HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter segnis (GCA_003130095.1)

Select a Genome:
BAKTA Annotations for GCA_003130095.1
Genome Selected: Aggregatibacter segnis
ContigsBases CDSrRNA tmRNAtRNA
12 1978324 1851 10 1 50
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3868 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 3868 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 NRCX01000003.1 GCA003130095_01122 gene open 75995-77185
2502 NRCX01000003.1 GCA003130095_01123 gene open 77188-78390
2503 NRCX01000003.1 GCA003130095_01124 gene open 78391-78975 dcd
2504 NRCX01000003.1 GCA003130095_01125 gene open 78985-79635 udk
2505 NRCX01000003.1 GCA003130095_01126 gene open 79899-80939 afuA
2506 NRCX01000003.1 GCA003130095_01127 gene open 81095-82129
2507 NRCX01000003.1 GCA003130095_01128 gene open 82196-84253 fbpB1
2508 NRCX01000003.1 GCA003130095_01129 gene open 84270-85316 fbpC
2509 NRCX01000003.1 GCA003130095_01130 gene open 85450-87468
2510 NRCX01000003.1 GCA003130095_01131 gene open 87647-89035 yegQ
2511 NRCX01000003.1 GCA003130095_01132 gene open 89318-90409 queA
2512 NRCX01000003.1 GCA003130095_01133 gene open 90518-91669 tgt
2513 NRCX01000003.1 GCA003130095_01134 gene open 91753-92271
2514 NRCX01000003.1 GCA003130095_01135 gene open 92291-92512 sirA
2515 NRCX01000003.1 GCA003130095_01136 gene open 92675-92974 yajC
2516 NRCX01000003.1 GCA003130095_01137 gene open 93005-94855 secD
2517 NRCX01000003.1 GCA003130095_01138 gene open 94873-95838 secF
2518 NRCX01000003.1 GCA003130095_01139 gene open 96000-97262 glyA
2519 NRCX01000003.1 GCA003130095_01140 gene open 97477-98766 purD
2520 NRCX01000003.1 GCA003130095_01141 gene open 98949-100550 purH
2521 NRCX01000003.1 GCA003130095_01142 gene open 100982-101986 rsmC
2522 NRCX01000003.1 GCA003130095_01143 gene open 102054-102494
2523 NRCX01000003.1 GCA003130095_01144 gene open 102507-102950 rimI
2524 NRCX01000003.1 GCA003130095_01145 gene open 102953-106348 recC
2525 NRCX01000003.1 GCA003130095_01146 gene open 106387-106689
2526 NRCX01000003.1 GCA003130095_01147 gene open 106664-107359
2527 NRCX01000003.1 GCA003130095_01148 gene open 107356-108099 pulJ
2528 NRCX01000003.1 GCA003130095_01149 gene open 108086-108604
2529 NRCX01000003.1 GCA003130095_01150 gene open 108656-108778
2530 NRCX01000003.1 GCA003130095_01154 gene open 109281-109733 pal
2531 NRCX01000003.1 GCA003130095_01155 gene open 109748-111028 tolB
2532 NRCX01000003.1 GCA003130095_01156 gene open 111062-112177 tolA
2533 NRCX01000003.1 GCA003130095_01157 gene open 112195-112617 tolR
2534 NRCX01000003.1 GCA003130095_01158 gene open 112703-113392 tolQ
2535 NRCX01000003.1 GCA003130095_01159 gene open 113422-113826 ybgC
2536 NRCX01000003.1 GCA003130095_01160 gene open 113940-114227 ybgE
2537 NRCX01000003.1 GCA003130095_01161 gene open 114232-114330
2538 NRCX01000003.1 GCA003130095_01162 gene open 114341-115480 cydB
2539 NRCX01000003.1 GCA003130095_01163 gene open 115495-117060
2540 NRCX01000003.1 GCA003130095_01164 gene open 117505-117828 ruvB
2541 NRCX01000003.1 GCA003130095_01165 gene open 117880-118893 ruvB
2542 NRCX01000003.1 GCA003130095_01166 gene open 118909-119523 ruvA
2543 NRCX01000003.1 GCA003130095_01167 gene open 119587-120159 ruvC
2544 NRCX01000003.1 GCA003130095_01168 gene open 120217-120642
2545 NRCX01000003.1 GCA003130095_01169 gene open 120652-121392 tACO1
2546 NRCX01000003.1 GCA003130095_01170 gene open 121405-121785
2547 NRCX01000003.1 GCA003130095_01171 gene open 121963-123231 mntH
2548 NRCX01000003.1 GCA003130095_01172 gene open 123688-124389
2549 NRCX01000003.1 GCA003130095_01173 gene open 124452-126218 aspS
2550 NRCX01000003.1 GCA003130095_01174 gene open 126384-127106 cmoA
2551 NRCX01000003.1 GCA003130095_01175 gene open 127201-129756
2552 NRCX01000003.1 GCA003130095_01176 gene open 130056-132152
2553 NRCX01000003.1 GCA003130095_01177 gene open 132300-132707 gloA
2554 NRCX01000003.1 GCA003130095_01178 gene open 132795-133448 rnt
2555 NRCX01000003.1 GCA003130095_01179 gene open 133806-135155 gntP
2556 NRCX01000003.1 GCA003130095_01180 gene open 135212-135784
2557 NRCX01000003.1 GCA003130095_01181 gene open 135840-137264 miaB
2558 NRCX01000003.1 GCA003130095_01182 gene open 137550-138278 queH
2559 NRCX01000003.1 GCA003130095_01183 gene open 138619-139590 ispB
2560 NRCX01000003.1 GCA003130095_01184 gene open 139850-140161 rplU
2561 NRCX01000003.1 GCA003130095_01185 gene open 140182-140439 rpmA
2562 NRCX01000003.1 GCA003130095_01186 gene open 140497-141423
2563 NRCX01000003.1 GCA003130095_01187 gene open 141451-142626 cgtA
2564 NRCX01000003.1 GCA003130095_01188 gene open 142702-143184 smpB
2565 NRCX01000003.1 GCA003130095_01189 gene open 143425-144129 arcA
2566 NRCX01000003.1 GCA003130095_01190 gene open 144373-144513 ykgO
2567 NRCX01000003.1 GCA003130095_01191 gene open 144523-144789 rpmE2
2568 NRCX01000003.1 GCA003130095_01192 gene open 145008-145568
2569 NRCX01000003.1 GCA003130095_01193 gene open 145727-147493 dsbD
2570 NRCX01000003.1 GCA003130095_01194 gene open 147599-147997 doxX
2571 NRCX01000003.1 GCA003130095_01195 gene open 148130-148942
2572 NRCX01000003.1 GCA003130095_01196 gene open 149072-150115 znuA
