HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Campylobacter concisus clade-433 (GCA_003048645.1)

Select a Genome:
BAKTA Annotations for GCA_003048645.1
Genome Selected: Campylobacter concisus clade-433
ContigsBases CDSrRNA tmRNAtRNA
11 1979247 1948 3 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3994 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3994 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 PIRA01000003.1 GCA003048645_01228 gene open 270043-271203
2502 PIRA01000003.1 GCA003048645_01230 gene open 272197-272748 ubiX
2503 PIRA01000003.1 GCA003048645_01231 gene open 272745-273215 coaD
2504 PIRA01000003.1 GCA003048645_01232 gene open 273217-273804 tmk
2505 PIRA01000003.1 GCA003048645_01233 gene open 273833-275059 hisS
2506 PIRA01000003.1 GCA003048645_01234 gene open 275056-276891 speA
2507 PIRA01000003.1 GCA003048645_01235 gene open 276903-278081
2508 PIRA01000003.1 GCA003048645_01236 gene open 278081-278284 thiS
2509 PIRA01000003.1 GCA003048645_01237 gene open 278292-279143 thiF
2510 PIRA01000003.1 GCA003048645_01238 gene open 279144-279908
2511 PIRA01000003.1 GCA003048645_01239 gene open 279908-281062 thiH
2512 PIRA01000003.1 GCA003048645_01240 gene open 281055-281669
2513 PIRA01000003.1 GCA003048645_01241 gene open 281771-286471
2514 PIRA01000003.1 GCA003048645_01242 gene open 286792-287649 sdhE
2515 PIRA01000003.1 GCA003048645_01243 gene open 287652-288617 sdhB
2516 PIRA01000003.1 GCA003048645_01244 gene open 288627-290465 sdhA
2517 PIRA01000003.1 GCA003048645_01245 gene open 290896-291318
2518 PIRA01000003.1 GCA003048645_01246 gene open 291358-291909
2519 PIRA01000003.1 GCA003048645_01247 gene open 291906-292751
2520 PIRA01000003.1 GCA003048645_01248 gene open 292741-293871
2521 PIRA01000003.1 GCA003048645_01249 gene open 293868-294179
2522 PIRA01000003.1 GCA003048645_01250 gene open 294188-295081
2523 PIRA01000003.1 GCA003048645_01251 gene open 295085-297259
2524 PIRA01000003.1 GCA003048645_01252 gene open 297323-298147
2525 PIRA01000003.1 GCA003048645_01253 gene open 298209-300806
2526 PIRA01000003.1 GCA003048645_01254 gene open 301029-301370 hypA
2527 PIRA01000003.1 GCA003048645_01255 gene open 301370-302362 hypE
2528 PIRA01000003.1 GCA003048645_01256 gene open 302371-303459 hypD
2529 PIRA01000003.1 GCA003048645_01257 gene open 303459-303698 hypC
2530 PIRA01000003.1 GCA003048645_01258 gene open 303698-304510 hypB
2531 PIRA01000003.1 GCA003048645_01259 gene open 304635-305267
2532 PIRA01000003.1 GCA003048645_01260 gene open 305264-306529
2533 PIRA01000003.1 GCA003048645_01261 gene open 306893-307306 nikR
2534 PIRA01000003.1 GCA003048645_01262 gene open 307352-309577 hypF
2535 PIRA01000003.1 GCA003048645_01263 gene open 309561-311033 hydE
2536 PIRA01000003.1 GCA003048645_01264 gene open 311030-311572
2537 PIRA01000003.1 GCA003048645_01265 gene open 311572-312252 cybH
2538 PIRA01000003.1 GCA003048645_01266 gene open 312262-313980
2539 PIRA01000003.1 GCA003048645_01267 gene open 313991-315136
2540 PIRA01000003.1 GCA003048645_01268 gene open 315481-316188 flgH
2541 PIRA01000003.1 GCA003048645_01269 gene open 316255-317622 pta
2542 PIRA01000003.1 GCA003048645_01270 gene open 317624-318817 ackA
2543 PIRA01000003.1 GCA003048645_01271 gene open 318820-319884 xerH
2544 PIRA01000003.1 GCA003048645_01272 gene open 319989-320384
2545 PIRA01000003.1 GCA003048645_01273 gene open 320569-321018
2546 PIRA01000003.1 GCA003048645_01274 gene open 321015-322439
2547 PIRA01000003.1 GCA003048645_01275 gene open 322436-323221
2548 PIRA01000003.1 GCA003048645_01276 gene open 323211-323441
2549 PIRA01000003.1 GCA003048645_01277 gene open 323506-324546 ddl
2550 PIRA01000003.1 GCA003048645_01278 gene open 324558-325112 ruvA
2551 PIRA01000003.1 GCA003048645_01279 gene open 325112-327043
2552 PIRA01000003.1 GCA003048645_01280 gene open 327166-328566 murJ
2553 PIRA01000003.1 GCA003048645_01281 gene open 328553-329947 cysS
2554 PIRA01000003.1 GCA003048645_01282 gene open 329916-331664
2555 PIRA01000003.1 GCA003048645_01283 gene open 331717-332790
2556 PIRA01000003.1 GCA003048645_01284 gene open 332802-334043
2557 PIRA01000003.1 GCA003048645_01285 gene open 334046-334939 dapA
2558 PIRA01000003.1 GCA003048645_01286 gene open 334939-335727
2559 PIRA01000003.1 GCA003048645_01287 gene open 335759-336304 pgsA
2560 PIRA01000003.1 GCA003048645_01288 gene open 336307-337323
2561 PIRA01000003.1 GCA003048645_01289 gene open 337345-338454 rseP
2562 PIRA01000003.1 GCA003048645_01290 gene open 338454-339089
2563 PIRA01000003.1 GCA003048645_01291 gene open 339200-339742
2564 PIRA01000003.1 GCA003048645_01292 gene open 339848-340891 flgG
2565 PIRA01000003.1 GCA003048645_01293 gene open 340927-341085
2566 PIRA01000003.1 GCA003048645_00972 gene open 2953-3029 trnR
2567 PIRA01000003.1 GCA003048645_01172 gene open 207154-207240 trnL
2568 PIRA01000003.1 GCA003048645_01178 gene open 213976-214050 trnfM
2569 PIRA01000003.1 GCA003048645_01179 gene open 214078-214152 trnQ
2570 PIRA01000003.1 GCA003048645_01229 gene open 271254-271328 trnG
2571 PIRA01000003.1 GCA003048645_00972 tRNA open 2953-3029 trnR tRNA-Arg(gcg)
2572 PIRA01000003.1 GCA003048645_01172 tRNA open 207154-207240 trnL tRNA-Leu(caa)
2573 PIRA01000003.1 GCA003048645_01178 tRNA open 213976-214050 trnfM tRNA-fMet(cat)
2574 PIRA01000003.1 GCA003048645_01179 tRNA open 214078-214152 trnQ tRNA-Gln(ttg)
2575 PIRA01000003.1 GCA003048645_01229 tRNA open 271254-271328 trnG tRNA-Gly(gcc)
2576 PIRA01000004.1 GCA003048645_01556 gene open 241808-242166 ssrA
2577 PIRA01000004.1 GCA003048645_01556 tmRNA open 241808-242166 ssrA transfer-messenger RNA%2C SsrA
2578 PIRA01000004.1 repeat_region open 8697-10385 CRISPR array with 26 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 35
