HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnoanaerobaculum umeaense (GCA_003254255.1)

Select a Genome:
BAKTA Annotations for GCA_003254255.1
Genome Selected: Lachnoanaerobaculum umeaense
ContigsBases CDSrRNA tmRNAtRNA
78 2705257 2496 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5114 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 5114 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 QKZH01000034.1 GCA003254255_02254 CDS open 22145-24343 _na     732_aa Carbohydrate-binding domain-containing protein
4502 QKZH01000034.1 GCA003254255_02255 CDS open 24514-25158 _na     214_aa Cyclase family protein
4503 QKZH01000034.1 GCA003254255_02256 CDS open 25167-25688 _na     173_aa pncA nicotinamidase
4504 QKZH01000034.1 GCA003254255_02257 CDS open 25973-26419 _na     148_aa Type II secretion system protein G
4505 QKZH01000034.1 GCA003254255_02237 gene open 529-3867 mfd
4506 QKZH01000034.1 GCA003254255_02238 gene open 3876-4568 pth
4507 QKZH01000034.1 GCA003254255_02239 gene open 4712-6049 sacC
4508 QKZH01000034.1 GCA003254255_02240 gene open 6063-7238 yaaN
4509 QKZH01000034.1 GCA003254255_02241 gene open 7244-8356
4510 QKZH01000034.1 GCA003254255_02242 gene open 8717-9313 acrR
4511 QKZH01000034.1 GCA003254255_02243 gene open 9380-11842 ppsA
4512 QKZH01000034.1 GCA003254255_02244 gene open 11844-13184 norM
4513 QKZH01000034.1 GCA003254255_02245 gene open 13283-14116 yktD
4514 QKZH01000034.1 GCA003254255_02246 gene open 14126-14803 ompR
4515 QKZH01000034.1 GCA003254255_02247 gene open 14800-16134 baeS
4516 QKZH01000034.1 GCA003254255_02248 gene open 16215-16502
4517 QKZH01000034.1 GCA003254255_02249 gene open 16720-17664 yfdV
4518 QKZH01000034.1 GCA003254255_02250 gene open 17680-19302 sfcA
4519 QKZH01000034.1 GCA003254255_02251 gene open 19618-20001
4520 QKZH01000034.1 GCA003254255_02252 gene open 20001-21053 nAGPA
4521 QKZH01000034.1 GCA003254255_02253 gene open 21069-22145 wcaA
4522 QKZH01000034.1 GCA003254255_02254 gene open 22145-24343
4523 QKZH01000034.1 GCA003254255_02255 gene open 24514-25158
4524 QKZH01000034.1 GCA003254255_02256 gene open 25167-25688 pncA
4525 QKZH01000034.1 GCA003254255_02257 gene open 25973-26419
4526 QKZH01000035.1 GCA003254255_02258 CDS open 80-1261 _na     393_aa thrA Homoserine dehydrogenase
4527 QKZH01000035.1 GCA003254255_02259 CDS open 1265-1708 _na     147_aa pheB ACT domain-containing protein
4528 QKZH01000035.1 GCA003254255_02260 CDS open 1831-3546 _na     571_aa manB Phosphoglucomutase
4529 QKZH01000035.1 GCA003254255_02261 CDS open 3618-4466 _na     282_aa alkA DNA-(apurinic or apyrimidinic site) lyase
4530 QKZH01000035.1 GCA003254255_02262 CDS open 4459-5352 _na     297_aa rluA Pseudouridine synthase
4531 QKZH01000035.1 GCA003254255_02263 CDS open 5352-5624 _na     90_aa frmR Copper-sensing transcriptional repressor CsoR
4532 QKZH01000035.1 GCA003254255_02264 CDS open 5624-8170 _na     848_aa copZ copper chaperone CopZ
4533 QKZH01000035.1 GCA003254255_02265 CDS open 8533-8814 _na     93_aa hupA HU family DNA-binding protein
4534 QKZH01000035.1 GCA003254255_02266 CDS open 8814-9053 _na     79_aa hslR RNA-binding S4 domain-containing protein
4535 QKZH01000035.1 GCA003254255_02267 CDS open 9159-10067 _na     302_aa rlmK S-adenosylmethionine-dependent methyltransferase domain-containing protein
4536 QKZH01000035.1 GCA003254255_02268 CDS open 10131-11453 _na     440_aa gCD1 D%2CD-heptose 1%2C7-bisphosphate phosphatase
4537 QKZH01000035.1 GCA003254255_02269 CDS open 11450-12409 _na     319_aa rbsK Carbohydrate kinase
4538 QKZH01000035.1 GCA003254255_02270 CDS open 12454-13860 _na     468_aa yocR Transporter
4539 QKZH01000035.1 GCA003254255_02271 CDS open 14038-14982 _na     314_aa msrB bifunctional methionine sulfoxide reductase B/A protein
4540 QKZH01000035.1 GCA003254255_02272 CDS open 15201-16730 _na     509_aa Glucan-binding domain (YG repeat)
4541 QKZH01000035.1 GCA003254255_02273 CDS open 16931-17323 _na     130_aa iscR Rrf2 family protein
4542 QKZH01000035.1 GCA003254255_02274 CDS open 17530-19632 _na     700_aa flavocytochrome c
4543 QKZH01000035.1 GCA003254255_02275 CDS open 19716-20456 _na     246_aa cas6 CRISPR-associated endoribonuclease Cas6
4544 QKZH01000035.1 GCA003254255_02276 CDS open 20608-21906 _na     432_aa eno phosphopyruvate hydratase
4545 QKZH01000035.1 GCA003254255_02277 CDS open 22102-23157 _na     351_aa xerD Tyr recombinase domain-containing protein
4546 QKZH01000035.1 GCA003254255_02278 CDS open 23166-23447 _na     93_aa lysM LysM peptidoglycan-binding domain-containing protein
4547 QKZH01000035.1 GCA003254255_02279 CDS open 23542-24003 _na     153_aa smpB SsrA-binding protein SmpB
4548 QKZH01000035.1 GCA003254255_02280 CDS open 23987-26128 _na     713_aa rnr ribonuclease R
4549 QKZH01000035.1 GCA003254255_02281 CDS open 26191-26427 _na     78_aa secG preprotein translocase subunit SecG
4550 QKZH01000035.1 GCA003254255_02258 gene open 80-1261 thrA
4551 QKZH01000035.1 GCA003254255_02259 gene open 1265-1708 pheB
4552 QKZH01000035.1 GCA003254255_02260 gene open 1831-3546 manB
4553 QKZH01000035.1 GCA003254255_02261 gene open 3618-4466 alkA
4554 QKZH01000035.1 GCA003254255_02262 gene open 4459-5352 rluA
4555 QKZH01000035.1 GCA003254255_02263 gene open 5352-5624 frmR
4556 QKZH01000035.1 GCA003254255_02264 gene open 5624-8170 copZ
4557 QKZH01000035.1 GCA003254255_02265 gene open 8533-8814 hupA
