BAKTAGenome Explorer: Patescibacteria [C1 O1 F1 G1] bacterium HMT-872 (GCA_003260325.1)
Select a Genome:
|
BAKTA Annotations for GCA_003260325.1
|
Search & Sort all 2134 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | MOLU01000005.1 | GCA003260325_00751 | gene | open | 87152-87466 | |||
| 1502 | MOLU01000005.1 | GCA003260325_00752 | gene | open | 87676-88257 | |||
| 1503 | MOLU01000005.1 | GCA003260325_00753 | gene | open | 89854-90024 | |||
| 1504 | MOLU01000005.1 | GCA003260325_00754 | gene | open | 91756-91977 | |||
| 1505 | MOLU01000005.1 | GCA003260325_00755 | gene | open | 93598-93957 | |||
| 1506 | MOLU01000005.1 | GCA003260325_00756 | gene | open | 96015-96152 | |||
| 1507 | MOLU01000005.1 | GCA003260325_00757 | gene | open | 98895-99104 | |||
| 1508 | MOLU01000005.1 | GCA003260325_00661 | gene | open | 12449-12524 | trnE | ||
| 1509 | MOLU01000005.1 | GCA003260325_00664 | gene | open | 16381-16465 | trnL | ||
| 1510 | MOLU01000005.1 | GCA003260325_00665 | gene | open | 16665-16749 | trnY | ||
| 1511 | MOLU01000005.1 | GCA003260325_00666 | gene | open | 16804-16879 | trnT | ||
| 1512 | MOLU01000005.1 | GCA003260325_00747 | gene | open | 82450-82525 | trnR | ||
| 1513 | MOLU01000005.1 | GCA003260325_00661 | tRNA | open | 12449-12524 | trnE | tRNA-Glu(ctc) | |
| 1514 | MOLU01000005.1 | GCA003260325_00664 | tRNA | open | 16381-16465 | trnL | tRNA-Leu(tag) | |
| 1515 | MOLU01000005.1 | GCA003260325_00665 | tRNA | open | 16665-16749 | trnY | tRNA-Tyr(gta) | |
| 1516 | MOLU01000005.1 | GCA003260325_00666 | tRNA | open | 16804-16879 | trnT | tRNA-Thr(tgt) | |
| 1517 | MOLU01000005.1 | GCA003260325_00747 | tRNA | open | 82450-82525 | trnR | tRNA-Arg(gcg) | |
| 1518 | MOLU01000006.1 | GCA003260325_00758 | gene | open | 159-1645 | rrs | ||
| 1519 | MOLU01000006.1 | GCA003260325_00758 | rRNA | open | 159-1645 | rrs | 16S ribosomal RNA | |
| 1520 | MOLU01000006.1 | GCA003260325_00759 | CDS | open | 2020-2250 | _na 76_aa | hypothetical protein | |
| 1521 | MOLU01000006.1 | GCA003260325_00760 | CDS | open | 3293-3841 | _na 182_aa | hypothetical protein | |
| 1522 | MOLU01000006.1 | GCA003260325_00761 | CDS | open | 5668-5901 | _na 77_aa | hypothetical protein | |
| 1523 | MOLU01000006.1 | GCA003260325_00762 | CDS | open | 6865-7062 | _na 65_aa | hypothetical protein | |
| 1524 | MOLU01000006.1 | GCA003260325_00763 | CDS | open | 7147-7278 | _na 43_aa | hypothetical protein | |
| 1525 | MOLU01000006.1 | GCA003260325_00764 | CDS | open | 8052-8231 | _na 59_aa | hypothetical protein | |
| 1526 | MOLU01000006.1 | GCA003260325_00765 | CDS | open | 8978-9112 | _na 44_aa | hypothetical protein | |
| 1527 | MOLU01000006.1 | GCA003260325_00766 | CDS | open | 9109-9261 | _na 50_aa | hypothetical protein | |
| 1528 | MOLU01000006.1 | GCA003260325_00767 | CDS | open | 9415-9618 | _na 67_aa | hypothetical protein | |
| 1529 | MOLU01000006.1 | GCA003260325_00768 | CDS | open | 10911-11339 | _na 142_aa | hypothetical protein | |
| 1530 | MOLU01000006.1 | GCA003260325_00769 | CDS | open | 11810-12343 | _na 177_aa | tetR | TetR family transcriptional regulator |
| 1531 | MOLU01000006.1 | GCA003260325_00770 | CDS | open | 12350-12643 | _na 97_aa | hypothetical protein | |
| 1532 | MOLU01000006.1 | GCA003260325_00771 | CDS | open | 12659-13168 | _na 169_aa | Serine aminopeptidase S33 domain-containing protein | |
| 1533 | MOLU01000006.1 | GCA003260325_00772 | CDS | open | 13134-13388 | _na 84_aa | hypothetical protein | |
| 1534 | MOLU01000006.1 | GCA003260325_00773 | CDS | open | 13483-13764 | _na 93_aa | hypothetical protein | |
| 1535 | MOLU01000006.1 | GCA003260325_00774 | CDS | open | 13792-13938 | _na 48_aa | hypothetical protein | |
| 1536 | MOLU01000006.1 | GCA003260325_00775 | CDS | open | 14224-14946 | _na 240_aa | CAAX protease | |
| 1537 | MOLU01000006.1 | GCA003260325_00776 | CDS | open | 15115-15360 | _na 81_aa | hypothetical protein | |
| 1538 | MOLU01000006.1 | GCA003260325_00777 | CDS | open | 15595-16098 | _na 167_aa | Alpha/beta hydrolase | |
| 1539 | MOLU01000006.1 | GCA003260325_00778 | CDS | open | 16209-16343 | _na 44_aa | hypothetical protein | |
| 1540 | MOLU01000006.1 | GCA003260325_00779 | CDS | open | 16458-16586 | _na 42_aa | hypothetical protein | |
| 1541 | MOLU01000006.1 | GCA003260325_00780 | CDS | open | 17336-17461 | _na 41_aa | hypothetical protein | |
| 1542 | MOLU01000006.1 | GCA003260325_00781 | CDS | open | 17517-17936 | _na 139_aa | hypothetical protein | |
| 1543 | MOLU01000006.1 | GCA003260325_00782 | CDS | open | 18017-18205 | _na 62_aa | hypothetical protein | |
| 1544 | MOLU01000006.1 | GCA003260325_00783 | CDS | open | 20067-20324 | _na 85_aa | hypothetical protein | |
| 1545 | MOLU01000006.1 | GCA003260325_00784 | CDS | open | 20930-21175 | _na 81_aa | AMIN domain-containing protein | |
| 1546 | MOLU01000006.1 | GCA003260325_00785 | CDS | open | 21556-21675 | _na 39_aa | hypothetical protein | |
| 1547 | MOLU01000006.1 | GCA003260325_00786 | CDS | open | 21715-21906 | _na 63_aa | hypothetical protein | |
| 1548 | MOLU01000006.1 | GCA003260325_00787 | CDS | open | 23318-23506 | _na 62_aa | hypothetical protein | |
| 1549 | MOLU01000006.1 | GCA003260325_00788 | CDS | open | 26200-26313 | _na 37_aa | hypothetical protein | |
| 1550 | MOLU01000006.1 | GCA003260325_00789 | CDS | open | 26674-26802 | _na 42_aa | hypothetical protein | |
| 1551 | MOLU01000006.1 | GCA003260325_00790 | CDS | open | 27222-27326 | _na 34_aa | hypothetical protein | |
| 1552 | MOLU01000006.1 | GCA003260325_00791 | CDS | open | 27763-28032 | _na 89_aa | hypothetical protein | |
| 1553 | MOLU01000006.1 | GCA003260325_00792 | CDS | open | 28026-28292 | _na 88_aa | hypothetical protein | |
| 1554 | MOLU01000006.1 | GCA003260325_00794 | CDS | open | 30477-30719 | _na 80_aa | hypothetical protein | |
| 1555 | MOLU01000006.1 | GCA003260325_00795 | CDS | open | 31169-31345 | _na 58_aa | hypothetical protein | |
| 1556 | MOLU01000006.1 | GCA003260325_00796 | CDS | open | 32668-32868 | _na 66_aa | hypothetical protein | |
| 1557 | MOLU01000006.1 | GCA003260325_00797 | CDS | open | 32992-33153 | _na 53_aa | hypothetical protein | |