2579 PIRA01000004.1 repeat_region open 11291-11595 CRISPR array with 5 repeats of length 30%2C consensus sequence ATTAGAATTTACTCCGTTGGAGTTTGAAAC and spacer length 36
2580 PIRA01000004.1 GCA003048645_01295 CDS open 280-972 _na     230_aa CRISPR associated protein Cas6 C-terminal domain-containing protein
2581 PIRA01000004.1 GCA003048645_01296 CDS open 1143-2909 _na     588_aa CRISPR/Cas system-associated protein Cas8%2C type I-B/HMARI
2582 PIRA01000004.1 GCA003048645_01297 CDS open 2920-3861 _na     313_aa cas7b type I-B CRISPR-associated protein Cas7/Csh2
2583 PIRA01000004.1 GCA003048645_01298 CDS open 3863-4573 _na     236_aa CRISPR/Cas system-associated RAMP protein Cas5%2C type I-B/HMARI
2584 PIRA01000004.1 GCA003048645_01299 CDS open 4548-6749 _na     733_aa CRISPR/Cas system-associated endonuclease/helicase Cas3%2C type I-B/HMARI
2585 PIRA01000004.1 GCA003048645_01300 CDS open 6749-7249 _na     166_aa CRISPR-associated exonuclease Cas4
2586 PIRA01000004.1 GCA003048645_01301 CDS open 7258-7536 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
2587 PIRA01000004.1 GCA003048645_01302 CDS open 7546-8544 _na     332_aa cas1 CRISPR-associated endonuclease Cas1
2588 PIRA01000004.1 GCA003048645_01303 CDS open 10571-10849 _na     92_aa HTH cro/C1-type domain-containing protein
2589 PIRA01000004.1 GCA003048645_01304 CDS open 10846-11139 _na     97_aa Addiction module killer protein
2590 PIRA01000004.1 GCA003048645_01305 CDS open 11855-12376 _na     173_aa hypothetical protein
2591 PIRA01000004.1 GCA003048645_01306 CDS open 12513-12869 _na     118_aa rplS 50S ribosomal protein L19
2592 PIRA01000004.1 GCA003048645_01307 CDS open 12878-13570 _na     230_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2593 PIRA01000004.1 GCA003048645_01308 CDS open 13567-14097 _na     176_aa rimM ribosome maturation factor RimM
2594 PIRA01000004.1 GCA003048645_01309 CDS open 14090-14332 _na     80_aa RNA-binding protein (KH domain)
2595 PIRA01000004.1 GCA003048645_01310 CDS open 14332-14559 _na     75_aa rpsP 30S ribosomal protein S16
2596 PIRA01000004.1 GCA003048645_01311 CDS open 14631-15971 _na     446_aa ffh signal recognition particle protein
2597 PIRA01000004.1 GCA003048645_01312 CDS open 16034-16792 _na     252_aa RNA pseudouridylate synthase
2598 PIRA01000004.1 GCA003048645_01313 CDS open 16789-17925 _na     378_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
2599 PIRA01000004.1 GCA003048645_01314 CDS open 17934-18641 _na     235_aa C4-type zinc ribbon domain-containing protein
2600 PIRA01000004.1 GCA003048645_01315 CDS open 18658-19380 _na     240_aa Nif3-like dinuclear metal center hexameric protein
2601 PIRA01000004.1 GCA003048645_01316 CDS open 19387-20247 _na     286_aa glyQ glycine--tRNA ligase subunit alpha
2602 PIRA01000004.1 GCA003048645_01317 CDS open 20258-20674 _na     138_aa Bacterial transcription activator effector binding domain-containing protein
2603 PIRA01000004.1 GCA003048645_01318 CDS open 20678-21151 _na     157_aa DUF3972 domain-containing protein
2604 PIRA01000004.1 GCA003048645_01319 CDS open 21163-21657 _na     164_aa N5-carboxyaminoimidazole ribonucleotide mutase
2605 PIRA01000004.1 GCA003048645_01320 CDS open 21654-22913 _na     419_aa Peptidase family U32 C-terminal domain-containing protein
2606 PIRA01000004.1 GCA003048645_01321 CDS open 22913-23671 _na     252_aa Chemotaxis protein
2607 PIRA01000004.1 GCA003048645_01322 CDS open 23808-24587 _na     259_aa Histidinol-phosphatase
2608 PIRA01000004.1 GCA003048645_01323 CDS open 24675-26105 _na     476_aa glnA type I glutamate--ammonia ligase
2609 PIRA01000004.1 GCA003048645_01324 CDS open 26629-28290 _na     553_aa DNA polymerase III subunit gamma/tau
2610 PIRA01000004.1 GCA003048645_01325 CDS open 28408-29016 _na     202_aa lysE Transporter%2C LysE family
2611 PIRA01000004.1 GCA003048645_01326 CDS open 28951-29220 _na     89_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
2612 PIRA01000004.1 GCA003048645_01327 CDS open 29220-31598 _na     792_aa Copper-transporting ATPase
2613 PIRA01000004.1 GCA003048645_01328 CDS open 31595-32215 _na     206_aa PAC domain-containing protein
2614 PIRA01000004.1 GCA003048645_01329 CDS open 32362-32745 _na     127_aa ridA RidA family protein
2615 PIRA01000004.1 GCA003048645_01330 CDS open 32766-33842 _na     358_aa Threonine synthase
2616 PIRA01000004.1 GCA003048645_01331 CDS open 34007-35350 _na     447_aa rho transcription termination factor Rho
2617 PIRA01000004.1 GCA003048645_01332 CDS open 35496-35708 _na     70_aa Transcriptional regulator
2618 PIRA01000004.1 GCA003048645_01333 CDS open 35869-36471 _na     200_aa outer membrane beta-barrel protein
2619 PIRA01000004.1 GCA003048645_01334 CDS open 36540-37019 _na     159_aa N-acetyltransferase domain-containing protein
2620 PIRA01000004.1 GCA003048645_01335 CDS open 37019-38122 _na     367_aa nusA Transcription termination/antitermination protein NusA
2621 PIRA01000004.1 GCA003048645_01336 CDS open 38295-38537 _na     80_aa HP0268 domain-containing protein
2622 PIRA01000004.1 GCA003048645_01337 CDS open 38537-39838 _na     433_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
2623 PIRA01000004.1 GCA003048645_01338 CDS open 39819-40598 _na     259_aa DUF374 domain-containing protein
2624 PIRA01000004.1 GCA003048645_01339 CDS open 40588-41034 _na     148_aa Tetratricopeptide repeat protein
2625 PIRA01000004.1 GCA003048645_01340 CDS open 41095-42099 _na     334_aa Clan AA aspartic protease
2626 PIRA01000004.1 GCA003048645_01341 CDS open 42096-42617 _na     173_aa pilN Pilus assembly protein PilN
2627 PIRA01000004.1 GCA003048645_01342 CDS open 42610-43146 _na     178_aa Transformation system protein
2628 PIRA01000004.1 GCA003048645_01343 CDS open 43325-43537 _na     70_aa hypothetical protein
2629 PIRA01000004.1 GCA003048645_01344 CDS open 43530-43640 _na     36_aa Helix-turn-helix domain-containing protein