4558 QKZH01000035.1 GCA003254255_02266 gene open 8814-9053 hslR
4559 QKZH01000035.1 GCA003254255_02267 gene open 9159-10067 rlmK
4560 QKZH01000035.1 GCA003254255_02268 gene open 10131-11453 gCD1
4561 QKZH01000035.1 GCA003254255_02269 gene open 11450-12409 rbsK
4562 QKZH01000035.1 GCA003254255_02270 gene open 12454-13860 yocR
4563 QKZH01000035.1 GCA003254255_02271 gene open 14038-14982 msrB
4564 QKZH01000035.1 GCA003254255_02272 gene open 15201-16730
4565 QKZH01000035.1 GCA003254255_02273 gene open 16931-17323 iscR
4566 QKZH01000035.1 GCA003254255_02274 gene open 17530-19632
4567 QKZH01000035.1 GCA003254255_02275 gene open 19716-20456 cas6
4568 QKZH01000035.1 GCA003254255_02276 gene open 20608-21906 eno
4569 QKZH01000035.1 GCA003254255_02277 gene open 22102-23157 xerD
4570 QKZH01000035.1 GCA003254255_02278 gene open 23166-23447 lysM
4571 QKZH01000035.1 GCA003254255_02279 gene open 23542-24003 smpB
4572 QKZH01000035.1 GCA003254255_02280 gene open 23987-26128 rnr
4573 QKZH01000035.1 GCA003254255_02281 gene open 26191-26427 secG
4574 QKZH01000036.1 GCA003254255_02282 CDS open 243-1160 _na     305_aa Transposase
4575 QKZH01000036.1 GCA003254255_02283 CDS open 1476-2573 _na     365_aa Glucan-binding domain (YG repeat)
4576 QKZH01000036.1 GCA003254255_02284 CDS open 2595-3935 _na     446_aa hypothetical protein
4577 QKZH01000036.1 GCA003254255_02285 CDS open 4396-4914 _na     172_aa yjhB NUDIX hydrolase
4578 QKZH01000036.1 GCA003254255_02286 CDS open 4978-5421 _na     147_aa marR MarR family transcriptional regulator
4579 QKZH01000036.1 GCA003254255_02287 CDS open 5497-6042 _na     181_aa btuE Glutathione peroxidase
4580 QKZH01000036.1 GCA003254255_02288 CDS open 6057-6974 _na     305_aa trxB Thioredoxin reductase
4581 QKZH01000036.1 GCA003254255_02289 CDS open 7038-7346 _na     102_aa trxA thioredoxin
4582 QKZH01000036.1 GCA003254255_02290 CDS open 7423-8820 _na     465_aa alsT Amino acid carrier protein
4583 QKZH01000036.1 GCA003254255_02291 CDS open 8840-9586 _na     248_aa tcdA tRNA threonylcarbamoyladenosine dehydratase
4584 QKZH01000036.1 GCA003254255_02292 CDS open 9751-11247 _na     498_aa sacC Sucrose-6-phosphate hydrolase
4585 QKZH01000036.1 GCA003254255_02293 CDS open 11259-12935 _na     558_aa ugpB DUF3502 domain-containing protein
4586 QKZH01000036.1 GCA003254255_02294 CDS open 12956-13855 _na     299_aa ugpE ABC transporter%2C permease protein
4587 QKZH01000036.1 GCA003254255_02295 CDS open 13859-14788 _na     309_aa lplB ABC transmembrane type-1 domain-containing protein
4588 QKZH01000036.1 GCA003254255_02296 CDS open 15023-16084 _na     353_aa purR LacI family transcriptional regulator
4589 QKZH01000036.1 GCA003254255_02297 CDS open 16089-16727 _na     212_aa yesL DUF624 domain-containing protein
4590 QKZH01000036.1 GCA003254255_02298 CDS open 16720-17310 _na     196_aa hypothetical protein
4591 QKZH01000036.1 GCA003254255_02299 CDS open 17618-18496 _na     292_aa nlpA Lipoprotein
4592 QKZH01000036.1 GCA003254255_02300 CDS open 18568-19248 _na     226_aa metP ABC transmembrane type-1 domain-containing protein
4593 QKZH01000036.1 GCA003254255_02301 CDS open 19205-20275 _na     356_aa abcC ABC transporter domain-containing protein
4594 QKZH01000036.1 GCA003254255_02302 CDS open 20361-21809 _na     482_aa trkG Cation transporter
4595 QKZH01000036.1 GCA003254255_02303 CDS open 21809-23251 _na     480_aa trkA Trk system potassium transporter TrkA
4596 QKZH01000036.1 GCA003254255_02304 CDS open 23328-23564 _na     78_aa Polya polymerase
4597 QKZH01000036.1 GCA003254255_02305 CDS open 23712-25073 _na     453_aa Glucan-binding domain (YG repeat)
4598 QKZH01000036.1 GCA003254255_02282 gene open 243-1160
4599 QKZH01000036.1 GCA003254255_02283 gene open 1476-2573
4600 QKZH01000036.1 GCA003254255_02284 gene open 2595-3935
4601 QKZH01000036.1 GCA003254255_02285 gene open 4396-4914 yjhB
4602 QKZH01000036.1 GCA003254255_02286 gene open 4978-5421 marR
4603 QKZH01000036.1 GCA003254255_02287 gene open 5497-6042 btuE
4604 QKZH01000036.1 GCA003254255_02288 gene open 6057-6974 trxB
4605 QKZH01000036.1 GCA003254255_02289 gene open 7038-7346 trxA
4606 QKZH01000036.1 GCA003254255_02290 gene open 7423-8820 alsT
4607 QKZH01000036.1 GCA003254255_02291 gene open 8840-9586 tcdA
4608 QKZH01000036.1 GCA003254255_02292 gene open 9751-11247 sacC
4609 QKZH01000036.1 GCA003254255_02293 gene open 11259-12935 ugpB
4610 QKZH01000036.1 GCA003254255_02294 gene open 12956-13855 ugpE
4611 QKZH01000036.1 GCA003254255_02295 gene open 13859-14788 lplB
4612 QKZH01000036.1 GCA003254255_02296 gene open 15023-16084 purR
4613 QKZH01000036.1 GCA003254255_02297 gene open 16089-16727 yesL
4614 QKZH01000036.1 GCA003254255_02298 gene open 16720-17310
4615 QKZH01000036.1 GCA003254255_02299 gene open 17618-18496 nlpA
4616 QKZH01000036.1 GCA003254255_02300 gene open 18568-19248 metP
4617 QKZH01000036.1 GCA003254255_02301 gene open 19205-20275 abcC
4618 QKZH01000036.1 GCA003254255_02302 gene open 20361-21809 trkG
4619 QKZH01000036.1 GCA003254255_02303 gene open 21809-23251 trkA
4620 QKZH01000036.1 GCA003254255_02304 gene open 23328-23564
4621 QKZH01000036.1 GCA003254255_02305 gene open 23712-25073
4622 QKZH01000037.1 regulatory_region open 6156-6273 FMN riboswitch aptamer (RFN element)
4623 QKZH01000037.1 GCA003254255_02306 CDS open 341-1099 _na     252_aa Lipoprotein
4624 QKZH01000037.1 GCA003254255_02307 CDS open 1307-1663 _na     118_aa ylxM YlxM family DNA-binding protein