| 1558 | MOLU01000006.1 | GCA003260325_00798 | CDS | open | 33966-34085 | _na 39_aa | hypothetical protein | |
| 1559 | MOLU01000006.1 | GCA003260325_00799 | CDS | open | 35607-35744 | _na 45_aa | hypothetical protein | |
| 1560 | MOLU01000006.1 | GCA003260325_00800 | CDS | open | 35907-36185 | _na 92_aa | hypothetical protein | |
| 1561 | MOLU01000006.1 | GCA003260325_00801 | CDS | open | 36519-36725 | _na 68_aa | hypothetical protein | |
| 1562 | MOLU01000006.1 | GCA003260325_00802 | CDS | open | 37097-37315 | _na 72_aa | hypothetical protein | |
| 1563 | MOLU01000006.1 | GCA003260325_00803 | CDS | open | 37461-37736 | _na 91_aa | hypothetical protein | |
| 1564 | MOLU01000006.1 | GCA003260325_00804 | CDS | open | 38512-38787 | _na 91_aa | hypothetical protein | |
| 1565 | MOLU01000006.1 | GCA003260325_00805 | CDS | open | 39446-39751 | _na 101_aa | Bifunctional (P)ppGpp synthetase/guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase | |
| 1566 | MOLU01000006.1 | GCA003260325_00806 | CDS | open | 39827-39985 | _na 52_aa | HD domain-containing protein | |
| 1567 | MOLU01000006.1 | GCA003260325_00807 | CDS | open | 41552-41737 | _na 61_aa | hypothetical protein | |
| 1568 | MOLU01000006.1 | GCA003260325_00808 | CDS | open | 41656-42123 | _na 155_aa | hypothetical protein | |
| 1569 | MOLU01000006.1 | GCA003260325_00809 | CDS | open | 42160-42318 | _na 52_aa | hypothetical protein | |
| 1570 | MOLU01000006.1 | GCA003260325_00810 | CDS | open | 42930-43112 | _na 60_aa | Ribosomal subunit interface protein | |
| 1571 | MOLU01000006.1 | GCA003260325_00811 | CDS | open | 43498-43863 | _na 121_aa | Tetratricopeptide repeat protein | |
| 1572 | MOLU01000006.1 | GCA003260325_00812 | CDS | open | 44287-44523 | _na 78_aa | Histidine triad nucleotide-binding protein | |
| 1573 | MOLU01000006.1 | GCA003260325_00813 | CDS | open | 46530-46721 | _na 63_aa | hypothetical protein | |
| 1574 | MOLU01000006.1 | GCA003260325_00814 | CDS | open | 47244-47474 | _na 76_aa | hypothetical protein | |
| 1575 | MOLU01000006.1 | GCA003260325_00815 | CDS | open | 52099-52296 | _na 65_aa | hypothetical protein | |
| 1576 | MOLU01000006.1 | GCA003260325_00816 | CDS | open | 52837-53109 | _na 90_aa | hypothetical protein | |
| 1577 | MOLU01000006.1 | GCA003260325_00817 | CDS | open | 53909-54175 | _na 88_aa | hypothetical protein | |
| 1578 | MOLU01000006.1 | GCA003260325_00818 | CDS | open | 55087-55296 | _na 69_aa | hypothetical protein | |
| 1579 | MOLU01000006.1 | GCA003260325_00819 | CDS | open | 55408-55695 | _na 95_aa | hypothetical protein | |
| 1580 | MOLU01000006.1 | GCA003260325_00820 | CDS | open | 56332-56517 | _na 61_aa | DNA-directed RNA polymerase beta chain | |
| 1581 | MOLU01000006.1 | GCA003260325_00822 | CDS | open | 57250-57459 | _na 69_aa | DNA-directed RNA polymerase | |
| 1582 | MOLU01000006.1 | GCA003260325_00823 | CDS | open | 57748-57870 | _na 40_aa | hypothetical protein | |
| 1583 | MOLU01000006.1 | GCA003260325_00824 | CDS | open | 58435-58599 | _na 54_aa | DNA-directed RNA polymerase | |
| 1584 | MOLU01000006.1 | GCA003260325_00825 | CDS | open | 58742-58927 | _na 61_aa | hypothetical protein | |
| 1585 | MOLU01000006.1 | GCA003260325_00826 | CDS | open | 58988-59305 | _na 105_aa | hypothetical protein | |
| 1586 | MOLU01000006.1 | GCA003260325_00827 | CDS | open | 59850-60005 | _na 51_aa | hypothetical protein | |
| 1587 | MOLU01000006.1 | GCA003260325_00828 | CDS | open | 61324-61584 | _na 86_aa | hypothetical protein | |
| 1588 | MOLU01000006.1 | GCA003260325_00829 | CDS | open | 63114-63320 | _na 68_aa | hypothetical protein | |
| 1589 | MOLU01000006.1 | GCA003260325_00830 | CDS | open | 63663-63941 | _na 92_aa | hypothetical protein | |
| 1590 | MOLU01000006.1 | GCA003260325_00831 | CDS | open | 64246-64410 | _na 54_aa | hypothetical protein | |
| 1591 | MOLU01000006.1 | GCA003260325_00832 | CDS | open | 64601-64756 | _na 51_aa | hypothetical protein | |
| 1592 | MOLU01000006.1 | GCA003260325_00833 | CDS | open | 65254-65673 | _na 139_aa | Integron-associated effector binding protein domain-containing protein | |
| 1593 | MOLU01000006.1 | GCA003260325_00834 | CDS | open | 66223-66369 | _na 48_aa | hypothetical protein | |
| 1594 | MOLU01000006.1 | GCA003260325_00835 | CDS | open | 66397-66762 | _na 121_aa | hypothetical protein | |
| 1595 | MOLU01000006.1 | GCA003260325_00836 | CDS | open | 67208-67393 | _na 61_aa | hypothetical protein | |
| 1596 | MOLU01000006.1 | GCA003260325_00837 | CDS | open | 68471-68629 | _na 52_aa | hypothetical protein | |
| 1597 | MOLU01000006.1 | GCA003260325_00838 | CDS | open | 71795-71995 | _na 66_aa | hypothetical protein | |
| 1598 | MOLU01000006.1 | GCA003260325_00839 | CDS | open | 74033-74209 | _na 58_aa | hypothetical protein | |
| 1599 | MOLU01000006.1 | GCA003260325_00840 | CDS | open | 74339-74530 | _na 63_aa | hypothetical protein | |
| 1600 | MOLU01000006.1 | GCA003260325_00841 | CDS | open | 75105-75215 | _na 36_aa | hypothetical protein | |
| 1601 | MOLU01000006.1 | GCA003260325_00842 | CDS | open | 77003-77332 | _na 109_aa | hypothetical protein | |
| 1602 | MOLU01000006.1 | GCA003260325_00843 | CDS | open | 79178-79726 | _na 182_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 1603 | MOLU01000006.1 | GCA003260325_00844 | CDS | open | 80415-80621 | _na 68_aa | glycosyltransferase | |
| 1604 | MOLU01000006.1 | GCA003260325_00845 | CDS | open | 82406-82741 | _na 111_aa | hypothetical protein | |
| 1605 | MOLU01000006.1 | GCA003260325_00846 | CDS | open | 82790-83080 | _na 96_aa | hypothetical protein | |
| 1606 | MOLU01000006.1 | GCA003260325_00847 | CDS | open | 83831-84031 | _na 66_aa | hypothetical protein | |
| 1607 | MOLU01000006.1 | GCA003260325_00848 | CDS | open | 84099-84212 | _na 37_aa | hypothetical protein | |
| 1608 | MOLU01000006.1 | GCA003260325_00849 | CDS | open | 85713-85823 | _na 36_aa | hypothetical protein | |
| 1609 | MOLU01000006.1 | GCA003260325_00759 | gene | open | 2020-2250 | |||
| 1610 | MOLU01000006.1 | GCA003260325_00760 | gene | open | 3293-3841 | |||