2630 PIRA01000004.1 GCA003048645_01345 CDS open 43686-44309 _na     207_aa beta-lactamase
2631 PIRA01000004.1 GCA003048645_01346 CDS open 44322-44981 _na     219_aa beta-lactamase
2632 PIRA01000004.1 GCA003048645_01347 CDS open 44992-46332 _na     446_aa Dihydrolipoamide dehydrogenase
2633 PIRA01000004.1 GCA003048645_01348 CDS open 46329-46646 _na     105_aa Type II secretion system protein
2634 PIRA01000004.1 GCA003048645_01349 CDS open 46724-47275 _na     183_aa beta-lactamase
2635 PIRA01000004.1 GCA003048645_01350 CDS open 47297-48397 _na     366_aa prfB peptide chain release factor 2
2636 PIRA01000004.1 GCA003048645_01351 CDS open 48518-49339 _na     273_aa panC pantoate--beta-alanine ligase
2637 PIRA01000004.1 GCA003048645_01352 CDS open 49342-50652 _na     436_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2638 PIRA01000004.1 GCA003048645_01353 CDS open 50649-51641 _na     330_aa tRNA(Ile)-lysidine synthase
2639 PIRA01000004.1 GCA003048645_01354 CDS open 52708-53124 _na     138_aa sseB SseB protein N-terminal domain-containing protein
2640 PIRA01000004.1 GCA003048645_01355 CDS open 53105-53674 _na     189_aa gmhA D-sedoheptulose 7-phosphate isomerase
2641 PIRA01000004.1 GCA003048645_01356 CDS open 53649-55067 _na     472_aa hldE Bifunctional protein HldE
2642 PIRA01000004.1 GCA003048645_01357 CDS open 55060-56049 _na     329_aa rfaD ADP-glyceromanno-heptose 6-epimerase
2643 PIRA01000004.1 GCA003048645_01358 CDS open 56046-56561 _na     171_aa gmhB D-glycero-beta-D-manno-heptose 1%2C7-bisphosphate 7-phosphatase
2644 PIRA01000004.1 GCA003048645_01359 CDS open 56654-56956 _na     100_aa Cytochrome C553 (Soluble cytochrome f)
2645 PIRA01000004.1 GCA003048645_01360 CDS open 57324-57875 _na     183_aa epsC serine O-acetyltransferase EpsC
2646 PIRA01000004.1 GCA003048645_01361 CDS open 57880-58785 _na     301_aa cysK cysteine synthase A
2647 PIRA01000004.1 GCA003048645_01362 CDS open 58879-59547 _na     222_aa Endonuclease III
2648 PIRA01000004.1 GCA003048645_01363 CDS open 59544-60308 _na     254_aa AAA+ ATPase domain-containing protein
2649 PIRA01000004.1 GCA003048645_01364 CDS open 60305-63250 _na     981_aa mfd transcription-repair coupling factor
2650 PIRA01000004.1 GCA003048645_01365 CDS open 63231-64433 _na     400_aa tetrahydrofolate synthase
2651 PIRA01000004.1 GCA003048645_01366 CDS open 64430-66004 _na     524_aa GGDEF domain-containing protein
2652 PIRA01000004.1 GCA003048645_01367 CDS open 65985-66524 _na     179_aa Lipoprotein
2653 PIRA01000004.1 GCA003048645_01368 CDS open 66528-68993 _na     821_aa leuS leucine--tRNA ligase
2654 PIRA01000004.1 GCA003048645_01369 CDS open 69002-69340 _na     112_aa macA MacA
2655 PIRA01000004.1 GCA003048645_01370 CDS open 69350-70321 _na     323_aa secF Protein-export membrane protein SecF
2656 PIRA01000004.1 GCA003048645_01371 CDS open 70324-71904 _na     526_aa secD Protein translocase subunit SecD
2657 PIRA01000004.1 GCA003048645_01372 CDS open 71904-72176 _na     90_aa yajC preprotein translocase subunit YajC
2658 PIRA01000004.1 GCA003048645_01373 CDS open 72281-73444 _na     387_aa apolipoprotein N-acyltransferase
2659 PIRA01000004.1 GCA003048645_01374 CDS open 73487-74692 _na     401_aa metK methionine adenosyltransferase
2660 PIRA01000004.1 GCA003048645_01375 CDS open 74831-76198 _na     455_aa sstT serine/threonine transporter SstT
2661 PIRA01000004.1 GCA003048645_01376 CDS open 76287-78008 _na     573_aa Oligoendopeptidase F
2662 PIRA01000004.1 GCA003048645_01377 CDS open 78010-78459 _na     149_aa Stringent starvation protein B
2663 PIRA01000004.1 GCA003048645_01378 CDS open 78511-80580 _na     689_aa DNA 3'-5' helicase
2664 PIRA01000004.1 GCA003048645_01379 CDS open 80577-81398 _na     273_aa truB tRNA pseudouridine(55) synthase TruB
2665 PIRA01000004.1 GCA003048645_01380 CDS open 81392-81622 _na     76_aa csrA carbon storage regulator CsrA
2666 PIRA01000004.1 GCA003048645_01381 CDS open 81619-82362 _na     247_aa 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2667 PIRA01000004.1 GCA003048645_01382 CDS open 82374-82829 _na     151_aa smpB SsrA-binding protein SmpB
2668 PIRA01000004.1 GCA003048645_01383 CDS open 82838-83434 _na     198_aa Thioredoxin domain-containing protein
2669 PIRA01000004.1 GCA003048645_01384 CDS open 83497-83931 _na     144_aa flgB flagellar basal body rod protein FlgB
2670 PIRA01000004.1 GCA003048645_01385 CDS open 83940-84440 _na     166_aa flgC flagellar basal body rod protein FlgC
2671 PIRA01000004.1 GCA003048645_01386 CDS open 84440-84733 _na     97_aa fliE flagellar hook-basal body complex protein FliE
2672 PIRA01000004.1 GCA003048645_01387 CDS open 84742-86574 _na     610_aa ftsI Cell division protein FtsI / penicillin-binding protein
2673 PIRA01000004.1 GCA003048645_01388 CDS open 86663-87124 _na     153_aa Response regulator
2674 PIRA01000004.1 GCA003048645_01389 CDS open 87172-88125 _na     317_aa hemH ferrochelatase
2675 PIRA01000004.1 GCA003048645_01390 CDS open 88125-88994 _na     289_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
2676 PIRA01000004.1 GCA003048645_01391 CDS open 89165-91723 _na     852_aa alaS alanine--tRNA ligase
2677 PIRA01000004.1 GCA003048645_01392 CDS open 91720-92217 _na     165_aa 3-isopropylmalate dehydratase small subunit
2678 PIRA01000004.1 GCA003048645_01393 CDS open 92217-92759 _na     180_aa maf septum formation inhibitor Maf
2679 PIRA01000004.1 GCA003048645_01394 CDS open 92756-94684 _na     642_aa peptidoglycan glycosyltransferase
2680 PIRA01000004.1 GCA003048645_01395 CDS open 94693-95007 _na     104_aa Late competence protein ComEA%2C DNA receptor
2681 PIRA01000004.1 GCA003048645_01396 CDS open 95081-95746 _na     221_aa DUF1705 domain-containing protein