4625 QKZH01000037.1 GCA003254255_02308 CDS open 1673-3028 _na     451_aa ffh signal recognition particle protein
4626 QKZH01000037.1 GCA003254255_02309 CDS open 3126-3368 _na     80_aa rpsP 30S ribosomal protein S16
4627 QKZH01000037.1 GCA003254255_02310 CDS open 3381-3608 _na     75_aa khpA RNA-binding protein KhpA
4628 QKZH01000037.1 GCA003254255_02311 CDS open 3686-4195 _na     169_aa rimM ribosome maturation factor RimM
4629 QKZH01000037.1 GCA003254255_02312 CDS open 4198-4947 _na     249_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
4630 QKZH01000037.1 GCA003254255_02313 CDS open 4940-6052 _na     370_aa DUF4317 domain-containing protein
4631 QKZH01000037.1 GCA003254255_02314 CDS open 6362-7105 _na     247_aa fmnP ECF transporter S component
4632 QKZH01000037.1 GCA003254255_02315 CDS open 7822-9432 _na     536_aa Cell wall-binding protein
4633 QKZH01000037.1 GCA003254255_02316 CDS open 9446-16876 _na     2476_aa N-acetylmuramoyl-L-alanine amidase family protein
4634 QKZH01000037.1 GCA003254255_02317 CDS open 16894-21642 _na     1582_aa N-acetylmuramoyl-L-alanine amidase family protein
4635 QKZH01000037.1 GCA003254255_02318 CDS open 21705-22334 _na     209_aa upp uracil phosphoribosyltransferase
4636 QKZH01000037.1 GCA003254255_02319 CDS open 22401-23216 _na     271_aa DUF4163 domain-containing protein
4637 QKZH01000037.1 GCA003254255_02306 gene open 341-1099
4638 QKZH01000037.1 GCA003254255_02307 gene open 1307-1663 ylxM
4639 QKZH01000037.1 GCA003254255_02308 gene open 1673-3028 ffh
4640 QKZH01000037.1 GCA003254255_02309 gene open 3126-3368 rpsP
4641 QKZH01000037.1 GCA003254255_02310 gene open 3381-3608 khpA
4642 QKZH01000037.1 GCA003254255_02311 gene open 3686-4195 rimM
4643 QKZH01000037.1 GCA003254255_02312 gene open 4198-4947 trmD
4644 QKZH01000037.1 GCA003254255_02313 gene open 4940-6052
4645 QKZH01000037.1 GCA003254255_02314 gene open 6362-7105 fmnP
4646 QKZH01000037.1 GCA003254255_02315 gene open 7822-9432
4647 QKZH01000037.1 GCA003254255_02316 gene open 9446-16876
4648 QKZH01000037.1 GCA003254255_02317 gene open 16894-21642
4649 QKZH01000037.1 GCA003254255_02318 gene open 21705-22334 upp
4650 QKZH01000037.1 GCA003254255_02319 gene open 22401-23216
4651 QKZH01000038.1 GCA003254255_02320 CDS open 147-314 _na     55_aa hypothetical protein
4652 QKZH01000038.1 GCA003254255_02321 CDS open 324-692 _na     122_aa Lipoprotein
4653 QKZH01000038.1 GCA003254255_02322 CDS open 800-1246 _na     148_aa Lipoprotein
4654 QKZH01000038.1 GCA003254255_02323 CDS open 1301-1408 _na     35_aa hypothetical protein
4655 QKZH01000038.1 GCA003254255_02324 CDS open 1684-2076 _na     130_aa hypothetical protein
4656 QKZH01000038.1 GCA003254255_02325 CDS open 2332-2796 _na     154_aa hypothetical protein
4657 QKZH01000038.1 GCA003254255_02326 CDS open 3191-3559 _na     122_aa Lipoprotein
4658 QKZH01000038.1 GCA003254255_02327 CDS open 3732-3908 _na     58_aa hypothetical protein
4659 QKZH01000038.1 GCA003254255_02328 CDS open 4301-5647 _na     448_aa uraA Xanthine permease
4660 QKZH01000038.1 GCA003254255_02329 CDS open 5667-6608 _na     313_aa arcC carbamate kinase
4661 QKZH01000038.1 GCA003254255_02330 CDS open 6734-7933 _na     399_aa ygeW knotted carbamoyltransferase YgeW
4662 QKZH01000038.1 GCA003254255_02331 CDS open 8058-9386 _na     442_aa ygeY YgeY family selenium metabolism-linked hydrolase
4663 QKZH01000038.1 GCA003254255_02332 CDS open 9425-10618 _na     397_aa dpaL diaminopropionate ammonia-lyase
4664 QKZH01000038.1 GCA003254255_02333 CDS open 10638-11300 _na     220_aa yheO Transcriptional regulator
4665 QKZH01000038.1 GCA003254255_02334 CDS open 11600-12088 _na     162_aa Lipoprotein
4666 QKZH01000038.1 GCA003254255_02335 CDS open 12090-12563 _na     157_aa tadA tRNA adenosine(34) deaminase TadA
4667 QKZH01000038.1 GCA003254255_02336 CDS open 12735-13430 _na     231_aa ompR Stage 0 sporulation A-like protein
4668 QKZH01000038.1 GCA003254255_02337 CDS open 13432-15717 _na     761_aa histidine kinase
4669 QKZH01000038.1 GCA003254255_02338 CDS open 15933-17744 _na     603_aa ftsH ATP-dependent zinc metalloprotease FtsH
4670 QKZH01000038.1 GCA003254255_02339 CDS open 18027-19040 _na     337_aa prfB peptide chain release factor 2
4671 QKZH01000038.1 GCA003254255_02340 CDS open 19454-19741 _na     95_aa rpsF 30S ribosomal protein S6
4672 QKZH01000038.1 GCA003254255_02341 CDS open 19765-20214 _na     149_aa ssb Single-stranded DNA-binding protein
4673 QKZH01000038.1 GCA003254255_02342 CDS open 20242-20511 _na     89_aa rpsR 30S ribosomal protein S18
4674 QKZH01000038.1 GCA003254255_02343 CDS open 20675-22018 _na     447_aa Glucan-binding domain (YG repeat)
4675 QKZH01000038.1 GCA003254255_02344 CDS open 22031-22441 _na     136_aa hinT HIT family protein
4676 QKZH01000038.1 GCA003254255_02345 CDS open 22441-23040 _na     199_aa glpG Rhomboid family intramembrane serine protease
4677 QKZH01000038.1 GCA003254255_02320 gene open 147-314
4678 QKZH01000038.1 GCA003254255_02321 gene open 324-692
4679 QKZH01000038.1 GCA003254255_02322 gene open 800-1246
4680 QKZH01000038.1 GCA003254255_02323 gene open 1301-1408
4681 QKZH01000038.1 GCA003254255_02324 gene open 1684-2076
4682 QKZH01000038.1 GCA003254255_02325 gene open 2332-2796
4683 QKZH01000038.1 GCA003254255_02326 gene open 3191-3559
4684 QKZH01000038.1 GCA003254255_02327 gene open 3732-3908
4685 QKZH01000038.1 GCA003254255_02328 gene open 4301-5647 uraA