2573 NRCX01000003.1 GCA003130095_01197 gene open 150216-150986 tcdA
2574 NRCX01000003.1 GCA003130095_01198 gene open 150986-152092 mltA
2575 NRCX01000003.1 GCA003130095_01200 gene open 152480-153853 mpl
2576 NRCX01000003.1 GCA003130095_01201 gene open 154008-155012 fbp
2577 NRCX01000003.1 GCA003130095_01202 gene open 155110-155916
2578 NRCX01000003.1 GCA003130095_01203 gene open 156128-156799 yadS
2579 NRCX01000003.1 GCA003130095_01204 gene open 156808-158070
2580 NRCX01000003.1 GCA003130095_01205 gene open 158190-159542 lysC
2581 NRCX01000003.1 GCA003130095_01209 gene open 160223-161332 metC
2582 NRCX01000003.1 GCA003130095_01210 gene open 161356-162351 ldhA
2583 NRCX01000003.1 GCA003130095_01211 gene open 162448-162771 trxA
2584 NRCX01000003.1 GCA003130095_01212 gene open 162880-163929 rluC
2585 NRCX01000003.1 GCA003130095_01213 gene open 164173-164325
2586 NRCX01000003.1 GCA003130095_01214 gene open 164306-167164 rne
2587 NRCX01000003.1 GCA003130095_01216 gene open 167491-170940 mfd
2588 NRCX01000003.1 GCA003130095_01217 gene open 171064-171240
2589 NRCX01000003.1 GCA003130095_01218 gene open 171292-173229 tmcA
2590 NRCX01000003.1 GCA003130095_01219 gene open 173226-173690 ybeY
2591 NRCX01000003.1 GCA003130095_01220 gene open 173746-174849
2592 NRCX01000003.1 GCA003130095_01221 gene open 175027-177303 gshB
2593 NRCX01000003.1 GCA003130095_01222 gene open 177542-179149
2594 NRCX01000003.1 GCA003130095_01223 gene open 179375-179956 clpP
2595 NRCX01000003.1 GCA003130095_01224 gene open 179966-181216 clpX
2596 NRCX01000003.1 GCA003130095_01225 gene open 181260-183419 zntA
2597 NRCX01000003.1 GCA003130095_01226 gene open 183651-183863
2598 NRCX01000003.1 GCA003130095_01227 gene open 183954-184340 cspA
2599 NRCX01000003.1 GCA003130095_01228 gene open 184412-185149 tsaA
2600 NRCX01000003.1 GCA003130095_01229 gene open 185260-186165 menA
2601 NRCX01000003.1 GCA003130095_01230 gene open 186216-186716 rraA
2602 NRCX01000003.1 GCA003130095_01231 gene open 186908-188299 citT
2603 NRCX01000003.1 GCA003130095_01232 gene open 188365-188898 yjgA
2604 NRCX01000003.1 GCA003130095_01233 gene open 189015-190376 pmbA
2605 NRCX01000003.1 GCA003130095_01235 gene open 190607-191146 hpt
2606 NRCX01000003.1 GCA003130095_01236 gene open 191222-193024 deaD
2607 NRCX01000003.1 GCA003130095_01237 gene open 193133-194038 nlpI
2608 NRCX01000003.1 GCA003130095_01238 gene open 194127-196256 pnp
2609 NRCX01000003.1 GCA003130095_01239 gene open 196532-197002 nanQ
2610 NRCX01000003.1 GCA003130095_01240 gene open 197099-197893 focA
2611 NRCX01000003.1 GCA003130095_01241 gene open 198059-198604 ahpD
2612 NRCX01000003.1 GCA003130095_01242 gene open 199191-199745 ampD
2613 NRCX01000003.1 GCA003130095_01243 gene open 199872-200324 pilA
2614 NRCX01000003.1 GCA003130095_01244 gene open 200353-201762 pilB
2615 NRCX01000003.1 GCA003130095_01245 gene open 201755-202978 pilC
2616 NRCX01000003.1 GCA003130095_01246 gene open 202975-203667
2617 NRCX01000003.1 GCA003130095_01247 gene open 203717-204340 coaE
2618 NRCX01000003.1 GCA003130095_01248 gene open 204330-204545 yacG
2619 NRCX01000003.1 GCA003130095_01249 gene open 204542-204814
2620 NRCX01000003.1 GCA003130095_01250 gene open 205193-206569 alsT
2621 NRCX01000003.1 GCA003130095_01251 gene open 206803-207126 raiA
2622 NRCX01000003.1 GCA003130095_01252 gene open 207207-207932
2623 NRCX01000003.1 GCA003130095_01253 gene open 208028-208657
2624 NRCX01000003.1 GCA003130095_01254 gene open 208741-210096 mnmE
2625 NRCX01000003.1 GCA003130095_01255 gene open 210295-211923 yidC
2626 NRCX01000003.1 GCA003130095_01256 gene open 211923-212186 yidD
2627 NRCX01000003.1 GCA003130095_01257 gene open 212141-212476 rnpA
2628 NRCX01000003.1 GCA003130095_01258 gene open 212522-212656 rpmH
2629 NRCX01000003.1 GCA003130095_01259 gene open 213079-214440 dnaA
2630 NRCX01000003.1 GCA003130095_01260 gene open 214451-215551 dnaN
2631 NRCX01000003.1 GCA003130095_01261 gene open 215555-216631 recF
2632 NRCX01000003.1 GCA003130095_01262 gene open 216677-217432 ubiE
2633 NRCX01000003.1 GCA003130095_01263 gene open 217611-218180 sodC
2634 NRCX01000003.1 GCA003130095_01264 gene open 218346-218765 psiE
2635 NRCX01000003.1 GCA003130095_01265 gene open 218849-219754 era
2636 NRCX01000003.1 GCA003130095_01266 gene open 219751-220431 rnc
2637 NRCX01000003.1 GCA003130095_01267 gene open 220433-221455 lepB
2638 NRCX01000003.1 GCA003130095_01268 gene open 221466-223262 lepA
2639 NRCX01000003.1 GCA003130095_01269 gene open 223541-223732
2640 NRCX01000003.1 GCA003130095_01270 gene open 223958-224998
2641 NRCX01000003.1 GCA003130095_01271 gene open 225030-225932 lysR
2642 NRCX01000003.1 GCA003130095_01272 gene open 226060-226923 hchA
2643 NRCX01000003.1 GCA003130095_01273 gene open 227096-227317
2644 NRCX01000003.1 GCA003130095_01274 gene open 227767-228150 grcA
2645 NRCX01000003.1 GCA003130095_01275 gene open 228445-229116 ung
2646 NRCX01000003.1 GCA003130095_01276 gene open 229148-229924 yaaA
2647 NRCX01000003.1 GCA003130095_01277 gene open 229927-230490
2648 NRCX01000003.1 GCA003130095_01278 gene open 230490-231410 fieF