2682 PIRA01000004.1 GCA003048645_01397 CDS open 95736-96656 _na     306_aa eptA Phosphoethanolamine transferase EptA specific for the 1 phosphate group of core-lipid A
2683 PIRA01000004.1 GCA003048645_01398 CDS open 96699-98717 _na     672_aa Glycine--tRNA ligase beta subunit
2684 PIRA01000004.1 GCA003048645_01399 CDS open 98714-98866 _na     50_aa Small hydrophobic protein
2685 PIRA01000004.1 GCA003048645_01400 CDS open 98870-100264 _na     464_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2686 PIRA01000004.1 GCA003048645_01401 CDS open 100261-100740 _na     159_aa Putative tRNA (cytidine(34)-2'-O)-methyltransferase
2687 PIRA01000004.1 GCA003048645_01402 CDS open 100839-102005 _na     388_aa Multifunctional tRNA nucleotidyl transferase / 2'3'-cyclic phosphodiesterase / 2' nucleotidase/phosphatase
2688 PIRA01000004.1 GCA003048645_01403 CDS open 101965-102390 _na     141_aa Campylobacter invasion antigen D C-terminal domain-containing protein
2689 PIRA01000004.1 GCA003048645_01404 CDS open 102387-102632 _na     81_aa Tetratricopeptide repeat protein
2690 PIRA01000004.1 GCA003048645_01405 CDS open 102629-103696 _na     355_aa leuB 3-isopropylmalate dehydrogenase
2691 PIRA01000004.1 GCA003048645_01406 CDS open 103706-104191 _na     161_aa 3-isopropylmalate dehydratase small subunit
2692 PIRA01000004.1 GCA003048645_01407 CDS open 104316-105863 _na     515_aa Flavocytochrome c flavin subunit
2693 PIRA01000004.1 GCA003048645_01408 CDS open 105995-106888 _na     297_aa DUF4299 domain-containing protein
2694 PIRA01000004.1 GCA003048645_01409 CDS open 106906-107265 _na     119_aa drsE Putative DrsE domain protein
2695 PIRA01000004.1 GCA003048645_01410 CDS open 107339-107938 _na     199_aa Homoserine/Threonine efflux protein
2696 PIRA01000004.1 GCA003048645_01411 CDS open 108250-108741 _na     163_aa DUF1877 domain-containing protein
2697 PIRA01000004.1 GCA003048645_01412 CDS open 108826-109872 _na     348_aa Asparaginase II
2698 PIRA01000004.1 GCA003048645_01413 CDS open 109958-110293 _na     111_aa azlD Branched-chain amino acid transporter AzlD
2699 PIRA01000004.1 GCA003048645_01414 CDS open 110290-110952 _na     220_aa Branched-chain amino acid transport protein
2700 PIRA01000004.1 GCA003048645_01415 CDS open 111102-112061 _na     319_aa beta-lactamase
2701 PIRA01000004.1 GCA003048645_01416 CDS open 112071-112511 _na     146_aa Beta-lactamase
2702 PIRA01000004.1 GCA003048645_01417 CDS open 112579-113322 _na     247_aa beta-lactamase
2703 PIRA01000004.1 GCA003048645_01418 CDS open 113325-113438 _na     37_aa Phosphohydrolase
2704 PIRA01000004.1 GCA003048645_01419 CDS open 113444-114229 _na     261_aa flgG flagellar basal-body rod protein FlgG
2705 PIRA01000004.1 GCA003048645_01420 CDS open 114248-115057 _na     269_aa Flagellar basal body rod protein
2706 PIRA01000004.1 GCA003048645_01421 CDS open 115209-117062 _na     617_aa rpoD RNA polymerase sigma factor RpoD
2707 PIRA01000004.1 GCA003048645_01422 CDS open 117528-118283 _na     251_aa Flagellin N-terminal domain-containing protein
2708 PIRA01000004.1 GCA003048645_01423 CDS open 118422-119714 _na     430_aa Histidinol dehydrogenase
2709 PIRA01000004.1 GCA003048645_01424 CDS open 119711-120562 _na     283_aa 1-aminocyclopropane-1-carboxylate deaminase
2710 PIRA01000004.1 GCA003048645_01425 CDS open 120555-121646 _na     363_aa OmpA-like domain-containing protein
2711 PIRA01000004.1 GCA003048645_01426 CDS open 121643-122956 _na     437_aa Membrane protein
2712 PIRA01000004.1 GCA003048645_01427 CDS open 122961-124025 _na     354_aa fbaA class II fructose-bisphosphate aldolase
2713 PIRA01000004.1 GCA003048645_01428 CDS open 124041-124859 _na     272_aa peptidylprolyl isomerase
2714 PIRA01000004.1 GCA003048645_01429 CDS open 124954-125586 _na     210_aa nth endonuclease III
2715 PIRA01000004.1 GCA003048645_01430 CDS open 125623-126912 _na     429_aa Aminoacyl-histidine dipeptidase
2716 PIRA01000004.1 GCA003048645_01431 CDS open 126930-127187 _na     85_aa Cation transporter
2717 PIRA01000004.1 GCA003048645_01432 CDS open 127180-127503 _na     107_aa Aryl sulfotransferase
2718 PIRA01000004.1 GCA003048645_01433 CDS open 127500-128579 _na     359_aa Transglutaminase-like domain-containing protein
2719 PIRA01000004.1 GCA003048645_01434 CDS open 128672-128839 _na     55_aa Lipoprotein
2720 PIRA01000004.1 GCA003048645_01435 CDS open 128841-129710 _na     289_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
2721 PIRA01000004.1 GCA003048645_01436 CDS open 129719-130252 _na     177_aa Thioesterase domain-containing protein
2722 PIRA01000004.1 GCA003048645_01437 CDS open 130455-131687 _na     410_aa Major outer membrane protein
2723 PIRA01000004.1 GCA003048645_01438 CDS open 131802-132233 _na     143_aa Trehalose-6-phosphate synthase
2724 PIRA01000004.1 GCA003048645_01439 CDS open 132287-133096 _na     269_aa ppk2 polyphosphate kinase 2
2725 PIRA01000004.1 GCA003048645_01440 CDS open 133204-134931 _na     575_aa dsbD Thiol:disulfide interchange protein DsbD
2726 PIRA01000004.1 GCA003048645_01441 CDS open 135515-136225 _na     236_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
2727 PIRA01000004.1 GCA003048645_01442 CDS open 136222-137685 _na     487_aa thrC threonine synthase
2728 PIRA01000004.1 GCA003048645_01443 CDS open 137682-137996 _na     104_aa cutA Divalent-cation tolerance protein CutA
2729 PIRA01000004.1 GCA003048645_01444 CDS open 138047-138967 _na     306_aa lpxK tetraacyldisaccharide 4'-kinase
2730 PIRA01000004.1 GCA003048645_01445 CDS open 138960-140090 _na     376_aa UDP-4-keto-6-deoxy-N-acetylglucosamine 4-aminotransferase
2731 PIRA01000004.1 GCA003048645_01446 CDS open 140101-140838 _na     245_aa NAD+ synthase
2732 PIRA01000004.1 GCA003048645_01447 CDS open 140959-141561 _na     200_aa Metallo-beta-lactamase domain-containing protein