4686 QKZH01000038.1 GCA003254255_02329 gene open 5667-6608 arcC
4687 QKZH01000038.1 GCA003254255_02330 gene open 6734-7933 ygeW
4688 QKZH01000038.1 GCA003254255_02331 gene open 8058-9386 ygeY
4689 QKZH01000038.1 GCA003254255_02332 gene open 9425-10618 dpaL
4690 QKZH01000038.1 GCA003254255_02333 gene open 10638-11300 yheO
4691 QKZH01000038.1 GCA003254255_02334 gene open 11600-12088
4692 QKZH01000038.1 GCA003254255_02335 gene open 12090-12563 tadA
4693 QKZH01000038.1 GCA003254255_02336 gene open 12735-13430 ompR
4694 QKZH01000038.1 GCA003254255_02337 gene open 13432-15717
4695 QKZH01000038.1 GCA003254255_02338 gene open 15933-17744 ftsH
4696 QKZH01000038.1 GCA003254255_02339 gene open 18027-19040 prfB
4697 QKZH01000038.1 GCA003254255_02340 gene open 19454-19741 rpsF
4698 QKZH01000038.1 GCA003254255_02341 gene open 19765-20214 ssb
4699 QKZH01000038.1 GCA003254255_02342 gene open 20242-20511 rpsR
4700 QKZH01000038.1 GCA003254255_02343 gene open 20675-22018
4701 QKZH01000038.1 GCA003254255_02344 gene open 22031-22441 hinT
4702 QKZH01000038.1 GCA003254255_02345 gene open 22441-23040 glpG
4703 QKZH01000039.1 GCA003254255_02346 CDS open 831-1562 _na     243_aa hypothetical protein
4704 QKZH01000039.1 GCA003254255_02347 CDS open 1583-2182 _na     199_aa prfH peptide chain release factor H
4705 QKZH01000039.1 GCA003254255_02348 CDS open 2179-3318 _na     379_aa rtcB 3'-phosphate/5'-hydroxy nucleic acid ligase
4706 QKZH01000039.1 GCA003254255_02349 CDS open 3534-4319 _na     261_aa yhfC YhfC family intramembrane metalloprotease
4707 QKZH01000039.1 GCA003254255_02350 CDS open 4491-5252 _na     253_aa CPBP family intramembrane metalloprotease
4708 QKZH01000039.1 GCA003254255_02351 CDS open 5286-6389 _na     367_aa mpaA Peptidase
4709 QKZH01000039.1 GCA003254255_02352 CDS open 6772-8256 _na     494_aa adhE Aldehyde dehydrogenase domain-containing protein
4710 QKZH01000039.1 GCA003254255_02353 CDS open 8376-9074 _na     232_aa hypothetical protein
4711 QKZH01000039.1 GCA003254255_02354 CDS open 9164-10003 _na     279_aa napH 4Fe-4S dicluster domain protein
4712 QKZH01000039.1 GCA003254255_02355 CDS open 10190-10993 _na     267_aa Nucleotide modification associated domain-containing protein
4713 QKZH01000039.1 GCA003254255_02356 CDS open 11299-12447 _na     382_aa hgdB double-cubane-cluster-containing anaerobic reductase
4714 QKZH01000039.1 GCA003254255_02357 CDS open 12468-13253 _na     261_aa yjiL CoA activase
4715 QKZH01000039.1 GCA003254255_02358 CDS open 13315-13914 _na     199_aa DUF1851 domain-containing protein
4716 QKZH01000039.1 GCA003254255_02359 CDS open 13923-14063 _na     46_aa hypothetical protein
4717 QKZH01000039.1 GCA003254255_02360 CDS open 14185-14502 _na     105_aa cnoX Thioredoxin domain-containing protein
4718 QKZH01000039.1 GCA003254255_02361 CDS open 14711-15397 _na     228_aa ybbA Alpha/beta hydrolase
4719 QKZH01000039.1 GCA003254255_02362 CDS open 15430-15966 _na     178_aa DUF3841 domain-containing protein
4720 QKZH01000039.1 GCA003254255_02363 CDS open 16351-17976 _na     541_aa gmrSD DUF262 domain-containing protein
4721 QKZH01000039.1 GCA003254255_02346 gene open 831-1562
4722 QKZH01000039.1 GCA003254255_02347 gene open 1583-2182 prfH
4723 QKZH01000039.1 GCA003254255_02348 gene open 2179-3318 rtcB
4724 QKZH01000039.1 GCA003254255_02349 gene open 3534-4319 yhfC
4725 QKZH01000039.1 GCA003254255_02350 gene open 4491-5252
4726 QKZH01000039.1 GCA003254255_02351 gene open 5286-6389 mpaA
4727 QKZH01000039.1 GCA003254255_02352 gene open 6772-8256 adhE
4728 QKZH01000039.1 GCA003254255_02353 gene open 8376-9074
4729 QKZH01000039.1 GCA003254255_02354 gene open 9164-10003 napH
4730 QKZH01000039.1 GCA003254255_02355 gene open 10190-10993
4731 QKZH01000039.1 GCA003254255_02356 gene open 11299-12447 hgdB
4732 QKZH01000039.1 GCA003254255_02357 gene open 12468-13253 yjiL
4733 QKZH01000039.1 GCA003254255_02358 gene open 13315-13914
4734 QKZH01000039.1 GCA003254255_02359 gene open 13923-14063
4735 QKZH01000039.1 GCA003254255_02360 gene open 14185-14502 cnoX
4736 QKZH01000039.1 GCA003254255_02361 gene open 14711-15397 ybbA
4737 QKZH01000039.1 GCA003254255_02362 gene open 15430-15966
4738 QKZH01000039.1 GCA003254255_02363 gene open 16351-17976 gmrSD
4739 QKZH01000040.1 GCA003254255_02364 CDS open 46-717 _na     223_aa yhcG YhcG PDDEXK nuclease domain-containing protein
4740 QKZH01000040.1 GCA003254255_02365 CDS open 832-975 _na     47_aa DUF1016 domain-containing protein
4741 QKZH01000040.1 GCA003254255_02366 CDS open 1854-3194 _na     446_aa hypothetical protein
4742 QKZH01000040.1 GCA003254255_02367 CDS open 3314-3982 _na     222_aa Lipoprotein
4743 QKZH01000040.1 GCA003254255_02368 CDS open 4161-4778 _na     205_aa Acyl carrier protein
4744 QKZH01000040.1 GCA003254255_02369 CDS open 5035-5769 _na     244_aa psbP PsbP C-terminal domain-containing protein
4745 QKZH01000040.1 GCA003254255_02370 CDS open 5894-6553 _na     219_aa yoaK DUF1275 domain-containing protein
4746 QKZH01000040.1 GCA003254255_02371 CDS open 6573-7571 _na     332_aa pdxI NADP-dependent oxidoreductase domain-containing protein
4747 QKZH01000040.1 GCA003254255_02372 CDS open 7564-8127 _na     187_aa chrA Chromate transporter
4748 QKZH01000040.1 GCA003254255_02373 CDS open 8124-8681 _na     185_aa chrA Chromate transporter
4749 QKZH01000040.1 GCA003254255_02374 CDS open 8725-9582 _na     285_aa araC AraC-like ligand binding domain / DNA-binding helix-turn-helix multi-domain protein