| 1611 | MOLU01000006.1 | GCA003260325_00761 | gene | open | 5668-5901 | |||
| 1612 | MOLU01000006.1 | GCA003260325_00762 | gene | open | 6865-7062 | |||
| 1613 | MOLU01000006.1 | GCA003260325_00763 | gene | open | 7147-7278 | |||
| 1614 | MOLU01000006.1 | GCA003260325_00764 | gene | open | 8052-8231 | |||
| 1615 | MOLU01000006.1 | GCA003260325_00765 | gene | open | 8978-9112 | |||
| 1616 | MOLU01000006.1 | GCA003260325_00766 | gene | open | 9109-9261 | |||
| 1617 | MOLU01000006.1 | GCA003260325_00767 | gene | open | 9415-9618 | |||
| 1618 | MOLU01000006.1 | GCA003260325_00768 | gene | open | 10911-11339 | |||
| 1619 | MOLU01000006.1 | GCA003260325_00769 | gene | open | 11810-12343 | tetR | ||
| 1620 | MOLU01000006.1 | GCA003260325_00770 | gene | open | 12350-12643 | |||
| 1621 | MOLU01000006.1 | GCA003260325_00771 | gene | open | 12659-13168 | |||
| 1622 | MOLU01000006.1 | GCA003260325_00772 | gene | open | 13134-13388 | |||
| 1623 | MOLU01000006.1 | GCA003260325_00773 | gene | open | 13483-13764 | |||
| 1624 | MOLU01000006.1 | GCA003260325_00774 | gene | open | 13792-13938 | |||
| 1625 | MOLU01000006.1 | GCA003260325_00775 | gene | open | 14224-14946 | |||
| 1626 | MOLU01000006.1 | GCA003260325_00776 | gene | open | 15115-15360 | |||
| 1627 | MOLU01000006.1 | GCA003260325_00777 | gene | open | 15595-16098 | |||
| 1628 | MOLU01000006.1 | GCA003260325_00778 | gene | open | 16209-16343 | |||
| 1629 | MOLU01000006.1 | GCA003260325_00779 | gene | open | 16458-16586 | |||
| 1630 | MOLU01000006.1 | GCA003260325_00780 | gene | open | 17336-17461 | |||
| 1631 | MOLU01000006.1 | GCA003260325_00781 | gene | open | 17517-17936 | |||
| 1632 | MOLU01000006.1 | GCA003260325_00782 | gene | open | 18017-18205 | |||
| 1633 | MOLU01000006.1 | GCA003260325_00783 | gene | open | 20067-20324 | |||
| 1634 | MOLU01000006.1 | GCA003260325_00784 | gene | open | 20930-21175 | |||
| 1635 | MOLU01000006.1 | GCA003260325_00785 | gene | open | 21556-21675 | |||
| 1636 | MOLU01000006.1 | GCA003260325_00786 | gene | open | 21715-21906 | |||
| 1637 | MOLU01000006.1 | GCA003260325_00787 | gene | open | 23318-23506 | |||
| 1638 | MOLU01000006.1 | GCA003260325_00788 | gene | open | 26200-26313 | |||
| 1639 | MOLU01000006.1 | GCA003260325_00789 | gene | open | 26674-26802 | |||
| 1640 | MOLU01000006.1 | GCA003260325_00790 | gene | open | 27222-27326 | |||
| 1641 | MOLU01000006.1 | GCA003260325_00791 | gene | open | 27763-28032 | |||
| 1642 | MOLU01000006.1 | GCA003260325_00792 | gene | open | 28026-28292 | |||
| 1643 | MOLU01000006.1 | GCA003260325_00794 | gene | open | 30477-30719 | |||
| 1644 | MOLU01000006.1 | GCA003260325_00795 | gene | open | 31169-31345 | |||
| 1645 | MOLU01000006.1 | GCA003260325_00796 | gene | open | 32668-32868 | |||
| 1646 | MOLU01000006.1 | GCA003260325_00797 | gene | open | 32992-33153 | |||
| 1647 | MOLU01000006.1 | GCA003260325_00798 | gene | open | 33966-34085 | |||
| 1648 | MOLU01000006.1 | GCA003260325_00799 | gene | open | 35607-35744 | |||
| 1649 | MOLU01000006.1 | GCA003260325_00800 | gene | open | 35907-36185 | |||
| 1650 | MOLU01000006.1 | GCA003260325_00801 | gene | open | 36519-36725 | |||
| 1651 | MOLU01000006.1 | GCA003260325_00802 | gene | open | 37097-37315 | |||
| 1652 | MOLU01000006.1 | GCA003260325_00803 | gene | open | 37461-37736 | |||
| 1653 | MOLU01000006.1 | GCA003260325_00804 | gene | open | 38512-38787 | |||
| 1654 | MOLU01000006.1 | GCA003260325_00805 | gene | open | 39446-39751 | |||
| 1655 | MOLU01000006.1 | GCA003260325_00806 | gene | open | 39827-39985 | |||
| 1656 | MOLU01000006.1 | GCA003260325_00807 | gene | open | 41552-41737 | |||
| 1657 | MOLU01000006.1 | GCA003260325_00808 | gene | open | 41656-42123 | |||
| 1658 | MOLU01000006.1 | GCA003260325_00809 | gene | open | 42160-42318 | |||
| 1659 | MOLU01000006.1 | GCA003260325_00810 | gene | open | 42930-43112 | |||
| 1660 | MOLU01000006.1 | GCA003260325_00811 | gene | open | 43498-43863 | |||
| 1661 | MOLU01000006.1 | GCA003260325_00812 | gene | open | 44287-44523 | |||
| 1662 | MOLU01000006.1 | GCA003260325_00813 | gene | open | 46530-46721 | |||
| 1663 | MOLU01000006.1 | GCA003260325_00814 | gene | open | 47244-47474 | |||
| 1664 | MOLU01000006.1 | GCA003260325_00815 | gene | open | 52099-52296 | |||
| 1665 | MOLU01000006.1 | GCA003260325_00816 | gene | open | 52837-53109 | |||
| 1666 | MOLU01000006.1 | GCA003260325_00817 | gene | open | 53909-54175 | |||
| 1667 | MOLU01000006.1 | GCA003260325_00818 | gene | open | 55087-55296 | |||
| 1668 | MOLU01000006.1 | GCA003260325_00819 | gene | open | 55408-55695 | |||
| 1669 | MOLU01000006.1 | GCA003260325_00820 | gene | open | 56332-56517 | |||
| 1670 | MOLU01000006.1 | GCA003260325_00822 | gene | open | 57250-57459 | |||
| 1671 | MOLU01000006.1 | GCA003260325_00823 | gene | open | 57748-57870 | |||
| 1672 | MOLU01000006.1 | GCA003260325_00824 | gene | open | 58435-58599 | |||
| 1673 | MOLU01000006.1 | GCA003260325_00825 | gene | open | 58742-58927 | |||
| 1674 | MOLU01000006.1 | GCA003260325_00826 | gene | open | 58988-59305 | |||
| 1675 | MOLU01000006.1 | GCA003260325_00827 | gene | open | 59850-60005 | |||
| 1676 | MOLU01000006.1 | GCA003260325_00828 | gene | open | 61324-61584 | |||
| 1677 | MOLU01000006.1 | GCA003260325_00829 | gene | open | 63114-63320 | |||
| 1678 | MOLU01000006.1 | GCA003260325_00830 | gene | open | 63663-63941 | |||
| 1679 | MOLU01000006.1 | GCA003260325_00831 | gene | open | 64246-64410 | |||
| 1680 | MOLU01000006.1 | GCA003260325_00832 | gene | open | 64601-64756 | |||
| 1681 | MOLU01000006.1 | GCA003260325_00833 | gene | open | 65254-65673 | |||
| 1682 | MOLU01000006.1 | GCA003260325_00834 | gene | open | 66223-66369 | |||
| 1683 | MOLU01000006.1 | GCA003260325_00835 | gene | open | 66397-66762 | |||
| 1684 | MOLU01000006.1 | GCA003260325_00836 | gene | open | 67208-67393 | |||
| 1685 | MOLU01000006.1 | GCA003260325_00837 | gene | open | 68471-68629 | |||
| 1686 | MOLU01000006.1 | GCA003260325_00838 | gene | open | 71795-71995 | |||
| 1687 | MOLU01000006.1 | GCA003260325_00839 | gene | open | 74033-74209 | |||
