 152336-152599
2304 POXO01000004.1 GCA003044665_01118 gene open 152834-153253
2305 POXO01000004.1 GCA003044665_01119 gene open 153292-153762
2306 POXO01000004.1 GCA003044665_01120 gene open 153914-154627 ubiG
2307 POXO01000004.1 GCA003044665_01121 gene open 154790-155323
2308 POXO01000004.1 GCA003044665_01122 gene open 155511-155693 pilS
2309 POXO01000004.1 GCA003044665_01123 gene open 155735-156058
2310 POXO01000004.1 GCA003044665_01124 gene open 156055-156945 lysR
2311 POXO01000004.1 GCA003044665_01125 gene open 157066-157722 ywnB
2312 POXO01000004.1 GCA003044665_01126 gene open 158155-158694
2313 POXO01000004.1 GCA003044665_01127 gene open 158807-160171 mnmE
2314 POXO01000004.1 GCA003044665_01128 gene open 160256-160363
2315 POXO01000004.1 GCA003044665_01129 gene open 160406-160510
2316 POXO01000004.1 GCA003044665_01130 gene open 160598-160705
2317 POXO01000004.1 GCA003044665_01131 gene open 161199-163001 rmuC
2318 POXO01000004.1 GCA003044665_01132 gene open 163040-163834
2319 POXO01000004.1 GCA003044665_01133 gene open 164024-164845 dapD
2320 POXO01000004.1 GCA003044665_01134 gene open 165108-165866 aat
2321 POXO01000004.1 GCA003044665_01135 gene open 165932-166366 fur
2322 POXO01000004.1 GCA003044665_01136 gene open 166539-166976 bamE
2323 POXO01000004.1 GCA003044665_01137 gene open 166986-167795 dapB
2324 POXO01000004.1 GCA003044665_01138 gene open 167885-168772 prmA
2325 POXO01000004.1 GCA003044665_01139 gene open 168967-171357 gyrB
2326 POXO01000004.1 GCA003044665_01140 gene open 171565-172593 queA
2327 POXO01000004.1 GCA003044665_01141 gene open 172949-173410 accB
2328 POXO01000004.1 GCA003044665_01142 gene open 173482-173676
2329 POXO01000004.1 GCA003044665_01143 gene open 173705-175066 accC
2330 POXO01000004.1 GCA003044665_01144 gene open 175371-176885 katA
2331 POXO01000004.1 GCA003044665_01145 gene open 177181-178815 groL
2332 POXO01000004.1 GCA003044665_01146 gene open 178914-179201 groES
2333 POXO01000004.1 GCA003044665_01147 gene open 179618-181663
2334 POXO01000004.1 GCA003044665_01148 gene open 181779-182741 ceuA
2335 POXO01000004.1 GCA003044665_01149 gene open 182972-183940 feuB
2336 POXO01000004.1 GCA003044665_01150 gene open 183930-184901 ceuC
2337 POXO01000004.1 GCA003044665_01151 gene open 184990-185616
2338 POXO01000004.1 GCA003044665_01152 gene open 185697-186455
2339 POXO01000004.1 GCA003044665_01153 gene open 186524-187816 avtA
2340 POXO01000004.1 GCA003044665_01154 gene open 187957-188115
2341 POXO01000004.1 GCA003044665_01155 gene open 188188-188382
2342 POXO01000004.1 GCA003044665_01156 gene open 188684-188983
2343 POXO01000004.1 GCA003044665_01157 gene open 189079-189909
2344 POXO01000004.1 GCA003044665_01158 gene open 189919-190464 ruvC
2345 POXO01000004.1 GCA003044665_01159 gene open 190558-191427
2346 POXO01000004.1 GCA003044665_01160 gene open 192199-192993
2347 POXO01000004.1 GCA003044665_01161 gene open 193078-193890 prmC
2348 POXO01000004.1 GCA003044665_01162 gene open 193880-194341
2349 POXO01000004.1 GCA003044665_01163 gene open 194395-195837 tldD
2350 POXO01000004.1 GCA003044665_01165 gene open 196405-197247
2351 POXO01000004.1 GCA003044665_01166 gene open 197263-199023
2352 POXO01000004.1 GCA003044665_01167 gene open 199020-199523
2353 POXO01000004.1 GCA003044665_01171 gene open 200254-201105 folD
2354 POXO01000004.1 GCA003044665_01172 gene open 201190-202263
2355 POXO01000004.1 GCA003044665_01173 gene open 202393-203634 sdaC
2356 POXO01000004.1 GCA003044665_01174 gene open 203728-204180
2357 POXO01000004.1 GCA003044665_01175 gene open 204192-204770 gmhB