4750 QKZH01000040.1 GCA003254255_02375 CDS open 9755-12778 _na     1007_aa lacZ Beta-galactosidase
4751 QKZH01000040.1 GCA003254255_02376 CDS open 12803-14158 _na     451_aa melB Major facilitator superfamily (MFS) profile domain-containing protein
4752 QKZH01000040.1 GCA003254255_02377 CDS open 14281-15768 _na     495_aa galT2 Galactose-1-phosphate uridylyltransferase
4753 QKZH01000040.1 GCA003254255_02364 gene open 46-717 yhcG
4754 QKZH01000040.1 GCA003254255_02365 gene open 832-975
4755 QKZH01000040.1 GCA003254255_02366 gene open 1854-3194
4756 QKZH01000040.1 GCA003254255_02367 gene open 3314-3982
4757 QKZH01000040.1 GCA003254255_02368 gene open 4161-4778
4758 QKZH01000040.1 GCA003254255_02369 gene open 5035-5769 psbP
4759 QKZH01000040.1 GCA003254255_02370 gene open 5894-6553 yoaK
4760 QKZH01000040.1 GCA003254255_02371 gene open 6573-7571 pdxI
4761 QKZH01000040.1 GCA003254255_02372 gene open 7564-8127 chrA
4762 QKZH01000040.1 GCA003254255_02373 gene open 8124-8681 chrA
4763 QKZH01000040.1 GCA003254255_02374 gene open 8725-9582 araC
4764 QKZH01000040.1 GCA003254255_02375 gene open 9755-12778 lacZ
4765 QKZH01000040.1 GCA003254255_02376 gene open 12803-14158 melB
4766 QKZH01000040.1 GCA003254255_02377 gene open 14281-15768 galT2
4767 QKZH01000041.1 GCA003254255_02378 CDS open 470-3064 _na     864_aa bglX Glycosyl hydrolase
4768 QKZH01000041.1 GCA003254255_02379 CDS open 3067-3576 _na     169_aa gtrA Polysaccharide biosynthesis protein GtrA
4769 QKZH01000041.1 GCA003254255_02380 CDS open 3592-6576 _na     994_aa bglX Fibronectin type III-like domain-containing protein
4770 QKZH01000041.1 GCA003254255_02381 CDS open 6569-7939 _na     456_aa ldcC Aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme
4771 QKZH01000041.1 GCA003254255_02382 CDS open 7946-8530 _na     194_aa gmk Guanylate kinase
4772 QKZH01000041.1 GCA003254255_02383 CDS open 8532-9506 _na     324_aa dnaX DNA polymerase III subunit delta
4773 QKZH01000041.1 GCA003254255_02384 CDS open 9516-10325 _na     269_aa yaaT PSP1 C-terminal domain protein
4774 QKZH01000041.1 GCA003254255_02385 CDS open 10330-11076 _na     248_aa trmN6 tRNA1(Val) (Adenine(37)-N6)-methyltransferase
4775 QKZH01000041.1 GCA003254255_02386 CDS open 11066-11908 _na     280_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
4776 QKZH01000041.1 GCA003254255_02387 CDS open 11924-12373 _na     149_aa rpiB ribose 5-phosphate isomerase B
4777 QKZH01000041.1 GCA003254255_02388 CDS open 12378-12737 _na     119_aa hypothetical protein
4778 QKZH01000041.1 GCA003254255_02389 CDS open 12749-13588 _na     279_aa pdxK pyridoxamine kinase
4779 QKZH01000041.1 GCA003254255_02390 CDS open 13585-13779 _na     64_aa DUF951 domain-containing protein
4780 QKZH01000041.1 GCA003254255_02391 CDS open 13776-15329 _na     517_aa abc-f ribosomal protection-like ABC-F family protein
4781 QKZH01000041.1 GCA003254255_02378 gene open 470-3064 bglX
4782 QKZH01000041.1 GCA003254255_02379 gene open 3067-3576 gtrA
4783 QKZH01000041.1 GCA003254255_02380 gene open 3592-6576 bglX
4784 QKZH01000041.1 GCA003254255_02381 gene open 6569-7939 ldcC
4785 QKZH01000041.1 GCA003254255_02382 gene open 7946-8530 gmk
4786 QKZH01000041.1 GCA003254255_02383 gene open 8532-9506 dnaX
4787 QKZH01000041.1 GCA003254255_02384 gene open 9516-10325 yaaT
4788 QKZH01000041.1 GCA003254255_02385 gene open 10330-11076 trmN6
4789 QKZH01000041.1 GCA003254255_02386 gene open 11066-11908 rsmI
4790 QKZH01000041.1 GCA003254255_02387 gene open 11924-12373 rpiB
4791 QKZH01000041.1 GCA003254255_02388 gene open 12378-12737
4792 QKZH01000041.1 GCA003254255_02389 gene open 12749-13588 pdxK
4793 QKZH01000041.1 GCA003254255_02390 gene open 13585-13779
4794 QKZH01000041.1 GCA003254255_02391 gene open 13776-15329 abc-f
4795 QKZH01000042.1 GCA003254255_02392 CDS open 207-338 _na     43_aa hypothetical protein
4796 QKZH01000042.1 GCA003254255_02393 CDS open 409-1284 _na     291_aa pgaB Polysaccharide deacetylase
4797 QKZH01000042.1 GCA003254255_02394 CDS open 1498-2094 _na     198_aa 3D (Asp-Asp-Asp) domain%2C usually in lytic transglycosylases
4798 QKZH01000042.1 GCA003254255_02395 CDS open 2353-2865 _na     170_aa frnE Protein-disulfide isomerase
4799 QKZH01000042.1 GCA003254255_02396 CDS open 3002-3382 _na     126_aa copZ Heavy-metal-associated domain-containing protein
4800 QKZH01000042.1 GCA003254255_02397 CDS open 3654-4235 _na     193_aa DUF1877 domain-containing protein
4801 QKZH01000042.1 GCA003254255_02398 CDS open 4290-5528 _na     412_aa perM AI-2E family transporter
4802 QKZH01000042.1 GCA003254255_02399 CDS open 5530-6828 _na     432_aa lAP4 M18 family aminopeptidase
4803 QKZH01000042.1 GCA003254255_02400 CDS open 6849-7445 _na     198_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
4804 QKZH01000042.1 GCA003254255_02401 CDS open 7490-9784 _na     764_aa lon endopeptidase La
4805 QKZH01000042.1 GCA003254255_02402 CDS open 9840-11123 _na     427_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
4806 QKZH01000042.1 GCA003254255_02403 CDS open 11133-11714 _na     193_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
4807 QKZH01000042.1 GCA003254255_02404 CDS open 11795-13081 _na     428_aa tig trigger factor
4808 QKZH01000042.1 GCA003254255_02405 CDS open 13208-13717 _na     169_aa hypothetical protein
4809 QKZH01000042.1 GCA003254255_02392 gene open 207-338