| 1688 | MOLU01000006.1 | GCA003260325_00840 | gene | open | 74339-74530 | |||
| 1689 | MOLU01000006.1 | GCA003260325_00841 | gene | open | 75105-75215 | |||
| 1690 | MOLU01000006.1 | GCA003260325_00842 | gene | open | 77003-77332 | |||
| 1691 | MOLU01000006.1 | GCA003260325_00843 | gene | open | 79178-79726 | |||
| 1692 | MOLU01000006.1 | GCA003260325_00844 | gene | open | 80415-80621 | |||
| 1693 | MOLU01000006.1 | GCA003260325_00845 | gene | open | 82406-82741 | |||
| 1694 | MOLU01000006.1 | GCA003260325_00846 | gene | open | 82790-83080 | |||
| 1695 | MOLU01000006.1 | GCA003260325_00847 | gene | open | 83831-84031 | |||
| 1696 | MOLU01000006.1 | GCA003260325_00848 | gene | open | 84099-84212 | |||
| 1697 | MOLU01000006.1 | GCA003260325_00849 | gene | open | 85713-85823 | |||
| 1698 | MOLU01000006.1 | GCA003260325_00793 | gene | open | 28838-28912 | trnF | ||
| 1699 | MOLU01000006.1 | GCA003260325_00793 | tRNA | open | 28838-28912 | trnF | tRNA-Phe(gaa) | |
| 1700 | MOLU01000007.1 | repeat_region | open | 32172-32651 | CRISPR array with 8 repeats of length 36%2C consensus sequence TTTAACAACGTTATAAAATTTATACTTTTGTAGATA and spacer length 26 | |||
| 1701 | MOLU01000007.1 | repeat_region | open | 32731-33110 | CRISPR array with 6 repeats of length 34%2C consensus sequence TTAACAACGTTATAAAATTTCTACTTTTGTAGAT and spacer length 29 | |||
| 1702 | MOLU01000007.1 | repeat_region | open | 35263-35834 | CRISPR array with 9 repeats of length 36%2C consensus sequence ATTTAACAACTTTATATAATTTCTACTTTTGTAGAT and spacer length 27 | |||
| 1703 | MOLU01000007.1 | GCA003260325_00850 | CDS | open | 5-502 | _na 165_aa | ppk2 | polyphosphate kinase 2 |
| 1704 | MOLU01000007.1 | GCA003260325_00851 | CDS | open | 773-1114 | _na 113_aa | hypothetical protein | |
| 1705 | MOLU01000007.1 | GCA003260325_00852 | CDS | open | 1725-2117 | _na 130_aa | hypothetical protein | |
| 1706 | MOLU01000007.1 | GCA003260325_00853 | CDS | open | 2181-2480 | _na 99_aa | hypothetical protein | |
| 1707 | MOLU01000007.1 | GCA003260325_00854 | CDS | open | 2528-2713 | _na 61_aa | hypothetical protein | |
| 1708 | MOLU01000007.1 | GCA003260325_00855 | CDS | open | 4376-4768 | _na 130_aa | hypothetical protein | |
| 1709 | MOLU01000007.1 | GCA003260325_00856 | CDS | open | 4781-4939 | _na 52_aa | hypothetical protein | |
| 1710 | MOLU01000007.1 | GCA003260325_00857 | CDS | open | 6492-6704 | _na 70_aa | hypothetical protein | |
| 1711 | MOLU01000007.1 | GCA003260325_00858 | CDS | open | 7571-7711 | _na 46_aa | hypothetical protein | |
| 1712 | MOLU01000007.1 | GCA003260325_00859 | CDS | open | 8301-8510 | _na 69_aa | hypothetical protein | |
| 1713 | MOLU01000007.1 | GCA003260325_00860 | CDS | open | 8681-8914 | _na 77_aa | hypothetical protein | |
| 1714 | MOLU01000007.1 | GCA003260325_00861 | CDS | open | 8945-9190 | _na 81_aa | hypothetical protein | |
| 1715 | MOLU01000007.1 | GCA003260325_00862 | CDS | open | 9736-9900 | _na 54_aa | hypothetical protein | |
| 1716 | MOLU01000007.1 | GCA003260325_00863 | CDS | open | 10646-10738 | _na 30_aa | hypothetical protein | |
| 1717 | MOLU01000007.1 | GCA003260325_00864 | CDS | open | 11589-11732 | _na 47_aa | hypothetical protein | |
| 1718 | MOLU01000007.1 | GCA003260325_00865 | CDS | open | 12040-12336 | _na 98_aa | hypothetical protein | |
| 1719 | MOLU01000007.1 | GCA003260325_00866 | CDS | open | 12578-12733 | _na 51_aa | hypothetical protein | |
| 1720 | MOLU01000007.1 | GCA003260325_00867 | CDS | open | 13373-13675 | _na 100_aa | hypothetical protein | |
| 1721 | MOLU01000007.1 | GCA003260325_00868 | CDS | open | 13802-14002 | _na 66_aa | hypothetical protein | |
| 1722 | MOLU01000007.1 | GCA003260325_00869 | CDS | open | 14048-14182 | _na 44_aa | hypothetical protein | |
| 1723 | MOLU01000007.1 | GCA003260325_00870 | CDS | open | 14972-15097 | _na 41_aa | hypothetical protein | |
| 1724 | MOLU01000007.1 | GCA003260325_00871 | CDS | open | 16295-16570 | _na 91_aa | hypothetical protein | |
| 1725 | MOLU01000007.1 | GCA003260325_00872 | CDS | open | 16830-17000 | _na 56_aa | hypothetical protein | |
| 1726 | MOLU01000007.1 | GCA003260325_00873 | CDS | open | 17820-17942 | _na 40_aa | hypothetical protein | |
| 1727 | MOLU01000007.1 | GCA003260325_00874 | CDS | open | 19018-19329 | _na 103_aa | hypothetical protein | |
| 1728 | MOLU01000007.1 | GCA003260325_00875 | CDS | open | 19656-19892 | _na 78_aa | hypothetical protein | |
| 1729 | MOLU01000007.1 | GCA003260325_00876 | CDS | open | 20009-20287 | _na 92_aa | hypothetical protein | |
| 1730 | MOLU01000007.1 | GCA003260325_00877 | CDS | open | 22874-23023 | _na 49_aa | hypothetical protein | |
| 1731 | MOLU01000007.1 | GCA003260325_00878 | CDS | open | 23176-23313 | _na 45_aa | hypothetical protein | |
| 1732 | MOLU01000007.1 | GCA003260325_00879 | CDS | open | 23950-24177 | _na 75_aa | hypothetical protein | |
| 1733 | MOLU01000007.1 | GCA003260325_00880 | CDS | open | 24248-24505 | _na 85_aa | hypothetical protein | |
| 1734 | MOLU01000007.1 | GCA003260325_00881 | CDS | open | 24603-24740 | _na 45_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 1735 | MOLU01000007.1 | GCA003260325_00882 | CDS | open | 25209-25619 | _na 136_aa | hypothetical protein | |
| 1736 | MOLU01000007.1 | GCA003260325_00883 | CDS | open | 26947-27141 | _na 64_aa | hypothetical protein | |
| 1737 | MOLU01000007.1 | GCA003260325_00884 | CDS | open | 27274-27417 | _na 47_aa | hypothetical protein | |
| 1738 | MOLU01000007.1 | GCA003260325_00885 | CDS | open | 27714-27968 | _na 84_aa | hypothetical protein | |
| 1739 | MOLU01000007.1 | GCA003260325_00886 | CDS | open | 28003-28227 | _na 74_aa | hypothetical protein | |
| 1740 | MOLU01000007.1 | GCA003260325_00887 | CDS | open | 28286-28543 | _na 85_aa | hypothetical protein | |
| 1741 | MOLU01000007.1 | GCA003260325_00888 | CDS | open | 29418-29561 | _na 47_aa | hypothetical protein | |
| 1742 | MOLU01000007.1 | GCA003260325_00889 | CDS | open | 29608-29874 | _na 88_aa | hypothetical protein | |
| 1743 | MOLU01000007.1 | GCA003260325_00891 | CDS | open | 37812-37976 | _na 54_aa | hypothetical protein | |