2358 POXO01000004.1 GCA003044665_01176 gene open 204842-205573
2359 POXO01000004.1 GCA003044665_01177 gene open 205612-206334
2360 POXO01000004.1 GCA003044665_01178 gene open 206506-206877
2361 POXO01000004.1 GCA003044665_01179 gene open 207034-208509
2362 POXO01000004.1 GCA003044665_01180 gene open 208796-210295
2363 POXO01000004.1 GCA003044665_01181 gene open 210588-211631 aroG
2364 POXO01000004.1 GCA003044665_01182 gene open 211790-212407
2365 POXO01000004.1 GCA003044665_01183 gene open 212500-214320 hutW
2366 POXO01000004.1 GCA003044665_01184 gene open 214595-215320
2367 POXO01000004.1 GCA003044665_01185 gene open 215366-216307
2368 POXO01000004.1 GCA003044665_01186 gene open 216450-217241 hmuT
2369 POXO01000004.1 GCA003044665_01187 gene open 217314-219512
2370 POXO01000004.1 GCA003044665_01188 gene open 219657-221834 fhuE
2371 POXO01000004.1 GCA003044665_01189 gene open 222046-222651 wrbA
2372 POXO01000004.1 GCA003044665_01190 gene open 222751-223953
2373 POXO01000004.1 GCA003044665_01191 gene open 224053-225834
2374 POXO01000004.1 GCA003044665_01192 gene open 226249-226527 arsR
2375 POXO01000004.1 GCA003044665_01193 gene open 226695-227465 xth
2376 POXO01000004.1 GCA003044665_01194 gene open 228000-228629
2377 POXO01000004.1 GCA003044665_01195 gene open 228673-230700 uvrB
2378 POXO01000004.1 GCA003044665_01196 gene open 230924-231418
2379 POXO01000004.1 GCA003044665_00995 gene open 27761-27835 trnE
2380 POXO01000004.1 GCA003044665_00996 gene open 27848-27924 trnR
2381 POXO01000004.1 GCA003044665_01053 gene open 88320-88395 trnV
2382 POXO01000004.1 GCA003044665_01054 gene open 88429-88505 trnD
2383 POXO01000004.1 GCA003044665_01055 gene open 88545-88620 trnV
2384 POXO01000004.1 GCA003044665_01056 gene open 88653-88729 trnD
2385 POXO01000004.1 GCA003044665_01168 gene open 199786-199861 trnH
2386 POXO01000004.1 GCA003044665_01169 gene open 199871-199947 trnR
2387 POXO01000004.1 GCA003044665_01170 gene open 199975-200052 trnP
2388 POXO01000004.1 GCA003044665_00995 tRNA open 27761-27835 trnE tRNA-Glu(ttc)
2389 POXO01000004.1 GCA003044665_00996 tRNA open 27848-27924 trnR tRNA-Arg(acg)
2390 POXO01000004.1 GCA003044665_01053 tRNA open 88320-88395 trnV tRNA-Val(tac)
2391 POXO01000004.1 GCA003044665_01054 tRNA open 88429-88505 trnD tRNA-Asp(gtc)
2392 POXO01000004.1 GCA003044665_01055 tRNA open 88545-88620 trnV tRNA-Val(tac)
2393 POXO01000004.1 GCA003044665_01056 tRNA open 88653-88729 trnD tRNA-Asp(gtc)
2394 POXO01000004.1 GCA003044665_01168 tRNA open 199786-199861 trnH tRNA-His(gtg)
2395 POXO01000004.1 GCA003044665_01169 tRNA open 199871-199947 trnR tRNA-Arg(tct)
2396 POXO01000004.1 GCA003044665_01170 tRNA open 199975-200052 trnP tRNA-Pro(tgg)
2397 POXO01000005.1 repeat_region open 77834-79022 CRISPR array with 18 repeats of length 36%2C consensus sequence ATTGTAGCACTGCGAAATGAGAAAGGGAGCTACAAC and spacer length 30
2398 POXO01000005.1 GCA003044665_01197 CDS open 315-1127 _na     270_aa ypjD Inner membrane protein YpjD
2399 POXO01000005.1 GCA003044665_01198 CDS open 1310-2680 _na     456_aa ffh signal recognition particle protein
2400 POXO01000005.1 GCA003044665_01199 CDS open 2848-3543 _na     231_aa dsbG Thiol:disulfide interchange protein
2401 POXO01000005.1 GCA003044665_01200 CDS open 3714-5552 _na     612_aa fiu Putative siderophore receptor
2402 POXO01000005.1 GCA003044665_01201 CDS open 5691-5822 _na     43_aa hypothetical protein
2403 POXO01000005.1 GCA003044665_01202 CDS open 5982-6515 _na     177_aa Serine hydrolase
2404 POXO01000005.1 GCA003044665_01203 CDS open 6526-6870 _na     114_aa Integral membrane protein