4810 QKZH01000042.1 GCA003254255_02393 gene open 409-1284 pgaB
4811 QKZH01000042.1 GCA003254255_02394 gene open 1498-2094
4812 QKZH01000042.1 GCA003254255_02395 gene open 2353-2865 frnE
4813 QKZH01000042.1 GCA003254255_02396 gene open 3002-3382 copZ
4814 QKZH01000042.1 GCA003254255_02397 gene open 3654-4235
4815 QKZH01000042.1 GCA003254255_02398 gene open 4290-5528 perM
4816 QKZH01000042.1 GCA003254255_02399 gene open 5530-6828 lAP4
4817 QKZH01000042.1 GCA003254255_02400 gene open 6849-7445 yihA
4818 QKZH01000042.1 GCA003254255_02401 gene open 7490-9784 lon
4819 QKZH01000042.1 GCA003254255_02402 gene open 9840-11123 clpX
4820 QKZH01000042.1 GCA003254255_02403 gene open 11133-11714 clpP
4821 QKZH01000042.1 GCA003254255_02404 gene open 11795-13081 tig
4822 QKZH01000042.1 GCA003254255_02405 gene open 13208-13717
4823 QKZH01000043.1 repeat_region open 250-1218 CRISPR array with 14 repeats of length 30%2C consensus sequence GTTTCCATTCCTTATAGGTAAGGTACTCAC and spacer length 42
4824 QKZH01000043.1 repeat_region open 11602-12930 CRISPR array with 19 repeats of length 30%2C consensus sequence GTTTCCATTCCTTATAGGTAAGGTACTTAC and spacer length 41
4825 QKZH01000043.1 repeat_region open 13049-13536 CRISPR array with 7 repeats of length 30%2C consensus sequence GTTTCCATTCCTTATAGGTAAGGTACTTAC and spacer length 40
4826 QKZH01000043.1 GCA003254255_02406 CDS open 1939-2295 _na     118_aa CRISPR-associated protein
4827 QKZH01000043.1 GCA003254255_02407 CDS open 2350-4086 _na     578_aa hypothetical protein
4828 QKZH01000043.1 GCA003254255_02408 CDS open 4076-6502 _na     808_aa csx10gr5 CRISPR-associated RAMP protein
4829 QKZH01000043.1 GCA003254255_02409 CDS open 6516-8033 _na     505_aa csm3 CRISPR-associated RAMP protein
4830 QKZH01000043.1 GCA003254255_02410 CDS open 8014-8550 _na     178_aa csx19 CRISPR-associated protein Csx19
4831 QKZH01000043.1 GCA003254255_02411 CDS open 8553-10562 _na     669_aa TIGR03986 family CRISPR-associated RAMP protein
4832 QKZH01000043.1 GCA003254255_02412 CDS open 10592-10861 _na     89_aa hypothetical protein
4833 QKZH01000043.1 GCA003254255_02413 CDS open 11116-11424 _na     102_aa relB Type II toxin-antitoxin system RelB/DinJ family antitoxin
4834 QKZH01000043.1 GCA003254255_02406 gene open 1939-2295
4835 QKZH01000043.1 GCA003254255_02407 gene open 2350-4086
4836 QKZH01000043.1 GCA003254255_02408 gene open 4076-6502 csx10gr5
4837 QKZH01000043.1 GCA003254255_02409 gene open 6516-8033 csm3
4838 QKZH01000043.1 GCA003254255_02410 gene open 8014-8550 csx19
4839 QKZH01000043.1 GCA003254255_02411 gene open 8553-10562
4840 QKZH01000043.1 GCA003254255_02412 gene open 10592-10861
4841 QKZH01000043.1 GCA003254255_02413 gene open 11116-11424 relB
4842 QKZH01000044.1 GCA003254255_02414 CDS open 299-889 _na     196_aa udg4 Uracil-DNA glycosylase family protein
4843 QKZH01000044.1 GCA003254255_02415 CDS open 936-2003 _na     355_aa carA carbamoyl phosphate synthase small subunit
4844 QKZH01000044.1 GCA003254255_02416 CDS open 2004-4136 _na     710_aa hypothetical protein
4845 QKZH01000044.1 GCA003254255_02417 CDS open 4184-4528 _na     114_aa Choline-binding protein A
4846 QKZH01000044.1 GCA003254255_02418 CDS open 4865-6799 _na     644_aa ilvB Thiamine pyrophosphate-binding protein
4847 QKZH01000044.1 GCA003254255_02419 CDS open 6809-7759 _na     316_aa wcaG NAD(P)-dependent oxidoreductase
4848 QKZH01000044.1 GCA003254255_02420 CDS open 7783-8907 _na     374_aa ubiG C-methyltransferase domain-containing protein
4849 QKZH01000044.1 GCA003254255_02414 gene open 299-889 udg4
4850 QKZH01000044.1 GCA003254255_02415 gene open 936-2003 carA
4851 QKZH01000044.1 GCA003254255_02416 gene open 2004-4136
4852 QKZH01000044.1 GCA003254255_02417 gene open 4184-4528
4853 QKZH01000044.1 GCA003254255_02418 gene open 4865-6799 ilvB
4854 QKZH01000044.1 GCA003254255_02419 gene open 6809-7759 wcaG
4855 QKZH01000044.1 GCA003254255_02420 gene open 7783-8907 ubiG
4856 QKZH01000045.1 GCA003254255_02422 CDS open 581-1477 _na     298_aa hypothetical protein
4857 QKZH01000045.1 GCA003254255_02423 CDS open 1602-3326 _na     574_aa nar1 Hydrogenase
4858 QKZH01000045.1 GCA003254255_02424 CDS open 3320-5152 _na     610_aa nuoF NADH-ubiquinone oxidoreductase 51kDa subunit iron-sulphur binding domain-containing protein
4859 QKZH01000045.1 GCA003254255_02425 CDS open 5426-6028 _na     200_aa recX Regulatory protein RecX
4860 QKZH01000045.1 GCA003254255_02426 CDS open 6025-7194 _na     389_aa recA recombinase RecA
4861 QKZH01000045.1 GCA003254255_02427 CDS open 7604-8968 _na     454_aa wcaJ Sugar transferase
4862 QKZH01000045.1 GCA003254255_02428 CDS open 9143-10105 _na     320_aa dusB tRNA dihydrouridine synthase DusB
4863 QKZH01000045.1 GCA003254255_02429 CDS open 10102-10524 _na     140_aa gtrA GtrA family protein
4864 QKZH01000045.1 GCA003254255_02430 CDS open 10527-10895 _na     122_aa DUF6145 domain-containing protein
4865 QKZH01000045.1 GCA003254255_02431 CDS open 10897-11865 _na     322_aa pfkA 6-phosphofructokinase
4866 QKZH01000045.1 GCA003254255_02422 gene open 581-1477
4867 QKZH01000045.1 GCA003254255_02423 gene open 1602-3326 nar1
4868 QKZH01000045.1 GCA003254255_02424 gene open 3320-5152 nuoF
4869 QKZH01000045.1 GCA003254255_02425 gene open 5426-6028 recX
4870 QKZH01000045.1 GCA003254255_02426 gene open 6025-7194 recA
4871 QKZH01000045.1 GCA003254255_02427 gene open 7604-8968 wcaJ