| 1744 | MOLU01000007.1 | GCA003260325_00895 | CDS | open | 39390-39581 | _na 63_aa | Anti-sigma factor antagonist | |
| 1745 | MOLU01000007.1 | GCA003260325_00896 | CDS | open | 40355-40564 | _na 69_aa | hypothetical protein | |
| 1746 | MOLU01000007.1 | GCA003260325_00897 | CDS | open | 41268-41453 | _na 61_aa | hypothetical protein | |
| 1747 | MOLU01000007.1 | GCA003260325_00898 | CDS | open | 41604-41714 | _na 36_aa | hypothetical protein | |
| 1748 | MOLU01000007.1 | GCA003260325_00899 | CDS | open | 43244-43459 | _na 71_aa | hypothetical protein | |
| 1749 | MOLU01000007.1 | GCA003260325_00900 | CDS | open | 43466-43732 | _na 88_aa | hypothetical protein | |
| 1750 | MOLU01000007.1 | GCA003260325_00901 | CDS | open | 44186-44359 | _na 57_aa | hypothetical protein | |
| 1751 | MOLU01000007.1 | GCA003260325_00903 | CDS | open | 45887-46063 | _na 58_aa | Elongation factor Ts | |
| 1752 | MOLU01000007.1 | GCA003260325_00904 | CDS | open | 46328-46507 | _na 59_aa | hypothetical protein | |
| 1753 | MOLU01000007.1 | GCA003260325_00905 | CDS | open | 46660-46815 | _na 51_aa | DUF4870 domain-containing protein | |
| 1754 | MOLU01000007.1 | GCA003260325_00906 | CDS | open | 46890-47216 | _na 108_aa | Small ribosomal subunit protein uS2 | |
| 1755 | MOLU01000007.1 | GCA003260325_00907 | CDS | open | 47226-47423 | _na 65_aa | hypothetical protein | |
| 1756 | MOLU01000007.1 | GCA003260325_00908 | CDS | open | 47463-47675 | _na 70_aa | hypothetical protein | |
| 1757 | MOLU01000007.1 | GCA003260325_00909 | CDS | open | 48017-48268 | _na 83_aa | S1 RNA-binding domain-containing protein | |
| 1758 | MOLU01000007.1 | GCA003260325_00910 | CDS | open | 48392-48601 | _na 69_aa | hypothetical protein | |
| 1759 | MOLU01000007.1 | GCA003260325_00911 | CDS | open | 48653-49018 | _na 121_aa | hypothetical protein | |
| 1760 | MOLU01000007.1 | GCA003260325_00913 | CDS | open | 49723-49998 | _na 91_aa | hypothetical protein | |
| 1761 | MOLU01000007.1 | GCA003260325_00914 | CDS | open | 50479-50685 | _na 68_aa | Response regulatory domain-containing protein | |
| 1762 | MOLU01000007.1 | GCA003260325_00915 | CDS | open | 51596-51697 | _na 33_aa | hypothetical protein | |
| 1763 | MOLU01000007.1 | GCA003260325_00916 | CDS | open | 52190-52294 | _na 34_aa | hypothetical protein | |
| 1764 | MOLU01000007.1 | GCA003260325_00917 | CDS | open | 53749-54084 | _na 111_aa | hypothetical protein | |
| 1765 | MOLU01000007.1 | GCA003260325_00918 | CDS | open | 55901-56371 | _na 156_aa | hypothetical protein | |
| 1766 | MOLU01000007.1 | GCA003260325_00919 | CDS | open | 56281-56505 | _na 74_aa | hypothetical protein | |
| 1767 | MOLU01000007.1 | GCA003260325_00920 | CDS | open | 56970-57089 | _na 39_aa | hypothetical protein | |
| 1768 | MOLU01000007.1 | GCA003260325_00921 | CDS | open | 58004-58135 | _na 43_aa | hypothetical protein | |
| 1769 | MOLU01000007.1 | GCA003260325_00922 | CDS | open | 58245-58406 | _na 53_aa | hypothetical protein | |
| 1770 | MOLU01000007.1 | GCA003260325_00923 | CDS | open | 58696-58920 | _na 74_aa | hypothetical protein | |
| 1771 | MOLU01000007.1 | GCA003260325_00924 | CDS | open | 59807-59992 | _na 61_aa | hypothetical protein | |
| 1772 | MOLU01000007.1 | GCA003260325_00925 | CDS | open | 60286-60534 | _na 82_aa | hypothetical protein | |
| 1773 | MOLU01000007.1 | GCA003260325_00926 | CDS | open | 64168-64293 | _na 41_aa | hypothetical protein | |
| 1774 | MOLU01000007.1 | GCA003260325_00927 | CDS | open | 65490-65621 | _na 43_aa | hypothetical protein | |
| 1775 | MOLU01000007.1 | GCA003260325_00928 | CDS | open | 66078-66500 | _na 140_aa | hypothetical protein | |
| 1776 | MOLU01000007.1 | GCA003260325_00929 | CDS | open | 66514-66816 | _na 100_aa | hypothetical protein | |
| 1777 | MOLU01000007.1 | GCA003260325_00930 | CDS | open | 66884-67186 | _na 100_aa | hypothetical protein | |
| 1778 | MOLU01000007.1 | GCA003260325_00850 | gene | open | 5-502 | ppk2 | ||
| 1779 | MOLU01000007.1 | GCA003260325_00851 | gene | open | 773-1114 | |||
| 1780 | MOLU01000007.1 | GCA003260325_00852 | gene | open | 1725-2117 | |||
| 1781 | MOLU01000007.1 | GCA003260325_00853 | gene | open | 2181-2480 | |||
| 1782 | MOLU01000007.1 | GCA003260325_00854 | gene | open | 2528-2713 | |||
| 1783 | MOLU01000007.1 | GCA003260325_00855 | gene | open | 4376-4768 | |||
| 1784 | MOLU01000007.1 | GCA003260325_00856 | gene | open | 4781-4939 | |||
| 1785 | MOLU01000007.1 | GCA003260325_00857 | gene | open | 6492-6704 | |||
| 1786 | MOLU01000007.1 | GCA003260325_00858 | gene | open | 7571-7711 | |||
| 1787 | MOLU01000007.1 | GCA003260325_00859 | gene | open | 8301-8510 | |||
| 1788 | MOLU01000007.1 | GCA003260325_00860 | gene | open | 8681-8914 | |||
| 1789 | MOLU01000007.1 | GCA003260325_00861 | gene | open | 8945-9190 | |||
| 1790 | MOLU01000007.1 | GCA003260325_00862 | gene | open | 9736-9900 | |||
| 1791 | MOLU01000007.1 | GCA003260325_00863 | gene | open | 10646-10738 | |||
| 1792 | MOLU01000007.1 | GCA003260325_00864 | gene | open | 11589-11732 | |||
| 1793 | MOLU01000007.1 | GCA003260325_00865 | gene | open | 12040-12336 | |||
| 1794 | MOLU01000007.1 | GCA003260325_00866 | gene | open | 12578-12733 | |||
| 1795 | MOLU01000007.1 | GCA003260325_00867 | gene | open | 13373-13675 | |||
| 1796 | MOLU01000007.1 | GCA003260325_00868 | gene | open | 13802-14002 | |||
| 1797 | MOLU01000007.1 | GCA003260325_00869 | gene | open | 14048-14182 | |||
| 1798 | MOLU01000007.1 | GCA003260325_00870 | gene | open | 14972-15097 | |||
| 1799 | MOLU01000007.1 | GCA003260325_00871 | gene | open | 16295-16570 | |||
| 1800 | MOLU01000007.1 | GCA003260325_00872 | gene | open | 16830-17000 | |||
| 1801 | MOLU01000007.1 | GCA003260325_00873 | gene | open | 17820-17942 | |||
| 1802 | MOLU01000007.1 | GCA003260325_00874 | gene | open | 19018-19329 | |||
| 1803 | MOLU01000007.1 | GCA003260325_00875 | gene | open | 19656-19892 | |||
| 1804 | MOLU01000007.1 | GCA003260325_00876 | gene | open | 20009-20287 | |||
| 1805 | MOLU01000007.1 | GCA003260325_00877 | gene | open | 22874-23023 | |||
| 1806 | MOLU01000007.1 | GCA003260325_00878 | gene | open | 23176-23313 | |||