2405 POXO01000005.1 GCA003044665_01204 CDS open 6857-7636 _na     259_aa xthA exodeoxyribonuclease III
2406 POXO01000005.1 GCA003044665_01205 CDS open 7682-8995 _na     437_aa argA amino-acid N-acetyltransferase
2407 POXO01000005.1 GCA003044665_01206 CDS open 8992-9387 _na     131_aa MJ0042 family finger-like domain protein
2408 POXO01000005.1 GCA003044665_01207 CDS open 9487-10128 _na     213_aa pyrE Orotate phosphoribosyltransferase
2409 POXO01000005.1 GCA003044665_01208 CDS open 10299-10769 _na     156_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2410 POXO01000005.1 GCA003044665_01209 CDS open 10933-11652 _na     239_aa pyrH UMP kinase
2411 POXO01000005.1 GCA003044665_01210 CDS open 11871-12725 _na     284_aa tsf translation elongation factor Ts
2412 POXO01000005.1 GCA003044665_01211 CDS open 12849-13577 _na     242_aa rpsB 30S ribosomal protein S2
2413 POXO01000005.1 GCA003044665_01212 CDS open 13752-13994 _na     80_aa Integral membrane protein
2414 POXO01000005.1 GCA003044665_01213 CDS open 14072-14662 _na     196_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
2415 POXO01000005.1 GCA003044665_01214 CDS open 14757-15344 _na     195_aa rimL GNAT family protein
2416 POXO01000005.1 GCA003044665_01215 CDS open 15501-17396 _na     631_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
2417 POXO01000005.1 GCA003044665_01216 CDS open 17481-18485 _na     334_aa amgK N-acetylmuramate/N-acetylglucosamine kinase AmgK
2418 POXO01000005.1 GCA003044665_01217 CDS open 18600-20954 _na     784_aa lptD LPS-assembly protein LptD
2419 POXO01000005.1 GCA003044665_01218 CDS open 20951-21940 _na     329_aa prsA Foldase protein PrsA 3
2420 POXO01000005.1 GCA003044665_01219 CDS open 22055-22864 _na     269_aa besA Ferri-bacillibactin esterase BesA
2421 POXO01000005.1 GCA003044665_01220 CDS open 23020-23898 _na     292_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2422 POXO01000005.1 GCA003044665_01221 CDS open 23964-24311 _na     115_aa yraN YraN family protein
2423 POXO01000005.1 GCA003044665_01222 CDS open 24316-24909 _na     197_aa gmhA phosphoheptose isomerase
2424 POXO01000005.1 GCA003044665_01223 CDS open 24983-25594 _na     203_aa Phospholipid-binding domain protein
2425 POXO01000005.1 GCA003044665_01224 CDS open 25661-26248 _na     195_aa ftsN Cell division protein FtsN
2426 POXO01000005.1 GCA003044665_01225 CDS open 26312-27091 _na     259_aa map type I methionyl aminopeptidase
2427 POXO01000005.1 GCA003044665_01226 CDS open 27496-27789 _na     97_aa yiaG RsaL-like HTH domain-containing protein
2428 POXO01000005.1 GCA003044665_01227 CDS open 27884-28834 _na     316_aa AB hydrolase-1 domain-containing protein
2429 POXO01000005.1 GCA003044665_01228 CDS open 28847-29473 _na     208_aa bcrC Undecaprenyl-diphosphatase BcrC
2430 POXO01000005.1 GCA003044665_01229 CDS open 29473-30273 _na     266_aa pncC Nicotinamide-nucleotide amidohydrolase PncC
2431 POXO01000005.1 GCA003044665_01230 CDS open 30384-31727 _na     447_aa argG argininosuccinate synthase
2432 POXO01000005.1 GCA003044665_01231 CDS open 31770-31985 _na     71_aa DUF4177 domain-containing protein
2433 POXO01000005.1 GCA003044665_01232 CDS open 31978-32193 _na     71_aa Integral membrane protein
2434 POXO01000005.1 GCA003044665_01233 CDS open 32323-32772 _na     149_aa DUF3290 domain-containing protein
2435 POXO01000005.1 GCA003044665_01234 CDS open 32787-33419 _na     210_aa ycaP DUF421 domain-containing protein
2436 POXO01000005.1 GCA003044665_01235 CDS open 33492-33863 _na     123_aa DUF488 domain-containing protein