2733 PIRA01000004.1 GCA003048645_01448 CDS open 141713-143584 _na     623_aa dnaK molecular chaperone DnaK
2734 PIRA01000004.1 GCA003048645_01449 CDS open 143616-144158 _na     180_aa grpE nucleotide exchange factor GrpE
2735 PIRA01000004.1 GCA003048645_01450 CDS open 144155-144949 _na     264_aa hrcA HrcA family transcriptional regulator
2736 PIRA01000004.1 GCA003048645_01451 CDS open 145317-145562 _na     81_aa HTH cro/C1-type domain-containing protein
2737 PIRA01000004.1 GCA003048645_01452 CDS open 145563-145742 _na     59_aa hypothetical protein
2738 PIRA01000004.1 GCA003048645_01453 CDS open 146014-146364 _na     116_aa Aminoacyl-histidine dipeptidase
2739 PIRA01000004.1 GCA003048645_01454 CDS open 146452-147729 _na     425_aa Dihydroorotase
2740 PIRA01000004.1 GCA003048645_01455 CDS open 147732-148661 _na     309_aa pyrB aspartate carbamoyltransferase catalytic subunit
2741 PIRA01000004.1 GCA003048645_01456 CDS open 148679-149089 _na     136_aa beta-lactamase
2742 PIRA01000004.1 GCA003048645_01457 CDS open 149099-149326 _na     75_aa Cell division protein
2743 PIRA01000004.1 GCA003048645_01458 CDS open 149323-150348 _na     341_aa DHHA1 domain-containing protein
2744 PIRA01000004.1 GCA003048645_01459 CDS open 150358-152553 _na     731_aa flhA flagellar biosynthesis protein FlhA
2745 PIRA01000004.1 GCA003048645_01460 CDS open 152556-152960 _na     134_aa Transcriptional regulator
2746 PIRA01000004.1 GCA003048645_01461 CDS open 153107-153379 _na     90_aa rpsO 30S ribosomal protein S15
2747 PIRA01000004.1 GCA003048645_01462 CDS open 153738-154160 _na     140_aa fdhF formate dehydrogenase subunit alpha
2748 PIRA01000004.1 GCA003048645_01463 CDS open 154257-156014 _na     585_aa Formate dehydrogenase%2C alpha subunit
2749 PIRA01000004.1 GCA003048645_01464 CDS open 156068-156502 _na     144_aa hypothetical protein
2750 PIRA01000004.1 GCA003048645_01465 CDS open 156456-156929 _na     157_aa hypothetical protein
2751 PIRA01000004.1 GCA003048645_01466 CDS open 157182-158090 _na     302_aa hypothetical protein
2752 PIRA01000004.1 GCA003048645_01467 CDS open 158485-158685 _na     66_aa hypothetical protein
2753 PIRA01000004.1 GCA003048645_01468 CDS open 158738-159442 _na     234_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
2754 PIRA01000004.1 GCA003048645_01469 CDS open 159439-160332 _na     297_aa bifunctional riboflavin kinase/FAD synthetase
2755 PIRA01000004.1 GCA003048645_01470 CDS open 160298-161011 _na     237_aa 16S/23S rRNA (Cytidine-2'-O)-methyltransferase
2756 PIRA01000004.1 GCA003048645_01471 CDS open 161001-162944 _na     647_aa ligA NAD-dependent DNA ligase LigA
2757 PIRA01000004.1 GCA003048645_01472 CDS open 162986-163846 _na     286_aa NADAR domain-containing protein
2758 PIRA01000004.1 GCA003048645_01473 CDS open 163871-165010 _na     379_aa folP dihydropteroate synthase
2759 PIRA01000004.1 GCA003048645_01474 CDS open 165007-165627 _na     206_aa DNA polymerase III subunit delta'
2760 PIRA01000004.1 GCA003048645_01475 CDS open 165628-166167 _na     179_aa DnaA-binding chromosome replication initiation factor
2761 PIRA01000004.1 GCA003048645_01476 CDS open 166167-167366 _na     399_aa aspartate kinase
2762 PIRA01000004.1 GCA003048645_01477 CDS open 167366-167830 _na     154_aa RNA pyrophosphohydrolase
2763 PIRA01000004.1 GCA003048645_01478 CDS open 167960-169006 _na     348_aa hemW radical SAM family heme chaperone HemW
2764 PIRA01000004.1 GCA003048645_01479 CDS open 169074-169472 _na     132_aa tatB Sec-independent protein translocase protein TatB
2765 PIRA01000004.1 GCA003048645_01480 CDS open 169472-170227 _na     251_aa tatC twin-arginine translocase subunit TatC
2766 PIRA01000004.1 GCA003048645_01481 CDS open 170220-171242 _na     340_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2767 PIRA01000004.1 GCA003048645_01482 CDS open 171239-172033 _na     264_aa Response regulator
2768 PIRA01000004.1 GCA003048645_01483 CDS open 172028-172396 _na     122_aa ruvX Holliday junction resolvase RuvX
2769 PIRA01000004.1 GCA003048645_01484 CDS open 172408-173178 _na     256_aa dprA DNA-processing protein DprA
2770 PIRA01000004.1 GCA003048645_01485 CDS open 173175-174626 _na     483_aa Divergent polysaccharide deacetylase
2771 PIRA01000004.1 GCA003048645_01486 CDS open 174630-175652 _na     340_aa ilvC ketol-acid reductoisomerase
2772 PIRA01000004.1 GCA003048645_01487 CDS open 175800-176618 _na     272_aa HDOD domain-containing protein
2773 PIRA01000004.1 GCA003048645_01488 CDS open 176615-178534 _na     639_aa exoribonuclease II
2774 PIRA01000004.1 GCA003048645_01489 CDS open 178527-179525 _na     332_aa holA DNA polymerase III subunit delta
2775 PIRA01000004.1 GCA003048645_01490 CDS open 179603-180022 _na     139_aa rpsF 30S ribosomal protein S6
2776 PIRA01000004.1 GCA003048645_01491 CDS open 180036-180563 _na     175_aa single-stranded DNA-binding protein
2777 PIRA01000004.1 GCA003048645_01492 CDS open 180580-180840 _na     86_aa rpsR 30S ribosomal protein S18
2778 PIRA01000004.1 GCA003048645_01493 CDS open 181065-182888 _na     607_aa mrdA penicillin-binding protein 2
2779 PIRA01000004.1 GCA003048645_01494 CDS open 182885-183376 _na     163_aa Integral membrane protein
2780 PIRA01000004.1 GCA003048645_01495 CDS open 183378-183989 _na     203_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
2781 PIRA01000004.1 GCA003048645_01496 CDS open 183986-184462 _na     158_aa lptA lipopolysaccharide transport periplasmic protein LptA
2782 PIRA01000004.1 GCA003048645_01497 CDS open 184435-184962 _na     175_aa lptC LPS export ABC transporter periplasmic protein LptC
2783 PIRA01000004.1 GCA003048645_01498 CDS open 184953-185441 _na     162_aa yrbI 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family