| 1807 | MOLU01000007.1 | GCA003260325_00879 | gene | open | 23950-24177 | |||
| 1808 | MOLU01000007.1 | GCA003260325_00880 | gene | open | 24248-24505 | |||
| 1809 | MOLU01000007.1 | GCA003260325_00881 | gene | open | 24603-24740 | gatC | ||
| 1810 | MOLU01000007.1 | GCA003260325_00882 | gene | open | 25209-25619 | |||
| 1811 | MOLU01000007.1 | GCA003260325_00883 | gene | open | 26947-27141 | |||
| 1812 | MOLU01000007.1 | GCA003260325_00884 | gene | open | 27274-27417 | |||
| 1813 | MOLU01000007.1 | GCA003260325_00885 | gene | open | 27714-27968 | |||
| 1814 | MOLU01000007.1 | GCA003260325_00886 | gene | open | 28003-28227 | |||
| 1815 | MOLU01000007.1 | GCA003260325_00887 | gene | open | 28286-28543 | |||
| 1816 | MOLU01000007.1 | GCA003260325_00888 | gene | open | 29418-29561 | |||
| 1817 | MOLU01000007.1 | GCA003260325_00889 | gene | open | 29608-29874 | |||
| 1818 | MOLU01000007.1 | GCA003260325_00891 | gene | open | 37812-37976 | |||
| 1819 | MOLU01000007.1 | GCA003260325_00895 | gene | open | 39390-39581 | |||
| 1820 | MOLU01000007.1 | GCA003260325_00896 | gene | open | 40355-40564 | |||
| 1821 | MOLU01000007.1 | GCA003260325_00897 | gene | open | 41268-41453 | |||
| 1822 | MOLU01000007.1 | GCA003260325_00898 | gene | open | 41604-41714 | |||
| 1823 | MOLU01000007.1 | GCA003260325_00899 | gene | open | 43244-43459 | |||
| 1824 | MOLU01000007.1 | GCA003260325_00900 | gene | open | 43466-43732 | |||
| 1825 | MOLU01000007.1 | GCA003260325_00901 | gene | open | 44186-44359 | |||
| 1826 | MOLU01000007.1 | GCA003260325_00903 | gene | open | 45887-46063 | |||
| 1827 | MOLU01000007.1 | GCA003260325_00904 | gene | open | 46328-46507 | |||
| 1828 | MOLU01000007.1 | GCA003260325_00905 | gene | open | 46660-46815 | |||
| 1829 | MOLU01000007.1 | GCA003260325_00906 | gene | open | 46890-47216 | |||
| 1830 | MOLU01000007.1 | GCA003260325_00907 | gene | open | 47226-47423 | |||
| 1831 | MOLU01000007.1 | GCA003260325_00908 | gene | open | 47463-47675 | |||
| 1832 | MOLU01000007.1 | GCA003260325_00909 | gene | open | 48017-48268 | |||
| 1833 | MOLU01000007.1 | GCA003260325_00910 | gene | open | 48392-48601 | |||
| 1834 | MOLU01000007.1 | GCA003260325_00911 | gene | open | 48653-49018 | |||
| 1835 | MOLU01000007.1 | GCA003260325_00913 | gene | open | 49723-49998 | |||
| 1836 | MOLU01000007.1 | GCA003260325_00914 | gene | open | 50479-50685 | |||
| 1837 | MOLU01000007.1 | GCA003260325_00915 | gene | open | 51596-51697 | |||
| 1838 | MOLU01000007.1 | GCA003260325_00916 | gene | open | 52190-52294 | |||
| 1839 | MOLU01000007.1 | GCA003260325_00917 | gene | open | 53749-54084 | |||
| 1840 | MOLU01000007.1 | GCA003260325_00918 | gene | open | 55901-56371 | |||
| 1841 | MOLU01000007.1 | GCA003260325_00919 | gene | open | 56281-56505 | |||
| 1842 | MOLU01000007.1 | GCA003260325_00920 | gene | open | 56970-57089 | |||
| 1843 | MOLU01000007.1 | GCA003260325_00921 | gene | open | 58004-58135 | |||
| 1844 | MOLU01000007.1 | GCA003260325_00922 | gene | open | 58245-58406 | |||
| 1845 | MOLU01000007.1 | GCA003260325_00923 | gene | open | 58696-58920 | |||
| 1846 | MOLU01000007.1 | GCA003260325_00924 | gene | open | 59807-59992 | |||
| 1847 | MOLU01000007.1 | GCA003260325_00925 | gene | open | 60286-60534 | |||
| 1848 | MOLU01000007.1 | GCA003260325_00926 | gene | open | 64168-64293 | |||
| 1849 | MOLU01000007.1 | GCA003260325_00927 | gene | open | 65490-65621 | |||
| 1850 | MOLU01000007.1 | GCA003260325_00928 | gene | open | 66078-66500 | |||
| 1851 | MOLU01000007.1 | GCA003260325_00929 | gene | open | 66514-66816 | |||
| 1852 | MOLU01000007.1 | GCA003260325_00930 | gene | open | 66884-67186 | |||
| 1853 | MOLU01000007.1 | GCA003260325_00890 | gene | open | 35008-35081 | trnC | ||
| 1854 | MOLU01000007.1 | GCA003260325_00892 | gene | open | 38422-38497 | trnP | ||
| 1855 | MOLU01000007.1 | GCA003260325_00893 | gene | open | 38502-38578 | trnI | ||
| 1856 | MOLU01000007.1 | GCA003260325_00894 | gene | open | 38664-38740 | trnG | ||
| 1857 | MOLU01000007.1 | GCA003260325_00902 | gene | open | 45625-45699 | trnW | ||
| 1858 | MOLU01000007.1 | GCA003260325_00912 | gene | open | 49303-49379 | trnH | ||
| 1859 | MOLU01000007.1 | GCA003260325_00890 | tRNA | open | 35008-35081 | trnC | tRNA-Cys(gca) | |
| 1860 | MOLU01000007.1 | GCA003260325_00892 | tRNA | open | 38422-38497 | trnP | tRNA-Pro(tgg) | |
| 1861 | MOLU01000007.1 | GCA003260325_00893 | tRNA | open | 38502-38578 | trnI | tRNA-Ile(gat) | |
| 1862 | MOLU01000007.1 | GCA003260325_00894 | tRNA | open | 38664-38740 | trnG | tRNA-Gly(tcc) | |
| 1863 | MOLU01000007.1 | GCA003260325_00902 | tRNA | open | 45625-45699 | trnW | tRNA-Trp(cca) | |
| 1864 | MOLU01000007.1 | GCA003260325_00912 | tRNA | open | 49303-49379 | trnH | tRNA-His(gtg) | |
| 1865 | MOLU01000008.1 | GCA003260325_00931 | CDS | open | 717-1307 | _na 196_aa | hypothetical protein | |
| 1866 | MOLU01000008.1 | GCA003260325_00932 | CDS | open | 1672-1779 | _na 35_aa | hypothetical protein | |
| 1867 | MOLU01000008.1 | GCA003260325_00933 | CDS | open | 3374-3613 | _na 79_aa | hypothetical protein | |
| 1868 | MOLU01000008.1 | GCA003260325_00934 | CDS | open | 4327-4470 | _na 47_aa | hypothetical protein | |
| 1869 | MOLU01000008.1 | GCA003260325_00935 | CDS | open | 4483-4686 | _na 67_aa | DUF304 domain-containing protein | |
| 1870 | MOLU01000008.1 | GCA003260325_00936 | CDS | open | 5164-5430 | _na 88_aa | hypothetical protein | |
| 1871 | MOLU01000008.1 | GCA003260325_00937 | CDS | open | 5524-5709 | _na 61_aa | hypothetical protein | |
| 1872 | MOLU01000008.1 | GCA003260325_00938 | CDS | open | 5737-5949 | _na 70_aa | hypothetical protein | |
| 1873 | MOLU01000008.1 | GCA003260325_00939 | CDS | open | 6567-6779 | _na 70_aa | hypothetical protein | |
| 1874 | MOLU01000008.1 | GCA003260325_00940 | CDS | open | 7033-7239 | _na 68_aa | hypothetical protein | |
| 1875 | MOLU01000008.1 | GCA003260325_00941 | CDS | open | 7988-8233 | _na 81_aa | hypothetical protein | |
| 1876 | MOLU01000008.1 | GCA003260325_00942 | CDS | open | 10546-10839 | _na 97_aa | hypothetical protein | |