4872 QKZH01000045.1 GCA003254255_02428 gene open 9143-10105 dusB
4873 QKZH01000045.1 GCA003254255_02429 gene open 10102-10524 gtrA
4874 QKZH01000045.1 GCA003254255_02430 gene open 10527-10895
4875 QKZH01000045.1 GCA003254255_02431 gene open 10897-11865 pfkA
4876 QKZH01000045.1 GCA003254255_02421 gene open 393-480 trnS
4877 QKZH01000045.1 GCA003254255_02421 tRNA open 393-480 trnS tRNA-Ser(gct)
4878 QKZH01000046.1 GCA003254255_02432 CDS open 333-8504 _na     2723_aa MucBP domain-containing protein
4879 QKZH01000046.1 GCA003254255_02432 gene open 333-8504
4880 QKZH01000047.1 regulatory_region open 6287-6441 glmS glucosamine-6-phosphate activated ribozyme aptamer
4881 QKZH01000047.1 GCA003254255_02433 CDS open 473-661 _na     62_aa hypothetical protein
4882 QKZH01000047.1 GCA003254255_02434 CDS open 748-2223 _na     491_aa DUF3298 domain-containing protein
4883 QKZH01000047.1 GCA003254255_02435 CDS open 2251-3999 _na     582_aa Lipoprotein
4884 QKZH01000047.1 GCA003254255_02436 CDS open 4150-4314 _na     54_aa hypothetical protein
4885 QKZH01000047.1 GCA003254255_02437 CDS open 4420-6261 _na     613_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
4886 QKZH01000047.1 GCA003254255_02438 CDS open 6579-7592 _na     337_aa MacB-like periplasmic core domain-containing protein
4887 QKZH01000047.1 GCA003254255_02439 CDS open 7691-9244 _na     517_aa guaA glutamine-hydrolyzing GMP synthase
4888 QKZH01000047.1 GCA003254255_02440 CDS open 9257-9547 _na     96_aa sseB SseB protein C-terminal domain-containing protein
4889 QKZH01000047.1 GCA003254255_02441 CDS open 10005-11012 _na     335_aa FRG domain-containing protein
4890 QKZH01000047.1 GCA003254255_02433 gene open 473-661
4891 QKZH01000047.1 GCA003254255_02434 gene open 748-2223
4892 QKZH01000047.1 GCA003254255_02435 gene open 2251-3999
4893 QKZH01000047.1 GCA003254255_02436 gene open 4150-4314
4894 QKZH01000047.1 GCA003254255_02437 gene open 4420-6261 glmS
4895 QKZH01000047.1 GCA003254255_02438 gene open 6579-7592
4896 QKZH01000047.1 GCA003254255_02439 gene open 7691-9244 guaA
4897 QKZH01000047.1 GCA003254255_02440 gene open 9257-9547 sseB
4898 QKZH01000047.1 GCA003254255_02441 gene open 10005-11012
4899 QKZH01000048.1 GCA003254255_02443 CDS open 233-649 _na     138_aa fur Transcriptional repressor
4900 QKZH01000048.1 GCA003254255_02444 CDS open 722-1258 _na     178_aa rbr rubrerythrin
4901 QKZH01000048.1 GCA003254255_02445 CDS open 1484-2182 _na     232_aa rpsA S1 motif domain-containing protein
4902 QKZH01000048.1 GCA003254255_02446 CDS open 2195-3589 _na     464_aa lAP4 aminopeptidase
4903 QKZH01000048.1 GCA003254255_02447 CDS open 3630-4838 _na     402_aa tig trigger factor
4904 QKZH01000048.1 GCA003254255_02448 CDS open 4884-6014 _na     376_aa tig trigger factor
4905 QKZH01000048.1 GCA003254255_02449 CDS open 6057-6854 _na     265_aa cof HAD hydrolase%2C family IIB
4906 QKZH01000048.1 GCA003254255_02450 CDS open 6888-7592 _na     234_aa cysE serine O-acetyltransferase
4907 QKZH01000048.1 GCA003254255_02451 CDS open 7592-7927 _na     111_aa yhbQ GIY-YIG nuclease family protein
4908 QKZH01000048.1 GCA003254255_02452 CDS open 7905-8555 _na     216_aa rluA RluA family pseudouridine synthase
4909 QKZH01000048.1 GCA003254255_02453 CDS open 8652-9233 _na     193_aa DUF3793 domain-containing protein
4910 QKZH01000048.1 GCA003254255_02454 CDS open 9283-9711 _na     142_aa fldA flavodoxin
4911 QKZH01000048.1 GCA003254255_02443 gene open 233-649 fur
4912 QKZH01000048.1 GCA003254255_02444 gene open 722-1258 rbr
4913 QKZH01000048.1 GCA003254255_02445 gene open 1484-2182 rpsA
4914 QKZH01000048.1 GCA003254255_02446 gene open 2195-3589 lAP4
4915 QKZH01000048.1 GCA003254255_02447 gene open 3630-4838 tig
4916 QKZH01000048.1 GCA003254255_02448 gene open 4884-6014 tig
4917 QKZH01000048.1 GCA003254255_02449 gene open 6057-6854 cof
4918 QKZH01000048.1 GCA003254255_02450 gene open 6888-7592 cysE
4919 QKZH01000048.1 GCA003254255_02451 gene open 7592-7927 yhbQ
4920 QKZH01000048.1 GCA003254255_02452 gene open 7905-8555 rluA
4921 QKZH01000048.1 GCA003254255_02453 gene open 8652-9233
4922 QKZH01000048.1 GCA003254255_02454 gene open 9283-9711 fldA
4923 QKZH01000048.1 GCA003254255_02442 gene open 1-56 trnG
4924 QKZH01000048.1 GCA003254255_02442 tRNA open 1-56 trnG tRNA-Gly(gcc)
4925 QKZH01000049.1 GCA003254255_02456 CDS open 487-1848 _na     453_aa DUF1576 domain-containing protein
4926 QKZH01000049.1 GCA003254255_02457 CDS open 1808-2674 _na     288_aa DUF3881 domain-containing protein
4927 QKZH01000049.1 GCA003254255_02458 CDS open 2795-3994 _na     399_aa tuf elongation factor Tu
4928 QKZH01000049.1 GCA003254255_02459 CDS open 4103-6217 _na     704_aa fusA elongation factor G
4929 QKZH01000049.1 GCA003254255_02460 CDS open 6232-6702 _na     156_aa rpsG 30S ribosomal protein S7
4930 QKZH01000049.1 GCA003254255_02461 CDS open 6843-7262 _na     139_aa rpsL 30S ribosomal protein S12
4931 QKZH01000049.1 GCA003254255_02462 CDS open 7496-7909 _na     137_aa hypothetical protein
4932 QKZH01000049.1 GCA003254255_02456 gene open 487-1848
4933 QKZH01000049.1 GCA003254255_02457 gene open 1808-2674
4934 QKZH01000049.1 GCA003254255_02458 gene open 2795-3994 tuf
4935 QKZH01000049.1 GCA003254255_02459 gene open 4103-6217 fusA
4936 QKZH01000049.1 GCA003254255_02460 gene open 6232-6702 rpsG
4937 QKZH01000049.1 GCA003254255_02461 gene open 6843-7262 rpsL
4938 QKZH01000049.1 GCA003254255_02462 gene open 7496-7909