2784 PIRA01000004.1 GCA003048645_01499 CDS open 185438-186025 _na     195_aa hisB imidazoleglycerol-phosphate dehydratase HisB
2785 PIRA01000004.1 GCA003048645_01500 CDS open 186029-186889 _na     286_aa rlpA putative endolytic peptidoglycan transglycosylase RlpA
2786 PIRA01000004.1 GCA003048645_01501 CDS open 186876-188087 _na     403_aa Membrane-bound lytic murein transglycosylase D
2787 PIRA01000004.1 GCA003048645_01502 CDS open 188153-188938 _na     261_aa SsDNA/RNA exonuclease%2C 3'-5' specific
2788 PIRA01000004.1 GCA003048645_01503 CDS open 188935-190191 _na     418_aa Bile resistance regulator
2789 PIRA01000004.1 GCA003048645_01504 CDS open 190280-191800 _na     506_aa recN DNA repair protein RecN
2790 PIRA01000004.1 GCA003048645_01505 CDS open 191793-192668 _na     291_aa NAD(+) kinase
2791 PIRA01000004.1 GCA003048645_01506 CDS open 192761-194518 _na     585_aa aspS aspartate--tRNA ligase
2792 PIRA01000004.1 GCA003048645_01507 CDS open 194707-195276 _na     189_aa adk adenylate kinase
2793 PIRA01000004.1 GCA003048645_01508 CDS open 195384-195722 _na     112_aa NirD/YgiW/YdeI family stress tolerance protein
2794 PIRA01000004.1 GCA003048645_01509 CDS open 195793-196311 _na     172_aa ppa inorganic diphosphatase
2795 PIRA01000004.1 GCA003048645_01511 CDS open 196621-197280 _na     219_aa Zinc metalloprotease
2796 PIRA01000004.1 GCA003048645_01512 CDS open 197273-200347 _na     1024_aa Type I restriction enzyme endonuclease subunit
2797 PIRA01000004.1 GCA003048645_01513 CDS open 200367-201284 _na     305_aa DUF4868 domain-containing protein
2798 PIRA01000004.1 GCA003048645_01514 CDS open 201281-201808 _na     175_aa Integral membrane protein
2799 PIRA01000004.1 GCA003048645_01515 CDS open 201859-203001 _na     380_aa restriction endonuclease subunit S
2800 PIRA01000004.1 GCA003048645_01516 CDS open 202998-204491 _na     497_aa type I restriction-modification system subunit M
2801 PIRA01000004.1 GCA003048645_01517 CDS open 204493-205077 _na     194_aa Restriction endonuclease
2802 PIRA01000004.1 GCA003048645_01518 CDS open 205456-206316 _na     286_aa Molybdenum ABC transporter%2C ModA-like periplasmic molybdate-binding protein
2803 PIRA01000004.1 GCA003048645_01519 CDS open 206309-207121 _na     270_aa 4Fe-4S ferredoxin-type domain-containing protein
2804 PIRA01000004.1 GCA003048645_01520 CDS open 207121-207948 _na     275_aa nifB nitrogenase cofactor biosynthesis protein NifB
2805 PIRA01000004.1 GCA003048645_01521 CDS open 208359-209708 _na     449_aa histidine kinase
2806 PIRA01000004.1 GCA003048645_01522 CDS open 209692-210351 _na     219_aa Two-component system response regulator
2807 PIRA01000004.1 GCA003048645_01523 CDS open 210393-211016 _na     207_aa 3-methyladenine DNA glycosylase
2808 PIRA01000004.1 GCA003048645_01524 CDS open 211063-211548 _na     161_aa PepSY domain-containing protein
2809 PIRA01000004.1 GCA003048645_01526 CDS open 212004-212531 _na     175_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2810 PIRA01000004.1 GCA003048645_01527 CDS open 212612-213046 _na     144_aa Type II secretion system protein
2811 PIRA01000004.1 GCA003048645_01528 CDS open 213046-214014 _na     322_aa Prepilin-type N-terminal cleavage/methylation domain-containing protein
2812 PIRA01000004.1 GCA003048645_01529 CDS open 214011-214664 _na     217_aa Prepilin-type cleavage/methylation domain-containing protein
2813 PIRA01000004.1 GCA003048645_01530 CDS open 214658-218992 _na     1444_aa Internalin
2814 PIRA01000004.1 GCA003048645_01531 CDS open 219046-219429 _na     127_aa fliW flagellar assembly protein FliW
2815 PIRA01000004.1 GCA003048645_01532 CDS open 219542-220189 _na     215_aa bamD Outer membrane protein assembly factor BamD
2816 PIRA01000004.1 GCA003048645_01533 CDS open 220198-222615 _na     805_aa lon endopeptidase La
2817 PIRA01000004.1 GCA003048645_01534 CDS open 223194-225158 _na     654_aa Methyl-accepting transducer domain-containing protein
2818 PIRA01000004.1 GCA003048645_01535 CDS open 225307-226125 _na     272_aa pyridoxamine kinase
2819 PIRA01000004.1 GCA003048645_01536 CDS open 226129-227043 _na     304_aa radical SAM protein
2820 PIRA01000004.1 GCA003048645_01537 CDS open 227033-228055 _na     340_aa hemE uroporphyrinogen decarboxylase
2821 PIRA01000004.1 GCA003048645_01538 CDS open 228148-228654 _na     168_aa arcD Arginine/ornithine antiporter ArcD
2822 PIRA01000004.1 GCA003048645_01539 CDS open 229040-229969 _na     309_aa Ribose-phosphate pyrophosphokinase
2823 PIRA01000004.1 GCA003048645_01540 CDS open 230143-230505 _na     120_aa marR MarR family transcriptional regulator
2824 PIRA01000004.1 GCA003048645_01541 CDS open 230492-231514 _na     340_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2825 PIRA01000004.1 GCA003048645_01542 CDS open 231561-232151 _na     196_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
2826 PIRA01000004.1 GCA003048645_01543 CDS open 232151-233005 _na     284_aa fliY flagellar motor switch protein FliY
2827 PIRA01000004.1 GCA003048645_01544 CDS open 232995-234098 _na     367_aa fliM flagellar motor switch protein FliM
2828 PIRA01000004.1 GCA003048645_01545 CDS open 234098-234802 _na     234_aa RNA polymerase sigma28 factor
2829 PIRA01000004.1 GCA003048645_01546 CDS open 234774-235118 _na     114_aa Motility integral membrane protein
2830 PIRA01000004.1 GCA003048645_01547 CDS open 235132-235998 _na     288_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
2831 PIRA01000004.1 GCA003048645_01548 CDS open 235991-237010 _na     339_aa flhF flagellar biosynthesis protein FlhF
2832 PIRA01000004.1 GCA003048645_01549 CDS open 237207-237347 _na     46_aa hypothetical protein
2833 PIRA01000004.1 GCA003048645_01550 CDS open 237357-237833 _na     158_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