| 1877 | MOLU01000008.1 | GCA003260325_00943 | CDS | open | 10868-11128 | _na 86_aa | hypothetical protein | |
| 1878 | MOLU01000008.1 | GCA003260325_00944 | CDS | open | 12922-13212 | _na 96_aa | hypothetical protein | |
| 1879 | MOLU01000008.1 | GCA003260325_00945 | CDS | open | 13458-13667 | _na 69_aa | secE | preprotein translocase subunit SecE |
| 1880 | MOLU01000008.1 | GCA003260325_00946 | CDS | open | 14233-14388 | _na 51_aa | hypothetical protein | |
| 1881 | MOLU01000008.1 | GCA003260325_00947 | CDS | open | 14551-14760 | _na 69_aa | hypothetical protein | |
| 1882 | MOLU01000008.1 | GCA003260325_00948 | CDS | open | 16721-16885 | _na 54_aa | hypothetical protein | |
| 1883 | MOLU01000008.1 | GCA003260325_00949 | CDS | open | 16925-17122 | _na 65_aa | hypothetical protein | |
| 1884 | MOLU01000008.1 | GCA003260325_00950 | CDS | open | 18028-18312 | _na 94_aa | hypothetical protein | |
| 1885 | MOLU01000008.1 | GCA003260325_00952 | CDS | open | 19801-19980 | _na 59_aa | ftsL | Cell division protein FtsL |
| 1886 | MOLU01000008.1 | GCA003260325_00953 | CDS | open | 20381-20767 | _na 128_aa | hypothetical protein | |
| 1887 | MOLU01000008.1 | GCA003260325_00954 | CDS | open | 22176-22400 | _na 74_aa | hypothetical protein | |
| 1888 | MOLU01000008.1 | GCA003260325_00955 | CDS | open | 23921-24109 | _na 62_aa | hypothetical protein | |
| 1889 | MOLU01000008.1 | GCA003260325_00956 | CDS | open | 25762-25947 | _na 61_aa | hypothetical protein | |
| 1890 | MOLU01000008.1 | GCA003260325_00957 | CDS | open | 26641-26796 | _na 51_aa | hypothetical protein | |
| 1891 | MOLU01000008.1 | GCA003260325_00958 | CDS | open | 27111-27374 | _na 87_aa | hypothetical protein | |
| 1892 | MOLU01000008.1 | GCA003260325_00959 | CDS | open | 28103-28201 | _na 32_aa | hypothetical protein | |
| 1893 | MOLU01000008.1 | GCA003260325_00960 | CDS | open | 28355-28540 | _na 61_aa | hypothetical protein | |
| 1894 | MOLU01000008.1 | GCA003260325_00961 | CDS | open | 29095-29382 | _na 95_aa | hypothetical protein | |
| 1895 | MOLU01000008.1 | GCA003260325_00962 | CDS | open | 29443-29589 | _na 48_aa | hypothetical protein | |
| 1896 | MOLU01000008.1 | GCA003260325_00964 | CDS | open | 30940-31179 | _na 79_aa | hypothetical protein | |
| 1897 | MOLU01000008.1 | GCA003260325_00965 | CDS | open | 31889-32011 | _na 40_aa | hypothetical protein | |
| 1898 | MOLU01000008.1 | GCA003260325_00966 | CDS | open | 32720-32911 | _na 63_aa | hypothetical protein | |
| 1899 | MOLU01000008.1 | GCA003260325_00967 | CDS | open | 33151-33516 | _na 121_aa | hypothetical protein | |
| 1900 | MOLU01000008.1 | GCA003260325_00968 | CDS | open | 34831-34986 | _na 51_aa | hypothetical protein | |
| 1901 | MOLU01000008.1 | GCA003260325_00969 | CDS | open | 35071-35277 | _na 68_aa | hypothetical protein | |
| 1902 | MOLU01000008.1 | GCA003260325_00970 | CDS | open | 35271-35489 | _na 72_aa | hypothetical protein | |
| 1903 | MOLU01000008.1 | GCA003260325_00971 | CDS | open | 37094-37267 | _na 57_aa | hypothetical protein | |
| 1904 | MOLU01000008.1 | GCA003260325_00972 | CDS | open | 37450-37599 | _na 49_aa | hypothetical protein | |
| 1905 | MOLU01000008.1 | GCA003260325_00973 | CDS | open | 39010-39132 | _na 40_aa | Aminoacyl-tRNA synthetase class II (G/ P/ S/T) domain-containing protein | |
| 1906 | MOLU01000008.1 | GCA003260325_00974 | CDS | open | 41462-41869 | _na 135_aa | Polyphosphate kinase-2-related domain-containing protein | |
| 1907 | MOLU01000008.1 | GCA003260325_00975 | CDS | open | 43430-43639 | _na 69_aa | hypothetical protein | |
| 1908 | MOLU01000008.1 | GCA003260325_00976 | CDS | open | 44742-44966 | _na 74_aa | Aldehyde dehydrogenase family protein | |
| 1909 | MOLU01000008.1 | GCA003260325_00977 | CDS | open | 45871-46077 | _na 68_aa | hypothetical protein | |
| 1910 | MOLU01000008.1 | GCA003260325_00978 | CDS | open | 47856-48038 | _na 60_aa | hypothetical protein | |
| 1911 | MOLU01000008.1 | GCA003260325_00979 | CDS | open | 50591-50722 | _na 43_aa | hypothetical protein | |
| 1912 | MOLU01000008.1 | GCA003260325_00980 | CDS | open | 51359-51670 | _na 103_aa | L-threonylcarbamoyladenylate synthase | |
| 1913 | MOLU01000008.1 | GCA003260325_00981 | CDS | open | 51715-51978 | _na 87_aa | hypothetical protein | |
| 1914 | MOLU01000008.1 | GCA003260325_00982 | CDS | open | 52191-52391 | _na 66_aa | hypothetical protein | |
| 1915 | MOLU01000008.1 | GCA003260325_00983 | CDS | open | 52739-52849 | _na 36_aa | hypothetical protein | |
| 1916 | MOLU01000008.1 | GCA003260325_00931 | gene | open | 717-1307 | |||
| 1917 | MOLU01000008.1 | GCA003260325_00932 | gene | open | 1672-1779 | |||
| 1918 | MOLU01000008.1 | GCA003260325_00933 | gene | open | 3374-3613 | |||
| 1919 | MOLU01000008.1 | GCA003260325_00934 | gene | open | 4327-4470 | |||
| 1920 | MOLU01000008.1 | GCA003260325_00935 | gene | open | 4483-4686 | |||
| 1921 | MOLU01000008.1 | GCA003260325_00936 | gene | open | 5164-5430 | |||
| 1922 | MOLU01000008.1 | GCA003260325_00937 | gene | open | 5524-5709 | |||
| 1923 | MOLU01000008.1 | GCA003260325_00938 | gene | open | 5737-5949 | |||
| 1924 | MOLU01000008.1 | GCA003260325_00939 | gene | open | 6567-6779 | |||
| 1925 | MOLU01000008.1 | GCA003260325_00940 | gene | open | 7033-7239 | |||
| 1926 | MOLU01000008.1 | GCA003260325_00941 | gene | open | 7988-8233 | |||
| 1927 | MOLU01000008.1 | GCA003260325_00942 | gene | open | 10546-10839 | |||
| 1928 | MOLU01000008.1 | GCA003260325_00943 | gene | open | 10868-11128 | |||
| 1929 | MOLU01000008.1 | GCA003260325_00944 | gene | open | 12922-13212 | |||
| 1930 | MOLU01000008.1 | GCA003260325_00945 | gene | open | 13458-13667 | secE | ||
| 1931 | MOLU01000008.1 | GCA003260325_00946 | gene | open | 14233-14388 | |||
| 1932 | MOLU01000008.1 | GCA003260325_00947 | gene | open | 14551-14760 | |||
| 1933 | MOLU01000008.1 | GCA003260325_00948 | gene | open | 16721-16885 | |||
| 1934 | MOLU01000008.1 | GCA003260325_00949 | gene | open | 16925-17122 | |||
| 1935 | MOLU01000008.1 | GCA003260325_00950 | gene | open | 18028-18312 | |||
| 1936 | MOLU01000008.1 | GCA003260325_00952 | gene | open | 19801-19980 | ftsL | ||