2649 NRCX01000003.1 GCA003130095_01279 gene open 231473-232438 pfkA
2650 NRCX01000003.1 GCA003130095_01280 gene open 232516-235530
2651 NRCX01000003.1 GCA003130095_01281 gene open 235760-236935 rlmC
2652 NRCX01000003.1 GCA003130095_01282 gene open 236937-237983 nagZ
2653 NRCX01000003.1 GCA003130095_01283 gene open 237985-238338 virB7
2654 NRCX01000003.1 GCA003130095_01284 gene open 238338-238688 hinT
2655 NRCX01000003.1 GCA003130095_01285 gene open 238998-239849 focA
2656 NRCX01000003.1 GCA003130095_01286 gene open 239936-242248 pflB
2657 NRCX01000003.1 GCA003130095_01287 gene open 242412-243152 pflA
2658 NRCX01000003.1 GCA003130095_01288 gene open 243295-244158 rhaT
2659 NRCX01000003.1 GCA003130095_01289 gene open 244310-245749
2660 NRCX01000003.1 GCA003130095_01290 gene open 245820-246410
2661 NRCX01000003.1 GCA003130095_01291 gene open 246451-246639
2662 NRCX01000003.1 GCA003130095_01292 gene open 246747-248159 ftsP
2663 NRCX01000003.1 GCA003130095_01293 gene open 248160-248912
2664 NRCX01000003.1 GCA003130095_01294 gene open 249021-249752 lpxH
2665 NRCX01000003.1 GCA003130095_01295 gene open 249745-250251
2666 NRCX01000003.1 GCA003130095_01296 gene open 250310-250876 efp
2667 NRCX01000003.1 GCA003130095_01297 gene open 250908-251927 epmB
2668 NRCX01000003.1 GCA003130095_01298 gene open 252097-253305 oapA
2669 NRCX01000003.1 GCA003130095_01299 gene open 253367-253744
2670 NRCX01000003.1 GCA003130095_01300 gene open 253852-254433
2671 NRCX01000003.1 GCA003130095_01301 gene open 254509-255456 cysK
2672 NRCX01000003.1 GCA003130095_01302 gene open 255555-256379 cysZ
2673 NRCX01000003.1 GCA003130095_01303 gene open 256520-257548 zipA
2674 NRCX01000003.1 GCA003130095_01304 gene open 257652-259667 ligA
2675 NRCX01000003.1 GCA003130095_01305 gene open 259738-260316 tdk
2676 NRCX01000003.1 GCA003130095_01306 gene open 260316-260549
2677 NRCX01000003.1 GCA003130095_01307 gene open 260620-261648 tsaD
2678 NRCX01000003.1 GCA003130095_01308 gene open 261873-262088 rpsU
2679 NRCX01000003.1 GCA003130095_01309 gene open 262210-263970 dnaG
2680 NRCX01000003.1 GCA003130095_01310 gene open 264046-265911 rpoD
2681 NRCX01000003.1 GCA003130095_01312 gene open 266313-267509
2682 NRCX01000003.1 GCA003130095_01313 gene open 267674-269464
2683 NRCX01000003.1 GCA003130095_01314 gene open 269448-269891
2684 NRCX01000003.1 GCA003130095_01315 gene open 269891-270115
2685 NRCX01000003.1 GCA003130095_01316 gene open 270108-270458
2686 NRCX01000003.1 GCA003130095_01317 gene open 270445-270636
2687 NRCX01000003.1 GCA003130095_01318 gene open 270652-270834
2688 NRCX01000003.1 GCA003130095_01319 gene open 270827-271426
2689 NRCX01000003.1 GCA003130095_01321 gene open 271625-271936
2690 NRCX01000003.1 GCA003130095_01322 gene open 271948-272151 alpA
2691 NRCX01000003.1 GCA003130095_01323 gene open 272296-273252 slyX
2692 NRCX01000003.1 GCA003130095_01324 gene open 273397-273957
2693 NRCX01000003.1 GCA003130095_01325 gene open 273950-274222
2694 NRCX01000003.1 GCA003130095_01326 gene open 274504-276123
2695 NRCX01000003.1 GCA003130095_01327 gene open 276180-276548
2696 NRCX01000003.1 GCA003130095_01328 gene open 277140-277454
2697 NRCX01000003.1 GCA003130095_01329 gene open 277441-277785
2698 NRCX01000003.1 GCA003130095_01330 gene open 277769-279001
2699 NRCX01000003.1 GCA003130095_01331 gene open 279003-279569
2700 NRCX01000003.1 GCA003130095_01332 gene open 279623-280810
2701 NRCX01000003.1 GCA003130095_01333 gene open 281275-284049
2702 NRCX01000003.1 GCA003130095_01334 gene open 284294-285049 glpR
2703 NRCX01000003.1 GCA003130095_01335 gene open 285114-285989 glpG
2704 NRCX01000003.1 GCA003130095_01336 gene open 286031-286345
2705 NRCX01000003.1 GCA003130095_01337 gene open 286342-286668 glpE
2706 NRCX01000003.1 GCA003130095_01338 gene open 287060-287389
2707 NRCX01000003.1 GCA003130095_01339 gene open 287509-288108 rdgB
2708 NRCX01000003.1 GCA003130095_01340 gene open 288148-288471 ybjQ
2709 NRCX01000003.1 GCA003130095_01341 gene open 288471-289643 hemW
2710 NRCX01000003.1 GCA003130095_01342 gene open 289739-290395 rpiA
2711 NRCX01000003.1 GCA003130095_01343 gene open 290414-291646 serA
2712 NRCX01000003.1 GCA003130095_01344 gene open 291711-292352
2713 NRCX01000003.1 GCA003130095_01345 gene open 292384-294132 dauA
2714 NRCX01000003.1 GCA003130095_01347 gene open 294571-296988 lon
2715 NRCX01000003.1 GCA003130095_01348 gene open 297115-298962 ppiD
2716 NRCX01000003.1 GCA003130095_01349 gene open 299089-299715 upp
2717 NRCX01000003.1 GCA003130095_01350 gene open 299847-301091 uraA
2718 NRCX01000003.1 GCA003130095_01351 gene open 301206-301910 hda
2719 NRCX01000003.1 GCA003130095_01352 gene open 301917-302369
2720 NRCX01000003.1 GCA003130095_01353 gene open 302424-303038
2721 NRCX01000003.1 GCA003130095_01354 gene open 303048-304325 hisS
2722 NRCX01000003.1 GCA003130095_01355 gene open 304351-305454 ispG
2723 NRCX01000003.1 GCA003130095_01356 gene open 305465-306505
2724 NRCX01000003.1 GCA003130095_01357 gene open 306721-307272 pilW
2725 NRCX01000003.1 GCA003130095_01358 gene open 307297-308451 rlmN
2726 NRCX01000003.1 GCA003130095_01359 gene open 308691-309209 sprT