2437 POXO01000005.1 GCA003044665_01236 CDS open 33928-34710 _na     260_aa trpC indole-3-glycerol phosphate synthase TrpC
2438 POXO01000005.1 GCA003044665_01237 CDS open 34854-36326 _na     490_aa malate:quinone oxidoreductase
2439 POXO01000005.1 GCA003044665_01238 CDS open 36761-37255 _na     164_aa Integral membrane protein
2440 POXO01000005.1 GCA003044665_01239 CDS open 37338-37967 _na     209_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2441 POXO01000005.1 GCA003044665_01240 CDS open 38035-38805 _na     256_aa Sporulation initiation inhibitor protein Soj
2442 POXO01000005.1 GCA003044665_01241 CDS open 39089-39328 _na     79_aa DNA-formamidopyrimidine glycosylase family protein
2443 POXO01000005.1 GCA003044665_01242 CDS open 39432-40340 _na     302_aa retron St85 family RNA-directed DNA polymerase
2444 POXO01000005.1 GCA003044665_01243 CDS open 40345-41199 _na     284_aa retron St85 family effector protein
2445 POXO01000005.1 GCA003044665_01244 CDS open 41406-44324 _na     972_aa hrpA ATP-dependent RNA helicase HrpA
2446 POXO01000005.1 GCA003044665_01245 CDS open 44425-45999 _na     524_aa lpt3 lipooligosaccharide phosphoethanolamine transferase
2447 POXO01000005.1 GCA003044665_01246 CDS open 46267-46935 _na     222_aa hypothetical protein
2448 POXO01000005.1 GCA003044665_01247 CDS open 47023-48417 _na     464_aa hrpA ATP-dependent RNA helicase HrpA
2449 POXO01000005.1 GCA003044665_01248 CDS open 48526-48912 _na     128_aa rsfS ribosome silencing factor
2450 POXO01000005.1 GCA003044665_01249 CDS open 48971-49576 _na     201_aa nadD nicotinate-nucleotide adenylyltransferase
2451 POXO01000005.1 GCA003044665_01250 CDS open 49595-50179 _na     194_aa Carbonate dehydratase
2452 POXO01000005.1 GCA003044665_01251 CDS open 50303-51193 _na     296_aa Isopentenyl-diphosphate Delta-isomerase
2453 POXO01000005.1 GCA003044665_01252 CDS open 51209-52150 _na     313_aa potA Spermidine/putrescine import ATP-binding protein PotA
2454 POXO01000005.1 GCA003044665_01253 CDS open 52640-52912 _na     90_aa hypothetical protein
2455 POXO01000005.1 GCA003044665_01254 CDS open 52986-55817 _na     943_aa valS valine--tRNA ligase
2456 POXO01000005.1 GCA003044665_01255 CDS open 55914-56723 _na     269_aa zupT zinc transporter ZupT
2457 POXO01000005.1 GCA003044665_01256 CDS open 56904-58160 _na     418_aa dadA D-amino acid dehydrogenase
2458 POXO01000005.1 GCA003044665_01257 CDS open 58244-59635 _na     463_aa alsT Amino acid carrier protein
2459 POXO01000005.1 GCA003044665_01258 CDS open 60021-60863 _na     280_aa ATP-grasp domain-containing protein
2460 POXO01000005.1 GCA003044665_01259 CDS open 60990-62225 _na     411_aa Deoxyribodipyrimidine photolyase
2461 POXO01000005.1 GCA003044665_01260 CDS open 62373-63092 _na     239_aa minC septum site-determining protein MinC
2462 POXO01000005.1 GCA003044665_01261 CDS open 63119-63934 _na     271_aa minD septum site-determining protein MinD
2463 POXO01000005.1 GCA003044665_01262 CDS open 63938-64201 _na     87_aa minE cell division topological specificity factor MinE
2464 POXO01000005.1 GCA003044665_01263 CDS open 64205-65125 _na     306_aa lysR Hydrogen peroxide-inducible genes activator
2465 POXO01000005.1 GCA003044665_01264 CDS open 65189-65401 _na     70_aa Glycine zipper 2TM domain-containing protein
2466 POXO01000005.1 GCA003044665_01265 CDS open 65656-66105 _na     149_aa Integral membrane protein
2467 POXO01000005.1 GCA003044665_01266 CDS open 66139-67113 _na     324_aa terC Tellurium resistance protein TerC