| 1937 | MOLU01000008.1 | GCA003260325_00953 | gene | open | 20381-20767 | |||
| 1938 | MOLU01000008.1 | GCA003260325_00954 | gene | open | 22176-22400 | |||
| 1939 | MOLU01000008.1 | GCA003260325_00955 | gene | open | 23921-24109 | |||
| 1940 | MOLU01000008.1 | GCA003260325_00956 | gene | open | 25762-25947 | |||
| 1941 | MOLU01000008.1 | GCA003260325_00957 | gene | open | 26641-26796 | |||
| 1942 | MOLU01000008.1 | GCA003260325_00958 | gene | open | 27111-27374 | |||
| 1943 | MOLU01000008.1 | GCA003260325_00959 | gene | open | 28103-28201 | |||
| 1944 | MOLU01000008.1 | GCA003260325_00960 | gene | open | 28355-28540 | |||
| 1945 | MOLU01000008.1 | GCA003260325_00961 | gene | open | 29095-29382 | |||
| 1946 | MOLU01000008.1 | GCA003260325_00962 | gene | open | 29443-29589 | |||
| 1947 | MOLU01000008.1 | GCA003260325_00964 | gene | open | 30940-31179 | |||
| 1948 | MOLU01000008.1 | GCA003260325_00965 | gene | open | 31889-32011 | |||
| 1949 | MOLU01000008.1 | GCA003260325_00966 | gene | open | 32720-32911 | |||
| 1950 | MOLU01000008.1 | GCA003260325_00967 | gene | open | 33151-33516 | |||
| 1951 | MOLU01000008.1 | GCA003260325_00968 | gene | open | 34831-34986 | |||
| 1952 | MOLU01000008.1 | GCA003260325_00969 | gene | open | 35071-35277 | |||
| 1953 | MOLU01000008.1 | GCA003260325_00970 | gene | open | 35271-35489 | |||
| 1954 | MOLU01000008.1 | GCA003260325_00971 | gene | open | 37094-37267 | |||
| 1955 | MOLU01000008.1 | GCA003260325_00972 | gene | open | 37450-37599 | |||
| 1956 | MOLU01000008.1 | GCA003260325_00973 | gene | open | 39010-39132 | |||
| 1957 | MOLU01000008.1 | GCA003260325_00974 | gene | open | 41462-41869 | |||
| 1958 | MOLU01000008.1 | GCA003260325_00975 | gene | open | 43430-43639 | |||
| 1959 | MOLU01000008.1 | GCA003260325_00976 | gene | open | 44742-44966 | |||
| 1960 | MOLU01000008.1 | GCA003260325_00977 | gene | open | 45871-46077 | |||
| 1961 | MOLU01000008.1 | GCA003260325_00978 | gene | open | 47856-48038 | |||
| 1962 | MOLU01000008.1 | GCA003260325_00979 | gene | open | 50591-50722 | |||
| 1963 | MOLU01000008.1 | GCA003260325_00980 | gene | open | 51359-51670 | |||
| 1964 | MOLU01000008.1 | GCA003260325_00981 | gene | open | 51715-51978 | |||
| 1965 | MOLU01000008.1 | GCA003260325_00982 | gene | open | 52191-52391 | |||
| 1966 | MOLU01000008.1 | GCA003260325_00983 | gene | open | 52739-52849 | |||
| 1967 | MOLU01000008.1 | GCA003260325_00951 | gene | open | 19363-19438 | trnQ | ||
| 1968 | MOLU01000008.1 | GCA003260325_00963 | gene | open | 30010-30095 | trnL | ||
| 1969 | MOLU01000008.1 | GCA003260325_00951 | tRNA | open | 19363-19438 | trnQ | tRNA-Gln(ttg) | |
| 1970 | MOLU01000008.1 | GCA003260325_00963 | tRNA | open | 30010-30095 | trnL | tRNA-Leu(caa) | |
| 1971 | MOLU01000009.1 | GCA003260325_01025 | CDS | open | 25-414 | _na 129_aa | hypothetical protein | |
| 1972 | MOLU01000009.1 | GCA003260325_01026 | CDS | open | 1579-1836 | _na 85_aa | hypothetical protein | |
| 1973 | MOLU01000009.1 | GCA003260325_01027 | CDS | open | 1964-2179 | _na 71_aa | hypothetical protein | |
| 1974 | MOLU01000009.1 | GCA003260325_01028 | CDS | open | 2718-2969 | _na 83_aa | hypothetical protein | |
| 1975 | MOLU01000009.1 | GCA003260325_01029 | CDS | open | 5081-5281 | _na 66_aa | hypothetical protein | |
| 1976 | MOLU01000009.1 | GCA003260325_01030 | CDS | open | 7222-7329 | _na 35_aa | hypothetical protein | |
| 1977 | MOLU01000009.1 | GCA003260325_01031 | CDS | open | 7810-8118 | _na 102_aa | hypothetical protein | |
| 1978 | MOLU01000009.1 | GCA003260325_01032 | CDS | open | 8575-8796 | _na 73_aa | hypothetical protein | |
| 1979 | MOLU01000009.1 | GCA003260325_01033 | CDS | open | 8827-9048 | _na 73_aa | hypothetical protein | |
| 1980 | MOLU01000009.1 | GCA003260325_01034 | CDS | open | 9265-9471 | _na 68_aa | traM | TraM recognition domain-containing protein |
| 1981 | MOLU01000009.1 | GCA003260325_01035 | CDS | open | 11837-11989 | _na 50_aa | hypothetical protein | |
| 1982 | MOLU01000009.1 | GCA003260325_01036 | CDS | open | 12182-12400 | _na 72_aa | hypothetical protein | |
| 1983 | MOLU01000009.1 | GCA003260325_01037 | CDS | open | 12624-12776 | _na 50_aa | hypothetical protein | |
| 1984 | MOLU01000009.1 | GCA003260325_01038 | CDS | open | 13494-13664 | _na 56_aa | hypothetical protein | |
| 1985 | MOLU01000009.1 | GCA003260325_01039 | CDS | open | 14010-14198 | _na 62_aa | hypothetical protein | |
| 1986 | MOLU01000009.1 | GCA003260325_01040 | CDS | open | 15224-15400 | _na 58_aa | hypothetical protein | |
| 1987 | MOLU01000009.1 | GCA003260325_01041 | CDS | open | 15442-15648 | _na 68_aa | hypothetical protein | |
| 1988 | MOLU01000009.1 | GCA003260325_01042 | CDS | open | 16637-16816 | _na 59_aa | hypothetical protein | |
| 1989 | MOLU01000009.1 | GCA003260325_01043 | CDS | open | 17506-17661 | _na 51_aa | hypothetical protein | |
| 1990 | MOLU01000009.1 | GCA003260325_01044 | CDS | open | 17783-18100 | _na 105_aa | hypothetical protein | |
| 1991 | MOLU01000009.1 | GCA003260325_01045 | CDS | open | 18648-18761 | _na 37_aa | hypothetical protein | |
| 1992 | MOLU01000009.1 | GCA003260325_01046 | CDS | open | 18722-18838 | _na 38_aa | hypothetical protein | |
| 1993 | MOLU01000009.1 | GCA003260325_01047 | CDS | open | 18988-19158 | _na 56_aa | hypothetical protein | |
| 1994 | MOLU01000009.1 | GCA003260325_01048 | CDS | open | 19896-20255 | _na 119_aa | hypothetical protein | |
| 1995 | MOLU01000009.1 | GCA003260325_01049 | CDS | open | 23272-23538 | _na 88_aa | hypothetical protein | |
| 1996 | MOLU01000009.1 | GCA003260325_01050 | CDS | open | 23893-24012 | _na 39_aa | hypothetical protein | |
| 1997 | MOLU01000009.1 | GCA003260325_01051 | CDS | open | 24106-24246 | _na 46_aa | traG | TraG P-loop domain-containing protein |
| 1998 | MOLU01000009.1 | GCA003260325_01052 | CDS | open | 25147-25452 | _na 101_aa | hypothetical protein | |
| 1999 | MOLU01000009.1 | GCA003260325_01053 | CDS | open | 27289-27723 | _na 144_aa | hypothetical protein | |
| 2000 | MOLU01000009.1 | GCA003260325_01054 | CDS | open | 27871-28347 | _na 158_aa | hypothetical protein |