2727 NRCX01000003.1 GCA003130095_01360 gene open 309414-312221
2728 NRCX01000003.1 GCA003130095_01361 gene open 312406-313350 ispH
2729 NRCX01000003.1 GCA003130095_01362 gene open 313347-313847 lspA
2730 NRCX01000003.1 GCA003130095_01363 gene open 314184-314906
2731 NRCX01000003.1 GCA003130095_01364 gene open 314903-315649
2732 NRCX01000003.1 GCA003130095_01365 gene open 315658-316305 tenA
2733 NRCX01000003.1 GCA003130095_01366 gene open 316324-317271
2734 NRCX01000003.1 GCA003130095_01367 gene open 317340-320162 ileS
2735 NRCX01000003.1 GCA003130095_01368 gene open 320202-321140 ribF
2736 NRCX01000003.1 GCA003130095_01369 gene open 321222-322799 murJ
2737 NRCX01000003.1 GCA003130095_01370 gene open 323068-323331 rpsT
2738 NRCX01000003.1 GCA003130095_01371 gene open 323440-324084 ahpA
2739 NRCX01000003.1 GCA003130095_01372 gene open 324196-325140 serB
2740 NRCX01000003.1 GCA003130095_01373 gene open 325151-325642 yajQ
2741 NRCX01000003.1 GCA003130095_01374 gene open 325763-326347 pth
2742 NRCX01000003.1 GCA003130095_01375 gene open 326415-327506 ychF
2743 NRCX01000003.1 GCA003130095_01376 gene open 327580-327810 pglI
2744 NRCX01000003.1 GCA003130095_01377 gene open 327829-329448 pglI
2745 NRCX01000003.1 GCA003130095_01378 gene open 329520-331127 rmuC
2746 NRCX01000003.1 GCA003130095_01379 gene open 331293-331841
2747 NRCX01000003.1 GCA003130095_01380 gene open 331846-332397
2748 NRCX01000003.1 GCA003130095_01381 gene open 332401-333201 aroE
2749 NRCX01000003.1 GCA003130095_01382 gene open 333207-334079 rarD
2750 NRCX01000003.1 GCA003130095_01383 gene open 334107-334985 ilvY
2751 NRCX01000003.1 GCA003130095_01384 gene open 335727-337205 ilvC
2752 NRCX01000003.1 GCA003130095_01385 gene open 337273-339753
2753 NRCX01000003.1 GCA003130095_01386 gene open 339814-340668
2754 NRCX01000003.1 GCA003130095_01387 gene open 340652-341416
2755 NRCX01000003.1 GCA003130095_01388 gene open 341426-342094
2756 NRCX01000003.1 GCA003130095_01389 gene open 342084-342230
2757 NRCX01000003.1 GCA003130095_01390 gene open 342190-342744
2758 NRCX01000003.1 GCA003130095_01391 gene open 343055-343429 rpsL
2759 NRCX01000003.1 GCA003130095_01392 gene open 343582-344052 rpsG
2760 NRCX01000003.1 GCA003130095_01393 gene open 344169-346271 fusA
2761 NRCX01000003.1 GCA003130095_01115 gene open 70087-70163 trnD
2762 NRCX01000003.1 GCA003130095_01116 gene open 70183-70259 trnD
2763 NRCX01000003.1 GCA003130095_01151 gene open 108814-108890 trnK
2764 NRCX01000003.1 GCA003130095_01152 gene open 108916-108991 trnK
2765 NRCX01000003.1 GCA003130095_01153 gene open 109015-109090 trnK
2766 NRCX01000003.1 GCA003130095_01199 gene open 152353-152429 trnfM
2767 NRCX01000003.1 GCA003130095_01206 gene open 159708-159794 trnL
2768 NRCX01000003.1 GCA003130095_01207 gene open 159826-159899 trnC
2769 NRCX01000003.1 GCA003130095_01208 gene open 159907-159982 trnG
2770 NRCX01000003.1 GCA003130095_01215 gene open 167257-167346 trnS
2771 NRCX01000003.1 GCA003130095_01311 gene open 266038-266114 trnI
2772 NRCX01000003.1 GCA003130095_01346 gene open 294289-294378 trnS
2773 NRCX01000003.1 GCA003130095_01115 tRNA open 70087-70163 trnD tRNA-Asp(gtc)
2774 NRCX01000003.1 GCA003130095_01116 tRNA open 70183-70259 trnD tRNA-Asp(gtc)
2775 NRCX01000003.1 GCA003130095_01151 tRNA open 108814-108890 trnK tRNA-Lys(ctt)
2776 NRCX01000003.1 GCA003130095_01152 tRNA open 108916-108991 trnK tRNA-Lys(ttt)
2777 NRCX01000003.1 GCA003130095_01153 tRNA open 109015-109090 trnK tRNA-Lys(ttt)
2778 NRCX01000003.1 GCA003130095_01199 tRNA open 152353-152429 trnfM tRNA-fMet(cat)
2779 NRCX01000003.1 GCA003130095_01206 tRNA open 159708-159794 trnL tRNA-Leu(taa)
2780 NRCX01000003.1 GCA003130095_01207 tRNA open 159826-159899 trnC tRNA-Cys(gca)
2781 NRCX01000003.1 GCA003130095_01208 tRNA open 159907-159982 trnG tRNA-Gly(gcc)
2782 NRCX01000003.1 GCA003130095_01215 tRNA open 167257-167346 trnS tRNA-Ser(tga)
2783 NRCX01000003.1 GCA003130095_01311 tRNA open 266038-266114 trnI tRNA-Ile2(cat)
2784 NRCX01000003.1 GCA003130095_01346 tRNA open 294289-294378 trnS tRNA-Ser(gga)
2785 NRCX01000004.1 regulatory_region open 4061-4208 FMN riboswitch aptamer (RFN element)
2786 NRCX01000004.1 regulatory_region open 50784-50883 TPP riboswitch aptamer (THI element)
2787 NRCX01000004.1 repeat_region open 34273-34820 CRISPR array with 8 repeats of length 37%2C consensus sequence GTCGAAAGACCCCGCCCTGTTCCAAAGGGATTAAAAC and spacer length 34
2788 NRCX01000004.1 repeat_region open 39277-39467 CRISPR array with 3 repeats of length 40%2C consensus sequence GTCGAAAGACCTTGCCCTGTTCCAAAGGGATTAAGACTTG and spacer length 30
2789 NRCX01000004.1 GCA003130095_01394 CDS open 313-825 _na     170_aa hemG menaquinone-dependent protoporphyrinogen IX dehydrogenase
2790 NRCX01000004.1 GCA003130095_01395 CDS open 825-2246 _na     473_aa trkH TrkH family potassium uptake protein
2791 NRCX01000004.1 GCA003130095_01396 CDS open 2301-2912 _na     203_aa IMPACT family protein
2792 NRCX01000004.1 GCA003130095_01397 CDS open 2999-3238 _na     79_aa tusA sulfurtransferase TusA
2793 NRCX01000004.1 GCA003130095_01398 CDS open 3308-3952 _na     214_aa 3%2C4-dihydroxy-2-butanone 4-phosphate synthase