2468 POXO01000005.1 GCA003044665_01267 CDS open 67177-67575 _na     132_aa Ag473 family lipoprotein
2469 POXO01000005.1 GCA003044665_01269 CDS open 68133-69575 _na     480_aa aldA aldehyde dehydrogenase
2470 POXO01000005.1 GCA003044665_01270 CDS open 69755-71266 _na     503_aa lysS lysine--tRNA ligase
2471 POXO01000005.1 GCA003044665_01271 CDS open 71529-72953 _na     474_aa alsT Amino acid carrier protein
2472 POXO01000005.1 GCA003044665_01272 CDS open 73225-76470 _na     1081_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
2473 POXO01000005.1 GCA003044665_01273 CDS open 76537-77451 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
2474 POXO01000005.1 GCA003044665_01274 CDS open 77462-77770 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
2475 POXO01000005.1 GCA003044665_01275 CDS open 79105-79479 _na     124_aa rplQ 50S ribosomal protein L17
2476 POXO01000005.1 GCA003044665_01276 CDS open 79504-80490 _na     328_aa rpoA DNA-directed RNA polymerase subunit alpha
2477 POXO01000005.1 GCA003044665_01277 CDS open 80516-81136 _na     206_aa rpsD 30S ribosomal protein S4
2478 POXO01000005.1 GCA003044665_01278 CDS open 81156-81551 _na     131_aa rpsK 30S ribosomal protein S11
2479 POXO01000005.1 GCA003044665_01279 CDS open 81571-81933 _na     120_aa rpsM 30S ribosomal protein S13
2480 POXO01000005.1 GCA003044665_01280 CDS open 82133-82351 _na     72_aa infA translation initiation factor IF-1
2481 POXO01000005.1 GCA003044665_01281 CDS open 82356-83483 _na     375_aa secY preprotein translocase subunit SecY
2482 POXO01000005.1 GCA003044665_01282 CDS open 83683-84117 _na     144_aa rplO 50S ribosomal protein L15
2483 POXO01000005.1 GCA003044665_01283 CDS open 84119-84304 _na     61_aa rpmD 50S ribosomal protein L30
2484 POXO01000005.1 GCA003044665_01284 CDS open 84297-84815 _na     172_aa rpsE 30S ribosomal protein S5
2485 POXO01000005.1 GCA003044665_01285 CDS open 84833-85186 _na     117_aa rplR 50S ribosomal protein L18
2486 POXO01000005.1 GCA003044665_01286 CDS open 85200-85733 _na     177_aa rplF 50S ribosomal protein L6
2487 POXO01000005.1 GCA003044665_01287 CDS open 85747-86139 _na     130_aa rpsH 30S ribosomal protein S8
2488 POXO01000005.1 GCA003044665_01288 CDS open 86154-86459 _na     101_aa rpsN 30S ribosomal protein S14
2489 POXO01000005.1 GCA003044665_01289 CDS open 86462-87001 _na     179_aa rplE 50S ribosomal protein L5
2490 POXO01000005.1 GCA003044665_01290 CDS open 87011-87334 _na     107_aa rplX 50S ribosomal protein L24
2491 POXO01000005.1 GCA003044665_01291 CDS open 87346-87714 _na     122_aa rplN 50S ribosomal protein L14
2492 POXO01000005.1 GCA003044665_01292 CDS open 87942-88205 _na     87_aa rpsQ 30S ribosomal protein S17
2493 POXO01000005.1 GCA003044665_01293 CDS open 88205-88396 _na     63_aa rpmC 50S ribosomal protein L29
2494 POXO01000005.1 GCA003044665_01294 CDS open 88396-88812 _na     138_aa rplP 50S ribosomal protein L16
2495 POXO01000005.1 GCA003044665_01295 CDS open 88796-89488 _na     230_aa rpsC 30S ribosomal protein S3
2496 POXO01000005.1 GCA003044665_01296 CDS open 89498-89827 _na     109_aa rplV 50S ribosomal protein L22
2497 POXO01000005.1 GCA003044665_01297 CDS open 89836-90114 _na     92_aa rpsS 30S ribosomal protein S19
2498 POXO01000005.1 GCA003044665_01298 CDS open 90120-90953 _na     277_aa rplB 50S ribosomal protein L2
2499 POXO01000005.1 GCA003044665_01299 CDS open 90959-91273 _na     104_aa rplW 50S ribosomal protein L23
2500 POXO01000005.1 GCA003044665_01300 CDS open 91270-91890 _na     206_aa rplD 50S ribosomal protein L4