4939 QKZH01000049.1 GCA003254255_02455 gene open 162-241 trnL
4940 QKZH01000049.1 GCA003254255_02455 tRNA open 162-241 trnL tRNA-Leu(tag)
4941 QKZH01000050.1 GCA003254255_02463 CDS open 304-2142 _na     612_aa spoIVCA Recombinase domain-containing protein
4942 QKZH01000050.1 GCA003254255_02464 CDS open 2223-2420 _na     65_aa tnpW Transposon-encoded protein TnpW
4943 QKZH01000050.1 GCA003254255_02465 CDS open 2493-2813 _na     106_aa DUF3847 domain-containing protein
4944 QKZH01000050.1 GCA003254255_02466 CDS open 3055-4515 _na     486_aa mobQ MobQ family relaxase
4945 QKZH01000050.1 GCA003254255_02467 CDS open 4588-5367 _na     259_aa menH Serine aminopeptidase S33 domain-containing protein
4946 QKZH01000050.1 GCA003254255_02468 CDS open 5430-6863 _na     477_aa msrA Peptide methionine sulfoxide reductase MsrA
4947 QKZH01000050.1 GCA003254255_02469 CDS open 6866-7219 _na     117_aa manC Cupin 2 conserved barrel domain-containing protein
4948 QKZH01000050.1 GCA003254255_02470 CDS open 7649-7906 _na     85_aa hypothetical protein
4949 QKZH01000050.1 GCA003254255_02463 gene open 304-2142 spoIVCA
4950 QKZH01000050.1 GCA003254255_02464 gene open 2223-2420 tnpW
4951 QKZH01000050.1 GCA003254255_02465 gene open 2493-2813
4952 QKZH01000050.1 GCA003254255_02466 gene open 3055-4515 mobQ
4953 QKZH01000050.1 GCA003254255_02467 gene open 4588-5367 menH
4954 QKZH01000050.1 GCA003254255_02468 gene open 5430-6863 msrA
4955 QKZH01000050.1 GCA003254255_02469 gene open 6866-7219 manC
4956 QKZH01000050.1 GCA003254255_02470 gene open 7649-7906
4957 QKZH01000051.1 GCA003254255_02471 CDS open 177-1013 _na     278_aa fadB 3-hydroxybutyryl-CoA dehydrogenase
4958 QKZH01000051.1 GCA003254255_02472 CDS open 1082-1858 _na     258_aa caiD Enoyl-CoA hydratase
4959 QKZH01000051.1 GCA003254255_02473 CDS open 2330-3517 _na     395_aa paaJ acetyl-CoA C-acetyltransferase
4960 QKZH01000051.1 GCA003254255_02474 CDS open 3514-4164 _na     216_aa atoD CoA transferase subunit A
4961 QKZH01000051.1 GCA003254255_02475 CDS open 4164-4808 _na     214_aa atoA 3-oxoacid CoA-transferase subunit B
4962 QKZH01000051.1 GCA003254255_02476 CDS open 5065-6432 _na     455_aa atoE TIGR00366 family protein
4963 QKZH01000051.1 GCA003254255_02477 CDS open 6473-7399 _na     308_aa eCM27 Sodium:calcium antiporter
4964 QKZH01000051.1 GCA003254255_02478 CDS open 7347-7502 _na     51_aa hypothetical protein
4965 QKZH01000051.1 GCA003254255_02471 gene open 177-1013 fadB
4966 QKZH01000051.1 GCA003254255_02472 gene open 1082-1858 caiD
4967 QKZH01000051.1 GCA003254255_02473 gene open 2330-3517 paaJ
4968 QKZH01000051.1 GCA003254255_02474 gene open 3514-4164 atoD
4969 QKZH01000051.1 GCA003254255_02475 gene open 4164-4808 atoA
4970 QKZH01000051.1 GCA003254255_02476 gene open 5065-6432 atoE
4971 QKZH01000051.1 GCA003254255_02477 gene open 6473-7399 eCM27
4972 QKZH01000051.1 GCA003254255_02478 gene open 7347-7502
4973 QKZH01000052.1 GCA003254255_02479 CDS open 615-824 _na     69_aa hypothetical protein
4974 QKZH01000052.1 GCA003254255_02480 CDS open 1056-2081 _na     341_aa hypothetical protein
4975 QKZH01000052.1 GCA003254255_02481 CDS open 2161-2676 _na     171_aa hypothetical protein
4976 QKZH01000052.1 GCA003254255_02482 CDS open 3285-5969 _na     894_aa aprE VWA domain-containing protein
4977 QKZH01000052.1 GCA003254255_02479 gene open 615-824
4978 QKZH01000052.1 GCA003254255_02480 gene open 1056-2081
4979 QKZH01000052.1 GCA003254255_02481 gene open 2161-2676
4980 QKZH01000052.1 GCA003254255_02482 gene open 3285-5969 aprE
4981 QKZH01000053.1 GCA003254255_02483 CDS open 46-225 _na     59_aa Transposase%2C YhgA-like domain protein
4982 QKZH01000053.1 GCA003254255_02484 CDS open 743-1402 _na     219_aa hisM Amino acid ABC transporter permease
4983 QKZH01000053.1 GCA003254255_02485 CDS open 1383-2054 _na     223_aa hisM ABC transmembrane type-1 domain-containing protein
4984 QKZH01000053.1 GCA003254255_02486 CDS open 2074-2847 _na     257_aa glnQ Amino acid ABC transporter ATP-binding protein
4985 QKZH01000053.1 GCA003254255_02487 CDS open 2872-3723 _na     283_aa hisJ Solute-binding protein family 3/N-terminal domain-containing protein
4986 QKZH01000053.1 GCA003254255_02488 CDS open 3817-4614 _na     265_aa Glucan-binding domain (YG repeat)
4987 QKZH01000053.1 GCA003254255_02489 CDS open 4735-5370 _na     211_aa ycaP DUF421 domain-containing protein
4988 QKZH01000053.1 GCA003254255_02490 CDS open 5374-5823 _na     149_aa DUF3290 domain-containing protein
4989 QKZH01000053.1 GCA003254255_02483 gene open 46-225
4990 QKZH01000053.1 GCA003254255_02484 gene open 743-1402 hisM
4991 QKZH01000053.1 GCA003254255_02485 gene open 1383-2054 hisM
4992 QKZH01000053.1 GCA003254255_02486 gene open 2074-2847 glnQ
4993 QKZH01000053.1 GCA003254255_02487 gene open 2872-3723 hisJ
4994 QKZH01000053.1 GCA003254255_02488 gene open 3817-4614
4995 QKZH01000053.1 GCA003254255_02489 gene open 4735-5370 ycaP
4996 QKZH01000053.1 GCA003254255_02490 gene open 5374-5823
4997 QKZH01000054.1 GCA003254255_02491 CDS open 327-1889 _na     520_aa CRISPR-associated (Cas) DxTHG family
4998 QKZH01000054.1 GCA003254255_02492 CDS open 2253-2657 _na     134_aa hypothetical protein
4999 QKZH01000054.1 GCA003254255_02493 CDS open 2800-3573 _na     257_aa tauB ABC transporter ATP-binding protein
5000 QKZH01000054.1 GCA003254255_02494 CDS open 3554-4558 _na     334_aa tauA ABC transporter substrate-binding protein