2794 NRCX01000004.1 GCA003130095_01399 CDS open 4444-5715 _na     423_aa nadR multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR
2795 NRCX01000004.1 GCA003130095_01400 CDS open 5728-6414 _na     228_aa Calcineurin-like phosphoesterase domain-containing protein
2796 NRCX01000004.1 GCA003130095_01401 CDS open 6526-7749 _na     407_aa Aromatic amino acid permease
2797 NRCX01000004.1 GCA003130095_01402 CDS open 7814-8221 _na     135_aa merR MerR family transcriptional regulator
2798 NRCX01000004.1 GCA003130095_01403 CDS open 8261-8572 _na     103_aa DUF721 domain-containing protein
2799 NRCX01000004.1 GCA003130095_01404 CDS open 8664-8981 _na     105_aa secM secA translation cis-regulator SecM
2800 NRCX01000004.1 GCA003130095_01405 CDS open 9059-11767 _na     902_aa secA preprotein translocase subunit SecA
2801 NRCX01000004.1 GCA003130095_01406 CDS open 11853-12251 _na     132_aa mutT 8-oxo-dGTP diphosphatase MutT
2802 NRCX01000004.1 GCA003130095_01407 CDS open 12312-12572 _na     86_aa TonB-dependent receptor
2803 NRCX01000004.1 GCA003130095_01408 CDS open 12673-13713 _na     346_aa holA DNA polymerase III subunit delta
2804 NRCX01000004.1 GCA003130095_01409 CDS open 13713-14216 _na     167_aa lptE LPS-assembly lipoprotein LptE
2805 NRCX01000004.1 GCA003130095_01410 CDS open 14277-16865 _na     862_aa leuS leucine--tRNA ligase
2806 NRCX01000004.1 GCA003130095_01411 CDS open 16984-17616 _na     210_aa Diadenosine tetraphosphatase
2807 NRCX01000004.1 GCA003130095_01412 CDS open 17625-18452 _na     275_aa apaH bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH
2808 NRCX01000004.1 GCA003130095_01413 CDS open 18468-19331 _na     287_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
2809 NRCX01000004.1 GCA003130095_01414 CDS open 19410-20333 _na     307_aa Peptidyl-prolyl cis-trans isomerase
2810 NRCX01000004.1 GCA003130095_01415 CDS open 20404-20985 _na     193_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
2811 NRCX01000004.1 GCA003130095_01416 CDS open 21193-22305 _na     370_aa asd aspartate-semialdehyde dehydrogenase
2812 NRCX01000004.1 GCA003130095_01417 CDS open 22365-22979 _na     204_aa Helix-hairpin-helix domain-containing protein
2813 NRCX01000004.1 GCA003130095_01418 CDS open 23206-25410 _na     734_aa cas10 type III-A CRISPR-associated protein Cas10/Csm1
2814 NRCX01000004.1 GCA003130095_01419 CDS open 25419-25802 _na     127_aa CRISPR system Cms protein Csm2
2815 NRCX01000004.1 GCA003130095_01420 CDS open 25813-26517 _na     234_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
2816 NRCX01000004.1 GCA003130095_01421 CDS open 26527-27465 _na     312_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
2817 NRCX01000004.1 GCA003130095_01422 CDS open 27462-29090 _na     542_aa RAMP superfamily
2818 NRCX01000004.1 GCA003130095_01423 CDS open 29087-30010 _na     307_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
2819 NRCX01000004.1 GCA003130095_01424 CDS open 30071-30361 _na     96_aa CRISPR-associated protein VVA1548 family protein
2820 NRCX01000004.1 GCA003130095_01425 CDS open 30370-31512 _na     380_aa Card1 endonuclease domain-containing protein
2821 NRCX01000004.1 GCA003130095_01426 CDS open 31512-32666 _na     384_aa csm6 CRISPR-associated ring nuclease Csm6
2822 NRCX01000004.1 GCA003130095_01427 CDS open 35774-35899 _na     41_aa hypothetical protein
2823 NRCX01000004.1 GCA003130095_01428 CDS open 36077-36436 _na     119_aa hypothetical protein
2824 NRCX01000004.1 GCA003130095_01429 CDS open 36525-37379 _na     284_aa hypothetical protein
2825 NRCX01000004.1 GCA003130095_01430 CDS open 37395-37679 _na     94_aa cas2 CRISPR-associated endonuclease Cas2
2826 NRCX01000004.1 GCA003130095_01431 CDS open 37688-38758 _na     356_aa cas1 CRISPR-associated endonuclease Cas1
2827 NRCX01000004.1 GCA003130095_01432 CDS open 38771-39058 _na     95_aa cas2 CRISPR-associated endonuclease Cas2
2828 NRCX01000004.1 GCA003130095_01433 CDS open 39986-42556 _na     856_aa clpB ATP-dependent chaperone ClpB
2829 NRCX01000004.1 GCA003130095_01434 CDS open 42656-43156 _na     166_aa Surface-adhesin protein
2830 NRCX01000004.1 GCA003130095_01435 CDS open 43341-44381 _na     346_aa Phosphoribosylformylglycinamidine cyclo-ligase
2831 NRCX01000004.1 GCA003130095_01436 CDS open 44381-45019 _na     212_aa purN phosphoribosylglycinamide formyltransferase
2832 NRCX01000004.1 GCA003130095_01437 CDS open 45055-45870 _na     271_aa IIB family HAD hydrolase
2833 NRCX01000004.1 GCA003130095_01438 CDS open 46026-46712 _na     228_aa Competence protein F
2834 NRCX01000004.1 GCA003130095_01439 CDS open 46822-47406 _na     194_aa nfuA Fe-S biogenesis protein NfuA
2835 NRCX01000004.1 GCA003130095_01440 CDS open 47456-48754 _na     432_aa brnQ branched-chain amino acid transport system II carrier protein
2836 NRCX01000004.1 GCA003130095_01441 CDS open 49006-50640 _na     544_aa pyrG glutamine hydrolyzing CTP synthase
2837 NRCX01000004.1 GCA003130095_01442 CDS open 50942-51604 _na     220_aa thiE thiamine phosphate synthase
2838 NRCX01000004.1 GCA003130095_01443 CDS open 51806-53116 _na     436_aa eno phosphopyruvate hydratase