2834 PIRA01000004.1 GCA003048645_01551 CDS open 237830-238855 _na     341_aa X-Pro dipeptidase
2835 PIRA01000004.1 GCA003048645_01552 CDS open 238852-239331 _na     159_aa aroQ type II 3-dehydroquinate dehydratase
2836 PIRA01000004.1 GCA003048645_01553 CDS open 239416-240633 _na     405_aa Amidohydrolase-related domain-containing protein
2837 PIRA01000004.1 GCA003048645_01554 CDS open 240621-241484 _na     287_aa Signal peptide peptidase protease IV
2838 PIRA01000004.1 GCA003048645_01555 CDS open 241535-241744 _na     69_aa ribonuclease
2839 PIRA01000004.1 GCA003048645_01557 CDS open 242197-242601 _na     134_aa HPt domain-containing protein
2840 PIRA01000004.1 GCA003048645_01558 CDS open 242687-243502 _na     271_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2841 PIRA01000004.1 GCA003048645_01559 CDS open 243589-244476 _na     295_aa Double Cache domain-containing protein
2842 PIRA01000004.1 GCA003048645_01560 CDS open 244469-244840 _na     123_aa HIT domain-containing protein
2843 PIRA01000004.1 GCA003048645_01561 CDS open 244855-245895 _na     346_aa Acid membrane antigen A
2844 PIRA01000004.1 GCA003048645_01562 CDS open 246096-247175 _na     359_aa Cytochrome C
2845 PIRA01000004.1 GCA003048645_01563 CDS open 247199-248209 _na     336_aa ruvB Holliday junction branch migration DNA helicase RuvB
2846 PIRA01000004.1 GCA003048645_01564 CDS open 248259-249365 _na     368_aa histidine kinase
2847 PIRA01000004.1 GCA003048645_01565 CDS open 249349-250017 _na     222_aa Two-component system response regulator
2848 PIRA01000004.1 GCA003048645_01566 CDS open 250108-251043 _na     311_aa nrfD Polysulfide reductase NrfD
2849 PIRA01000004.1 GCA003048645_01567 CDS open 251036-251599 _na     187_aa Putative thiosulfate/polysulfide reductase%2C 4Fe-4S iron-sulfur binding domain-containing subunit
2850 PIRA01000004.1 GCA003048645_01568 CDS open 251609-253675 _na     688_aa phsA thiosulfate reductase PhsA
2851 PIRA01000004.1 GCA003048645_01569 CDS open 253617-253883 _na     88_aa twin-arginine translocation signal domain-containing protein
2852 PIRA01000004.1 GCA003048645_01570 CDS open 254186-255529 _na     447_aa dcuA C4-dicarboxylate transporter DcuA
2853 PIRA01000004.1 GCA003048645_01571 CDS open 255621-257021 _na     466_aa Aspartase A
2854 PIRA01000004.1 GCA003048645_01295 gene open 280-972
2855 PIRA01000004.1 GCA003048645_01296 gene open 1143-2909
2856 PIRA01000004.1 GCA003048645_01297 gene open 2920-3861 cas7b
2857 PIRA01000004.1 GCA003048645_01298 gene open 3863-4573
2858 PIRA01000004.1 GCA003048645_01299 gene open 4548-6749
2859 PIRA01000004.1 GCA003048645_01300 gene open 6749-7249
2860 PIRA01000004.1 GCA003048645_01301 gene open 7258-7536 cas2
2861 PIRA01000004.1 GCA003048645_01302 gene open 7546-8544 cas1
2862 PIRA01000004.1 GCA003048645_01303 gene open 10571-10849
2863 PIRA01000004.1 GCA003048645_01304 gene open 10846-11139
2864 PIRA01000004.1 GCA003048645_01305 gene open 11855-12376
2865 PIRA01000004.1 GCA003048645_01306 gene open 12513-12869 rplS
2866 PIRA01000004.1 GCA003048645_01307 gene open 12878-13570 trmD
2867 PIRA01000004.1 GCA003048645_01308 gene open 13567-14097 rimM
2868 PIRA01000004.1 GCA003048645_01309 gene open 14090-14332
2869 PIRA01000004.1 GCA003048645_01310 gene open 14332-14559 rpsP
2870 PIRA01000004.1 GCA003048645_01311 gene open 14631-15971 ffh
2871 PIRA01000004.1 GCA003048645_01312 gene open 16034-16792
2872 PIRA01000004.1 GCA003048645_01313 gene open 16789-17925 waaA
2873 PIRA01000004.1 GCA003048645_01314 gene open 17934-18641
2874 PIRA01000004.1 GCA003048645_01315 gene open 18658-19380
2875 PIRA01000004.1 GCA003048645_01316 gene open 19387-20247 glyQ
2876 PIRA01000004.1 GCA003048645_01317 gene open 20258-20674
2877 PIRA01000004.1 GCA003048645_01318 gene open 20678-21151
2878 PIRA01000004.1 GCA003048645_01319 gene open 21163-21657
2879 PIRA01000004.1 GCA003048645_01320 gene open 21654-22913
2880 PIRA01000004.1 GCA003048645_01321 gene open 22913-23671
2881 PIRA01000004.1 GCA003048645_01322 gene open 23808-24587
2882 PIRA01000004.1 GCA003048645_01323 gene open 24675-26105 glnA
2883 PIRA01000004.1 GCA003048645_01324 gene open 26629-28290
2884 PIRA01000004.1 GCA003048645_01325 gene open 28408-29016 lysE
2885 PIRA01000004.1 GCA003048645_01326 gene open 28951-29220 ccoS
2886 PIRA01000004.1 GCA003048645_01327 gene open 29220-31598
2887 PIRA01000004.1 GCA003048645_01328 gene open 31595-32215
2888 PIRA01000004.1 GCA003048645_01329 gene open 32362-32745 ridA
2889 PIRA01000004.1 GCA003048645_01330 gene open 32766-33842
2890 PIRA01000004.1 GCA003048645_01331 gene open 34007-35350 rho
2891 PIRA01000004.1 GCA003048645_01332 gene open 35496-35708
2892 PIRA01000004.1 GCA003048645_01333 gene open 35869-36471
2893 PIRA01000004.1 GCA003048645_01334 gene open 36540-37019
2894 PIRA01000004.1 GCA003048645_01335 gene open 37019-38122 nusA
2895 PIRA01000004.1 GCA003048645_01336 gene open 38295-38537
2896 PIRA01000004.1 GCA003048645_01337 gene open 38537-39838 miaB
2897 PIRA01000004.1 GCA003048645_01338 gene open 39819-40598
2898 PIRA01000004.1 GCA003048645_01339 gene open 40588-41034
2899 PIRA01000004.1 GCA003048645_01340 gene open 41095-42099
2900 PIRA01000004.1 GCA003048645_01341 gene open 42096-42617 pilN
2901 PIRA01000004.1 GCA003048645_01342 gene open 42610-43146
2902 PIRA01000004.1 GCA003048645_01343 gene open 43325-43537
2903 PIRA01000004.1 GCA003048645_01344 gene open 43530-43640
2904 PIRA01000004.1 GCA003048645_01345 gene open 43686-44309
2905 PIRA01000004.1 GCA003048645_01346 gene open 44322-44981
2906 PIRA01000004.1 GCA003048645_01347 gene open 44992-46332
2907 PIRA01000004.1 GCA003048645_01348 gene open 46329-46646
2908 PIRA01000004.1 GCA003048645_01349 gene open 46724-47275
2909 PIRA01000004.1 GCA003048645_01350 gene open 47297-48397 prfB
2910 PIRA01000004.1 GCA003048645_01351 gene open 48518-49339 panC