2839 NRCX01000004.1 GCA003130095_01444 CDS open 53219-53638 _na     139_aa ruvX Holliday junction resolvase RuvX
2840 NRCX01000004.1 GCA003130095_01445 CDS open 53638-54198 _na     186_aa algH YqgE/AlgH family protein
2841 NRCX01000004.1 GCA003130095_01446 CDS open 54212-54946 _na     244_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
2842 NRCX01000004.1 GCA003130095_01447 CDS open 55028-55345 _na     105_aa metJ met regulon transcriptional regulator MetJ
2843 NRCX01000004.1 GCA003130095_01448 CDS open 55496-56383 _na     295_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
2844 NRCX01000004.1 GCA003130095_01449 CDS open 56454-57818 _na     454_aa manB phosphomannomutase
2845 NRCX01000004.1 GCA003130095_01450 CDS open 57859-58041 _na     60_aa csrA carbon storage regulator CsrA
2846 NRCX01000004.1 GCA003130095_01451 CDS open 58181-60805 _na     874_aa alaS alanine--tRNA ligase
2847 NRCX01000004.1 GCA003130095_01452 CDS open 61017-61442 _na     141_aa uspA universal stress protein UspA
2848 NRCX01000004.1 GCA003130095_01453 CDS open 61601-62395 _na     264_aa mazG nucleoside triphosphate pyrophosphohydrolase
2849 NRCX01000004.1 GCA003130095_01454 CDS open 62465-63454 _na     329_aa ssnA putative protein HI_0843
2850 NRCX01000004.1 GCA003130095_01455 CDS open 63712-65451 _na     579_aa Alkaline phosphatase superfamily hydrolase
2851 NRCX01000004.1 GCA003130095_01456 CDS open 65459-65680 _na     73_aa UPF0352 protein HMPREF9064_1772
2852 NRCX01000004.1 GCA003130095_01457 CDS open 65805-66827 _na     340_aa yejK nucleoid-associated protein YejK
2853 NRCX01000004.1 GCA003130095_01458 CDS open 66892-67302 _na     136_aa bamE outer membrane protein assembly factor BamE
2854 NRCX01000004.1 GCA003130095_01459 CDS open 67351-68049 _na     232_aa cpxR Transcriptional regulatory protein CpxR
2855 NRCX01000004.1 GCA003130095_01460 CDS open 68148-69356 _na     402_aa gltS sodium/glutamate symporter
2856 NRCX01000004.1 GCA003130095_01461 CDS open 69524-69958 _na     144_aa dtd D-aminoacyl-tRNA deacylase
2857 NRCX01000004.1 GCA003130095_01462 CDS open 69955-70791 _na     278_aa brkB virulence factor BrkB family protein
2858 NRCX01000004.1 GCA003130095_01463 CDS open 70788-71261 _na     157_aa ychJ YchJ family protein
2859 NRCX01000004.1 GCA003130095_01464 CDS open 71264-71932 _na     222_aa MOSC domain protein
2860 NRCX01000004.1 GCA003130095_01465 CDS open 72061-73560 _na     499_aa cedB AAA+ ATPase domain-containing protein
2861 NRCX01000004.1 GCA003130095_01466 CDS open 73802-74617 _na     271_aa tcmP Tetracenomycin polyketide synthesis O-methyltransferase TcmP
2862 NRCX01000004.1 GCA003130095_01467 CDS open 74693-76525 _na     610_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2863 NRCX01000004.1 GCA003130095_01468 CDS open 76581-77357 _na     258_aa Glucitol operon repressor
2864 NRCX01000004.1 GCA003130095_01469 CDS open 77494-77766 _na     90_aa DNA-binding protein HU
2865 NRCX01000004.1 GCA003130095_01470 CDS open 77928-78521 _na     197_aa D-fructose-6-phosphate amidotransferase
2866 NRCX01000004.1 GCA003130095_01471 CDS open 78536-79600 _na     354_aa hemE uroporphyrinogen decarboxylase
2867 NRCX01000004.1 GCA003130095_01472 CDS open 79607-80392 _na     261_aa nudC NAD(+) diphosphatase
2868 NRCX01000004.1 GCA003130095_01473 CDS open 80558-84826 _na     1422_aa rpoC DNA-directed RNA polymerase subunit beta'
2869 NRCX01000004.1 GCA003130095_01474 CDS open 84930-88958 _na     1342_aa rpoB DNA-directed RNA polymerase subunit beta
2870 NRCX01000004.1 GCA003130095_01475 CDS open 89228-89599 _na     123_aa rplL 50S ribosomal protein L7/L12
2871 NRCX01000004.1 GCA003130095_01476 CDS open 89651-90142 _na     163_aa rplJ 50S ribosomal protein L10
2872 NRCX01000004.1 GCA003130095_01477 CDS open 90498-91187 _na     229_aa rplA 50S ribosomal protein L1
2873 NRCX01000004.1 GCA003130095_01478 CDS open 91192-91620 _na     142_aa rplK 50S ribosomal protein L11
2874 NRCX01000004.1 GCA003130095_01479 CDS open 91774-92325 _na     183_aa nusG transcription termination/antitermination protein NusG
2875 NRCX01000004.1 GCA003130095_01480 CDS open 92327-92737 _na     136_aa secE preprotein translocase subunit SecE
2876 NRCX01000004.1 GCA003130095_01481 CDS open 92899-93828 _na     309_aa AEC family auxin efflux carrier transporter
2877 NRCX01000004.1 GCA003130095_01482 CDS open 93857-95308 _na     483_aa modF molybdate ABC transporter ATP-binding protein ModF
2878 NRCX01000004.1 GCA003130095_01483 CDS open 95405-96388 _na     327_aa DUF4424 domain-containing protein
2879 NRCX01000004.1 GCA003130095_01484 CDS open 96572-96808 _na     78_aa recA Recombinase RecA
2880 NRCX01000004.1 GCA003130095_01485 CDS open 96947-98611 _na     554_aa protein-N(pi)-phosphohistidine--D-fructose phosphotransferase
2881 NRCX01000004.1 GCA003130095_01486 CDS open 98616-99560 _na     314_aa fruK 1-phosphofructokinase
2882 NRCX01000004.1 GCA003130095_01487 CDS open 99560-101098 _na     512_aa fruB fused PTS fructose transporter subunit IIA/HPr protein
2883 NRCX01000004.1 GCA003130095_01488 CDS open 101212-101733 _na     173_aa Lipoprotein
2884 NRCX01000004.1 GCA003130095_01489 CDS open 101820-102407 _na     195_aa mobA molybdenum cofactor guanylyltransferase MobA
2885 NRCX01000004.1 GCA003130095_01490 CDS open 102482-102748 _na     88_aa DUF1040 domain-containing protein
2886 NRCX01000004.1 GCA003130095_01491 CDS open 102770-103387 _na     205_aa dsbA thiol:disulfide interchange protein DsbA
2887 NRCX01000004.1 GCA003130095_01492 CDS open 103447-103776 _na     109_aa yifE DUF413 domain-containing protein
2888 NRCX01000004.1 GCA003130095_01493 CDS open 103842-104948 _na     368_aa trmA tRNA (uridine(54)-C5)-methyltransferase TrmA
2889 NRCX01000004.1 GCA003130095_01494 CDS open 104951-105709 _na     252_aa Ribosomal RNA small subunit methyltransferase J
2890 NRCX01000004.1 GCA003130095_01495 CDS open 105716-106897 _na     393_aa Glutathionylspermidine synthase pre-ATP-grasp-like domain-containing protein
2891 NRCX01000004.1 GCA003130095_01496 CDS open 106900-107448 _na     182_aa putative protein HI_0930
2892 NRCX01000004.1 GCA003130095_01497 CDS open 107764-109092 _na     442_aa brnQ branched-chain amino acid transport system II carrier protein
2893 NRCX01000004.1 GCA003130095_01498 CDS open 109620-110987 _na     455_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2894 NRCX01000004.1 GCA003130095_01499 CDS open 111070-112200 _na     376_aa anhydro-N-acetylmuramic acid kinase
2895 NRCX01000004.1 GCA003130095_01500 CDS open 112197-113111 _na     304_aa murQ N-acetylmuramic acid 6-phosphate etherase
2896 NRCX01000004.1 GCA003130095_01501 CDS open 113201-115546 _na     781_aa lptD LPS assembly protein LptD
2897 NRCX01000004.1 GCA003130095_01502 CDS open 115613-116173 _na     186_aa DNA-3-methyladenine glycosylase I
2898 NRCX01000004.1 GCA003130095_01503 CDS open 116355-118352 _na     665_aa tkt transketolase
2899 NRCX01000004.1 GCA003130095_01504 CDS open 118482-119435 _na     317_aa tal transaldolase
2900 NRCX01000004.1 GCA003130095_01505 CDS open 119710-120801 _na     363_aa Putrescine-binding periplasmic protein
2901 NRCX01000004.1 GCA003130095_01506 CDS open 121074-122438 _na     454_aa Patatin-like phospholipase family protein
2902 NRCX01000004.1 GCA003130095_01507 CDS open 122579-122974 _na     131_aa Deoxyribonuclease V
2903 NRCX01000004.1 GCA003130095_01508 CDS open 123062-124357 _na     431_aa dadA Gamma-glutamylputrescine oxidoreductase
2904 NRCX01000004.1 GCA003130095_01509 CDS open 124489-125268 _na     259_aa hisJ Putative cystine-binding periplasmic protein
2905 NRCX01000004.1 GCA003130095_01510 CDS open 125291-125974 _na     227_aa Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein
2906 NRCX01000004.1 GCA003130095_01511 CDS open 125984-126751 _na     255_aa glnQ Amino acid ABC superfamily ATP binding cassette transporter%2C ABC protein YckI
2907 NRCX01000004.1 GCA003130095_01512 CDS open 126762-127049 _na     95_aa tusB Sulfurtransferase complex subunit TusB
2908 NRCX01000004.1 GCA003130095_01513 CDS open 127052-127414 _na     120_aa tusC sulfurtransferase complex subunit TusC
2909 NRCX01000004.1 GCA003130095_01514 CDS open 127411-127788 _na     125_aa tusD sulfurtransferase complex subunit TusD
2910 NRCX01000004.1 GCA003130095_01515 CDS open 127791-128459 _na     222_aa yheO Transcriptional regulator
2911 NRCX01000004.1 GCA003130095_01516 CDS open 128539-129267 _na     242_aa Peptidyl-prolyl cis-trans isomerase
2912 NRCX01000004.1 GCA003130095_01517 CDS open 129357-129578 _na     73_aa Protein SlyX-like protein
2913 NRCX01000004.1 GCA003130095_01518 CDS open 129636-130364 _na     242_aa pGdx Hybrid peroxiredoxin hyPrx5
2914 NRCX01000004.1 GCA003130095_01519 CDS open 130519-131415 _na     298_aa oxyR DNA-binding transcriptional regulator OxyR
2915 NRCX01000004.1 GCA003130095_01520 CDS open 131427-132047 _na     206_aa fabR HTH-type transcriptional repressor FabR
2916 NRCX01000004.1 GCA003130095_01521 CDS open 132034-132543 _na     169_aa AhpC/TSA family antioxidant
2917 NRCX01000004.1 GCA003130095_01522 CDS open 132719-133642 _na     307_aa rfaD ADP-L-glycero-D-mannoheptose-6-epimerase
2918 NRCX01000004.1 GCA003130095_01523 CDS open 133727-134770 _na     347_aa waaF lipopolysaccharide heptosyltransferase II
2919 NRCX01000004.1 GCA003130095_01524 CDS open 134873-136768 _na     631_aa gss bifunctional glutathionylspermidine amidase/synthase
2920 NRCX01000004.1 GCA003130095_01525 CDS open 136853-137488 _na     211_aa napC Cytochrome c-type protein
2921 NRCX01000004.1 GCA003130095_01526 CDS open 137501-137950 _na     149_aa Periplasmic nitrate reductase%2C electron transfer subunit
2922 NRCX01000004.1 GCA003130095_01527 CDS open 137988-138869 _na     293_aa napH quinol dehydrogenase ferredoxin subunit NapH
2923 NRCX01000004.1 GCA003130095_01528 CDS open 138869-139702 _na     277_aa napG ferredoxin-type protein NapG
2924 NRCX01000004.1 GCA003130095_01529 CDS open 139752-142232 _na     826_aa napA nitrate reductase catalytic subunit NapA
2925 NRCX01000004.1 GCA003130095_01530 CDS open 142264-142548 _na     94_aa napD Chaperone NapD
2926 NRCX01000004.1 GCA003130095_01531 CDS open 142541-143071 _na     176_aa napF ferredoxin-type protein NapF