2911 PIRA01000004.1 GCA003048645_01352 gene open 49342-50652 rimO
2912 PIRA01000004.1 GCA003048645_01353 gene open 50649-51641
2913 PIRA01000004.1 GCA003048645_01354 gene open 52708-53124 sseB
2914 PIRA01000004.1 GCA003048645_01355 gene open 53105-53674 gmhA
2915 PIRA01000004.1 GCA003048645_01356 gene open 53649-55067 hldE
2916 PIRA01000004.1 GCA003048645_01357 gene open 55060-56049 rfaD
2917 PIRA01000004.1 GCA003048645_01358 gene open 56046-56561 gmhB
2918 PIRA01000004.1 GCA003048645_01359 gene open 56654-56956
2919 PIRA01000004.1 GCA003048645_01360 gene open 57324-57875 epsC
2920 PIRA01000004.1 GCA003048645_01361 gene open 57880-58785 cysK
2921 PIRA01000004.1 GCA003048645_01362 gene open 58879-59547
2922 PIRA01000004.1 GCA003048645_01363 gene open 59544-60308
2923 PIRA01000004.1 GCA003048645_01364 gene open 60305-63250 mfd
2924 PIRA01000004.1 GCA003048645_01365 gene open 63231-64433
2925 PIRA01000004.1 GCA003048645_01366 gene open 64430-66004
2926 PIRA01000004.1 GCA003048645_01367 gene open 65985-66524
2927 PIRA01000004.1 GCA003048645_01368 gene open 66528-68993 leuS
2928 PIRA01000004.1 GCA003048645_01369 gene open 69002-69340 macA
2929 PIRA01000004.1 GCA003048645_01370 gene open 69350-70321 secF
2930 PIRA01000004.1 GCA003048645_01371 gene open 70324-71904 secD
2931 PIRA01000004.1 GCA003048645_01372 gene open 71904-72176 yajC
2932 PIRA01000004.1 GCA003048645_01373 gene open 72281-73444
2933 PIRA01000004.1 GCA003048645_01374 gene open 73487-74692 metK
2934 PIRA01000004.1 GCA003048645_01375 gene open 74831-76198 sstT
2935 PIRA01000004.1 GCA003048645_01376 gene open 76287-78008
2936 PIRA01000004.1 GCA003048645_01377 gene open 78010-78459
2937 PIRA01000004.1 GCA003048645_01378 gene open 78511-80580
2938 PIRA01000004.1 GCA003048645_01379 gene open 80577-81398 truB
2939 PIRA01000004.1 GCA003048645_01380 gene open 81392-81622 csrA
2940 PIRA01000004.1 GCA003048645_01381 gene open 81619-82362
2941 PIRA01000004.1 GCA003048645_01382 gene open 82374-82829 smpB
2942 PIRA01000004.1 GCA003048645_01383 gene open 82838-83434
2943 PIRA01000004.1 GCA003048645_01384 gene open 83497-83931 flgB
2944 PIRA01000004.1 GCA003048645_01385 gene open 83940-84440 flgC
2945 PIRA01000004.1 GCA003048645_01386 gene open 84440-84733 fliE
2946 PIRA01000004.1 GCA003048645_01387 gene open 84742-86574 ftsI
2947 PIRA01000004.1 GCA003048645_01388 gene open 86663-87124
2948 PIRA01000004.1 GCA003048645_01389 gene open 87172-88125 hemH
2949 PIRA01000004.1 GCA003048645_01390 gene open 88125-88994
2950 PIRA01000004.1 GCA003048645_01391 gene open 89165-91723 alaS
2951 PIRA01000004.1 GCA003048645_01392 gene open 91720-92217
2952 PIRA01000004.1 GCA003048645_01393 gene open 92217-92759 maf
2953 PIRA01000004.1 GCA003048645_01394 gene open 92756-94684
2954 PIRA01000004.1 GCA003048645_01395 gene open 94693-95007
2955 PIRA01000004.1 GCA003048645_01396 gene open 95081-95746
2956 PIRA01000004.1 GCA003048645_01397 gene open 95736-96656 eptA
2957 PIRA01000004.1 GCA003048645_01398 gene open 96699-98717
2958 PIRA01000004.1 GCA003048645_01399 gene open 98714-98866
2959 PIRA01000004.1 GCA003048645_01400 gene open 98870-100264
2960 PIRA01000004.1 GCA003048645_01401 gene open 100261-100740
2961 PIRA01000004.1 GCA003048645_01402 gene open 100839-102005
2962 PIRA01000004.1 GCA003048645_01403 gene open 101965-102390
2963 PIRA01000004.1 GCA003048645_01404 gene open 102387-102632
2964 PIRA01000004.1 GCA003048645_01405 gene open 102629-103696 leuB
2965 PIRA01000004.1 GCA003048645_01406 gene open 103706-104191
2966 PIRA01000004.1 GCA003048645_01407 gene open 104316-105863
2967 PIRA01000004.1 GCA003048645_01408 gene open 105995-106888
2968 PIRA01000004.1 GCA003048645_01409 gene open 106906-107265 drsE
2969 PIRA01000004.1 GCA003048645_01410 gene open 107339-107938
2970 PIRA01000004.1 GCA003048645_01411 gene open 108250-108741
2971 PIRA01000004.1 GCA003048645_01412 gene open 108826-109872
2972 PIRA01000004.1 GCA003048645_01413 gene open 109958-110293 azlD
2973 PIRA01000004.1 GCA003048645_01414 gene open 110290-110952
2974 PIRA01000004.1 GCA003048645_01415 gene open 111102-112061
2975 PIRA01000004.1 GCA003048645_01416 gene open 112071-112511
2976 PIRA01000004.1 GCA003048645_01417 gene open 112579-113322
2977 PIRA01000004.1 GCA003048645_01418 gene open 113325-113438
2978 PIRA01000004.1 GCA003048645_01419 gene open 113444-114229 flgG
2979 PIRA01000004.1 GCA003048645_01420 gene open 114248-115057
2980 PIRA01000004.1 GCA003048645_01421 gene open 115209-117062 rpoD
2981 PIRA01000004.1 GCA003048645_01422 gene open 117528-118283
2982 PIRA01000004.1 GCA003048645_01423 gene open 118422-119714
2983 PIRA01000004.1 GCA003048645_01424 gene open 119711-120562
2984 PIRA01000004.1 GCA003048645_01425 gene open 120555-121646
2985 PIRA01000004.1 GCA003048645_01426 gene open 121643-122956
2986 PIRA01000004.1 GCA003048645_01427 gene open 122961-124025 fbaA
2987 PIRA01000004.1 GCA003048645_01428 gene open 124041-124859
2988 PIRA01000004.1 GCA003048645_01429 gene open 124954-125586 nth
2989 PIRA01000004.1 GCA003048645_01430 gene open 125623-126912
2990 PIRA01000004.1 GCA003048645_01431 gene open 126930-127187
2991 PIRA01000004.1 GCA003048645_01432 gene open 127180-127503
2992 PIRA01000004.1 GCA003048645_01433 gene open 127500-128579
2993 PIRA01000004.1 GCA003048645_01434 gene open 128672-128839
2994 PIRA01000004.1 GCA003048645_01435 gene open 128841-129710 cmoB
2995 PIRA01000004.1 GCA003048645_01436 gene open 129719-130252
2996 PIRA01000004.1 GCA003048645_01437 gene open 130455-131687
2997 PIRA01000004.1 GCA003048645_01438 gene open 131802-132233
2998 PIRA01000004.1 GCA003048645_01439 gene open 132287-133096 ppk2
2999 PIRA01000004.1 GCA003048645_01440 gene open 133204-134931 dsbD
3000 PIRA01000004.1 GCA003048645_01441 gene open 135515-136225 kdsB