2927 NRCX01000004.1 GCA003130095_01532 CDS open 143291-144994 _na     567_aa narQ nitrate/nitrite two-component system sensor histidine kinase NarQ
2928 NRCX01000004.1 GCA003130095_01533 CDS open 145008-146033 _na     341_aa murB UDP-N-acetylmuramate dehydrogenase
2929 NRCX01000004.1 GCA003130095_01534 CDS open 146047-146355 _na     102_aa UDP-N-acetylenolpyruvoylglucosamine reductase
2930 NRCX01000004.1 GCA003130095_01535 CDS open 146355-147308 _na     317_aa tehA dicarboxylate transporter/tellurite-resistance protein TehA
2931 NRCX01000004.1 GCA003130095_01536 CDS open 147450-148298 _na     282_aa rpoH RNA polymerase sigma factor RpoH
2932 NRCX01000004.1 GCA003130095_01537 CDS open 148369-149829 _na     486_aa Aminoacyl-histidine dipeptidase
2933 NRCX01000004.1 GCA003130095_01538 CDS open 149943-150407 _na     154_aa gpt xanthine phosphoribosyltransferase
2934 NRCX01000004.1 GCA003130095_01394 gene open 313-825 hemG
2935 NRCX01000004.1 GCA003130095_01395 gene open 825-2246 trkH
2936 NRCX01000004.1 GCA003130095_01396 gene open 2301-2912
2937 NRCX01000004.1 GCA003130095_01397 gene open 2999-3238 tusA
2938 NRCX01000004.1 GCA003130095_01398 gene open 3308-3952
2939 NRCX01000004.1 GCA003130095_01399 gene open 4444-5715 nadR
2940 NRCX01000004.1 GCA003130095_01400 gene open 5728-6414
2941 NRCX01000004.1 GCA003130095_01401 gene open 6526-7749
2942 NRCX01000004.1 GCA003130095_01402 gene open 7814-8221 merR
2943 NRCX01000004.1 GCA003130095_01403 gene open 8261-8572
2944 NRCX01000004.1 GCA003130095_01404 gene open 8664-8981 secM
2945 NRCX01000004.1 GCA003130095_01405 gene open 9059-11767 secA
2946 NRCX01000004.1 GCA003130095_01406 gene open 11853-12251 mutT
2947 NRCX01000004.1 GCA003130095_01407 gene open 12312-12572
2948 NRCX01000004.1 GCA003130095_01408 gene open 12673-13713 holA
2949 NRCX01000004.1 GCA003130095_01409 gene open 13713-14216 lptE
2950 NRCX01000004.1 GCA003130095_01410 gene open 14277-16865 leuS
2951 NRCX01000004.1 GCA003130095_01411 gene open 16984-17616
2952 NRCX01000004.1 GCA003130095_01412 gene open 17625-18452 apaH
2953 NRCX01000004.1 GCA003130095_01413 gene open 18468-19331 rsmA
2954 NRCX01000004.1 GCA003130095_01414 gene open 19410-20333
2955 NRCX01000004.1 GCA003130095_01415 gene open 20404-20985 pyrR
2956 NRCX01000004.1 GCA003130095_01416 gene open 21193-22305 asd
2957 NRCX01000004.1 GCA003130095_01417 gene open 22365-22979
2958 NRCX01000004.1 GCA003130095_01418 gene open 23206-25410 cas10
2959 NRCX01000004.1 GCA003130095_01419 gene open 25419-25802
2960 NRCX01000004.1 GCA003130095_01420 gene open 25813-26517 csm3
2961 NRCX01000004.1 GCA003130095_01421 gene open 26527-27465 csm4
2962 NRCX01000004.1 GCA003130095_01422 gene open 27462-29090
2963 NRCX01000004.1 GCA003130095_01423 gene open 29087-30010
2964 NRCX01000004.1 GCA003130095_01424 gene open 30071-30361
2965 NRCX01000004.1 GCA003130095_01425 gene open 30370-31512
2966 NRCX01000004.1 GCA003130095_01426 gene open 31512-32666 csm6
2967 NRCX01000004.1 GCA003130095_01427 gene open 35774-35899
2968 NRCX01000004.1 GCA003130095_01428 gene open 36077-36436
2969 NRCX01000004.1 GCA003130095_01429 gene open 36525-37379
2970 NRCX01000004.1 GCA003130095_01430 gene open 37395-37679 cas2
2971 NRCX01000004.1 GCA003130095_01431 gene open 37688-38758 cas1
2972 NRCX01000004.1 GCA003130095_01432 gene open 38771-39058 cas2
2973 NRCX01000004.1 GCA003130095_01433 gene open 39986-42556 clpB
2974 NRCX01000004.1 GCA003130095_01434 gene open 42656-43156
2975 NRCX01000004.1 GCA003130095_01435 gene open 43341-44381
2976 NRCX01000004.1 GCA003130095_01436 gene open 44381-45019 purN
2977 NRCX01000004.1 GCA003130095_01437 gene open 45055-45870
2978 NRCX01000004.1 GCA003130095_01438 gene open 46026-46712
2979 NRCX01000004.1 GCA003130095_01439 gene open 46822-47406 nfuA
2980 NRCX01000004.1 GCA003130095_01440 gene open 47456-48754 brnQ
2981 NRCX01000004.1 GCA003130095_01441 gene open 49006-50640 pyrG
2982 NRCX01000004.1 GCA003130095_01442 gene open 50942-51604 thiE
2983 NRCX01000004.1 GCA003130095_01443 gene open 51806-53116 eno
2984 NRCX01000004.1 GCA003130095_01444 gene open 53219-53638 ruvX
2985 NRCX01000004.1 GCA003130095_01445 gene open 53638-54198 algH
2986 NRCX01000004.1 GCA003130095_01446 gene open 54212-54946 rsmE
2987 NRCX01000004.1 GCA003130095_01447 gene open 55028-55345 metJ
2988 NRCX01000004.1 GCA003130095_01448 gene open 55496-56383 galU
2989 NRCX01000004.1 GCA003130095_01449 gene open 56454-57818 manB
2990 NRCX01000004.1 GCA003130095_01450 gene open 57859-58041 csrA
2991 NRCX01000004.1 GCA003130095_01451 gene open 58181-60805 alaS
2992 NRCX01000004.1 GCA003130095_01452 gene open 61017-61442 uspA
2993 NRCX01000004.1 GCA003130095_01453 gene open 61601-62395 mazG
2994 NRCX01000004.1 GCA003130095_01454 gene open 62465-63454 ssnA
2995 NRCX01000004.1 GCA003130095_01455 gene open 63712-65451
2996 NRCX01000004.1 GCA003130095_01456 gene open 65459-65680
2997 NRCX01000004.1 GCA003130095_01457 gene open 65805-66827 yejK
2998 NRCX01000004.1 GCA003130095_01458 gene open 66892-67302 bamE
2999 NRCX01000004.1 GCA003130095_01459 gene open 67351-68049 cpxR
3000 NRCX01000004.1 GCA003130095_01460 gene open 68148-69356 gltS